Arabidopsis thaliana cell suspension culture as a model system to … · Arabidopsis thaliana cell suspension culture as a model system to understand plant responses under phosphate

Arabidopsis thaliana cell suspension culture as a model system to

understand plant responses under phosphate stress

Fazilah Abd Manan

2012

School of Plant Biology

Faculty of Natural and Agricultural Sciences

The University of Western Australia

This thesis is presented for the degree of

Doctor of Philosophy of

The University of Western Australia

ii

ABSTRACT

The requirement of phosphate (Pi) in many biochemical processes means that a plant

experiences stress when available Pi is limiting. The Phosphate Starvation Response (PSR)

in plants helps avoid the stress brought on by Pi limitation. Molecular processes in plants

are controlled by three different genomes. Sub-sets of genes in the nuclear, mitochondria

and plastid genomes are coordinately expressed to sustain plant growth and development

either in normal or stress conditions. In mitochondria, oxidative phosphorylation makes an

essential contribution to plant energy status and is a Pi-requiring process that is limited by

low Pi availability. The impact of the PSR on the expression of genes encoded in the

mtDNA, especially those involved in oxidative phosphorylation, is unknown. A proteomics

approach was undertaken to search for nucleic acid-binding proteins from Arabidopsis

thaliana cells grown in culture to evaluate this system as a model to understand plant

mitochondrial responses to Pi limitation. As a result, glycine rich RNA binding protein

(GR-RBP5), endoribonuclease L-PSP, chaperonin 20, and malate dehydrogenase were

identified in Pi-depleted cells as proteins that co-purify with mitochondrial nucleic acids

during CsCl gradient centrifugation, an assay that was developed to identify mitochondrial

nucleic acid-binding proteins. Based on available microarray data, the abundance of

transcripts encoding these proteins does not respond to Pi availability. In the cell cultures,

as Pi became depleted, members of three Pi transporter (PHT) gene families were up-

regulated, including PHT1;1, PHT1;2, PHT1;4, PHT1;7,and PHT3;2, as occurs in plant

tissues. In addition, the accumulation of lactate indicated that Pi deficient cells might

switch toward fermentative pathways of metabolism instead of aerobic respiration. At the

same time, higher amounts of organic acids that are involved in citric acid cycle in Pi

limited cells suggested that these compounds were not utilised for aerobic respiration.

Nonetheless, the relative abundance of the detected metabolites was reversed when Pi was

re-supplied to the cells. With the addition of phosphite (Phi), cell responses towards Pi

depletion were altered, depending on internal Pi status. Cell growth and P allocation

patterns differed between Pi-fed and Pi-deprived cells. At the transcript level, the induction

of PHT1;1, PHT 1;8 and PHT1;9 during Pi deficiency was accelerated by Phi, suggesting

Phi exacerbates Pi deficiency. Metabolic pathways were severely inhibited when cells

depleted of Pi were treated with Phi. The metabolic changes seem to reverse the effect of Pi

limitation for Phi treated cells indicated by a huge decreased for most of the compounds

iii

detected by GC-MS. Fermentation that replaced normal respiration during low Pi was more

strongly inhibited by Phi. Taken together, cells alter their physiology in Pi and Phi stress.

Similarly, their molecular metabolisms including transcript abundance of the PHT gene

family members and the metabolite profiles were changed under these conditions. These

results confirmed that Arabidopsis cultured cells could be used to better understand higher

plants responses to Pi and Phi stress.

iv

DECLARATION

I declare that this thesis contains no material that has been previously presented for any

degree at any university or institution. The experiments and the writing of this thesis were

all carried out by myself (unless stated in the thesis) in consultation with my supervisors

Associate Professor Patrick Finnegan and Winthrop Professor Harvey Millar.

Fazilah Abd Manan

June 2012

v

ACKNOWLEDGEMENTS

First of all, I would like to thank my outstanding supervisors, Associate Professor Patrick

Finnegan and Winthrop Professor Harvey Millar for their excellent supervision during my

PhD journey.

I am grateful to be a recipient of Malaysian Government Scholarship to pursue my study at

the University of Western Australia. I also acknowledge UWA for the Adhoc top-up

scholarship and School of Plant Biology for the financial and administrative support during

my PhD study.

Thanks to Nicholas, Oliver, Matt, Adam, Shaobai, Ricarda Jost, Ricarda Fenske and Dave

for valuable discussions and suggestions related to this project. Thanks to all past and

present members of Pat’s and Harvey’s lab especially Yingjun, Hazel, Pharma, Wangxing,

Weihua, Khalil, Lei, Michelle, Alex, and Tiago for being good companions in the lab.

To all my best friends; Somcit, Ejen, Chai and Annisa, thank you for all your supports and

kindness. Great to have you guys here while I’m so far away from home! Special thanks to

my beloved family; my parents Abd Manan and Sapiah, my brothers and sister; Faizal,

Shahrin, Shahirah, and my aunty; Sapinah. Thank you for your endless love and supports!

vi

LIST OF ABBREVIATIONS

AOX Alternative oxidase

ATP Adenosine triphosphate

dsDNA Double stranded DNA

EXS Protein domain

GABA Gamma-aminobutyric acid

GRP Glycine rich protein

GR-RBP Glycine rich RNA binding protein

Hsp60 Heat shock protein 60

Ilv5 Isoleucine-plus-valine requiring protein

mtDNA Mitochondrial DNA

mtTFA Mitochondrial Transcription Factor A

mtTFB Mitochondrial Transcription Factor B

MYB63 Transcription Factor

mRBP Mitochondrial RNA-binding protein

NDH NAD(P)H dehydrogenase

Pi Phosphate

Phi Phosphite

PHO2 Ubiquitin conjugating E2 enzyme UBC24

PHR1 Phosphate Starvation Response 1

PSR Phosphate starvation response

ROS Reactive oxygen species

SIZ1 Small ubiquitin-like modifier (SUMO) E3 ligase

SPX Protein domain

ssDNA Single stranded DNA

UCP Uncoupling protein

WYKR75 Transcription Factor

ZAT6 Transcription Factor

vii

TABLE OF CONTENTS

Thesis title i

Thesis abstract ii

Declaration iv

Acknowledgements v

List of abbreviations vi

Table of contents vii

CHAPTER 1 General Introduction and Literature Review 1

General introduction 2

Literature review 5

References 22

CHAPTER 2 Identification of mitochondrial nucleic acid-binding proteins

from Arabidopsis thaliana cells grown in cultures 32

Abstract 33

Introduction 34

Results 36

Discussion 51

Materials and methods 56

References 62

CHAPTER 3 Arabidopsis thaliana cells in suspension cultures alter their

physiological, transcript and metabolite responses during phosphate

depletion and re-supply 67

Abstract 68

Introduction 69

Results 71

Discussion 88


References 99

viii

CHAPTER 4 Arabidopsis thaliana cells in suspension cultures alter their

physiological, transcripts and metabolites responses under phosphite stress 105

Abstract 106

Introduction 107

Results 108

Discussion 124


References 135

CHAPTER 5 General Discussion and Conclusion 139

Introduction 140

Summary of major findings 141

Limitations 147

Future work 149

Conclusion 150

References 151

APPENDICES 154

Appendix 1: List of primers for qRT –PCR 155

Appendix 2: List of compounds and their retention time determined

from AMDIS and ME 156

Appendix 3: Metabolite ratios for Pi-deficient and Pi-resupplied

cells from AMDIS analysis 160

Appendix 4: Metabolite ratios for Pi-deficient and Pi-resupplied

cells from ME analysis 161

Appendix 5: Metabolite ratios for Phi-treated and non-treated cells

from AMDIS analysis 163

Appendix 6: Metabolite ratios for Phi-treated and non-treated cells

from ME analysis 164

1

CHAPTER 1:

General Introduction and Literature Review

2

General Introduction

Phosphate (Pi) is a major nutrient that is often limiting for plant growth. Due to the

importance of Pi in various biochemical processes, as well as its function as the building

blocks for many compounds inside the cells, Pi deficiency leads to stress. To survive during

low Pi availability, plants responded by changing their morphology and cellular

metabolism. The development of cellular processes in plants is controlled by three different

genomes: nuclear, mitochondrial and plastid. The expression of the genes located in these

genomes needs to be co-ordinately regulated to ensure plant survival under all

circumstances. Abiotic stress certainly impacts on the expression of these genomes

although the mechanism is not well understood. Thus, there are still much to learn about the

mechanisms of interconnected responses by these genomes during stress.

The work presented in this thesis was initiated to test the hypothesis that the mitochondrial

genome will respond to Pi status through changes in gene expression, including those genes

encoded by mitochondrial DNA (mtDNA) and types of proteins that were associated with

it, and that the changes in gene expression in response to Pi status would be altered by the

Pi analogue phosphite (Phi).

All experiments were conducted using Arabidopsis thaliana (Arabidopsis) cell suspension

culture derived from the stem of accession Landsberg erecta (May and Leaver, 1993)

which I proposed as a model system to understand the mechanism of Pi-deficiency

responses in plants.

For nearly all eukaryotes, the production of ATP by mitochondria is crucial as ATP is a

major mobile source of energy to drive biochemical processes. Pi deficiency interrupts

processes that produce ATP including photosynthesis (Fredeen et al., 1990; Ghannoum and

Conroy, 2007) and respiration (Theodorou and Plaxton, 1993; Plaxton and Tran, 2011). The

disruption of ATP synthesis will lead to an energy crisis in the cells which may initiate

changes in mitochondrial biogenesis as part of the Pi deficiency response. However, not

much is known about the factors regulating mitochondrial biogenesis in plants under stress

or normal conditions. During Pi stress, mtDNA expression is likely to change, and these

3

changes may be co-ordinately regulated by the activity of proteins that directly bind

mtDNA. This includes transcription factors and other proteins such as malate

dehydrogenase, which has been reported before to bind mtDNA (M.C. Freeman and D.G

Muench, unpublished data). Since nearly nothing is known about the proteins that bind

nucleic acid in plant mitochondria, the first experimental chapter in this work focused on

identification of mtDNA-binding proteins from Arabidopsis thaliana cells grown in culture

(Chapter 2).

Most genes in plants are carried by the nuclear genome. It is well documented that Pi

deficiency alters nuclear gene expression. In this study, the assay for identifying mtDNA-

binding proteins was not robust enough to see if they changed with Pi deprivation. Thus, re-

focussed work on understanding the physiological and cellular changes that occur in

Arabidopsis cells as Pi status changes during the culture cycle were studied. The emphasis

was on the regulation of Pi transporter (PHT) gene expression, including Pi transporter

located on the mitochondrial membrane. A major part of this study was to determine the

dynamics of the P status in the cell culture system, and examine the kinetics of the Pi

transporter gene transcript accumulation, metabolic changes and the physiological state of

cells during Pi depletion (Chapter 3) and the responses of these processes to the Pi analogue

phosphite (Phi) (Chapter 4).

Previous studies have shown that many Pi starvation induced responses in Arabidopsis

plants are regulated at the transcriptional level (Hammond et al., 2004; Misson et al., 2005;

Morcuende et al., 2007). Among these transcriptional responses, plants increase the

capacity of Pi uptake by up-regulating the expression of PHT gene family members (Smith

et al., 1997; Smith, 2002). Signalling molecules are important to sense the amount of Pi

needed to trigger the starvation response, including the up-regulation of Pi transporter

genes. Knowledge on Pi sensing machinery is well described in yeast and bacteria (Oshima,

1997; Vershinina and Znamenskaya, 2002), but it is still unclear in plants. Several genes

involved in Pi homeostasis in plants were identified to date. Among them is PHO2 that

regulates Pi uptake, allocation and remobilisation (Dong et al., 1998), which is also a target

of miRNA399 (Bari et al., 2006; Lin and Chiou, 2008; Fang et al., 2009; Yang and

Finnegan, 2010). Changes at the transcript level concomitantly showed that changes in

4

metabolic processes might occur. In Chapter 3, these perspectives were investigated using

the Arabidopsis cell suspension cultures.

In Chapter 4, Phi was used as a tool to advance our understanding of plant responses to

changes in Pi status. Phi was selected as it is a Pi analog and is known to disrupt Pi

starvation responses to Pi deficiency (Carswell et al., 1997; McDonald et al., 2001;

Varadarajan et al., 2002). With quite extensive research that provide initial discoveries in

plant responses to Phi, I hypothesised that Phi would change plant cell responses at the

physiological, transcript and metabolic levels.

Specifically, the three main objectives covered by this research are:

To identify the mitochondrial nucleic acid-binding proteins from Arabidopsis

thaliana cell culture using an undirected approach (Chapter 2)

To profile the physiological and cellular responses of plants under Pi deprivation

and Pi resupply using an Arabidopsis thaliana cell culture system (Chapter 3)

To profile the physiological and cellular responses of plants as Pi status changes in

the presence of Phi using an Arabidopsis thaliana cell culture system (Chapter 4)

5

Literature review

Introduction

Phosphorus (P) is a major nutrient needed in the cell components such as nucleic acids and

phospholipids, and involved in the regulation of various physiological and biochemical

reactions. P deficiency has been a classic problem for plants. This is because Pi, the form of

P that can be taken up by plants readily forms complexes with other compounds in soil

(Raghothama and Karthikeyan, 2005). Pi is an indispensable substrate for ATP synthesis,

and is therefore required for photosynthesis in the plastid and oxidative phosphorylation in

the mitochondria, processes that need input from both the nuclear and respective organellar

genomes.

In soil, the concentration of P is usually less than 10 µM (Bieleski, 1973) while the

concentration in the plant cytoplasm is in mM range (Smith, 2002). Sequestration of Pi by

soil particles often leads to Pi deficiency in plants. Due to Pi deficiency, the activities

controlled by all genomes in plants will be altered and plants cellular metabolism will be

affected.

To date, substantial studies in various plant species related to Pi limitation have been

conducted. While information on physiological aspects is quite abundant, there are still

many questions on the molecular aspects of plant responses to Pi deprivation. The

integration of expression of genes from all three plant genomes in response to Pi deficiency

at the transcript level that is also integrated with metabolite level is not well understood.

In this chapter, I review our current knowledge on several plant adaptations to Pi

deficiency. Since mitochondria are an important site for ATP production, a process that

needs Pi, I start the discussion by introducing mitochondrial function in general, the

importance of coordinated expression between mitochondrial and nuclear genomes, and the

importance of mtDNA-binding proteins that mainly regulate mitochondrial genome

expression. This information is the background knowledge for the studies reported in

Chapter 2.

6

I further explore our current knowledge and the gaps that might be addressed on plant

responses towards Pi limitation. These responses are generally termed the Pi starvation

response (PSR). They includes plant sensing of Pi supply limitations, changes in plant

morphology, and the deployment of the biochemical adaptations used by plants to survive

under Pi limited conditions. The regulation of Pi-starvation responsive genes at the

transcript level and the existing metabolic profiles of plants under Pi stress, which basically

relate to Chapter 3, are discussed.

Finally, I review our current, very limited knowledge on the application of Phi to further

explore the response of plants to Pi limitation, which will be the basis for Chapter 4. Since

an Arabidopsis cell suspension culture system was used throughout the study, I close with a

discussion on the importance of cells grown in culture in plant research.

Phosphate deficiency in plants: A mitochondrial genome perspective

Mitochondria are essential organelles in land plants that are continually produced during

cell growth. Renowned as the powerhouse of the cells and present in almost all eukaryotes,

mitochondria play many important roles, regardless of the small percentage (only 1%) of

the total cell volume that they occupy.

A main function of mitochondria is to produce cellular adenosine triphosphate (ATP) by

coupling electron transport to ATP synthesis in the process of oxidative phosphorylation.

This process oxidises organic compounds available in the cell cytoplasm to produce carbon

dioxide through the tricarboxylic acid (TCA) cycle during cellular respiration (Mackenzie

and McIntosh, 1999). ATP is a major mobile energy source for living organisms that has Pi

as a main component. Several studies have previously shown that low Pi conditions

reduced ATP content (Mikulska et al., 1998) and respiration was affected by Pi deficiency

(Theodorou and Plaxton, 1993; Plaxton and Tran, 2011).

Plant mitochondria are also involved in several anabolic pathways, including the synthesis

of nucleotides, amino acids (Ravanel et al., 1998; Hell, 2002; Hesse et al., 2004), vitamins

(Bartoli et al., 2000; Rebeille et al., 2007), lipids (Gueguen, 2000), folate (Rebeille et al.,

7

2007) and biotin (Picciocchi et al., 2001). Besides that, mitochondria take part in nitrogen

assimilation (Lam et al., 1996) and iron homeostasis (Balk and Lobréaux, 2005), involved

in protection against viral or pathogen invasion (Murphy et al., 1999), also involved in

programmed cell death (Reape et al., 2008). During stress, any of these functions might be

affected.

While most of the proteins are encoded by plant nuclear genome, the mitochondrial

genomes encode a number of components of the electron transport chain, including

apocytochrome b of the cytochrome b/cl complex, subunits nadl to nad7 of the NADH-

ubiquinone oxidoreductase complex, three subunits (coxl, coxll, and coxIII) of the

cytochrome c oxidase complex and at least four subunits of the Fo-Fl ATP synthase

complex. The mitochondrial genome size of Arabidopsis thaliana is 367 kb. It encodes 33

proteins, three rRNAs (26S, 18S, and a 5S rRNA), and 20 tRNAs (Unseld et al., 1997).

Thus, coordinated expression of all genome is important for plants.

During stress, mitochondrial genome expression will change and disturb plant cellular

metabolism. Nevertheless, the factors that control mitochondrial genome expression under

normal and stress conditions are not fully understood. Under Pi limited conditions, plants

utilise an alternative respiration pathway, bypassing the steps that require P-containing

compounds (Duff et al., 1989; Nagano and Ashihara, 1993; Plaxton and Tran, 2011). This

pathway involves the function of alternative oxidase (AOX), which diverts electrons

directly from the ubiquinone pool, reducing oxygen to water. The diversion of electrons

from flowing through complex III and IV causes the release of free energy in the form of

heat (Vanlerberghe and McIntosh, 1997; Finnegan et al., 2004). This process does not

contribute to the proton gradient and thus reduces ATP production. The increased

abundance of AOX protein has been observed in Pi-deficient tobacco cell cultures (Parsons

et al., 1999).

Besides AOX, uncoupling protein (UCP) and alternative NADH dehydrogenase (NDH) are

components of the mitochondrial electron transport chain that are responsive to stress

(Clifton et al., 2005). Mitochondria typically produce reactive oxygen species (ROS) during

stress, causing oxidative damage to various molecules in plants (Apel and Hirt, 2004). The

8

level of ROS could be reduced by accumulation of compounds such as pyruvate, GABA

and proline that help plants to cope under stress condition (Bouché and Fromm, 2004).

Pyruvate accumulation (Juszczuk and Rychter, 2002), which stimulates AOX activity

(Millar et al., 1993) in respiration are important aspects of plant metabolic adaptations

under low Pi condition. Unlike sucrose starvation, which regulates mitochondrial

biogenesis by changes in nuclear gene expression that are coordinated at the post-

transcriptional level (Giege et al., 2005), the nuclear response to Pi starvation is regulated at

the transcriptional (Misson et al., 2005; Thibaud et al., 2010), also post-transcriptional level

which mediated by miRNAs (Bari et al., 2006; Chiou et al., 2006), and post-translational

level where the enzyme activity is mediated by PHO2 and SIZ1 (Bari et al., 2006; Miura et

al., 2005).

The mitochondrial gene expression might be regulated by mitochondrial nucleic acid-

binding proteins. mtDNA- binding proteins regulates mitochondrial functions in

replication, recombination, repair and transcription, while mtRNA-binding proteins might

involved in post-translational processes (Vermel et al., 2002; Kucej and Butow, 2007;

Glisovic et al., 2008). Although many nucleic acid-binding proteins have been found in

yeast, animals and plants, the nucleic acid-binding protein from plant mitochondria has not

well defined in terms of number, identity and function. In most organisms examined, more

than 25 proteins are bound to mtDNA to form mitochondrial nucleoids (Kucej and Butow,

2007). The nucleoid is the region of mitochondrion where DNA is confined.

In mammals, mtTFA and mtSSB are two mtDNA-binding proteins involved in

mitochondrial biogenesis, although their specific function under stress was not clear (Lee

and Wei, 2005). While information on mitochondrial nucleic acid-binding proteins

involved in stress responses is still lacking in plants, such proteins are known from yeast for

example Ilv5 and Hsp60 (Kucej et al., 2008). During amino acid starvation, Ilv5 is needed

for parsing mtDNA into nucleoids (MacAlpine et al., 2000) while Hsp60 is a heat shock

protein or proteases that engaged to nucleoids during glucose repression (Kucej et al.,

2008).

9

Some examples of proteins that interact with plant mitochondrial nucleic acids are proteins

from Vigna radiata (mung bean) that were demonstrated to have the ability to direct DNA

replication and RNA transcription in vitro (Dai et al., 2005), Isovaleryl-CoA in Pisum

sativum (pea) that is involved in cell metabolism and linked to gene expression (Daschner

et al., 2001; Daschner et al., 1999) and p63 protein bound to the cox2 promoter in Triticum

aestivum (wheat) which initiate the transcription process. Other than that, proteins

interacting with the promoter region of cox1 were found in Zea mays (maize) (Tarasenko et

al., 2005). Similarly, two proteins were identified to have affinity towards the atp9 gene

promoter sequence in pea (Hatzack et al., 1998) and three proteins were found interacting

with different sequence promoters representing different parts of Lupinus albus (lupin)

mitochondria (Lesniewicz et al., 2003). These examples indicate that mt-DNA binding

proteins play various roles in plants. Unfortunately, knowledge on the function of these

proteins in stress condition is largely unknown. To date, the Arabidopsis mRBP1, a family

of RNA recognition motif-containing GRP was found to be induced by cold treatment.

However, its actual function during stress is still unclear (Vermel et al., 2002).

With the aim to identify mitochondrial nucleic acid-binding proteins that are possibly

involved in the plant response to low Pi condition, an undirected, proteomics-based

approach of protein identification was conducted using Arabidopsis thaliana cell

suspension culture as a model system (Chapter 2).

Phosphate deficiency in plants: Morphological and biochemical perspectives

Phosphorus (P) is a macronutrient and one of the least bioavailable nutrients for plants.

Inorganic phosphate (Pi) is the form of P that can be taken up by plants (Ullricheberius et

al., 1981; Raghothama, 1999), but since Pi in soil is often bound to other elements, such as

Ca, Al and Fe, it is not fully accessible to plants. To overcome the problem of P shortages

in plants, P fertiliser has been widely used in agricultural fields. However, the amount used

needs to be appropriate as excess P leads to eutrophication issues that disturb ecosystems

(Carpenter, 2005).

10

Due to limited amount of Pi naturally, plants responded either by increasing the capacity of

Pi uptake or reusing any available P source. Root morphology will be changed during Pi

deficiency. The root growth is enhanced relative to shoot growth, resulting in an increased

root to shoot ratio (Raghothama, 1999). Root architecture is also altered, with more lateral

roots being formed rather than the primary roots (Lopez-Bucio et al., 2003). For some

species, such as lupinus albus, the formation of cluster roots helps the plant acquire Pi in

low P conditions (Lambers and Shane, 2007; Cheng et al., 2011).

One P saving strategy under P limitation is to re-translocate Pi from older leaves to younger

leaves (Jeschke et al., 1997). Some other P containing compounds such as nucleotides will

be metabolised and used as a source of P (Ticconi et al., 2001). Other than that,

phospholipids could be replaced by sulfolipids during Pi deficiency which preserve anionic

character of the membranes (Essigmann et al., 1998). To dissolve the Pi from P containing

compounds in the soil, plants will secrete organic acids (Shen et al., 2002; Lambers et al.,

2006) or enzymes such as ribonucleases and phosphatases (Duff et al., 1994; Green, 1994;

Raghothama, 1999; Vance et al., 2003). The symbiotic interaction of plant roots with

mychorrizal fungi is another strategy that helps plants to acquire Pi (Bolan, 1991).

At the transcript level, microarray techniques have been used to elucidate the differential

expression of various genes in different plant tissues at various stages of Pi-deficiency

(Hammond et al., 2004; Misson et al., 2005; Muller, 2006). With this high throughput

technology, large sets of genes that are differentially expressed under Pi limitation were

identified and classified based on their function. Indeed, many processes were altered under

Pi stress, including the genes involved in plant metabolic pathways, transport, signaling,

transcriptional regulation, growth and development, and stress responses (Misson et al.,

2005).

Plant Pi uptake is against a concentration gradient and involves a proton co-transport

mechanism (Ullricheberius et al., 1981). At the cellular level under Pi deficiency, the

capacity of Pi uptake is increased by up-regulation of Pi transporter (PHT) gene expression

(Raghothama and Karthikeyan, 2005). Arabidopsis has nine PHT1 gene family members,

encoding proteins that are located on the plasma membrane, three members of PHT3

11

encoding proteins that are located to mitochondria (Takabatake et al., 1999) and one PHT2

encoding protein that is located to plastid (Daram et al., 1999). PHT1 members served as

high affinity transporters (Karthikeyan et al., 2002; Mudge et al., 2002). The Km value in

micromolar range indicates that PHT1 family is a high affinity Pi transporter. PHT1;1

specifically has a Km value of 3.1 µM (Mitsukawa et al., 1997). PHT2 on the other hand is

a low affinity transporter with a Km for Pi of 394 µM (Daram et al., 1999; Versaw and

Harrison, 2002). A recent study has found six members of PHT4 in Arabidopsis with five

of them encoding proteins that are located to plastid and one located to Golgi apparatus.

The Km values for members of PHT4 ranged from 0.45 mM to 0.74 mM (Guo et al., 2008).

Genes encoding Pi transporters are down-regulated when the internal Pi concentration is

high due to sufficient external Pi, and vice versa (Smith et al., 2000). Table 1.1 shows the

description of the PHT gene family members in Arabidopsis, while Figure 1.1 shows the

localisation of the PHT transporters in Arabidopsis cells.

Table 1.1 Description of PHT gene family members in Arabidopsis thaliana

Gene

AGI

number

Protein

Localisation

Ref Expressed in

tissue

Ref

PHT1;1

At5g43350 Plasma

membrane

(Rausch and

Bucher, 2002)

(Knappe et al.,

2003)

(Takabatake et

al., 1999)

Axillary buds

Hydathodes

Leaf vascular

tissues

Root hair zone

Lateral root

Root cap/root

tip

(Mudge et al.,

2002)

(Karthikeyan

et al., 2002)

(Nussaume et

al., 2011)

PHT1;2

At5g43370 Plasma

membrane

(Rausch and

Bucher, 2002)

(Knappe et al.,

2003)

(Takabatake et

al., 1999)

Old primary

root

Root hair zone

Lateral root

(Mudge et al.,

2002)

(Nussaume et

al., 2011)

PHT1;3

At5g43360

Plasma

membrane

(Rausch and

Bucher, 2002)

(Knappe et al.,

2003)

Pollen/anthers

Hydathodes

Leaf vascular

tissues

(Mudge et al.,

2002)

(Winter et al.,

2007)

12

(Takabatake et

al., 1999)

Root hair zone

Lateral root

Root cap/root

tip

Old primary

root

(Nussaume et

al., 2011)

PHT1;4

At2g38940 Plasma

membrane

(Rausch and

Bucher, 2002)

(Knappe et al.,

2003)

(Takabatake et

al., 1999)

Silique

abscission zone

Pollen/anthers

Flower

abscission zone

Axillary buds

Hydathodes

Leaf vascular

tissues

Senescing

leaves

Old primary

root

Root hair zone

Lateral root

Root cap/root

tip

(Mudge et al.,

2002)

(Karthikeyan

et al., 2009)

(Winter et al.,

2007)

(Nussaume et

al., 2011)

PHT1;5

At2g32830 Plasma

membrane

(Rausch and

Bucher, 2002)

(Knappe et al.,

2003)

(Takabatake et

al., 1999)

Young floral

buds

Hydathodes

Leaf vascular

tissues

Root hair zone

Senescing

leaves

(Mudge et al.,

2002)

(Nagarajan et

al., 2011)

(Nussaume et

al., 2011)

PHT1;6

At5g43340 Plasma

membrane

(Rausch and

Bucher, 2002)

(Knappe et al.,

2003)

(Takabatake et

Pollen/ anthers

Young floral

buds

(Mudge et al.,

2002)

(Nussaume et

al., 2011)

13

al., 1999)

PHT1;7

At3g54700 Plasma

membrane

(Rausch and

Bucher, 2002)

(Knappe et al.,

2003)

(Takabatake et

al., 1999)

Pollen/ anthers

Hydathodes

Root hair zone

(Mudge et al.,

2002)

(Nussaume et

al., 2011)

PHT1;8

At1g20860 Plasma

membrane

(Rausch and

Bucher, 2002)

(Knappe et al.,

2003)

(Takabatake et

al., 1999)

Root hair zone

(Mudge et al.,

2002)

(Nussaume et

al., 2011)

PHT1;9

At1g76430 Plasma

membrane

(Rausch and

Bucher, 2002)

(Knappe et al.,

2003)

(Takabatake et

al., 1999)

Root hair zone

(Mudge et al.,

2002)

(Nussaume et

al., 2011)

PHT2

At3g26570 Plastid inner

envelope

(Rausch and

Bucher, 2002)

(Knappe et al.,

2003)

Green tissues

(Daram et al.,

1999)

PHT3;1 At5g14040 Mitochondrial

inner

membrane

(Rausch and

Bucher, 2002)

(Knappe et al.,

2003)

(Takabatake et

al., 1999)

PHT3;2

At3g48850 Mitochondrial

inner

membrane

(Rausch and

Bucher, 2002)

(Knappe et al.,

2003)

(Takabatake et

al., 1999)

Root

(Muller et al.,

2007)

(Morcuende

et al., 2007)

(Misson et

al., 2005)

PHT3;3

At2g17270 Mitochondrial

inner

membrane

(Rausch and

Bucher, 2002)

(Knappe et al.,

14

2003)

(Takabatake et

al., 1999)

PHT4;1 At2g29650 Plastid

envelope

(Ferro et al.,

2003)

(Roth et al.,

2004)

(Guo et al.,

2008)

Leaves

Roots

(Guo et al.,

2008)


envelope

(Emanuelsson et

al., 2000)

(Emanuelsson et

al., 1999)

Root

(Guo et al.,

2008)


envelope

Targeting

prediction

Leaves

Roots

(Guo et al.,

2008)


envelope

(Ferro et al.,

2003)

(Roth et al.,

2004)

Leaves

(Guo et al.,

2008)


envelope

(Guo et al.,

2008)

Leaves

Roots

(Guo et al.,

2008)

PHT4;6 At5g44370 Golgi (Guo et al.,

2008)

Leaves

Roots

(Guo et al.,

2008)

15

PHT1;1

PHT1;2

PHT1;3

PHT1;4

PHT1;5

PHT1;6

PHT1;7

PHT1;8

PHT1;9 PHT3;1

PHT3;2

PHT3;3

PHT4:6

Plasma

membrane

Figure 1.1 The localisation of Arabidopsis thaliana phosphate transporters in plant cells

During Pi deficient condition, the sensing machinery will detect the lack of Pi and plants

will start to give responses. A Pi sensor in plants has not been elucidated yet although there

has been a speculation that members of the PHT1 family might involve in Pi sensing and

the systemic regulation of Pi homeostasis in plants (Abel et al., 2002). A Pi sensing

mechanism was described previously in yeast and bacteria. The Pho81 and PhoR/PhoB in

yeast and E.coli, respectively, sense the Pi-deficient condition and regulate the expression

of genes involved in Pi uptake (Lenburg and O'Shea, 1996; Hsieh and Wanner, 2010).

In plants, several components were identified to be involved in the regulation of Pi

starvation. PHR1 gene is a transcription factor that is believed to control the induction of

miRNA399 and some other genes during low Pi. Other transcription factors found to have a

role in the plant response to Pi deficiency are WRKY75 (Devaiah et al., 2007), ZAT6

(Devaiah et al., 2007), and MYB62 (Devaiah et al., 2009). Other than that, it is known that

miRNA399 and PHO2 genes regulate Pi-starvation responses in Arabidopsis (Lin and

Chiou, 2008; Fang et al., 2009) with perhaps PHT1;8 and PHT1;9 are functioning

PHT2

PHT4;1

PHT4;2

PHT4;3

PHT4;4

PHT4;5

Golgi

Mitochondria Chloroplast

Nucleus

16

downstream of PHO2. This is because PHT1;8 and PHT1;9 genes were up-regulated in the

pho2 mutant roots (Aung et al., 2006; Kuo and Chiou, 2011). miRNAs are transcribed as

primary transcripts (pri-miRNAs), which fold into stem loop structures and processed to

form precursor (pre-miRNAs). Once the loop is detached, mature miRNA is formed (Leung

and Sharp 2010). During Pi limitation, non-biologically active primary transcript (pri-

miR399) was induced, correspond to its biologically active mature miRNA399 (Jones-

Rhoades and Bartel, 2004; Bari et al., 2006; Pant et al., 2008). The model of Pi signaling

pathway is presented in Figure 1.2 (Bari et al 2006).

Figure 1.2 A model for Pi signalling pathway (Adapted from Bari et al., 2006).

Changes at the transcript level might reflect changes in metabolic level. Obviously in

plants, the level of sugar was increased (Liu et al., 2005; Karthikeyan et al., 2007; Muller et

al., 2007) during Pi deficiency. It could be due to the lack of Pi to convert sugar to starch or

to mobilise sugar into phloem. This mechanism is actually beneficial to support the up-

regulation of Pi transporter genes expression. Quite recently, sucrose has been found to be

the regulator of Pi-deficient responses in plants (Lei et al., 2011).

17

Other than that, low level of organic acids were detected inside the cells of some Pi-

deficient plants. This was presumably because most organic acids were secreted out to

solubilise P from the environment (Uhde-Stone et al., 2003). Compounds that serve as

indicators of oxidative stress were also found to accumulate during Pi limited condition, for

example putrecine in rice suspension culture (Shih and Kao, 1996) and anthocyanin in

many plants including rice and Arabidopsis (Dobermann and Fairhust 2000; Jiang et al.,

2007). Unlike the expression of Pi-starvation responsive genes that were quite common in

many plants, the metabolic responses were quite different depending on plant species

(Ciereszko and Barbachowska, 2000; Morcuende et al., 2007; Muller et al., 2007; Huang et

al., 2008).

To date, many reviews are available on various aspects of Pi- deficiency in plants

summarising the extensive studies that have been carried out in this field (Rouached et al.

2010; Yang and Finnegan., 2010; Dong et al., 1999; Raghothama, 1999; Franco-Zorrilla et

al., 2004; Hammond et al., 2004; Fang et al., 2009). However, the kinetics of plant

responses during Pi depletion and Pi resupply are not fully understood. In this study, I have

looked into the transcripts response of the PHT genes, the primary miRNA399 and PHO2,

also on the abundance of aqueous metabolites detectable by GC-MS method using

Arabidopsis thaliana cell cultures as a model system (Chapter 3).

Phosphate deficiency in plants: The effects of phosphite as an analog of phosphate

Phosphite (Phi) is an analog of Pi and transported via Pi transporters (Griffith et al., 1989;

Guest and Grant, 1991). It is a reduced form of Pi, lacking one oxygen molecule (Figure

1.3) and widely used in agriculture as a fungicide to control Phytophthora, a group of

oomycete pathogens that cause plant dieback (Fenn and Coffey, 1984; Guest and Grant,

1991; Guera et al., 2000).

Besides being a fungicide, Phi has been claimed to be a source of P fertiliser (Lovatt and

Mikkelsen 2006). More recently, Young (2004) has come out with a Phi fertiliser patent.

Currently, many commercial Phi fertilisers can be found on the market. Most of the

18

manufacturers declared that Phi is good to combat pathogen, has the ability to replace Pi for

nutrient, and at the same time it is environmentally friendly.

Nonetheless, the use of Phi as fertiliser has been a controversial issue (Rickard, 2000). It

has been rejected as a fertiliser because plants have no capacity to metabolise Phi without

the presence of bacteria (Ohtake et al., 1996; Barrett et al., 2004). Even though the

oxidation of Phi to Pi occurs in soil by soil bacteria, it happens in a very slow rate

(McDonald et al., 2001; Thao and Yamakawa, 2009).

Since Phi is used to control plant dieback, the toxic effects of Phi have been more

elucidated in Phytophthora than in plants. Following Phi application, the mycelial growth

of P.cinnamomi was inhibited (King et al., 2010). Other than that, Phi also triggers plant

respond by producing stress signalling compounds to enhance their defence mechanism

against pathogen (Guest and Grant, 1991; Daniel and Guest, 2005). For instance, cells of

Arabidopsis plants infected by Phytophthora and treated with Phi has form cytoplasmic

aggregates, increase superoxide production, increase localised cell death and accumulate

phenolic compounds (Daniel and Guest, 2005). One of the sites of Phi action in

Phytophthora is phosphorus metabolism. The level of pyrophosphate increased (Niere et al.,

1990; Niere et al., 1994), while adenylate and phosphorylated nucleotide production were

affected (Griffith et al., 1990; Barchietto et al., 1992).

To date, many evidences have shown that Phi actually does not contribute to crop

improvement, but rather, brings deteriorating effects to plants (Abel et al., 2002; Carswell

et al., 1996; Forster et al., 1998; Schroetter et al., 2006). As early as 1950s, Macintire found

that plant growth was impaired during the first year of Phi application (Macintire et al.,

1950). This is supported with more recent findings that show that Phi does not support the

growth of plants (Thao and Yamakawa 2010; Thao et al., 2008; Ratjen and Gerendas, 2009;

Thao et al., 2009). With these arguments, reviews about pros and cons of Phi application to

plants have been published (McDonald et al., 2001; Thao and Yamakawa, 2009; Lovatt and

Mikkelsen 2006).

19

Figure 1.3 Oxidation of Phi to Pi

From the molecular aspect, instead of replacing the need for Pi, Phi mimics Pi. Thus, plants

behaved as if they had enough Pi despite remained in Pi deficient condition (Carswell et al.,

1997). This is a big concern as Phi will inhibit plant adaptation to low Pi conditions

(Carswell et al., 1997; McDonald et al., 2001; Ticconi et al., 2001; Varadarajan et al., 2002;

Bozzo et al., 2004). Initial discovery have shown that relatively low Phi concentrations are

phytotoxic to Pi deprived plant. This is because Phi blocks the upregulation of enzymes and

high affinity Pi transporters characteristic of plant PSR (Carswell et al., 1996; Carswell et

al., 1997). This has lead to more studies being conducted using Phi as a tool to dissect plant

molecular and biochemical responses to Pi starvation. Later, more findings have shown that

the effect of Phi is clear in Pi-starved, but not Pi-sufficient plants (Thao and Yamakawa,

2009). Ticconi et al 2001 demonstrated the inability of Arabidopsis to discriminate between

Phi and Pi in suppressing common responses to Pi limitation, for example in the production

of anthocyanin, changes in roots architecture, the expression of nucleolytic enzymes and

transcripts of Pi-starvation inducible genes (Ticconi et al., 2001). Similarly, Pi-starved

Brassica nigra seedlings treated with Phi had reduced fresh weight, decreased root to shoot

ratio and decreased of intracellular Pi (Carswell et al., 1996). This is in agreement with the

findings from Pi starved tomato and Arabidopsis, where Pi starvation induced genes such as

several high affinity Pi transporters, a novel acid phosphatase and purple acid phosphatase,

were also suppressed by Phi (Varadarajan et al., 2002).

At the protein level, the induction of serine proteases upon Pi or Phi addition to –Pi tomato

cells caused the degradation of Pi-starvation inducible extracellular proteins (Bozzo et al.,

2004). Other enzymes such as phosphoenolpyruvate phosphatases and inorganic

Phosphite Phosphate

20

pyrophosphate-dependent phosphofructokinase induction were also reduced in Pi-limited

Brassica nigra seedlings treated with Phi (Carswell et al., 1996). In addition, Phi markedly

alters in vivo protein phosphorylation in Pi starved Brassica napus suspension cell cultures

(Carswell et al 1997).

Study in Brassica napus suspension cells have also shown the reduction of growth, Pi

content, acid phosphatase, pyrophosphate (PPi)-dependent phosphofructokinase and high

affinity translocator in Pi-starved cells treated with Phi (Carswell et al., 1997). The

deteriorating effects of Phi were also observed in organism such as yeast (McDonald et al.,

2001) and Chlorophyta ulvales (Lee et al., 2005). In yeast, although low Phi did not

influence respiration process, Phi presence in higher amounts inhibited certain enzymes

such as 3-phosphoglyceraldehyde dehydrogenase (Stehmann and Grant, 2000). The use of a

pho84 mutant which is unresponsive to Phi proved that PHO84 is the target for Phi action

in yeast (McDonald et al., 2001).

These examples have shown that Phi primary site of action in higher plants is at the signal

transduction level and Phi specifically interrupts processes involved in regulation of Pi

starvation responses. As Phi is non-metabolised by plants, it will persist in the tissues.

Thus, plants will continuously get the negative effects from Phi and finally cause cell’s

death (Singh et al., 2003).

Taken together, most of the available Phi studies are based on the physiological impact of

Phi towards plant growth and development. Although increasing research is conducted in

this area, a lot more information is needed especially in plant responses to Phi treatment at

the molecular and gene expression levels. Chapter 4 in this thesis describes the kinetics of

the responses of Arabidopsis cell cultures treated with Phi under +P and –P conditions.

Arabidopsis thaliana cell suspension culture

Arabidopsis thaliana has been widely used to study diverse aspects of plant physiology and

molecular biology. Given its many advantages over other plant species, Arabidopsis has

been adopted as a ‘model’ in studies related to plants. A cell culture derived from

21

Arabidopsis has been available for many years (May and Leaver, 1993). It has added value

to Arabidopsis research due to the advantages of cell suspension culture over plants. Cell

suspension cultures provide a homogenous and uniform system, unlike real plant that is

complex with many tissues and compartments. In this simple system, cells in suspension

divide rapidly and the growth conditions can be easily manipulated, hence very convenient

for molecular research.

Suspension cell cultures have been quite well established as an excellent model system to

study molecular and biochemical aspects of the Arabidopsis PSR (Veljanovski et al., 2006;

Tran and Plaxton., 2008; Gregory et al., 1990; Tran et al., 2010). In fact, suspension cell

cultures from other plants have been widely used for at least for the past 25 years for

detailed studies of plant PSR, including cell cultures of Catharanthus roseus (Nagano and

Ashihara 1993), Lycopersicon esculentum (tomato) (Bozzo et al., 2004; Bozzo et al.,2006)

and the closely related crucifers to Arabidopsis such as Brassica nigra (Duff et al., 1989)

and Brassica napus (Moraes and Plaxton 2000).

In my research, Arabidopsis cell suspension culture was proposed as a good model system

to study plant adaptations towards low Pi conditions, avoiding the challenge from the

complexity of Pi distribution to the various tissues in real plants. Arabidopsis has available

full genome and transcript sequences, which allows the identification of proteins from mass

spectrometry data and to design primers for quantitative real time PCR in this study. Many

databases on Arabidopsis are also available, thus basic research involving Arabidopsis

greatly aides the area of plant molecular and genetics. The external Pi concentration can be

easily controlled to suit experimental requirements and Phi can be added into the system to

better understand Pi-starvation effects on the cells. Finally, the results may be useful in

understanding the mechanisms of Pi-deficient responses in the more intricate plant system

because research findings obtained in Arabidopsis are often transferable to other plant

species.

Despite the rapid growing knowledge on plant adaptations towards Pi-deficiency, there are

still many gaps in the underlying molecular mechanisms that need to be filled. The majority

of information that is available is more on the physiological responses rather than the

22

molecular mechanisms underlying the physiology. Understanding the fundametal

mechanisms of Pi-starvation responses and the metabolic changes that occur under Pi

limitation is very valuable not only to gain new insights into plant adaptation to stress, but

also serves as a step stone to plan for better crop management in the future.

References

Abel S, Ticconi CA, Delatorre CA (2002) Phosphate sensing in higher plants. Physiologia

Plantarum 115: 1-8

Apel K, Hirt H (2004) Reactive oxygen species: Metabolism, oxidative stress, and signal

transduction. Annual Review of Plant Biology 55: 373-399

Aung K, Lin S-I, Wu C-C, Huang Y-T, Su C-L, Chiou T-J (2006) pho2, a phosphate

overaccumulator, is caused by a nonsense mutation in a MicroRNA399 target gene.

Plant Physiology 141: 1000-1011

Balk J, Lobréaux S (2005) Biogenesis of iron-sulfur proteins in plants. Trends in Plant

Science 10: 324-331

Barchietto T, Saindrenan P, Bompeix G (1992) Physiological responses of Phytophthora

citrophthora to a subinhibitory concentration of phosphonate. Pesticide

Biochemistry and Physiology 42: 151-166

Bari R., Pant B.D., Stitt M. & Scheible W.-R. (2006) PHO2, microRNA399, and PHR1

define a phosphate-signalling pathway in plants. Plant Physiology 141: 988–999.

Barrett S, Shearer B, Hardy G (2004) Phytotoxicity in relation to in planta concentration

of the fungicide phosphite in nine Western Australian native species. Australasian

Plant Pathology 33: 521-528

Bartoli CG, Pastori GM, Foyer CH (2000) Ascorbate biosynthesis in mitochondria is

linked to the electron transport chain between complexes III and IV. Plant

Physiology. 123: 335-344

Bieleski RL (1973) Phosphate pools, phosphate transport, and phosphate availability.

Annual Review of Plant Physiology and Plant Molecular Biology 24: 225-252

Bolan NS (1991) A critical review on the role of mycorrhizal fungi in the uptake of

phosphorus by plants. Plant and Soil 134: 189-207

Bouché N, Fromm H (2004) GABA in plants: just a metabolite? Trends in Plant Science

9: 110-115

Bozzo GG, Singh VK, Plaxton WC (2004) Phosphate or phosphite addition promotes the

proteolytic turnover of phosphate-starvation inducible tomato purple acid

phosphatase isozymes. FEBS Letters 573: 51-54

Bozzo GG, Dunn EL, Plaxton WC (2006) Differential synthesis of phosphate-starvation

inducible purple acid phosphatase isozymes in tomato (Lycopersicon esculentum)

suspension cells and seedlings. Plant Cell and Environment 29: 303-313

Carpenter SR (2005) Eutrophication of aquatic ecosystems: Bistability and soil

phosphorus. Proceedings of the National Academy of Sciences of the United States

of America 102: 10002-10005

23

Carswell C, Grant BR, Theodorou ME, Harris J, Niere JO, Plaxton WC (1996) The

fungicide phosphonate disrupts the phosphate-starvation response in Brassica nigra

seedlings. Plant Physiology 110: 105-110

Carswell MC, Grant BR, Plaxton WC (1997) Disruption of the phosphate-starvation

response of oilseed rape suspension cells by the fungicide phosphonate. Planta 203:

67-74

Cheng L, Bucciarelli B, Shen J, Allan D, Vance CP (2011) Update on white lupin cluster

root acclimation to phosphorus deficiency update on lupin cluster roots. Plant

Physiology 156: 1025-1032

Chiou TJ, Aung K, Lin SI, Wu CC, Chiang SF. & Su CL. (2006) Regulation of

phosphate homeostasis by microRNA in Arabidopsis. Plant Cell 18: 412–421

Ciereszko I, Barbachowska A (2000) Sucrose metabolism in leaves and roots of bean

(Phaseolus vulgaris L.) during phosphate deficiency. Plant Physiology 156: 640-644

Clifton R, Lister R, Parker KL, Sappl PG, Elhafez D, Millar AH, Day DA, Whelan J (2005) Stress-induced co-expression of alternative respiratory chain components in

Arabidopsis thaliana. Plant Molecular Biology 58: 193-212

Dai H, Lo Y-S, Litvinchuk A, Wang Y-T, Jane W-N, Hsiao L-J, Chiang K-S (2005)

Structural and functional characterizations of mung bean mitochondrial nucleoids.

Nucleic Acids Research. 33: 4725-4739

Daniel R, Guest D (2005) Defence responses induced by potassium phosphonate in

Phytophthora palmivora-challenged Arabidopsis thaliana. Physiological and

Molecular Plant Pathology 67: 194-201

Daram P, Brunner S, Rausch C, Steiner C, Amrhein N, Bucher M (1999) Pht2;1

encodes a low-affinity phosphate transporter from Arabidopsis. The Plant Cell

Online 11: 2153-2166

Daschner K, Couee I, Binder S (2001) The mitochondrial isovaleryl-coenzyme A

dehydrogenase of Arabidopsis oxidizes intermediates of leucine and valine

catabolism. Plant Physiology 126: 601 - 612

Daschner K, Thalheim C, Guha C, Brennicke A, Binder S (1999) In plants a putative

isovaleryl-CoA-dehydrogenase is located in mitochondria. Plant Molecular Biology

39: 1275-1282

Devaiah BN, Karthikeyan AS, Raghothama KG (2007) WRKY75 transcription factor is

a modulator of phosphate acquisition and root development in Arabidopsis. Plant


Devaiah BN, Madhuvanthi R, Karthikeyan AS, Raghothama KG (2009) Phosphate

starvation responses and gibberellic acid biosynthesis are regulated by the MYB62

Transcription Factor in Arabidopsis. Molecular Plant 2: 43-58

Devaiah BN, Nagarajan VK, Raghothama KG (2007) Phosphate homeostasis and root

development in Arabidopsis are synchronized by the zinc finger transcription factor

ZAT6. Plant Physiology 145: 147-159

Dong B, Rengel Z, Delhaize E (1998) Uptake and translocation of phosphate by pho2

mutant and wild-type seedlings of Arabidopsis thaliana. Planta 205: 251-256

Dong B, Ryan PR, Rengel Z, Delhaize E (1999) Phosphate uptake in Arabidopsis

thaliana: dependence of uptake on the expression of transporter genes and internal

phosphate concentrations. Plant Cell and Environment 22: 1455-1461

Dobermann A, Fairhurst T. (2000). Rice. Nutrient disorders & nutrient management.

Handbook series. Potash & Phosphate Institute (PPI), Potash & Phosphate Institute

of Canada (PPIC) and International Rice Research Institute. 191 p.

24

Duff SMG, Moorhead GBG, Lefebvre DD, Plaxton WC (1989) Phosphate starvation

inducible `bypasses' of adenylate and phosphate dependent glycolytic enzymes in

Brassica nigra suspension Cells. Plant Physiology 90: 1275-1278

Duff SMG, Sarath G, Plaxton WC (1994) The role of acid-phosphatases in plant

phosphorus metabolism. Physiologia Plantarum 90: 791-800

Emanuelsson O, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular

localization of proteins based on their N-terminal amino acid sequence. Molecular

Biology 300: 1005-1016

Emanuelsson O, Nielsen H, Von Heijne G (1999) ChloroP, a neural network-based

method for predicting chloroplast transit peptides and their cleavage sites. Protein

Science 8: 978-984

Essigmann B, Guler S, Narang RA, Linke D, Benning C (1998) Phosphate availability

affects the thylakoid lipid composition and the expression of SQD1, a gene required

for sulfolipid biosynthesis in Arabidopsis thaliana. Proceedings of the National

Academy of Sciences of the United States of America 95: 1950-1955

Fang ZY, Shao C, Meng YJ, Wu P, Chen M (2009) Phosphate signaling in Arabidopsis

and Oryza sativa. Plant Science 176: 170-180

Fenn ME, Coffey MD (1984) Studies on the in vitro and in vivo antifungal activity of

fosetyl-al and phosphorous acid. Phytopathology 74: 606-611

Ferro M, Salvi D, Brugiere S, Miras S, Kowalski S, Louwagie M, Garin J, Joyard J,

Rolland N (2003) Proteomics of the chloroplast envelope membranes from

Arabidopsis thaliana. Molecular and Cellular Proteomics 2: 325-345

Finnegan PM, Soole KL, Umbach AL (2004) Alternative mitochondrial electron transport

proteins in higher plants. Plant Mitochondria: From Genome to Function 17: 163-

230

Forster H, Adaskaveg JE, Kim DH, Stanghellini ME (1998) Effect of phosphite on

tomato and pepper plants and on susceptibility of pepper to Phytophthora root and

crown rot in hydroponic culture. Plant Disease 82: 1165-1170

Franco-Zorrilla JM, Gonzalez E, Bustos R, Linhares F, Leyva A, Paz-Ares J (2004)

The transcriptional control of plant responses to phosphate limitation. Experimental

Botany 55: 285-293

Fredeen AL, Raab TK, Rao IM, Terry N (1990) Effects of phosphorous nutrition on

photosynthesis in Glycine-max (L.) Merr. Planta 181: 399-405

Ghannoum O, Conroy JP (2007) Phosphorus deficiency inhibits growth in parallel with

photosynthesis in a C(3) (Panicum laxum) but not two C(4) (P. coloratum and

Cenchrus ciliaris) grasses. Functional Plant Biology 34: 72-81

Giege P, Sweetlove LJ, Cognat V, Leaver CJ (2005) Coordination of nuclear and

mitochondrial genome expression during mitochondrial biogenesis in Arabidopsis.

Plant Cell 17: 1497-1512

Glisovic T, Bachorik JL, Yong J, Dreyfuss G (2008) RNA-binding proteins and post-

transcriptional gene regulation. FEBS Letters 582: 1977-1986

Green PJ (1994) The ribonucleases of higher-plants. Annual Review of Plant Physiology

and Plant Molecular Biology 45: 421-445

Gregory AL, Hurley BA, Tran HT, Valentine AJ, She YM, Knowles VL, Plaxton WC

(2009) In vivo regulatory phosphorylation of the phosphoenolpyruvate carboxylase

AtPPC1 in phosphate starved Arabidopsis thaliana. Biochem J 420:57–65

25

Griffith JM, Akins LA, Grant BR (1989) Properties of the phosphate and phosphite

transport systems of Phytophthora palmivora. Archives of Microbiology 152: 430-

436

Griffith JM, Smillie RH, Grant BR (1990) Alterations in nucleotide and pyrophosphate

levels in Phytophthora palmivora following exposure to the antifungal agent

potassium phosphonate (phosphite). General Microbiology 136: 1285-1291

Gueguen V (2000) Fatty acid and lipoic acid biosynthesis in higher plant mitochondria.

Biological Chemistry 275: 5016-5025

Guera A, de Nova PG, Sabater B (2000) Identification of the Ndh (NAD(P)H-

plastoquinone-oxidoreductase) complex in etioplast membranes of barley: Changes

during photomorphogenesis of chloroplasts. Plant and Cell Physiology 41: 49 - 59

Guest D, Grant B (1991) The complex action of phosphonates as antifungal agents.

Biological Reviews 66: 159-187

Guo B, Jin Y, Wussler C, Blancaflor EB, Motes CM, Versaw WK (2008) Functional

analysis of the Arabidopsis PHT4 family of intracellular phosphate transporters.

New Phytologist 177: 889-898

Hammond JP, Broadley MR, White PJ (2004) Genetic responses to phosphorus

deficiency. Annals of Botany 94: 323-332

Hatzack F., Dombrowski S., Brennicke A., Binder S. (1998) Characterization of DNA

Binding Proteins from Pea Mitochondria. Plant Physiology 116:519-527

Hell R (2002) Molecular and biochemical analysis of the enzymes of cysteine biosynthesis

in the plant Arabidopsis thaliana. Amino Acids 22: 245

Hesse H, Nikiforova V, Gakiere B, Hoefgen R (2004) Molecular analysis and control of

cysteine biosynthesis: integration of nitrogen and sulphur metabolism. Experimental

Botany. 55: 1283-1292

Hsieh Y-J, Wanner BL (2010) Global regulation by the seven-component Pi signaling

system. Current Opinion in Microbiology 13: 198-203

Huang CY, Roessner U, Eickmeier I, Genc Y, Callahan DL, Shirley N, Langridge P,

Bacic A (2008) Metabolite profiling reveals distinct changes in carbon and nitrogen

metabolism in phosphate-deficient barley plants (Hordeum vulgare L.). Plant and

Cell Physiology 49: 691-703

Jeschke WD, Kirkby EA, Peuke AD, Pate JS, Hartung W (1997) Effects of P deficiency

on assimilation and transport of nitrate and phosphate in intact plants of castor bean

(Ricinus communis L). Experimental Botany 48: 75-91

Jiang C, Gao X, Liao L, Harberd NP, Fu X (2007) Phosphate starvation root architecture

and anthocyanin accumulation responses are modulated by the gibberellin-DELLA

signaling pathway in Arabidopsis(1 OA ). Plant Physiology 145: 1460-1470

Jones-Rhoades MW, Bartel DP (2004) Computational identification of plant microRNAs

and their targets, including a stress-induced miRNA. Mol Cell 14: 787-799

Juszczuk I, Rychter A (2002) Pyruvate accumulation during phosphate deficiency stress

of bean roots. Plant Physiology and Biochemistry 40: 783-788

Karthikeyan AS, Ballachanda DN, Raghothama KG (2009) Promoter deletion analysis

elucidates the role of cis elements and 5'UTR intron in spatiotemporal regulation of

AtPht1;4 expression in Arabidopsis. Physiologia Plantarum 136: 10-18

Karthikeyan AS, Varadarajan DK, Jain A, Held MA, Carpita NC, Raghothama KG

(2007) Phosphate starvation responses are mediated by sugar signaling in

Arabidopsis. Planta 225: 907-918

26

Karthikeyan AS, Varadarajan DK, Mukatira UT, D'Urzo MP, Damsz B, Raghothama

KG (2002) Regulated expression of Arabidopsis phosphate transporters. Plant


King M, Reeve W, Van der Hoek MB, Williams N, McComb J, O'Brien PA, Hardy

GESJ (2010) Defining the phosphite-regulated transcriptome of the plant pathogen

Phytophthora cinnamomi. Molecular Genetics and Genomics 284: 425-435

Knappe S, Flugge UI, Fischer K (2003) Analysis of the plastidic phosphate translocator

gene family in Arabidopsis and identification of new phosphate translocator-

homologous transporters, classified by their putative substrate-binding site. Plant


Kucej M, Butow RA (2007) Evolutionary tinkering with mitochondrial nucleoids. Trends

in Cell Biology 17: 586-592

Kucej M, Kucejova B, Subramanian R, Chen XJ, Butow RA (2008) Mitochondrial

nucleoids undergo remodeling in response to metabolic cues. J Cell Sci 121: 1861-

1868

Kuo HF, Chiou TJ (2011) The role of MicroRNAs in phosphorus deficiency signaling.


Lam HM, Coschigano KT, Oliveira IC, Melo-Oliveira R, Coruzzi GM (1996) The

molecular genetics of nitrogen assimilation into amino acods in higher plants.


Lambers H, Shane MW (2007) Role of root clusters in phosphorus acquisition and

increasing biological diversity in agriculture. In Spiertz JHJ, Struik PC, Van Laar

HH, eds, Scale and Complexity in Plant Systems Research: Gene-Plant-Crop

Relations. Springer, Dordrecht, The Netherlands 21: 237-250

Lambers H, Shane MW, Cramer MD, Pearse SJ, Veneklaas EJ (2006) Root structure

and functioning for efficient acquisition of phosphorus: Matching morphological

and physiological traits. Annals of Botany 98: 693-713

Lee H-C, Wei Y-H (2005) Mitochondrial biogenesis and mitochondrial DNA maintenance

of mammalian cells under oxidative stress. The International Journal of

Biochemistry and Cell Biology 37: 822-834

Lee TM, Tsai PF, Shyu YT, Sheu F (2005) The effects of phosphite on phosphate

starvation responses of Ulva lactuca (Ulvales, Chlorophyta). Phycology 41: 975-

982

Lei M, Liu Y, Zhang B, Zhao Y, Wang X, Zhou Y, Raghothama KG, Liu D (2011)

Genetic and genomic evidence that sucrose is a global regulator of plant responses

to phosphate starvation in Arabidopsis. Plant Physiology 156: 1116-1130

Lenburg ME, O'Shea EK (1996) Signaling phosphate starvation. Trends in Biochemical

Sciences 21: 383-387

Lesniewicz K, Goraczniaka R, Radlowski M, Bartkowiak S, Augustyniak H (2003)

Detection of three DNA-binding proteins from lupine mitochondrial. International

Journal of Plant Sciences 164: 305-311

Leung, A. K. and Sharp, P. A. (2010) MicroRNA functions in stress responses. Mol.

Cell 40: 205-215.

Lin S-I, Chiou T-J (2008) Long-distance movement and differential targeting of

microRNA399s. Plant Signaling and Behavior 3: 730-732

Liu JQ, Samac DA, Bucciarelli B, Allan DL, Vance CP (2005) Signaling of phosphorus

deficiency-induced gene expression in white lupin requires sugar and phloem

transport. Plant Journal 41: 257-268

27

Lopez-Bucio J, Cruz-Ramirez A, Herrera-Estrella L (2003) The role of nutrient

availability in regulating root architecture. Current Opinion in Plant Biology 6: 280-

287

Lovatt, C.J. and R.L. Mikkelsen (2006) Phosphite fertilizers: What are they? Can you use

them? What can they do? Better Crops. 90: 11-13

MacAlpine DM, Perlman PS, Butow RA (2000) The numbers of individual

mitochondrial DNA molecules and mitochondrial DNA nucleoids in yeast are co-

regulated by the general amino acid control pathway. Embo Journal 19: 767-775

Macintire WH, Winterberg SH, Hardin LJ, Sterges AJ, Clements LB (1950) Fertilizer

evaluation of certain phosphorus, phosphorous, and phosphoric materials by means

of pot cultures. Agronomy Journal 42: 543-549

Mackenzie S, McIntosh L (1999) Higher Plant Mitochondria. Plant Cell 11: 571-586

May MJ, Leaver CJ (1993) Oxidative stimulation of glutathione synthesis in Arabidopsis

thaliana suspension-cultures. Plant Physiology 103: 621-627

McDonald AE, Grant BR, Plaxton WC (2001) Phosphite (phosphorous acid): Its

relevance in the environment and agriculture and influence on plant phosphate

starvation response. Plant Nutrition 24: 1505-1519

McDonald AE, Niere JO, Plaxton WC (2001) Phosphite disrupts the acclimation of

Saccharomyces cerevisiae to phosphate starvation. Canadian Journal of

Microbiology 47: 969-978

Mikulska M, Bomsel JL, Rychter AM (1998) The influence of phosphate deficiency on

photosynthesis, respiration and adenine nucleotide pool in bean leaves.

Photosynthetica 35: 79-88

Millar AH, Wiskich JT, Whelan J, Day DA (1993) Organic acid activation of the

alternative oxidase of plant mitochondria. FEBS Letters 329: 259-262

Miura K, Rus A, Sharkhuu A, Yokoi S, Karthikeyan AS, Raghothama KG, Baek D,

Koo YD, Jin JB, Bressan RA, et al (2005) The Arabidopsis SUMO E3 ligase SIZ1

controls phosphate deficiency responses. Proc Natl Acad Sci USA 102: 7760–7765

Misson J, Raghothama KG, Jain A, Jouhet J, Block MA, Bligny R, Ortet P, Creff A,

Somerville S, Rolland N, Doumas P, Nacry P, Herrerra-Estrella L, Nussaume

L, Thibaud M-C (2005) A genome-wide transcriptional analysis using Arabidopsis

thaliana Affymetrix gene chips determined plant responses to phosphate

deprivation. Proceedings of the National Academy of Sciences of the United States

of America 102: 11934-11939

Mitsukawa, N., Okumura, S., Shirano, Y., Sato, S., Kato, T., Harashima, S., and

Shibata, D. (1997) Overexpression of an Arabidopsis thaliana high-affinity

phosphate transporter gene in tobacco cultured cells enhances cell growth under

phosphate-limited conditions. Proc. Natl. Acad. Sci. U.S.A. 94: 7098–7102.

Moraes, T. and Plaxton, W.C. (2000) Purification and characterization of

phosphoenolpyruvate carboxylase from Brassica napus (rapeseed) suspension cell

cultures. Implications for phosphoenolpyruvate carboxylase regulation during

phosphate starvation, and the integration of glycolysis with nitrogen assimilation.

Eur. J. Biochem 267: 4465 –4476.

Morcuende R, Bari R, Gibon Y, Zheng WM, Pant BD, Blasing O, Usadel B,

Czechowski T, Udvardi MK, Stitt M, Scheible WR (2007) Genome-wide

reprogramming of metabolism and regulatory networks of Arabidopsis in response

to phosphorus. Plant Cell and Environment 30: 85-112

28

Mudge SR, Rae AL, Diatloff E, Smith FW (2002) Expression analysis suggests novel

roles for members of the Pht1 family of phosphate transporters in Arabidopsis. Plant

Journal 31: 341-353

Muller R (2006) Genome-wide analysis of the Arabidopsis leaf transcriptome reveals

interaction of phosphate and sugar metabolism. Plant Physiology 143: 156

Muller R, Morant M, Jarmer H, Nilsson L, Nielsen TH (2007) Genome-wide analysis of

the Arabidopsis leaf transcriptome reveals interaction of phosphate and sugar

metabolism. Plant Physiology 143: 156-171

Murphy AM, Chivasa S, Singh DP, Carr JP (1999) Salicylic acid-induced resistance to

viruses and other pathogens: a parting of the ways? Trends in Plant Science 4: 155-

160

Nagano M, Ashihara H (1993) Long-term phosphate starvation and respiratory

metabolism in suspension-cultured Catharanthus roseus cells. Plant and Cell


Nagarajan VK, Jain A, Poling MD, Lewis AJ, Raghothama KG, Smith AP (2011)

Arabidopsis Pht1;5 mobilizes phosphate between source and sink organs and

influences the interaction between phosphate homeostasis and ethylene signaling.


Niere JO, Deangelis G, Grant BR (1994) The effect of phosphonate on the acid soluble

phosphorus components in the genus Phytophthora. Microbiology-UK 140: 1661-

1670

Niere JO, Griffith JM, Grant BR (1990) P-31 NMR-studies on the effect of phosphite on

Phytopthora palmivora. General Microbiology 136: 147-156

Nussaume L, Kanno S, Javot Hln, Marin E, Nakanishi TM, Thibaud M-C (2011)

Phosphate import in plants: focus on the PHT1 transporters. Frontiers in Plant

Science 2: 83

Ohtake H, Wu H, Imazu K, Anbe Y, Kato J, Kuroda A (1996) Bacterial phosphonate

degradation, phosphite oxidation and polyphosphate accumulation. Resources,

Conservation and Recycling 18: 125-134

Oshima Y (1997) The phosphatase system in Saccharomyces cerevisiae. Genes and

Genetic Systems 72: 323-334

Pant BD, Buhtz A, Kehr J, Scheible WR (2008) MicroRNA399 is a long distance signal

for the regulation of plant phosphate homeostasis. Plant J 53: 731-738

Parsons HL, Yip JYH, Vanlerberghe GC (1999) Increased respiratory restriction during

phosphate-limited growth in transgenic tobacco cells lacking alternative oxidase.


Picciocchi A, Douce R, Alban C (2001) Biochemical characterization of the Arabidopsis

biotin synthase reaction. The importance of mitochondria in biotin synthesis. Plant

Physiology. 127: 1224-1233

Plaxton WC, Tran HT (2011) Metabolic adaptations of phosphate-starved plants. Plant


Raghothama KG (1999) Phosphate acquisition. Annual Review of Plant Physiology and

Plant Molecular Biology 50: 665-693

Raghothama KG, Karthikeyan AS (2005) Phosphate acquisition. Plant and Soil 274: 37-

49

Ratjen AM, Gerendas J (2009) A critical assessment of the suitability of phosphite as a

source of phosphorus. Plant Nutrition and Soil Science 172: 821-828

29

Rausch C, Bucher M (2002) Molecular mechanisms of phosphate transport in plants.

Planta 216: 23-37

Ravanel Sp, Gakiere B, Job D, Douce R (1998) The specific features of methionine

biosynthesis and metabolism in plants. Proceedings of the National Academy of

Sciences of the United States of America 95: 7805-7812

Reape TJ, Molony EM, McCabe PF (2008) Programmed cell death in plants:

distinguishing between different modes. Experimental Botany.: erm258

Rebeille F, Alban C, Bourguignon J, Ravanel S, Douce R (2007) The role of plant

mitochondria in the biosynthesis of coenzymes. Photosynthesis Research 92: 149-

162

Rickard DA (2000) Review of phosphorus acid and its salts as fertilizer materials. Plant

Nutrition 23: 161-180

Roth C, Menzel G, Petetot JMC, Rochat-Hacker S, Poirier Y (2004) Characterization of

a protein of the plastid inner envelope having homology to animal inorganic

phosphate, chloride and organic-anion transporters. Planta 218: 406-416

Rouached H, Arpat AB, Poirier Y (2010) Regulation of phosphate starvation responses in

plants: Signaling players and cross-talks. Molecular Plant 3: 288-299

Schroetter S, Angeles-Wedlel D, Kreuzig R, Schnug E (2006) Effects of phosphite on

phosphorus supply and growth of corn (Zea mays). Landbauforschung Volkenrode

56: 87-99

Shen H, Yan XL, Zhao M, Zheng SL, Wang XR (2002) Exudation of organic acids in

common bean as related to mobilization of aluminum- and iron-bound phosphates.

Environmental and Experimental Botany 48: 1-9

Shih CY, Kao CH (1996) Growth inhibition in suspension-cultured rice cells under

phosphate deprivation is mediated through putrescine accumulation. Plant


Singh VK, Wood SM, Knowles VL, Plaxton WC (2003) Phosphite accelerates

programmed cell death in phosphate-starved oilseed rape (Brassica napus)

suspension cell cultures. Planta 218: 233-239

Smith FW (2002) The phosphate uptake mechanism. Plant and Soil 245: 105-114

Smith FW, Ealing PM, Dong B, Delhaize E (1997) The cloning of two Arabidopsis genes

belonging to a phosphate transporter family. Plant Journal 11: 83-92

Smith FW, Rae AL, Hawkesford MJ (2000) Molecular mechanisms of phosphate and

sulphate transport in plants. Biochimica et Biophysica Acta (BBA) - Biomembranes

1465: 236-245

Stehmann C, Grant BR (2000) Inhibition of enzymes of the glycolytic pathway and

hexose monophosphate bypass by phosphonate. Pesticide Biochemistry and


Takabatake R, Hata S, Taniguchi M, Kouchi H, Sugiyama T, Izui K (1999) Isolation

and characterization of cDNAs encoding mitochondrial phosphate transporters in

soybean, maize, rice, and Arabidopsis. Plant Molecular Biology 40: 479-486

Tarasenko VI, Subota IY, Kobzev VF, Konstantinov YM (2005) Isolation of

mitochondrial DNA-binding proteins specific to the maize cox1 promoter.

Molecular Biology 39: 350-356

Thao HTB, Yamakawa T (2010) Phosphate absorption of intact komatsuna plants as

influenced by phosphite. Soil Science and Plant Nutrition 56: 133-139

Thao HTB, Yamakawa T (2009) Phosphite (phosphorous acid): Fungicide, fertilizer or

bio-stimulator? Soil Science and Plant Nutrition 55: 228-234

30

Thao HTB, Yamakawa T, Shibata K (2009) Effect of phosphite-phosphate interaction on

growth and quality of hydroponic lettuce (Lactuca sativa). Plant Nutrition and Soil

Science 172: 378-384

Thao HTB, Yamakawa T, Shibata K, Sarr PS, Myint AK (2008) Growth response of

komatsuna (Brassica rapa var. peruviridis) to root and foliar applications of

phosphite. Plant and Soil 308: 1-10

Theodorou ME, Plaxton WC (1993) Metabolic adaptations of plant respiration to

nutritional phosphate deprivation. Plant Physiology 101: 339-344

Thibaud M-C, Arrighi J-F, Bayle V, Chiarenza S, Creff A, Bustos R, Paz-Ares J,

Poirier Y, Nussaume L (2010) Dissection of local and systemic transcriptional

responses to phosphate starvation in Arabidopsis. Plant Journal 64: 775-789

Ticconi CA, Delatorre CA, Abel S (2001) Attenuation of phosphate starvation responses

by phosphite in arabidopsis. Plant Physiology 127: 963-972

Tran HT, Plaxton WC (2008) Proteomic analysis of alterations in the secretome of

Arabidopsis thaliana suspension cells subjected to nutritional phosphate deficiency.

Proteomics 8: 4317-4326

Tran HT, Qian W, Hurley BA, She YM, Wang D, Plaxton WC (2010b) Biochemical

and molecular characterization of AtPAP12 and AtPAP26: the predominant purple

acid phosphatase isozymes secreted by phosphate-starved Arabidopsis thaliana.

Plant Cell Environ 33: 1789–1803

Uhde-Stone C, Gilbert G, Johnson JMF, Litjens R, Zinn KE, Temple SJ, Vance CP,

Allan DL (2003) Acclimation of white lupin to phosphorus deficiency involves

enhanced expression of genes related to organic acid metabolism. Plant and Soil

248: 99-116

Ullricheberius CI, Novacky A, Fischer E, Luttge U (1981) Relationship between energy

dependent phosphate uptake and the electrical membrane potential in Lemna gibba

G1. Plant Physiology 67: 797-801

Unseld M, Marienfeld JR, Brandt P, Brennicke A (1997) The mitochondrial genome of

Arabidopsis thaliana contains 57 genes in 366,924 nucleotides. Nature Genetics 15:

57-61

Vance CP, Uhde-Stone C, Allan DL (2003) Phosphorus acquisition and use: critical

adaptations by plants for securing a nonrenewable resource. New Phytologist 157:

423-447

Vanlerberghe GC, McIntosh L (1997) Alternative oxidase: From gene to function.


Varadarajan DK, Karthikeyan AS, Matilda PD, Raghothama KG (2002) Phosphite, an

analog of phosphate, suppresses the coordinated expression of genes under

phosphate starvation. Plant Physiology 129: 1232-1240

Veljanovski V, Vanderbeld B, Knowles VL, Snedden WA, Plaxton WC (2006)

Biochemical and molecular characterization of AtPAP26, a vacuolar purple acid

phosphatase up-regulated in phosphate-deprived Arabidopsis suspension cells and


Vermel M, Guermann B, Delage L, Grienenberger J-M, Maréchal-Drouard L,

Gualberto JM (2002) A family of RRM-type RNA-binding proteins specific to

plant mitochondria. Proceedings of the National Academy of Sciences 99: 5866-

5871

31

Versaw WK, Harrison MJ (2002) A chloroplast phosphate transporter, PHT2;1,

influences allocation of phosphate within the plant and phosphate-starvation

responses. Plant Cell 14: 1751-1766

Vershinina OA, Znamenskaya LV (2002) The Pho regulons of bacteria. Microbiology

71: 497-511

Winter D, Vinegar B, Nahal H, Ammar R, Wilson GV, Provart NJ (2007) An

"Electronic Fluorescent Pictograph" browser for exploring and analyzing large-scale

biological data sets. Plos One 2

Yang XJ, Finnegan PM (2010) Regulation of phosphate starvation responses in higher

plants. Annals of Botany 105: 513-526

Young DC (2004) Ammonium phosphate/phosphate fertilizer compound. US Patent No.

6824584.

32

CHAPTER 2:

Identification of mitochondrial nucleic acid-binding proteins

from Arabidopsis thaliana cells grown in cultures

33

Abstract

Mitochondrial DNA (mtDNA) contains genes that are crucial to the survival of almost all

eukaryotes, including plants. Both nuclear and mitochondrial genomes need to be

coordinately expressed for optimal mitochondrial function. Despite the importance of

mitochondrial processes in plant development, little is known about the factors involved in

the synthesis, breakdown and reorganisation of mtDNA. It is likely that DNA-binding

proteins are involved in mtDNA replication, recombination, repair and transcription, while

RNA-binding proteins take part in post-transcriptional RNA maturation such as splicing,

editing, and translation. The research described in this chapter was designed to identify

mitochondrial nucleic acid-binding proteins from Arabidopsis thaliana cells grown in

suspension culture using an undirected approach. Mitochondria were isolated from cells

and fixed with 1 % formaldehyde to stabilise protein-nucleic acid interactions. The

temperature and length of heat treatment to reverse formaldehyde cross-linking were

optimised. Lysates of formaldehyde-fixed mitochondria were subjected to CsCl gradient

centrifugation for the isolation of mitochondrial nucleic acid-binding proteins as it was

found to be a better technique in getting more proteins than glycerol gradient

centrifugation. Proteins in the gradient fractions were separated using sodium dodecyl-

sulphate polyacrylamide gel electrophoresis (SDS-PAGE). Selected protein bands were

excised for trypsin digestion prior to liquid chromatography mass spectrometry sequencing.

This analysis identified a glycine-rich RNA-binding protein GR-RBP5 in lysates of fixed

mitochondria, and an endoribonuclease and chaperonin 20 in lysates of non-fixed

mitochondria. Malate dehydrogenase was detected in both fixed and non-fixed

mitochondrial lysates. These four proteins have the capacity to bind to mitochondrial

nucleic acids. Abundant mitochondrial proteins were identified in fixed, also non-fixed

mitochondrial lysates that were used as controls. Although several proteins associated with

mitochondrial nucleic acids were detected, this approach needs to be improved for better

protein identification in the future.

34

Introduction

Due to their sessile lifestyle, plants have to cope with various environmental conditions for

survival. Some of these conditions will lead to stress. Mitochondria have key roles in

oxidative stress where their function may change (Jones, 2000). Several mitochondrial

respiratory chain components responded to stress, especially the alternative oxidase (AOX).

AOX, type II NADPH dehydrogenase (NDH), and uncoupling protein (UCP) form

alternative electron-transport pathways. Phosphate (Pi) deficiency is among abiotic stress

that induce AOX abundance in Phaseolus vulgaris L.cv., Zlota Saxa (culture of bean

plants) (Juszczuk et al., 2001), and Nicotiana tabacum (tobacco) suspension-cultured cells

(Parsons et al., 1999). In some cases, changes in protein abundance have been demonstrated

to reflect the changes in the amounts of the transcripts encoding the protein. This could be

seen in AOX (Aubert et al., 1997) and UCP (Considine et al., 2001). While the transcript

abundance for alternative respiratory pathway genes is dynamic, the classical respiratory

chain and tricarboxylic acid (TCA) cycle genes are more stable under the majority of

conditions (Clifton et al., 2005).

The expression of genes encoding mitochondrial functions changed during stress. One

example is from Solanum tuberosum (potato) where the transcripts and protein amounts of

NADH dehydrogenase decreased under cold stress (Svensson et al., 2002). This condition

indicates that once plants experience stress, the mitochondrial functions may change

(Flagella et al., 2006). The changes most probably facilitated by transcription factors and

other mitochondrial nucleic acid-binding proteins. For example in yeast, Hsp60 and Ilv5

proteins attached to mtDNA nucleoids during glucose and amino acid starvation,

respectively (Kucej et al., 2008).

Nucleic acid-binding proteins have a DNA or RNA binding domain. DNA-binding proteins

will bind to specific DNA sequences, either alone or together with other proteins, to control

the transcriptional process. In general, transcription factors regulate gene expression by

controlling the activation and inactivation of certain genes in certain conditions, based on

the cellular requirements (Latchman, 1997; Martin et al., 2010; Riechmann et al., 2000;

Singh, 1998). This is true for plant nuclear genomes, but there is lack of information about

the factors involved in mtDNA metabolism or the proteins controlling mtDNA gene

35

expression. Since many transcription factors work by binding to DNA, DNA-binding

proteins are likely to be involved in mtDNA gene expression.

DNA-binding proteins are possibly involved in mtDNA replication, recombination, repair

and transcription (Kucej and Butow, 2007). During the replication of mtDNA of most

eukaryotes including plants, DNA polymerase, DNA primase and DNA helicase are

involved (Shutt and Gray, 2006). MutS Homolog1 (MSH1), RECA3 (Shedge et al., 2007)

and OSB1 (Zaegel et al., 2006) are three nuclear genes take part in recombination

surveillance in plant mitochondria. The transcription of plant mitochondrial genes is

initiated by multiple promoters (Kuhn et al., 2005) and performed by two phage-type RNA-

polymerases (Richter et al., 2002). mtrecA possibly functions in both mtDNA repair and

recombination in Arabidopsis thaliana (Arabidopsis) (Khazi et al., 2003).

Among several known mtDNA-binding proteins, members of the high mobility group

(HMG) box family (Kucej and Butow, 2007) are detectable in most organisms. For

instance, Abf2 in Saccharomyces cerevisiae (Diffley and Stillman, 1992), mtTFA and

mtTFB in Xenopus laevis (Shen and Bogenhagen, 2001), D-mtTFA (Takata et al., 2001),

D-mtTFB2 (Matsushima et al., 2004), and D-mtTFB1 (Matsushima et al., 2005) in

Drosophila and TFAM in human (Alam et al., 2003). In Arabidopsis, a gene encoding a

mtTFA-like protein was identified on chromosome III at locus AT3g51880 (Elo et al.,

2003). Various examples of proteins associated with mitochondrial nucleic acid in plants

are stated in Chapter 1. These proteins are often involved in regulating plant mitochondrial

DNA expression.

Unlike mtDNA-binding proteins, much less is known about plant mtRNA-binding proteins.

Generally, RNA-binding proteins contain RNA recognition motifs (RRM) and take part in

post-transcriptional RNA maturation processes, such as splicing, editing, and translation

(Vermel et al., 2002). In Arabidopsis, At-mRBP1a, AtmRBP1b, and At-mRBP2a were

found to have RNA binding activity, and could be imported to mitochondria (Vermel et al.,

2002). Other than that, glycine rich RNA binding protein (GR-RBP) family was found to

have high affinity to poly (G), poly (U), and ssDNA rather than poly (C), poly (A) and

dsDNA (Hirose et al., 1994; Ludevid et al., 1992; Vermel et al., 2002).

36

This study focused on developing an assay to identify novel mitochondrial nucleic acid-

binding proteins from Arabidopsis thaliana cells grown in culture. One of a major problems

in identifying mitochondrial nucleic acid binding-proteins is to separate them from the non-

nucleic acid-binding proteins. Thus, formaldehyde has been used as an agent to covalently

cross-link protein and nucleic acid, in addition to its ability to crosslink proteins (Orlando et

al., 1997). For proteins which have a physiological DNA binding capacity, cross-linking is

expected to occur easily. However, other proteins that do not naturally bind DNA are

expected to stay in the unbound condition even when a high concentration of formaldehyde

is used (Solomon and Varshavsky, 1985).

An undirected approach to identify proteins bound to formaldehyde-fixed mitochondrial

nucleoids in Arabidopsis cells grown in culture (Thirkettle-Watts, unpublished results)

discovered two problems. The first problem came from plastid contamination during

mitochondrial isolation. Similar to plants, cultured cells also contain many plastids. The

second problem came after mitochondrial lysis, when proteins containing cofactors such as

MnSOD appeared to co-purify with proteins that were bound to mitochondrial nucleic acids

(Thirkettle-Watts, unpublished results). In this research, dark-grown Arabidopsis

suspension cells were used to obtain mitochondria uncontaminated with mature

chloroplasts. A method for isolating nucleic acid-binding proteins from the mitochondria

was developed, and proteins that co-purified with nucleic acid were identified by mass

spectrometry.

Results

Optimisation of formaldehyde cross-linking and reversal in isolated mitochondria

Mitochondria were isolated using two-step Percoll™

gradient centrifugation from

Arabidopsis cells grown in cultures (Figure 2.1A). The mitochondria band (Figure 2.1B)

was determined based on previous mitochondrial isolation method (Millar et al 2001a and

b). The methods for formaldehyde fixation and reversal were optimised before

mitochondrial lysates were fractionated to identify nucleic acid-binding proteins.

37

A

B

Figure 2.1 Isolation of mitochondria from Arabidopsis cells grown in cultures. A. 7-day-

old Arabidopsis suspension cells were used to prepare mitochondria using B. two-step

Percoll™ density gradient centrifugation as described in the Materials and Methods.

Arrows indicate the bands of plastids, mitochondria and peroxisomes after the first and

second Percoll™ gradients.

Formaldehyde was used to fix and retain any protein-nucleic acid interactions present

within mitochondria after their isolation from Arabidopsis cells. Various amounts of

formaldehyde were tested to find the most suitable concentration for fixation - the amount

that ensures fixation and allows DNA and protein recovery after reversal of the cross-

linking. As heating reverses the cross-linking, DNA was recovered from formaldehyde-

fixed mitochondria after 30 min heat treatment at various temperatures. Lysates from

untreated mitochondria gave a sharp and strongly SYBR® gold stained band (Figure 2.2).

The amount of DNA recovered decreased with increasing formaldehyde concentration, but

Mitochondria

Peroxisomes

Plastid

Mitochondria

18%

5ml

25%

25ml

40%

5ml

Second gradient First gradient

38

8126

increased with increasing temperature for reversal. Thus, the greatest DNA recovery was

obtained from mitochondria treated with 0.5 % formaldehyde where cross-linking was

reversed with 70 oC heat treatment (Figure 2.2).

Analysis of both the formaldehyde treated and untreated mitochondria generated SYBR®

gold stained material that did not migrate into the gel (thick arrow, Figure 2.2). The

abundance of this material increased with formaldehyde concentration, even when heated at

70 oC.

Figure 2.2 Optimising formaldehyde cross-linking and reversal. Mitochondria were fixed

for 2 h with the concentrations of formaldehyde indicated across the top, and lysed as

described in Materials and Methods. The cross-linking was reversed by heating the lysates

for 30 min at the temperature indicated across the bottom. Equal portion of each sample of

the lysates were separated by agarose gel electrophoresis and stained with SYBR® gold. M

= Size marker (lambda DNA digested with Eco47I). The thin arrow points to a selected

marker band in base pair (bp). The thick arrow indicates the sample wells.

Varying the length of heat treatment did not change the DNA recovery for non-fixed

mitochondria (Figure 2.3). However, for fixed mitochondria, longer heat treatments

resulted in more intense DNA bands visible after agarose gel electrophoresis. Heating for

16 h reduced the intensity of the material retained in the loading wells (Figure 2.3).

25

60 70

Formaldehyde (%, v/v)

Reversal temperature (oC)

M (bp) 0 0.5 1.0 1.5 0 0.5 1.0 1.5 0 0.5 1.0 1.5

39

Figure 2.3 Optimising the length of heat treatment to reverse formaldehyde cross-linking.

Mitochondria were fixed with 1 % formaldehyde for 2 h and lysed as described in Materials

and Methods. The cross-linking was reversed by heating mitochondrial lysates at 70 oC for

the times indicated across the bottom. Equal portion of each sample of the lysate were

separated by agarose gel electrophoresis and stained with SYBR® gold. M = Size marker

(lambda DNA digested with Eco47I). F = Fixed mitochondria, NF = Non-fixed

mitochondria. The thin arrow points to a selected marker band in bp. The thick arrow

indicates the sample wells.

Mitochondrial lysates were subjected to differential centrifugation and large protein-DNA

complexes were expected to migrate to the bottom of the tube during centrifugation. Protein

recovery after various heat treatments of supernatant and pellet from the lysates was

determined. More proteins were found in the pellet of fixed than the non-fixed

mitochondrial lysates (Figure 2.4 B, C). In contrast, the abundance of proteins recovered in

the supernatant from lysates of non-fixed mitochondria was higher than from fixed

mitochondria, although the protein species was not obviously different (Figure 2.4 D, E).

Heating of more than 3 h produced less intense and smeary protein bands in fixed pellet

(Figure 2.4 B, C) and supernatant (Figure 2.4 D, E) fractions compared to the untreated

controls (Figure 2.4 A), suggesting protein degradation occurred during the heat treatment.

8126

M (bp) F NF F NF F NF F NF F NF

0.5 1 3 6 16 Heating time (h)

40

A B C

D E

Figure 2.4 Optimising the length of heating to reverse formaldehyde cross-linking.

Mitochondria were fixed with 1 % formaldehyde for 2 h and lysed as described in Materials

and Methods. Mitochondrial lysates were subjected to centrifugation at 20,200 x g for 2.5 h

at 4 oC. The pellet was resuspended in 350 µl ddH2O. The supernatant and resuspended

pellet were heated at 70 oC for the indicated times and 8 µl were loaded onto the SDS-

PAGE gels. The gels were stained with Flamingo™ fluorescent gel stain. M = Low

molecular weight marker in kilo dalton (kDa). At the top of each panel, F = Fixed

mitochondrial lysate, NF = Non-fixed mitochondrial lysate. A. Unfractionated crude lysate.

B and C. Resuspended pellet heated as indicated. D and E. Supernatant heated as indicated.

Gels were prepared separately and have been aligned to find matched protein size.

For downstream experiments, 1 % formaldehyde was used for fixation and 1 h heating at 70

oC for reversal. These conditions were selected because 1 % formaldehyde enabled DNA

and proteins to be recovered after heat treatment.

45

97

66

30

20

F NF F NF F NF F NF F NF F NF F NF

45

97

30 20

66

0 0.5 1 3 6 16

Heating time (h)

F NF F NF F NF F NF F NF F NF

Heating time (h) 0 0.5 1 3 6 16

41

Density gradient centrifugation as the basis for protein separations

The following sections describe the separation of mitochondrial lysates by different density

based centrifugation techniques to fractionate their components. Glycerol and/ or CsCl

solutions were used to separate mitochondrial lysates. The resulted gradients were tapped

and fractionated (Figure 2.5) before the contents were subjected to electrophoresis on

agarose or polyacrylamide gels.

Figure 2.5 Strategy for recovering gradient fractions after centrifugation. The gradient

obtained after centrifugation of mitochondrial lysates using glycerol or CsCl solutions was

tapped by poking a hole (thick arrow) with a needle about 1 cm from the bottom of the

tube. The first fraction collected was named as fraction 2. The fractions were continuously

collected until the top fraction. Fraction 1 was slowly pipette out not to include the pellet.

Attempts to isolate protein-DNA complexes by glycerol gradient centrifugation

Glycerol gradient centrifugation was used to separate components by size. Larger-sized

nucleoprotein complexes were anticipated to be towards the bottom of the gradient

(Bogenhagen et al., 2003). More intense mtDNA bands were visualised in the middle

fractions and towards the top fractions of the glycerol gradient (fractions 4 to 11) used to

separate lysates of non-fixed mitochondria. Compared to non-fixed lysates, less intense

bands were visualised for lysates of fixed mitochondria in fraction 6 to 11 (Figure 2.6). For

protein fractions from the same gradient (Figure 2.7), more protein bands were visible from

the middle towards the top fractions (fraction 4 to 7) of the gradient for non-fixed

mitochondrial lysates. For fixed mitochondrial lysates, more intense protein bands could be

Fraction 1

Top fraction

Pellet

Poke a hole here

42

seen at the top of the gradient (fraction 5 to 11). However, no obvious differences were

observed for the protein species present in the two lysates.

To further purify protein-nucleic acid complexes, the glycerol gradient fractions containing

nucleic acid were pooled and subjected to isopycnic centrifugation in a CsCl solution. From

SDS-PAGE analysis of the fractions collected, the amount of protein recovered was very

low, although several bands were still visible in the top fractions (9-13) from the non-fixed

mitochondria. Fraction 1 of non-fixed and fraction 2 of fixed mitochondria also had visible

proteins (Figure 2.8).

Figure 2.6 The recovery of nucleic acid from mitochondria fractionated by glycerol

gradient centrifugation. Non-fixed and fixed mitochondrial lysates were separated on

glycerol gradients (15 % - 40 %) as described in Materials and Methods. The gradients

were fractionated (700 µl each) and the pellets were resuspended in 700 µl dH2O. Each

fraction was heated at 70 oC for 1 h. For each fraction, 25 µl samples were separated by

agarose gel electrophoresis and stained with SYBR® gold. M= Size marker (lambda DNA

digested with Eco47I). P= Resuspended pellet. Lanes 1-11: Fractions 1 -11. The thin arrow

points to a selected marker band in bp. The thick arrow indicates the sample wells.

8126

Non-fixed Fixed

M (bp) P 1 2 3 4 5 6 7 8 9 10 11 P 1 2 3 4 5 6 7 8 9 10 11

Bottom Top Bottom Top

43

A B

C D

Figure 2.7 Protein distribution of mitochondrial lysates fractionated by glycerol gradient

centrifugation. 8 µl of each fraction described in Figure 2.6 was separated by SDS-PAGE

and stained with Flamingo™

fluorescent gel stain solution. M= Low molecular weight

protein marker in kDa. P= Resuspended pellet. Lanes 1-11: Fractions 1 -11. A and B. Non-

fixed fractions. C and D: Fixed fractions. (A and B), (C and D). Gels were prepared

separately and have been aligned to find matched protein size.

M (kDa P 1 2 3 4 5 6 7 8 9 10 11

45

97

66

30

20

45

97

66

30

20

M (kDa) P 1 2 3 4 5 6 7 8 9 10 11

Non-fixed

Fixed

Bottom Top

Bottom Top

44

A B

C D

Figure 2.8 Protein distribution of DNA-containing glycerol gradient fractions separated

across a CsCl gradient. Fractions containing mtDNA from the glycerol gradient as

described above were pooled and fractionated by CsCl gradient. The pellet from the CsCl

gradients were resuspended in 700 µl dH2O and each fraction heated at 70 oC for 1 h. 8 µl

of each fraction were separated by SDS-PAGE and stained with Flamingo™

fluorescent

stain. M= Low molecular weight marker in kDa. P= Resuspended pellet. Lanes 1-13:

Fractions 1-13. A and B: Non-fixed fractions. C and D: Fixed fractions. (A and B), (C and

D). Gels were prepared separately and have been aligned to find matched protein size.

M (kDa) P 1 2 3 4 5 6 7 8 9 10 11 12 13

M (kDa) P 1 2 3 4 5 6 7 8 9 10 11 12 13

45

97

66

30

20

45

97

66

30

20

Non-fixed

Fixed

Bottom Top

Bottom Top

45

CsCl gradient centrifugation allowed isolation of nucleic acid -protein complexes,

unlike the glycerol gradient or combinations of both gradients

To be able to be detected later by mass spectrometry, the proteins need to be concentrated.

Several methods to concentrate proteins were tested before-hand, including by 5000 kDa

molecular size cut-off spin columns, acetone, and methanol-chloroform precipitation, with

and without SDS (Figure 2.9). Acetone precipitation gave the highest protein recovery.

SDS added had changed the relative recovery of the proteins concentrated by spin column,

but not acetone and methanol-chloroform precipitated proteins.

Figure 2.9 Protein recovery from CsCl fractions. Fraction 13 from CsCl gradient

centrifugation of the non-fixed mitochondrial lysates were diluted 20X. 500 µl of the

diluted fraction were concentrated using spin columns with a 5000 kDa cut-off spin column

(SC), or acetone (A) or methanol-chloroform (Me) precipitation, either with (+) or without

(-) SDS. The precipitated proteins were separated by SDS-PAGE and stained with silver.

M= Low molecular weight marker in kDa. NP = non- precipitated samples.

Another preliminary experiment was determination of the density of CsCl fractions.

Different buoyant density of free proteins from proteins fixed to nucleic acids allowed these

two groups of proteins to be separated from one another by CsCl gradient centrifugation.

CsCl solution indeed generated a density gradient after centrifugation (Figure 2.10).

- + - + - + - +

NP SC A Me M (kDa) 97

45

97

66

30

20

46

1.15

1.2

1.25

1.3

1.35

1.4

1.45

P F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12

CsCl gradient fraction

Den

sit

y (

g/m

l)

Figure 2.10 CsCl centrifugation generates a density gradient. The density of fractions and

resuspended pellet collected from CsCl gradient centrifugation was determined using the

equation (10.8601x refractive index)-13.4974.

Using CsCl gradient centrifugation, fixed and non-fixed mitochondrial lysates were

fractionated. Agarose gel electrophoresis of the fractions collected after the centrifugation

showed mtDNA bands in the fractions near the bottom of the gradient for both fixed and

non-fixed mitochondrial lysates, with the brightest band visible in the pellet (Figure 2.11).

Less intense DNA bands were visualised for the fixed fractions than the non-fixed

fractions.

Many protein bands were observed towards the top (fractions 6 -13) of the gradient for both

fixed and non-fixed mitochondrial lysates. In non-fixed mitochondrial lysates, intense

protein bands in the pellet and fraction 1 were visualised. The same trend observed in the

pellet of fixed mitochondrial lysates (Figure 2.12). The detection of nucleic acids

correspond to proteins in the pellet of fixed mitochondrial lysates and also the pellet to

fraction 6 of unfixed mitochondrial lysates suggests that these fractions might contain

mitochondrial nucleic acid-binding proteins.

47

Figure 2.11 The recovery of nucleic acid after separation of mitochondrial lysates by CsCl

gradient centrifugation. Mitochondrial lysates were fractionated in CsCl gradient. The

pellet was resuspended in 700 µl dH2O. Each fraction was heated at 70 oC for 1 h. 25 µl of

heated fraction were separated by agarose gel electrophoresis and stained with SYBR®

gold. M = Size marker (lambda DNA digested with Eco47I). P= Resuspended pellet. Lanes

1-13: Fractions 1 -13. The thin arrow points to a selected marker band in bp. The thick

arrow indicates the sample wells.

8126

M (bp) P 1 2 3 4 5 6 7 8 9 10 11 12 13 P 1 2 3 4 5 6 7 8 9 10 11 12 13

Non-fixed Fixed

Non-fixed Fixed

Bottom Top Top Bottom

48

A

B

Figure 2.12 Protein distribution across CsCl gradient fractions. 8 µl of each fraction

described in Figure 2.11 was separated by SDS-PAGE and stained with silver. M= Low

molecular weight marker in kDa. P= Resuspended pellet. Lanes 1-13: Fractions 1 -13. A:

Non-fixed. B: Fixed fractions.

Several proteins co-purified with mitochondrial nucleic acid after CsCl gradient

fractionation have nucleic acid binding properties

The nucleic acid-containing fractions from CsCl gradient centrifugation from fixed and

non-fixed mitochondrial lysates were pooled. Pellet and fraction 1 were combined into pool

1; fraction 2, 3 and 4 were combined into pool 2; fraction 5 and 6 were combined into pool

3. Proteins in the pooled fractions were precipitated with acetone, separated by SDS-PAGE

and stained with colloidal coomassie, a stain compatible with mass spectrometry analysis.

Higher protein amounts and more protein species were detected in pool 1 compared to

pools 2 and 3 in both fixed and non-fixed mitochondria (Figure 2.13). Selected bands from

the gel were subjected to trypsin digestion prior to mass spectrometry analysis for protein

identification. The mass spectrometry analysis was conducted with the help of Dr. Nicholas

45

97

66

30

20

M (kDa) P 1 2 3 4 5 6 7 8 9 10 11 12 13

Non-fixed

Fixed

P 1 2 3 4 5 6 7 8 9 10 11 12 13

45

97

66

30

20

Bottom Top

Bottom Top

49

Taylor (Australian Research Council Centre of Excellence in Plant Energy Biology,

University of Western Australia, Perth).

The list of putatively identified proteins was screened using several criteria. Firstly, only

proteins identified by two or more tryptic peptides from the same band were considered. Of

those proteins, only proteins with a predicted mass that matched the position of the band on

the gel were considered as valid identifications. Using these criteria, a total of 19 proteins

were identified (Figure 2.14). Seventeen proteins were found only in pool 1 of non-fixed

mitochondria. A glycine-rich RNA binding protein 5 (GR-RBPP5) was found in pool 2 of

fixed mitochondria. A list of mitochondrial proteins including endoribonuclease L-PSP and

chaperonin 20 (CPN20) were identified in non-fixed mitochondria. Malate dehydrogenase

1 was found in pool 1 of both fixed and non-fixed mitochondria. The details of the proteins

identified were listed in Table 2.1.

A B

Figure 2.13 Protein distributions in pooled CsCl fractions. Selected fractions obtained from

CsCl gradient centrifugation were pooled, and acetone precipitated as described in

Materials and Methods. Proteins in the pooled fractions were separated by SDS-PAGE and

stained with colloidal coomasie blue. M= Low molecular weight marker in kDa. Lanes 1-3:

Pool 1-3 of CsCl gradient fractions. Lysates from A: Non-fixed mitochondria B: fixed

mitochondria. Numbers in red indicate the protein bands cut from the gel for mass

spectrometric analysis.

M (kDa) 1 2 3 1 2 3

Non-fixed Fixed

1

2

3

4

5

6

7

8

16

15

14

13

12

11

10

9

17

18

21

27

31

9

10

11

12

13

14

20

15

16

17

18

19 45

97

66

30

20

3

2 1

4

6

7

8

19

22

23

20

24

25

26

28

29

30

33

32

5

50

Figure 2.14 Proteins identified from fixed and non-fixed mitochondria. The bands shown

in Figure 2.13 were excised and digested with trypsin prior to protein identification using

LC-MS/MS as described in Materials and Methods.

Table 2.1 Details of proteins identified in pooled fractions of fixed and unfixed

mitochondria. MW: Molecular weight. F: Fixed sample. NF: Non-fixed sample.

Full name Locus Pool

(number

treatment)

Tryptic

fragments

(number)

Predicted

MW

(Da)

Approximate

Observed

MW gel (Da)

Glycine-rich RNA-binding

protein 5

AT1g74230 2 F 2 28711 <30000

Malate dehydrogenase 1 AT1g53240 1 F 10 35782 30000-45000

Malate dehydrogenase 1 AT1g53240 1 NF 2 35782 30000

Malate dehydrogenase 2 AT3g15020 1 NF 12 35782 30000

Glutamate Dehydrogenase 1 AT5g18170 1 NF 7 44496 45000

Glutamate Dehydrogenase 2 AT5g07440 1 NF 10 44671 45000

Mitochondrial Lipoamide AT1g48030 1 NF 4 53954 60000

1. Malate dehydrogenase2 2. Glutamate Dehydrogenase 1 3. Glutamate Dehydrogenase 2 4. Mitochondrial Lipoamide Dehydrogenase 1 5. Mitochondrial Lipoamide Dehydrogenase 2 6. ATP synthase subunit beta-1, mitochondrial 7. Succinate-semialdehyde dehydrogenase,

mitochondrial

8. Citrate synthase 4, mitochondrial 9. NADH-cytochrome b5 reductase-like protein 10. Probable ATP synthase 24 kDa subunit,

mitochondrial 11. 20 kDa chaperonin, chloroplastic

(Chaperonin 10) (Ch-CPN10) (Cpn10) (Chaperonin 20) (Protein Cpn21)

12. ATP synthase subunit O, mitochondrial

13. (Oligomycin sensitivity conferral protein) (OSCP)

14. ATP synthase subunit d, mitochondrial (ATPase subunit d)

15. Peroxiredoxin-2F, mitochondrial 16. (Peroxiredoxin IIF) (Thioredoxin reductase 2F) 17. Endoribonuclease L-PSP family protein)

(Translational inhibitor protein like)

Malate dehydrogenase 1

Fixed Non-Fixed

Glycine-rich RNA-binding

protein 5

51

Discussion

Nucleic acid-binding proteins are not likely to be as abundant as other types of proteins in

mitochondria. However, their presence is likely to be important in regulating mitochondrial

gene expression. With the aim of identifying mitochondrial nucleic acid-binding proteins so

that their response to stress could be assessed, I attempted to develop an assay to purify and

identify these proteins from Arabidopsis thaliana cells grown in culture.

Dehydrogenase 1

Mitochondrial Lipoamide

Dehydrigenase 2

AT3g17240 1 NF 3 53954 45000-60000

ATP synthase subunit beta-1,

mitochondrial

AT5g08670 1 NF

2 59594 60000

Succinate-semialdehyde

dehydrogenase, mitochondrial

AT1g79440 1 NF 4 56523 45000-60000

Citrate synthase 4, mitochondrial AT2g44350 1 NF 2 52621 45000-60000

NADH-cytochrome b5

reductase-like protein

AT5g20080 1 NF 3 35964 30000

Probable ATP synthase 24 kDa

subunit, mitochondrial

AT2g21870 1 NF 3 27579 30000

20 kDa chaperonin, chloroplastic

(Cpn10)

AT5g20720 1 NF 6 26785 <30000

ATP synthase subunit O,

mitochondrial (OSCP)

At5g13450 1 NF 26305 <30000

Superoxide dismutase [Mn],

mitochondrial

At3g10920 1 NF 5 25428 <30000

ATP synthase subunit d,

mitochondrial

AT3g52300 1 NF 6 19574 20100-30000

Peroxiredoxin-2F, mitochondrial

(Thioredoxin reductase 2F)

AT3g06050 1 NF 3 21432 201000-

30000

(Endoribonuclease L-PSP family

protein) (Translational inhibitor

protein like)

AT3g20390 1 NF 4 19803 <20100

52

Using LC-MS/MS, proteins that were co-purified with mitochondrial nucleic acids by CsCl

gradient centrifugation technique were identified. Only proteins where two or more tryptic

peptides obtained from a single gel fragment and where the band had approximately the

expected mass on the gel were considered significant. The limited number of nucleic acid-

binding proteins detected could be due to several reasons. Firstly, proteins bound to nucleic

acid might be too low in abundance to be detectable by LC-MS/MS. Secondly, I speculate

that CsCl gradient centrifugation might vigorously disturb protein-nucleic acid interactions,

and formaldehyde fixation.

Seventeen proteins identified in non-fixed mitochondrial lysates came from pool 1. No

proteins were confidently detected in pools 2 and 3. These pools had less intense protein

bands visible on the SDS-PAGE gel than pool 1. Among the proteins identified,

endoriboluclease L-PSP has annotated with a nucleic acid-associated function.

Endoribonuclease is an enzyme that inhibits protein synthesis by cleavage of mRNA and is

involved in the regulation of purine biosynthesis (Morishita et al., 1999; Oka et al., 1995;

Rappu et al., 1999) which occurs in mitochondria and plastid (Atkins et al., 1997). This is

one of the nuclear encoded mitochondrial proteins that was found clustered in the DNA

metabolism loci in the Arabidopsis genome (Elo et al., 2003). Using SUB-cellular location

database for Arabidopsis proteins (SUBA) (Heazlewood et al., 2007), however, have shown

that this protein was localised to the plastid by MS/MS (Olinares et al., 2010).

A chaperonin was also identified. Although there was no strong evidence that it binds to

nucleic acid, many of them were classified as heat shock proteins that normally bound to

nucleic acids (Helen R, 2008). From the SUBA database, this protein was identified by

MS/MS and it was targeted to both mitochondria (Lee et al., 2008) and plastid (Olinares et

al., 2010). However, GFP experiments have localised this protein to peroxisomes (Cutler et

al., 2000) and plastids (Carrie et al., 2009). The other proteins identified were abundant

mitochondrial proteins involved in various aspects of mitochondrial metabolism. This

includes malate dehydrogenase (MDH), which was found in DNA-rich fractions of lysates

from both fixed and non-fixed mitochondria. Unpublished data by M.C. Freeman and D.G

Muench have shown that MDH possessed RNA-binding activity (Muench and Park, 2006).

In lysates of fixed mitochondria, only MDH and glycine-rich RNA binding protein 5 (GR-

RBP5) were indentified, which came from pool 1 and 2, respectively. SUBA has shown

53

that GR-RBP5 identified from the MS/MS was targeted to mitochondria (Ito et al., 2009).

Although GR-RBP5 has a capacity to bind RNA, it could also be that GR-RBP5 is

associated with ssDNA or dsDNA as demonstrated previously for GR-RBP4 in

Arabidopsis. GR-RBP4 was also found to interact with non-specific RNA homopolymers

(Kwak et al., 2005).

The function of GR-RBP5 during stress is not clear compared to other GR-RBP family

members. However, the transcripts level of GR-RBP5 increased about two-fold during cold

treatment in Arabidopsis (Kwak et al., 2005). There are eight members of glycine rich

RNA-binding proteins. GR-RBP2 and GR-RBP7 induce seed germination and seedling

growth under low temperature (Kim et al., 2008), while GR-RBP4 is involved in cold and

salinity stress (Kwak et al., 2005).

Previously, formaldehyde has been used successfully as a cross-linking agent to maintain

nucleic acid- protein interactions in isolated mitochondria in yeast, mammals and plants

(Kaufman et al., 2000; Kucej and Butow, 2007; Orlando et al., 1997; Saleh et al., 2008).

The formaldehyde concentration for fixation and strength, and length of the heat treatment

for reversing the cross-linking were optimised for Arabidopsis suspension cells. The most

intensely staining mtDNA band was identified in mitochondrial lysates treated with 0.5 %

formaldehyde followed by an overnight heat treatment at 70 oC. Typically, 0.2 % to 1%

formaldehyde was used for cross-linking in yeast (Sutherland et al., 2008) and 1 % for

Arabidopsis plant tissues (Saleh et al., 2008). Formaldehyde concentration at 1 % has

succeeded in recovering protein and nucleic acids, thus this percentage was used

throughout the experiments.

In my study, glycerol gradient and CsCl gradient centrifugation, alone and in combination,

were tested to isolate proteins that were associated with mitochondrial nucleic acid. The

combination technique did not give a good protein recovery, thus CsCl gradient

centrifugation technique alone was proceed. Protein distributions in the mitochondrial

lysates subjected to differential centrifugation were analysed beforehand. More intense

protein bands were visible in the pellet of fixed-mitochondrial lysates. This was expected as

larger protein complexes sedimented faster than the non-fixed control. With this

expectation, my first attempt to isolate mitochondrial nucleic acid-binding proteins was by

54

using glycerol gradient centrifugation. Glycerol gradient centrifugation is a rate zonal

centrifugation technique, enabling particles to be separated based on size, shape and density

(Cline et al., 1971). This method gives the opportunity to remove non-protein-DNA

complexes materials, such as small soluble proteins, cofactors and enzymes. It was

expected that mtDNA-protein complexes will be separated from small proteins as the

complexes would have much larger sizes, causing them to move to the bottom of the

gradient faster.

DNA could be degraded by high temperature. In this experiment, high temperature is

needed to reverse the formaldehyde crosslinking. Heating at 700C is sufficient to recover

DNA although it might have little effect on degrading DNA. From agarose gel

electrophoresis, low intensity DNA bands were visible in the fixed compared to the non-

fixed mitochondrial lysates fractionated by glycerol gradient centrifugation. This correlated

with the observed decrease in intensity of DNA staining in mitochondrial lysates subjected

to formaldehyde fixation and reversal during the experiments to optimise the fixation. The

decrease staining might be due to formaldehyde treatment that may have masked DNA

from staining. In addition, the glycerol itself might interfere in obtaining sharp bands after

the electrophoresis.

SDS-PAGE analysis of fractions collected after the glycerol gradient centrifugation showed

that most of the proteins remained near the top of the gradient for the fixed mitochondrial

lysates. This was not surprising because the majority of mitochondrial proteins will not be

associated with nucleic acids. Smaller sizes of these proteins prevented them from

penetrating the gradient. However, as fixation might retain protein-nucleic acids

complexes, more protein bands were anticipated to be visible in the bottom fractions of the

gradient. Since this did not happen, I have concluded that glycerol gradient centrifugation

was not adequate to purify mitochondrial nucleic acid-binding proteins.

The next attempt was protein fractionation by CsCl gradient centrifugation, which allows

molecules to be separated based on buoyant density. Proteins, which have a lower buoyant

density than nucleic acids, will band nearer the top of the gradient, DNA in the middle and

RNA at the lowest part of the tube as RNA density is higher than DNA (Carr and Griffith,

1987).

55

In earlier work, isopycnic centrifugation using metrazamide of glycerol gradient-purified

mitochondrial nucleoids from Xenopus oocytes allowed mtTFA, mtSSB and novel proteins

that interact with the nucleoids which are adenine nucleotide translocator 1, the lipoyl-

containing E2 subunits of pyruvate dehydrogenase, branched chain α-ketoacid

dehydrogenase and prohibitin 2 to be identified (Bogenhagen et al., 2003). Attempt to use

the two-step gradient centrifugation (glycerol gradient centrifugation followed by CsCl

gradient centrifugation) was not suitable to recover proteins interacting with mitochondrial

nucleic acid in Arabidopsis cells, as the protein abundance decreased tremendously after

the second gradient.

I then focused the approach to using single step CsCl gradient centrifugation. In yeast,

formaldehyde cross-linked mitochondrial nucleoids were able to be purified on CsCl

gradients. This allowed several proteins, including Abf2, Hsp60 and Kgd2p, to be identified

as potential mtDNA-binding proteins (Kaufman et al., 2000). In previous work using

Arabidopsis cultured cells, mtDNA was detected only in the pellet of CsCl gradient-

separated lysates of unfixed Arabidopsis mitochondria. The mtDNA moved from the pellet

to higher fractions when treated with formaldehyde (Thirkettle-Watts, unpublished results),

suggesting that its buoyant density decreased due to associations with proteins. In my

study, however, mitochondrial nucleic acid from the non-fixed mitochondrial lysates was

detected not only in the pellet, but also in some of lower fractions, which suggests stable

and strong interactions between nucleic acid and protein in mitochondria. Proteins and

DNA were visible in both high and low density fractions, suggesting proteins co-purifying

with nucleic acid were separated from other free proteins. Thus, single step CsCl gradient

centrifugation was found to be a better separation method than glycerol gradients or the

combination of both techniques.

Apart from several proteins associated with mitochondrial nucleic acids, many of the

proteins identified were redox active proteins such as peroxiredoxin and dehydrogenase-

related proteins. These proteins were co-purified with mitochondrial nucleic acids and

detected in dense protein fractions of non-fixed mitochondrial lysates after fractionated by

CsCl gradient centrifugation. As they were only detected in non-formaldehyde fixed

samples, it could be that the presence was due to their intrinsic density properties. Redox

56

proteins involved in various functions in cells including the transport of electron, gene

regulation and signalling (Kamata and Hirata, 1999).

In conclusion, GR-RBP5, endoribonuclease L-PSP, CPN 20, MDH1 and MDH2 were

proteins found in this study that may be associated with mitochondrial nucleic acid of

Arabidopsis thaliana cells grown in culture. Cells used for mitochondrial isolation were

collected at day 7, at the end of the culture cycle, before subculturing into fresh medium.

These cells were Pi depleted (Chapter 3). Based on the findings, CsCl gradient has a limited

capacity to fractionate mitochondrial proteins, thus it is not suitable to use this assay to

detect the differences in mitochondrial nucleic acid-binding proteins in response to

phosphate availability.

Materials and Methods

Plant Materials

Arabidopsis thaliana accession Landsberg erecta cell suspension cultures (May and

Leaver, 1993) were maintained by weekly sub-culturing in Murashige and Skoog basal

medium (Murashige and Skoog, 1962) (Phytotechlab, Shawnee Mission, KS USA)

supplemented with 3 % (w/v) sucrose, 0.5 mg/L naphthalene acetic acid (NAA) and 0.05

mg L-1

kinetin . The pH was adjusted to 5.8 using 1 M KOH. For sub-culturing, 27 ml of 7

day-old cells were transferred into 100 ml fresh medium in 250 ml Erlenmeyer flasks under

sterile conditions. Cells for maintenance were grown under continuous light and cells for

mitochondrial preparation were grown in the dark. The dark treatment reduced plastid

contamination during mitochondrial preparation. Cells were grown at 22 oC with shaking at

140 rpm.

Isolation of mitochondria from Arabidopsis thaliana cell cultures

Mitochondria were prepared using two-step Percoll™ (Pharmacia, Uppsala, Sweden)

gradient centrifugation (Millar et al., 2001a; Millar et al., 2001b). Dark-grown 7-day old

cells from 10 to 12 flasks were harvested by filtering the suspension cultures through four

layers of Miracloth (Calbiochem®, Merck, Darmstadt, Germany). Approximately 600 ml

57

extraction buffer (0.45 M mannitol, 50 mM tetra-sodium pyrophosphate, 0.5 % (w/v)

bovine serum albumin (BSA), 0.5 % (w/v) polyvinylpyrrolidone 40, 2 mM ethylene glycol

tetra-acetic acid (EGTA), 20 mM cysteine, pH 8.0) was added to the cells. The cells were

homogenised using a blender (Waring, Torrington, USA), once for 10 s at high speed and

twice for 10 s at medium speed, with a 30 s break between steps. Cell homogenates were

filtered through four layers of Miracloth, transferred into tubes and subjected to differential

centrifugation. The first centrifugation was at 2500 x g for 10 min at 4 oC (JA 20 fixed-

angel rotor, Beckman Coulter, Fullerton, CA, USA). The supernatant was collected and

subjected to centrifugation at 18,000 x g for 20 min at 4 oC (JA 20 fixed-angel rotor). The

pellet was gently resuspended with 1 X mannitol wash buffer (0.3 M mannitol, 10 mM N-

tris (hydroxymethyl) methyl- 2-aminoethane sulfonic acid (TES) free acid, 0.1 % (w/v)

BSA, pH 7.5). The suspension was layered onto a Percoll™

gradient that contained 5 ml of

40 % (v/v) Percoll™

, 25 ml of 25 % (v/v) Percoll™

and 5 ml of 18 % (v/v) Percoll™

in

mannitol wash buffer (Figure 2.1) prior to centrifugation at 40,000 x g for 45 min (JA 25.5

rotor, Beckman Coulter, Fullerton, CA, USA). Mitochondria were collected as a grey band

between the 25 % (v/v) and 40 % (v/v) Percoll™

interface. The mitochondria were washed

with 1 X sucrose buffer (0.3 M sucrose, 10 mM TES free acid, 0.1 % (w/v), BSA pH 7.5)

and subjected to centrifugation at 10,000 x g for 10 min at 4 oC. The pellet was collected

and subjected to centrifugation in 35 % (v/v) Percoll™

in sucrose wash buffer for 45 min,

40,000 x g at 4 oC. The mitochondria that banded at the upper part of the tube were

collected, transferred to a new tube and washed with sucrose wash buffer without BSA

prior to centrifugation at 10,000 x g for 10 min at 4 oC. The final washing step was repeated

three times to remove residual Percoll™

.

Preparation of mitochondrial lysates for gradient centrifugation

Isolated mitochondria were resuspended in sucrose wash buffer without BSA and the

protein concentration determined (Marion M, 1976) using a commercial reagent

(Coomassie Plus Protein Assay Reagent, Pierce, Rockford, USA). The absorbance was

recorded at 595 nm (UVmini-1240 UV-VIS spectrophotometer, Shimatzu Scientific

Instruments, Sydney, Australia) and the protein concentration determined based on a BSA

standard curve. The mitochondria were treated with micrococcal nuclease (0.03 U µl-1

) for

1 h on ice. The reaction was terminated by adding 10 mM EGTA pH 8.0. The mitochondria

58

were collected, washed once with wash buffer and diluted to 2 mg ml-1

with cross-linking

buffer (0.5 M sucrose, 68 mM HEPES, 50 mM NaCl, 2 mM EDTA, 1 mM EGTA, pH 7.4).

For protein-nucleic acid fixation, formaldehyde was added to the mitochondria to 1 % (v/v)

and incubated at 4 oC for 2 h with slow mixing. The reaction was terminated by adding 125

mM glycine pH 7.0. The mitochondria were collected and stored at -80 oC. Mitochondria

were thawed and resuspended in lysis buffer (20 mM HEPES pH 8, 2 mM EDTA, fresh 2

mM dithiothreitol (DTT), homogenised with a dounce homogeniser and lysed by adding 1

% (w/v) Sarkosyl. RNase A was added to 50 µg ml-1

final concentration before incubating

1 h at room temperature.

Fractionation of mitochondrial lysates

Gradient solutions were prepared in centrifuge tubes and 700 µl of mitochondrial lysates

was layered onto the gradient.

Rate Zonal Centrifugation using Glycerol Gradients

Linear glycerol gradients contained 15 % (v/v) to 40 % (v/v) glycerol in 30 mM HEPES,

pH 8.0, 2 mM EDTA, 20 mM NaCl, fresh 2 mM DTT). Mitochondrial lysates layered on

top of glycerol gradients were subjected to centrifugation at 186,000 x g for 1 h at 4 oC

(SW-41 swing out rotor, L-70 Ultracentrifuge, Beckman, CA, USA).

Isopycnic Centrifugation using CsCl Gradients

The refractive index of mitochondrial lysates was adjusted to 1.365 with solid CsCl. CsCl

solution 48.8 % (w/v) prepared in Tris-EDTA (TE) buffer with 1 % (w/v) sarkosyl was

added to balance tubes prior to centrifugation at 260,000 x g for 16 h at 25 o

C (NVT65

fixed angle near vertical rotor, L-70 Ultracentrifuge, Beckman, CA, USA).

Gradients were gravity fractionated after centrifugation by collecting about 700 μl aliquots

(Figure 2.5). Fractions from CsCl gradients were dialysed against TE buffer pH 8.0 at 4 oC

for 16 hours with a 7000 Da cut off (Snake Skin Dialysis Tubing, Pierce, Thermo

Scientific, USA). Unless otherwise indicated, the formaldehyde cross-links were reversed

by heat treatment at 70 oC for 1 h.

59

Agarose gel electrophoresis

1 % (w/v) agarose gels were used for DNA analysis. DNA samples were mixed with

loading dye prior to electrophoresis in 1 X TBE running buffer (Sambrook et al., 1989).

Gels were incubated in 1 X staining SYBR® Gold (Invitrogen) solution for 16 h. 1X

solution was the SYBR® Gold stock diluted into TBE (89 mM Tris Base, 89 mM boric

acid, 1 mM EDTA, pH 8.0). The gel image was captured using a gel documentation

instrument (Electrophoresis Gel Imaging Scanner Analyzer).

SDS-PAGE

SDS-PAGE was carried out based on Laemmli (1970) (Miniprotein System, Bio-Rad-

Laboratories, Gladesville, Australia). The stacking gel solution (125 mM Tris-

hydrochloride (Tris-HCl) pH 6.8, 0.1 % (w/v) SDS, 4 % (w/v) acrylamide (acrylamide :

bis-acrylamide ratio of 37.5 : 1), 0.05 % (w/v) ammonium persulphate and 0.05 % (v/v)

N,N,N’,N’-tetramethylethane-1,2-diamine (TEMED) was overlayed on the separating gel

solution (375 mM Tris-HCl pH 8.8, 0.1 % (w/v) SDS, 12 % (w/v) acrylamide, 0.05 % (w/v)

ammonium persulphate and 0.5 % (v/v) TEMED). Samples were mixed with 2 X sample

buffer (125 mM Tris-HCl, pH 6.8, 4 % (w/v) SDS, 20 % (v/v) glycerol, 0.004 % (w/v)

bromophenol blue, 20 % (v/v) 2-mercaptoethanol) and heated for 5 min at 90 oC, followed

by centrifugation at 10,000 x g for 5 min at 25 oC. Samples were loaded on the gel and

separated at 200 V until the bromophenol blue reached the bottom of the gel. The gel was

stained with either:

a) Coomassie Blue: The gel was incubated in Coomassie blue R-250 (0.05 % (w/v)

coomassie blue R-250, 10 % (v/v) acetic acid, 40 % (v/v) methanol) for 16 h and

transferred to destaining solution (20 % (v/v) methanol, 7 % (v/v) acetic acid). Gel was

destained until the protein bands are visible and the gel background was colourless. The

image was captured using gel documentation equipment (Electrophoresis Gel Imaging

Scanner Analyzer).

60

b) Silver staining: The gel was incubated in fixation solution (50 % (v/v) methanol, 10 %

(v/v) glacial acetic acid) from 2 to 16 h. It was then transferred to incubation solution (30 %

ethanol (v/v), 0.2 % (v/v) sodium thiosulphate, 0.8 M anhydrous sodium acetate and 0.5 %

(v/v) gluteraldehyde) for 2 h, prior to staining with 0.1 % (w/v) silver nitrate in 0.01 %

(v/v) formaldehyde for 30 min. The gel was rinsed with deionised water and protein bands

were developed by incubating the gel in a solution containing 2.5 % (w/v) sodium

carbonate, 0.01 % (v/v) formaldehyde, pH 10.9. The development was terminated with 0.05

M EDTA. The image was captured using gel documentation equipment (Electrophoresis

Gel Imaging Scanner Analyzers).

c) Flamingo™

: The gel was soaked in 1 X Flamingo™

fluorescent reagent (Pierce,

Rockford, USA) for 16 h at 4 oC with 50 rpm shaking. The gel was imaged using a laser

scanner (Typhoon™

Laser scanner, GE Healthcare, Sydney, Australia) using blue laser 473

nm excitation wavelength with 530 nm emission filter.

d) Colloidal Coomassie: The gel was stained in colloidal coomassie solution (0.08 % (w/v)

coomassie G-250, 0.96 % (w/v) ortho-phosphoric acid, 8 % (w/v) ammonium sulphate

(NH4)2SO4, 20 % methanol) for 16 h. For destaining, gels were incubated in 0.5 % (w/v)

phosphoric acid.

Protein concentration methods

For spin columns, 500 μl samples were subjected to centrifugation at 15,000 x g, 4 oC on

spin columns having a 5000 kDa molecular weight cut-off (Ultrafree®-MC Centrifugal

Filter Units, Milipore Corporation, Billerica MA) until the volume was reduced to 20 μl for

recovery. For acetone precipitation, samples were mixed thoroughly with 4 volume (vol)

cold acetone prior to incubating at -20 o

C for at least 16 h. The samples were subjected to

centrifugation at 14,000 x g, 4 oC for 10 min. The supernatant was discarded and the pellet

was washed with 80 % of -20 oC cold acetone. The washing step was repeated twice and the

pellet was air dried. Precipitated proteins were dissolved in 20 μl sample buffer as

described for SDS-PAGE. For methanol-chloroform precipitation, samples were mixed

thoroughly with methanol: chloroform: water (4 : 1 : 2.5). The precipitate was collected by

centrifugation at 14,000 x g for 10 min at 4 oC. The aqueous phase was discarded and 2.5

61

vol methanol was added followed by centrifugation at the same conditions. The supernatant

was discarded and the pellet was air dried. Precipitated proteins were resuspended in 20 μl

sample buffer as described in SDS-PAGE.

In-gel trypsin digestion

Protein bands were excised from colloidal coomassie stained gels and subjected to in-gel

trypsin digestion (Shevchenko et al., 1996). Destaining solution (50 % (v/v) acetonitrile, 10

mM NH4HCO3) was added to the excised protein bands and incubated for 45 min with 800

rpm orbital shaking. The destaining was repeated. The gel was dried for 20 min at 50 oC

prior to digestion of the protein with 12.5 μg ml-1

trypsin, 10 mM NH4HCO3 at 37 oC for at

least 16 h. The gel was mixed with acetonitrile and incubated for 15 min with 800 rpm

orbital shaking. For peptide extraction, the supernatant was collected, transferred to a 96-

well microtitre plate and mixed with extraction solution (50 % (v/v) acetonitrile, 5 % (v/v)

formic acid). Samples were incubated with 800 rpm orbital shaking for 15 min. The

resulting supernatant was removed and stored in a 96-well microtitre plate. The peptide

extraction was repeated and collected supernatants were dried for 1 h under vacuum (Speed

Vac, Labconco, Kansas City, MO, USA).

Liquid Chromatography (LC)-electrospray-ionisation 9 ESI) - Ion Trap

For mass spectrometry analysis, dried tryptic peptides were resuspended in 5 % (v/v)

acetonitrile and 0.01 % (v/v) formic acid, and loaded to a microtitre plate. Samples were

loaded onto self-packed Microsorb (Varian Inc.) C18 (5 µm, 100 Å) reverse phase columns

(0.5 x 50 mm) using an Agilent Technologies 1100 series capillary liquid chromatography

system and eluted into an Agilent XCT Ultra IonTrap mass spectrometer with an ESI

source equipped with a low flow nebuliser in positive mode and controlled by Chemstation

(Rev B.01.03 [204]: Agilent Technologies) and MSD Trap Control v 6.0 (Build 38.15)

software (Bruker Daltonik). Peptides were eluted from the C18 reverse phase column at 10

µL min-1

using a 9 minute acetonitrile gradient (5 – 60 %) in 0.1% (v/v) formic acid at a

regulated temperature of 50 °C. The method used for initial ion detection utilized a mass

range of 200 – 1400 m/z with scan mode set to Standard (8100 m/z per sec) and a Ion

Charge Control (ICC) conditions set at 250000 with 3 Averages taken per scan. Smart

62

mode parameter settings were used using a Target of 800 m/z, a Compound Stability factor

of 90 %, a Trap Drive Level of 80 % and Optimize set to Normal. Ions were selected for

MS/MS after the intensity reached 80000 cps and two precursor ions were selected from the

initial MS scan. MS/MS conditions employed SmartFrag for ion fragmentation, a scan

range of 70 - 2200 m/z using an average of 3 scans, the exclusion of singly charged ions

option and ICC conditions set to 200000 in Ultra scan mode (26000 m/z per sec).

Protein identification

MS/MS spectra obtained were exported from the DataAnalysis for LC/MSD Trap version

3.3 (Build 149) software package (Bruker Daltonik) using default parameters for

AutoMS(n) and compound Export. Results extracted were queried against the Arabidopsis

protein set (TAIR 9, 33621 sequences; 13487170 residues) using the Mascot search engine

(Matrix Science, version 2.2.03) which utilizing error tolerances of ± 1.2 Da for MS and ±

0.6 Da for MS/MS, ‘Max Missed Cleavages’ set to 1, with variable modifications of

Oxidation (M), Carboxymethyl (C). Instrument set to ESI-TRAP and Peptide charge set at

2+ and 3+. Results were filtered using ‘Standard scoring’, ‘Max. number of hits’ set to 20,

‘Significance threshold’ at p< 0.05 and ‘Ions score cut-off’ at homology level,

approximately 38.

References

Alam T.I., Kanki T., Muta T., Ukaji K., Abe Y., Nakayama H., Takio K., Hamasaki

N., Kang D. (2003) Human mitochondrial DNA is packaged with TFAM. Nucleic

Acids Research 31:1640-1645

Atkins C.A., Smith P., Storer P.J. (1997) Reexamination of the intracellular localization

of de novo purine synthesis in cowpea nodules. Plant Physiology 113:127-135

Aubert S., Bligny R., Day D.A., Whelan J., Douce R. (1997) Induction of alternative

oxidase synthesis by herbicides inhibiting branched-chain amino acid synthesis.

Plant Journal 11:649-657

Bogenhagen D.F., Wang Y., Shen E.L., Kobayashi R. (2003) Protein components of

mitochondrial DNA nucleoids in higher eukaryotes. Molecular Cell Proteomics

2:1205-1216

Carr S.M., Griffith O.M. (1987) Rapid isolation of animal mitochondrial DNA in a small

fixed-angle rotor at ultrahigh speed. Biochemical Genetics 25:385-390

Carrie C., Kuhn K., Murcha M.W., Duncan O., Small I.D., O'Toole N., Whelan J. (2009) Approaches to defining dual-targeted proteins in Arabidopsis. Plant Journal

57:1128-1139

63

Clifton R., Lister R., Parker K.L., Sappl P.G., Elhafez D., Millar A.H., Day D.A.,

Whelan J. (2005) Stress-induced co-expression of alternative respiratory chain

components in Arabidopsis thaliana. Plant Molecular Biology 58:193-212

Cline G.B., Ryel R.B., William B.J. (1971) [18] Zonal centrifugation, Methods in

Enzymology, Academic Press.168-204

Considine M.J., Daley D.O., Whelan J. (2001) The expression of alternative oxidase and

uncoupling protein during fruit ripening in mango. Plant Physiology 126:1619-1629

Cutler S.R., Ehrhardt D.W., Griffitts J.S., Somerville C.R. (2000) Random GFP ::

cDNA fusions enable visualization of subcellular structures in cells of Arabidopsis

at a high frequency. Proceedings of the National Academy of Sciences of the United

States of America 97:3718-3723

Diffley J.F., Stillman B. (1992) DNA binding properties of an HMG1-related protein from

yeast mitochondria. Biological Chemistry 267:3368-3374

Elo A., Lyznik A., Gonzalez D.O., Kachman S.D., Mackenzie S.A. (2003) Nuclear genes

that encode mitochondrial proteins for DNA and RNA metabolism are clustered in

the Arabidopsis genome. Plant Cell 15:1619-1631

Flagella Z., Trono D., Pompa M., Di Fonzo N., Pastore D. (2006) Seawater stress

applied at germination affects mitochondrial function in durum wheat (Triticum

durum) early seedlings. Functional Plant Biology 33:357-366

Heazlewood J.L., Verboom R.E., Tonti-Filippini J., Small I., Millar A.H. (2007)

SUBA: The Arabidopsis subcellular database. Nucleic Acids Research 35:D213-

D218

Helen R S. (2008) Chaperone machines in action. Current Opinion in Structural Biology

18:35-42

Hirose T., Sugita M., Sugiura M. (1994) Characterization of a cDNA encoding a novel

type of RNA-binding protein in tobacco: its expression and nucleic acid-binding

properties. Molecular and General Genetics MGG 244:360-366

Ito J., Taylor N.L., Castleden I., Weckwerth W., Millar A.H., Heazlewood J.L. (2009)

A survey of the Arabidopsis thaliana mitochondrial phosphoproteome. Proteomics

9:4229-4240

Jones A. (2000) Does the plant mitochondrion integrate cellular stress and regulate

programmed cell death? Trends in Plant Science 5:225-230.

Juszczuk I., Malusa E., Rychter A.M. (2001) Oxidative stress during phosphate

deficiency in roots of bean plants (Phaseolus vulgaris L.). Plant Physiology

158:1299-1305

Kamata H., Hirata H. (1999) Redox regulation of cellular signalling. Cellular Signalling

11:1-14

Kaufman B.A., Newman S.M., Hallberg R.L., Slaughter C.A., Perlman P.S., Butow

R.A. (2000) In organello formaldehyde crosslinking of proteins to mtDNA:

Identification of bifunctional proteins. Proceedings of the National Academy of

Sciences of the United States of America 97:7772-7777

Khazi F.R., Edmondson A.C., Nielsen B.L. (2003) An Arabidopsis homologue of

bacterial RecA that complements an E. coli recA deletion is targeted to plant

mitochondria. Molecular Genetics and Genomics 269:454-463

Kim C.Y., Bove J., Assmann S.M. (2008) Overexpression of wound-responsive RNA-

binding proteins induces leaf senescence and hypersensitive-like cell death. New

Phytologist 180:57-70

Kucej M., Butow R.A. (2007) Evolutionary tinkering with mitochondrial nucleoids.

Trends in Cell Biology 17:586-592

64

Kucej M., Kucejova B., Subramanian R., Chen X.J., Butow R.A. (2008) Mitochondrial

nucleoids undergo remodeling in response to metabolic cues. Cell Science

121:1861-1868

Kuhn K., Weihe A., Borner T. (2005) Multiple promoters are a common feature of

mitochondrial genes in Arabidopsis. Nucleic Acids Research 33:337-346

Kwak K.J., Kim Y.O., Kang H. (2005) Characterization of transgenic Arabidopsis plants

overexpressing GR-RBP4 under high salinity, dehydration, or cold stress.

Experimental Botany 56:3007-3016

Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of

bacteriophage T4. Nature 227 (5259): 680-685

Latchman D.S. (1997) Transcription factors: An overview. The International Journal of

Biochemistry and Cell Biology 29:1305-1312

Lee C.P., Eubel H., O'Toole N., Millar A.H. (2008) Heterogeneity of the mitochondrial

proteome for photosynthetic and non-photosynthetic Arabidopsis metabolism.

Molecular and Cellular Proteomics 7:1297-1316

Ludevid M.D., Freire M.A., Gómez J., Burd C.G., Albericio F., Giralt E., Dreyfuss G.,

Pagès M. (1992) RNA binding characteristics of a 16 kDa glycine-rich protein from

maize. Plant Journal 2:999-1003

Marion M B. (1976) A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding. Analytical

Biochemistry 72:248-254

Martin C., Ellis N., Rook F. (2010) Do transcription factors play special roles in adaptive

variation? Plant Physiology 154:506-511

Matsushima Y., Garesse R., Kaguni L.S. (2004) Drosophila mitochondrial transcription

factor B2 regulates mitochondrial DNA copy number and transcription in Schneider

cells. Biological Chemistry 279:26900-26905

Matsushima Y., Adan C., Garesse R., Kaguni L.S. (2005) Drosophila mitochondrial

transcription factor B1 modulates mitochondrial translation but not transcription or

DNA copy number in Schneider cells. Biological Chemistry 280:16815-16820

May M.J., Leaver C.J. (1993) Oxidative stimulation of glutathione synthesis in

Arabidopsis thaliana suspension cultures. Plant Physiology 103:621-627

Millar A.H., Liddell A., Leaver C.J. (2001a) Isolation and subfractionation of

mitochondria from plants, Methods in Cell Biology, Vol 65, Academic Press Inc,

San Diego. pp. 53-74

Millar A.H., Sweetlove L.J., Giege P., Leaver C.J. (2001b) Analysis of the Arabidopsis

mitochondrial proteome. Plant Physiology 127:1711 - 1727

Morishita R., Kawagoshi A., Sawasaki T., Madin K., Ogasawara T., Oka T., Endo Y.

(1999) Ribonuclease activity of rat liver perchloric acid-soluble protein, a potent

inhibitor of protein synthesis. Biological Chemistry 274:20688-20692

Muench D.G., Park N. I. (2006) Messages on the move: the role of the cytoskeleton in

mRNA localization and translation in plant cells. Canadian Journal of Botany

84:572-580

Murashige T., Skoog F. (1962) A revised medium for rapid growth and bio assays with

tobacco tissue cultures. Physiologia Plantarum 15:473-497

Oka T., Tsuji H., Noda C., Sakai K., Hong Y.M., Suzuki I., Muñoz S., Natori Y. (1995)

Isolation and characterization of a novel perchloric acid-soluble protein inhibiting

cell-free protein synthesis. Jurnal of Biological Chemistry 270:30060-30067

Olinares P.D.B., Ponnala L., van Wijk K.J. (2010) Megadalton complexes in the

chloroplast stroma of Arabidopsis thaliana characterized by size exclusion

65

chromatography, mass spectrometry, and hierarchical clustering. Molecular and

Cellular Proteomics 9:1594-1615

Orlando V., Strutt H., Paro R. (1997) Analysis of chromatin structure by in vivo

formaldehyde cross-linking. Methods 11:205-214

Parsons H.L., Yip J.Y.H., Vanlerberghe G.C. (1999) Increased respiratory restriction

during phosphate-limited growth in transgenic tobacco cells lacking alternative

oxidase. Plant Physiology 121:1309-1320

Rappu P., Shin B.S., Zalkin H., Maentsaelae P. (1999) A role for a highly conserved

protein of unknown function in regulation of Bacillus subtilis purA by the purine

repressor. Bacteriology 181:3810-3815

Richter U., Kiessling J., Hedtke B., Decker E., Reski R., Borner T., Weihe A. (2002)

Two RpoT genes of Physcomitrella patens encode phage-type RNA polymerases

with dual targeting to mitochondria and plastids. Gene 290:95-105

Riechmann J.L., Heard J., Martin G., Reuber L., Jiang C.Z., Keddie J., Adam L.,

Pineda O., Ratcliffe O.J., Samaha R.R., Creelman R., Pilgrim M., Broun P.,

Zhang J.Z., Ghandehari D., Sherman B.K., Yu C.L. (2000) Arabidopsis

transcription factors: Genome-wide comparative analysis among eukaryotes.

Science 290:2105-2110

Saleh A., Alvarez-Venegas R., Avramova Z. (2008) An efficient chromatin

immunoprecipitation (ChIP) protocol for studying histone modifications in

Arabidopsis plants. Nature Protocols 3:1018-1025

Sambrook J., E.F.Fritsch, T. Maniatis (1989) Molecular cloning: A laboratory Manual

2nd

Ed. Cold Spring Harbor Laboratory Press

Shedge V., Arrieta-Montiel M., Christensen A.C., Mackenzie S.A. (2007) Plant

mitochondrial recombination surveillance requires unusual RecA and MutS

homologs. The Plant Cell Online 19:1251-1264

Shen E.L., Bogenhagen D.F. (2001) Developmentally-regulated packaging of

mitochondrial DNA by the HMG-box protein mtTFA during Xenopus oogenesis.

Nucleic Acids Research 29:2822-2828

Shevchenko A., Wilm M., Vorm O., Mann M. (1996) Mass spectrometric sequencing of

proteins from silver stained polyacrylamide gels. Analytical Chemistry 68:850-858

Shutt T., Gray M. (2006) Twinkle, the mitochondrial replicative DNA helicase, is

widespread in the eukaryotic radiation and may also be the mitochondrial DNA

primase in most eukaryotes. Molecular Evolution 62:588-599

Singh K.B. (1998) Transcriptional regulation in plants: The importance of combinatorial

control. Plant Physiology 118:1111-1120

Solomon M.J., Varshavsky A. (1985) Formaldehyde-mediated DNA-protein crosslinking:

a probe for in vivo chromatin structures. Proceedings of the National Academy of

Sciences of the United States of America 82:6470-6474

Sutherland B.W., Toews J., Kast J. (2008) Utility of formaldehyde cross-linking and

mass spectrometry in the study of protein-protein interactions. Mass Spectrometry

43:699-715

Svensson A.S., Johansson F.I., Møller I.M., Rasmusson A.G. (2002) Cold stress

decreases the capacity for respiratory NADH oxidation in potato leaves. FEBS

Letters 517:79-82

Takata K., Yoshida H., Hirose F., Yamaguchi M., Kai M., Oshige M., Sakimoto I.,

Koiwai O., Sakaguchi K. (2001) Drosophila mitochondrial transcription factor A:

Characterization of Its cDNA and expression pattern during development.

Biochemical and Biophysical Research Communications 287:474-483

66

Vermel M., Guermann B., Delage L., Grienenberger J.-M., Maréchal-Drouard L.,

Gualberto J.M. (2002) A family of RRM-type RNA-binding proteins specific to

plant mitochondria. Proceedings of the National Academy of Sciences 99:5866-

5871

Zaegel V., Guermann B., Le Ret M., Andrés C., Meyer D., Erhardt M., Canaday J.,

Gualberto J.M., Imbault P. (2006) The plant-specific ssDNA binding protein

OSB1 is involved in the stoichiometric transmission of mitochondrial DNA in

Arabidopsis. The Plant Cell Online 18:3548-3563

67

CHAPTER 3:

Arabidopsis thaliana cells in suspension cultures alter their

physiological, transcript and metabolite responses during

phosphate depletion and re-supply

68

Abstract

Phosphate (Pi) is a plant macronutrient that is often limiting for growth. Pi deficiency leads

to stress. Plants have various adaptations to survive Pi deprivation. For example, plants

typically increase the capacity of Pi transport through membranes by up-regulating the

expression of numerous Pi transporters of the PHT gene family. This chapter aimed to

develop a cell culture approach to understand how each member of the PHT1, PHT2 and

PHT3 gene families responds to Pi depletion and re-supply. Cell suspension cultures have

several advantages over the whole plant system. Cultures quickly produce many uniform

cells and can be easily manipulated. Arabidopsis thaliana (Arabidopsis) cells responded

quickly when subcultured into fresh media containing Pi. They rapidly took the majority of

Pi out of the media and the cell biomass increased. As in plant tissues, the transcripts of

several PHT gene family members were repressed in P-containing medium. Pi resupply to

Pi-deprived cells also caused the cells to switch from fermentation to a normal respiration

pathway. As Pi in the medium became depleted during growth, the Pi inside the cells

decreased but the biomass continued to increase for an extended period before cell

proliferation became inhibited, presumably due to Pi limitation. As Pi inside the cells

declined, several PHT gene transcripts started to be up-regulated, presumably to increase

the capacity of Pi uptake. However, the onset of induction varied from gene to gene. During

Pi depletion, the amounts of lactic acid increased indicating cells initiated a fermentation

process. Some sugars and organic acids that are mainly involved in the citric acid cycle

increased in abundance while the amounts of some amino acids decreased, reversing the

direction from their abundance change in Pi-resupplied cells. These results confirm and

extend previous work demonstrating that Arabidopsis suspension cells, like whole plants,

alter their physiological and molecular metabolism to maintain their survival under various

Pi conditions.

69

Introduction

Like other living organisms, plants need sufficient nutrients to sustain their growth and

development. Phosphorus (P) is one of the major nutrients that are necessary for plants and

Pi deficiency causes plant stress. Although there is a high level of P present in most soils,

most of it usually forms complexes with cations such as aluminium and iron, making it

hardly accessible to plants (Bieleski, 1973). Thus, plants typically need to adjust their

biochemical and cellular metabolisms to survive Pi limitation.

Lack of local Pi supply which is independent of internal Pi content will lead plants to

respond by altering their root morphology (Robinson, 1994; Bates and Lynch, 2001;

Williamson et al., 2001; Lynch and Brown, 2008). This is to acquire more P from soil. P is

taken up by plants in the form of the orthophosphate ion (PO43-

) and the capacity of Pi

uptake is increased by the up-regulation of members of the various Pi transporter gene

families (Muchhal et al., 1996; Mudge et al., 2002; Shin et al., 2004). The Pi acquired from

soil will be strategically used during low P conditions. For example, Pi may be translocated

from older to younger tissues or released from P-containing compounds (Vance et al.,

2003).

When plants change their physiological and molecular metabolisms, it indicates that the

gene expression patterns are altered. Transcriptome studies using microarrays in

Arabidopsis (Wu et al., 2003; Hammond et al., 2004; Misson et al., 2004) rice (Wasaki et

al., 2003; Li et al., 2010) and lupin (Uhde-Stone et al., 2003) revealed that the expression of

many genes involved in various functions were co-ordinately changed during Pi-deficiency.

Among them are the genes involved in regulation of the Pi-starvation responses and

signalling. Information related to Pi sensing and signalling in plants are still lacking, unlike

in yeast (Oshima, 1997) and bacteria (Vershinina and Znamenskaya, 2002) which has been

well characterised. To date, several genes were found to be involved Pi regulation in plants;

this includes a membrane protein PHO1 that contains SPX and EXS domains and PHO2

that encodes a ubiquitin-conjugating E2 enzyme, a target gene of miRNA399 (Lin et al.,

2009; Chiou and Lin, 2011). SPX and EXS domain-containing proteins are potential

regulators involved in the Pi signalling network (Chiou et al 2011). SPX domain could

70

function as a sensor for Pi level (Duan et al., 2008) while specific function for EXS domain

remains unknown.

During Pi-deficiency, mature miRNA399 is translocated from the shoot to the root,

repressing the translation of PHO2 transcripts. The outcome is an increase in the transcript

abundance for some PHT genes (Lin and Chiou, 2008). PHT family members have been

widely studied and most of them were found to be up-regulated in Pi stressed plants (Smith

et al., 1997; Okumura et al., 1998; Morcuende et al., 2007). The model of Pi signalling

pathway adapted from Bari et al., 2006 is included in Chapter 1. PHT1 are the transporters

located to plasma membrane that function under low and high Pi conditions (Misson et al.,

2004; Shin et al., 2004). Indeed, some members of the PHT1 family have also been

speculated to be the candidates for sensing the lack of Pi in plants (Abel, 2011). PHT2,

which is located to the inner envelope of plastid, is a low affinity Pi transporter that is

involved in Pi uptake into leaves and intercellular movement, but not Pi remobilisation

(Daram et al., 1999; Rausch et al., 2004). Three members of PHT3, are located to the

mitochondria (Takabatake et al., 1999). One of the members, PHT3;2 was found to be

regulated in Pi-limited Arabidopsis leaves and root (Misson et al., 2005; Morcuende et al.,

2007; Müller et al., 2007).

Changes in the transcript profiles of Pi starvation responsive genes suggest alterations in

metabolite profiles. Pi-deficient plants modify their carbohydrate metabolism to

compensate for low Pi condition (Plaxton, 1996; Abel et al., 2002; Huang et al., 2008).

Several biochemical pathways, for example glycolysis, become modified to bypass the

steps that require Pi (Duff et al., 1989; Plaxton et al., 2006), causing changes in the

amounts of citric acid cycle intermediates. Furthermore, the altered abundance of amino

acids during Pi deficiency will affect the amounts of compounds that are synthesised from

these amino acids (Morcuende et al., 2007). While similar Pi responsive transcript profiles

were found in different plants, the metabolite profiles seem to be more dependent on the

plant species (Ciereszko and Barbachowska, 2000; Ciereszko et al., 2002; Hernandez et al.,

2007; Huang et al., 2008).

This chapter aimed to understand plant responses towards Pi depletion and resupply, using

Arabidopsis cell suspension cultures as a model system. Cell suspension culture is a robust

71

0

0.2

0.4

0.6

0.8

1

1.2

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14

Day

Pi

left

in

med

ium

(m

M)

0

5

10

15

20

25

30

Pi

insid

e t

he c

ell

s

(µm

ol.

g F

W-1

)

Pi inside the cells Pi in the medium

system with many experimental advantages over plants (Chapter 1). In this study, I focused

on the physiological responses of the cells, the kinetics of transcript abundance of the PHT

gene family members, together with some other genes involved in Pi regulation and

signalling, and the metabolic changes that occur when Pi-limited Arabidopsis cells were re-

supplied with Pi, followed by Pi depletion during growth. The concentration of total P, Pi

and sucrose were estimated using respected standard curve. The similarities and differences

of the responses in suspension cells to these reported in plants are discussed.

Results

Pi depletion compromised the growth of Arabidopsis cells in suspension cultures

Arabidopsis cells cultured for 7 days in MS medium containing 1 mM Pi completely

depleted the media of Pi (Figure 3.1). During normal subculturing, 20 % of the cells

obtained in a 127 ml culture were subcultured into fresh MS media to give a final

concentration of 1 mM Pi. Cells went through three days of lag phase before the biomass

increased linearly from day 4, and reached about 14 g fresh weight per 127 ml culture at

day 7. For –Pi treatment, 20 % of cells from 7-day old cultures were subcultured into fresh

medium without Pi to prolong the Pi-deficient condition. Prolonged Pi deficiency caused a

drastic change to the cell growth profile. A very small increase of biomass was recorded

during the first three days of subculture and reached a plateau by day 10 from the last

exposure to 1 mM Pi (Figure 3.2).

Figure 3.1 Pi status of Arabidopsis suspension cells in response to Pi depletion during

growth. At day 0, 7-day old Arabidopsis cells were subcultured into fresh MS media

72

containing 1.25 mM Pi to give a final concentration of 1 mM Pi. Cells were grown for 7

days before subculture into fresh MS media without Pi and grown for a further 7 days. Pi

left in the medium (left-hand axis) and Pi inside the cells (right-hand axis) were

determined. Thin arrows indicate when the cells were subcultured. The thick arrow

indicates the level of Pi supplied by the subculture. Values are mean + SE (n=3 flasks).

When not visible, the error bars are too small to be seen outside the symbols for the data

points.

0

2

4

6

8

10

12

14

16

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14

Day

Fre

sh

we

igh

t (g

.fla

sk

-1)

Figure 3.2 Growth of Arabidopsis suspension cells in 1 mM Pi-containing medium

followed by growth in -Pi medium. Using the cultures from Figure 3.1, cell biomass was

determined. The heads of the arrows indicate the initial cell fresh weight and the day of

subculture. Values are mean + SE (n=3 flasks). At day 0, the cell fresh weight was obtained

before and after subculturing. When not visible, the error bars are too small to be seen

outside the symbols for the data points.

Cells cultured for 7 days in MS media with an initial Pi concentration of 1 mM took up

nearly all the Pi from the media within one day after subculturing into fresh P-containing

media (Figure 3.1). The highest Pi content inside the cells was found at day 1 indicated that

Pi-depleted cells responded quickly in taking up Pi upon Pi-resupply. The Pi content inside

the cells on a gram fresh weight basis decreased rapidly from day 2 until day 6 and reached

a minimum level at day 9.

Pi is used in a variety of biochemical reactions and some of them were transferred into P-

containing organic compounds (Po). Except for day 2, the amount of P in the Po pool was

73

always greater than that in the Pi pool throughout the cell growth period, although no clear

trend could be detected (Figure 3.3). For some cultures, the amount of total P recovered

was less than the amount initially supplied. This was because a variable amount of up to 30

% of the added P was unaccounted for the P assays during sample preparation.

0

10

20

30

40

50

60

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14

Day

P p

oo

ls in

sid

e t

he

ce

lls (

µm

ol.

g F

W-1

)

Pi Po

Figure 3.3 The dynamics of the Pi and Po pools in Arabidopsis suspension cells in

response to Pi depletion. Using the cultures from Figure 3.1, total P inside the cells was

determined. Po was calculated by subtracting Pi from total P. Values are mean + SE (n=3

flasks). When not visible, the error bars are too small to be seen outside the symbols for the

data points. The values for Pi are those shown in Figure 3.1.

The PHT gene family transcripts in Arabidopsis cells supplied with 1 mM Pi did not

respond strongly to changes in Pi-status

The response of the transcript pools for the PHT1, PHT2 and PHT3 gene family members

as a function of changing Pi status in cells supplied with 1 mM Pi was determined (Figure

3.4). Overall, transcripts from all PHT1 genes except PHT1;3 were detected in each

sample. PHT1;4 was by far the most abundant PHT1, followed by PHT1;7. PHT1;9 was

the least abundant of the detectable transcripts. PHT2 transcripts were about as abundant as

the average PHT1 transcript. The transcripts for all the PHT3 genes were quite plentiful,

each being about as abundant as PHT1;7 transcripts. The transcript amounts for some of the

PHT gene family members did not increase more than 2-fold between day 1, when cells

74

contained the highest concentrations of Pi, and day 11, when the media had been depleted

of Pi for about 10 days, including PHT1;4. The amounts of PHT1;5 and PHT1;6 transcripts

increased slightly more than 2-fold by day 11. However, the amounts of PHT1;1 and

PHT1;2 transcripts increased more than 5-fold over this period.

Transcripts for PHT2, the plastid Pi transporter, were 5-fold higher by day 11, while the

transcripts for the mitochondrial Pi transporters PHT3;1, PHT3;2 and PHT3;3 had a weak

induction of about 2-fold magnitude by day 11 (Figure 3.4). Except for PHT1;1, PHT1;2,

PHT1;5, PHT1;6 and PHT2, other transcripts changes between day 1 and day 11 were not

statistically significant. Overall, PHT gene transcript profiles suggested that the supply of 1

mM Pi to cells depleted of Pi over 7 days was insufficient to repress the expression of some

of the PHT gene family members to the extent reported in the literature. This observation

indicates that the cells were responding to a low Pi status throughout the growth period.

25

30

35

40

45

50

PHT1;1 PHT1;2 PHT1;3 PHT1;4 PHT1;5 PHT1;6 PHT1;7 PHT1;8 PHT1;9 PHT2 PHT3;1 PHT3;2 PHT3;3

Gene

40

-de

lta

Ct

Day1 Day7 Day11

Figure 3.4 The transcript profiles of PHT gene families in Arabidopsis suspension cells in

response to Pi depletion. Using the cultures from Figure 3.1, mRNA from 1-day-, 7-day-

and 11-day-old Arabidopsis cells were isolated and used for quantitative real time

polymerase chain reaction (qRT-PCR) assays. The y-axis is a log2 scale, where each

integer increment is equal to a 2-fold change in transcript abundance. Values are mean +

SE (n=3). When not visible, the error bars are too small to be seen outside the symbols for

*

* *

* *

Day1 Day7 Day11

[Pi]

75

the data points. Significant differences (*) between cells at day 1 and day 11 were

determined by a t-test (p<0.05). The triangle represents Pi concentration inside the cells for

indicated days.

High Pi supplies compromised the growth of Arabidopsis cells in suspension cultures

The 1 mM Pi supplied initially in MS media to Pi-depleted cell suspensions was apparently

not sufficient to fully repress PHT gene transcripts. To understand more clearly the

responses of these transcripts to Pi depletion, a range of Pi concentrations in the initial

medium were supplied and cells harvested after 7 days. A Pi supply of 1 mM gave the

highest yield of cells (Figure 3.5). The cell fresh weight was about 20 % lower for all Pi

supplies above 1 mM, suggesting unfavourable growth conditions.

0

2

4

6

8

10

12

14

16

0 1 2 4 8 16

Culture media [Pi] at Day-0 (mM)

Fre

sh

weig

ht

(g.f

lask

-1)

Figure 3.5 Growth of Arabidopsis suspension cells under various Pi supplies. At day 0, 7-

day old Arabidopsis cells were subcultured into fresh MS media containing the indicated Pi

supply. Cells were harvested at day 7 and the biomass was determined. Values are mean +

SE (n=3 flasks).

Pi supplied to Arabidopsis suspension cells in the medium were allocated to different P

pools

Arabidopsis suspension cells were very responsive in taken up Pi into the cells when they

were supplied with a certain amount of Pi (Figure 3.6). They had an even higher capacity to

consume Pi from the medium than was found in cultures supplied 1 mM Pi. For cultures

supplied with 4 to 16 mM Pi, about 50 % of the Pi was removed from the media during 7

76

day growth period, regardless of the starting Pi concentration. At day 7, the concentration

of Pi inside cells initially supplied with 4 mM Pi was 13 fold higher compared to cells

supplied with 1 mM Pi. Higher initial Pi supplies did not change the final Pi concentration

inside the cells at day 7. This result shows that an initial supply of 4 mM Pi was enough to

saturate the Pi storage capacity of cells in culture. In agreement with this finding, the

amount of Pi left in the medium after the culture period increased with increasing amounts

of Pi supplied above 4 mM (Figure 3.6).

0

2

4

6

8

10

0 1 2 4 8 16

Culture media [Pi] concentration at Day 0 (mM)

Pi

left

in

th

e m

ed

ium

(m

M)

0

5

10

15

20

25

30

35

40

Pi

insid

e t

he c

ell

s (

µm

ol.

g F

W-1

)


Figure 3.6 Pi status of Arabidopsis suspension cells grown under various initial Pi supplies.

Using the cultures from Figure 3.5, the Pi left in the medium (left-hand axis) and the Pi

inside the cells (right-hand axis) were determined. Values are mean + SE (n=3 flasks).

When not visible, the error bars are too small to be seen outside the symbols for the data

points.

For all treatments, the majority of P was in the Po pool. Similar to Pi concentration inside

the cells that reached plateau at Pi supplies of 4 mM or greater, the same trend was also

found for the amount of Po (Figure 3.7).

77

0

20

40

60

80

100

120

1 2 4 8 16

Culture media [Pi] at Day 0P p

oo

ls in

sid

e t

he

ce

lls (

µm

ol.

g FW

-1)

Pi Po

Figure 3.7 The response of P pools to Pi supply in Arabidopsis cells. Using the cultures

from Figure 3.5, total P inside the cells was determined. The amount of Po was calculated

by subtracting Pi from total P. Values are mean + SE (n=3 flasks). The values for Pi are

those shown in Figure 3.6.

Most members of PHT1 family and PHT3;2 gene transcripts were strongly repressed by

higher Pi supply

The PHT transcript profiles for 7 day old cells supplied with various amounts of Pi were

determined (Figure 3.8). Most of the PHT1 transcripts were repressed with increasing

amounts of Pi including PHT1;1, PHT1;2, PHT1;4, PHT1;6 and PHT1;7. Transcripts from

PHT1;5, PHT1;8 and PHT1;9 were not changed. For PHT genes located to the organelles,

PHT2 and PHT3;1 transcripts were induced with increasing Pi supply, PHT3;2 transcripts

were repressed while PHT3;3 transcripts did not change.

78

25

30

35

40

45

50

PHT1

;1

PHT1

;2

PHT1

;3

PHT1

;4

PHT1

;5

PHT1

;6

PHT1

;7

PHT1

;8

PHT1

;9

PHT2

PHT3

;1

PHT3

;2

PHT3

;3

Gene

40-D

elt

a C

t

0 mM Pi 1 mM Pi 2 mM Pi 4 mM Pi 8 mM Pi

Figure 3.8 The PHT gene family transcript profiles for Arabidopsis suspension cells in

various Pi supplies. Using the cultures from Figure 3.5, mRNA were isolated and used for

qRT-PCR. The y-axis is a log2 scale, where each integer increment is equal to a 2-fold

change in transcript abundance. Values are mean + SE (n=3). When not visible, the error

bars are too small to be seen outside the symbols for the data points.

Arabidopsis cells in suspension cultures loaded with excess Pi has the ability to survive

longer culture cycle without added Pi

To determine the effect of Pi depletion on cells supplied with a higher rate of Pi, cells

grown for 7 days in 1 mM Pi were subcultured into fresh MS medium and supplied 4 mM

Pi. By day 7, cell fresh weight had increased to about 11 g flask-1

(Figure 3.9), slightly less

than the amount of cells obtained from cultures supplied 1 mM Pi (Figure 3.5). These cells

were subcultured into fresh medium lacking Pi and a similar growth pattern was observed

through day 13, indicating enough Pi was still available for the cells. Cells were

subcultured again into medium without Pi. This time, the cell growth reached a plateau by

day 17 at a lower level than in the previous subcultures. The biomass accumulated at day

21 was about 50 % lower than that recorded at day 7 and day 13 (Figure 3.9), indicating

that cell growth arrested because the internal P pools had become lowered to the point of

compromising growth.

79

Figure 3.9 Growth of Arabidopsis suspension cells in Pi-containing medium followed by P

withdrawal. At day 0, 7-day old Arabidopsis cells grown in 1 mM Pi were subcultured into

fresh MS media to a final Pi concentration of 4 mM. Cells were grown for 7 days before

being subcultured into fresh MS media without Pi until day 13. These cells were

subcultured into fresh MS media without Pi at day 13 and the growth was continued until

day 21. Arrows indicate the initial cell fresh weight and day of subculture. Cells were

harvested every two-days and the fresh weight determined. Values are mean + SE (n=3

flasks). At day 0, the cell fresh weight was obtained before and after subculturing. When

not visible, the error bars are too small to be seen outside the symbols for the data points.

The P pool of Arabidopsis suspension cells was dynamically changed in response to Pi

loading and Pi depletion

Within one day of subculturing 7-day old Arabidopsis suspension cells from Pi-exhausted

media into fresh MS medium to a final concentration of 4 mM Pi, cells had taken up 90 %

of the Pi from the media. The amount of Pi inside the cells was at the highest level at day 1.

This amount decreased to almost undetectable levels from day 11 onwards. While the Pi

left in the medium was low at day 1, it increased 4-fold at day 3. An experiment to test if

the increasing of P amount was due to secreted P that was initially bound to the flask was

conducted. Empty flasks that previously contained medium without cells inoculated were

acid digested. Results have shown that only about 1 µmol P could be detected, indicating

not much P was contributed from this source. Starting from day 3, the amount of Pi in the

medium decreased to almost undetectable levels by day 9 (Figure 3.10).

0

2

4

6

8

10

12

14

16

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

Day

Fre

sh

weig

ht

(g.f

lask

-1)

80

0

1

2

3

4

5

0 1 3 5 7 9 11 13 15 17 19 21

Day

Pi

left

in

th

e m

ed

ium

(m

M)

0

20

40

60

80

100

120

Pi

insid

e t

he c

ell

s (

µm

ol.

g F

W-1

)


Figure 3.10 Pi status of Arabidopsis cells during Pi depletion. Using cultures from Figure

3.9, the Pi left in the medium (left-hand axis) and the Pi inside the cells (right-hand axis)

were determined. Thin arrows indicate the time-point when the cells were subcultured. The

thick arrow indicates the level of Pi supplied by the subculture. Values are mean + SE (n=3


data points.

Except for day 1 and day 3, the Po amounts inside the cells were at least two times higher

than the Pi amounts (Figure 3.11). At day 1, where Pi was at the highest level, there was

virtually no Po inside the cells. However, by day 3, cells have readjusted the P distribution

as could be seen from equal amounts in both Pi and Po. At day 9 (two days after subculture

of cells into fresh media lacking Pi, but containing the other substances needed for growth),

another dramatic remodelling of the P pools, where a large change in P content inside the

cells were observed. Po increased at day 9, before decreased again at day 11. By day 13, an

equilibrium has been reached and cell growth has stopped. It appears that 40 µmol.g FW -1

is the base P status for cell growth.

81

0

20

40

60

80

100

120

140

0 1 3 5 7 9 11 13 15 17 19 21P po

ols

insi

de t

he c

ells

(µm

ol. g

FW

-1)

Pi Po

Figure 3.11 The growth-dependent P pool dynamics of Pi-loaded Arabidopsis suspension

cells. Using the cultures from Figure 3.9, total P inside the cells was determined. The

amount of Po was computed by subtracting Pi from total P. Values are mean + SE (n=3


data points. The values for Pi are those shown in Figure 3.10.

The transcript abundance profiles for Pi-starvation responsive genes during Pi-depletion

are gene-dependent

Within one day of supplying Pi-depleted cells with 4 mM Pi, the amounts of transcripts for

most of the high-affinity Pi transporters decreased strongly (Figure 3.12A). Significant

reduction were determined at day 1 for PHT1;4 by nearly 200-fold, PHT1;7 by 75-fold,

PHT1;2 by 40-fold and PHT 1;8 by 24-fold. The amounts of transcripts for PHT1;6

decreased 3-fold upon Pi re-supply. PHT3;2 transcripts were strongly repressed by 17-fold,

while PHT2 gene transcripts decreased 2-fold (Figure 3.12B). By contrast to all other PHT

genes examined, there was a 2-fold increase in PHT3;3 transcripts. PHT1;4 and PHT1;8

repressed more quickly than other Pi transporters, while PHT3;2, PHT1;7 and PHT1;8

were the slowest to be repressed to the lowest level observed. These transcripts were

repressed for several days before induction began, presumably due to the onset of Pi

depletion. However, the kinetics of transcript repression and induction varied from gene to

gene. The transcript amounts for PHT1;4 and PHT1;6 started to increase at day 5, while

PHT1;1 and PHT1;2 transcripts began to accumulate by day 7. PHT1;7, PHT1;8 and

82

PHT1;9 had two cycles of repression and de-repression, which differs from the trends of

PHT1;1, PHT1;2, PHT1;4 and PHT3;2 which simply repressed and de-repressed.

The transcript pool behaviour of two genes involved in regulating the Pi-starvation

response in Arabidopsis, PHO2 and the primary miRNA399, were also examined. In

suspension cells, PHO2 transcript amounts decreased 8-fold upon Pi resupply (Figure 3.12

B). PHO2 transcripts accumulated as the Pi decreased. The abundance of the miRNA399

primary transcript decreased more than 800-fold by day 1 of Pi resupply. These transcripts

began to accumulate again by day 9.

A

25

30

35

40

45

50

PHT1;1 PHT1;2 PHT1;3 PHT1;4 PHT1;5 PHT1;6 PHT1;7 PHT1;8 PHT1;9

Genes

40

- D

elt

a C

t

Day 0 Day 1 Day 3 Day 5 Day 7 Day 9 Day 13 Day 21


[Pi]

83

B

25

30

35

40

45

50

PHT2 PHT3;1 PHT3;2 PHT3;3 PHO2 miRNA399

Genes

40-

Delt

a C

t


Figure 3.12 Transcript profiles for selected Pi-responsive genes in Arabidopsis suspension

cells in response to Pi supply and depletion. Using the cultures from Figure 3.9, mRNAs

from cells of selected time points were isolated and used for qRT-PCR. The y-axis is a

log2 scale, where each integer increment is equal to a 2-fold change in transcript

abundance. Values are mean + SE (n=3). When not visible, the error bars are too small to

be seen outside the symbols for the data points. A) Transcript amounts for PHT genes

encoding proteins located to the plasma membrane. B) Transcript amounts for the PHT

genes encoding proteins located to organelles, PHO2 and primary miRNA399. The triangle

represents Pi concentration inside the cells for indicated days.

High amounts of some sugars, amino acids and organic acids during Pi depletion were

reversed by Pi re-supply

Methanol-soluble metabolites in Arabidopsis suspension cells harvested at different Pi

status were identified and the relative abundance determined by GC-MS analysis. Using

automated mass spectral deconvolution and identification system software (AMDIS), a

total of 60 known compounds were detected, and 27 were of unknown identity (Appendix

2). Using the alternative data processing platform Metabolome Express (ME), a total 44

compounds were detected, 20 of which were classified as unknown compounds. The

84

metabolite ratio in -P cells (day 7 after 1 mM Pi resupply) and +P (day 1 after 4 mM Pi

resupply) were calculated and the full metabolites ratios from results analysed using

AMDIS are listed in Appendix 3.

Using the AMDIS analysis protocol, the levels of sucrose, glucose and fructose were higher

with Pi depletion (Figure 3.13). Amino acids such as threonine, serine, isoleucine, glycine

and proline were lower; while phenylalanine, valine and GABA were higher with Pi-

depletion. The detected organic acids; citrate, succinate, fumarate, and malate were

increased with Pi depletion, the same trend as lactate, a product of fermentation, was also

more abundant in cultures depleted of Pi.

For most of these metabolites, the same trend was found when ME analysis was performed.

Most sugars and organic acids increased except for citrate and lactate that were not detected

in ME analysis. Isoleucine, threonine and serine were also not detected in the ME analysis.

Alanine that was not detected by AMDIS was identified but found not to change in ME.

The full metabolites ratios from results analysed using ME are listed in Appendix 4.

Another metabolite comparison was made between –P cells that were harvested at day 9,

two days after subcultured into fresh medium without Pi, and +P cells harvested at day 1

after 4 mM Pi resupply. Analyses by both AMDIS and ME have shown the same trend for

detected metabolites. The amounts of sugars, lactate, citrate, succinate, and fumarate were

higher with Pi depletion (Figure 3.14).

85

Fructose

Alanine

Asparagine

Acetyl-coenzyme A

Glutamine

Citrate

Glucose

Glucose 6-phosphate

Fructose 6-phosphate

Glycerate 3-phosphate

Lactate

Day 0/ Day 1

from AMDIS

Phenylalanine

*8.2114.6 * 2.59

* 0.16

* 0.72

* 1.84

* 1.67Sucrose 1.44

7.99

0.92-

-

- 0.95 0.78

1.8

-

1.19 0.81

0.85 -

- 1.011.37 -

* 3.67 * 3.09

* 3.86 2.17

* 2.36 * 2.10 * 0.45 * 0.47

1.201.71

* 4.58 -

Day 0/ Day 1

from ME

ArginineProline

GABA

Glutamate

α-Ketoglutarate

Succinate

Malate

Fumarate

Oxaloacetate

Aspartate

Isoleucine

Threonine

0.85

Isoleucine

Valine

Leucine

GlycineSerine

Phosphoenolpyruvate

Pyruvate

Glycerol 3-phosphate

-

Leucine

1.01

-1.33

-4.23

Fructose

Alanine

Asparagine

Acetyl-coenzyme A

Glutamine

Citrate

Glucose

Glucose 6-phosphate



Lactate

Day 0/ Day 1

from AMDIS

Phenylalanine

*8.2114.6 * 2.59

* 0.16

* 0.72

* 1.84

* 1.67Sucrose 1.44

7.99

0.92-

-

- 0.95 0.78

1.8

-

1.19 0.81

0.85 -

- 1.011.37 -

* 3.67 * 3.09

* 3.86 2.17

* 2.36 * 2.10 * 0.45 * 0.47

1.201.71

* 4.58 -

Day 0/ Day 1

from ME

ArginineProline

GABA

Glutamate

α-Ketoglutarate

Succinate

Malate

Fumarate

Oxaloacetate

Aspartate

Isoleucine

Threonine

0.85

Isoleucine

Valine

Leucine

GlycineSerine

Phosphoenolpyruvate

Pyruvate


-

Leucine

1.01

-1.33

-4.23

Figure 3.13 Metabolite differences in Pi-depleted Arabidopsis suspension cells resupplied

with 4 mM Pi in MS medium: Selected cells treated as in Figure 3.9 were harvested and the

metabolites were profiled by GC-MS. The ratios of metabolites in -P cells (day 7 after 1

mM Pi resupply) and +P (day 1 after 4 mM Pi resupply) are shown on the figure by

different colour boxes. Compounds that were not detected are indicated in italics. Colours

represent ≥2, ≥5 and ≥10-fold higher (red gradient) or lower (green gradient) in +P cells

compared to –P cells. Mixed colours indicated different range in AMDIS and ME analysis.

The ratios obtained from AMDIS (left-hand box) and ME (right-hand box) are shown next

to the name of the metabolites. Whenever the ratio of metabolite was not determined, it was

indicated with a dash (-). Significant differences (*) were determined by a t-test (p<0.05, n=

2 biological replicates with 3 technical replicates for each biological replicate).

+5 +10 +2 -10 -5 -2

86

Fructose

Alanine

Asparagine

Acetyl-coenzyme A

Glutamine

Citrate

Glucose

Glucose 6-phosphate



Lactate

Day 9/ Day 1

from AMDIS

Phenylalanine

*4.63*5.6 *2.81

*0.09

*0.24

*3.44

*1.74Sucrose *2.32

*5.05

*13.75-

-

- *0.18 *0.17

- *0.21

-

*0.61 *0.53

0.87 -

- *0.35*0.17 -

*8.06 *6.17

*7.37 5.73

*2.29 *2.04 *0.25 *0.36

*0.51*0.60

* 2.73 -

Day 9/ Day 1

from ME

ArginineProline

GABAGlutamateα-Ketoglutarate

Succinate

Malate

Fumarate

Oxaloacetate

Aspartate

Isoleucine

Threonine

0.87

Isoleucine

Valine

Leucine

GlycineSerine

Phosphoenolpyruvate

Pyruvate


-

Leucine

Fructose

Alanine

Asparagine

Acetyl-coenzyme A

Glutamine

Citrate

Glucose

Glucose 6-phosphate



Lactate

Day 9/ Day 1

from AMDIS

Phenylalanine

*4.63*5.6 *2.81

*0.09

*0.24

*3.44

*1.74Sucrose *2.32

*5.05

*13.75-

-

- *0.18 *0.17

- *0.21

-

*0.61 *0.53

0.87 -

- *0.35*0.17 -

*8.06 *6.17

*7.37 5.73

*2.29 *2.04 *0.25 *0.36

*0.51*0.60

* 2.73 -

Day 9/ Day 1

from ME

ArginineProline


Succinate

Malate

Fumarate

Oxaloacetate

Aspartate

Isoleucine

Threonine

0.87

Isoleucine

Valine

Leucine

GlycineSerine

Phosphoenolpyruvate

Pyruvate


-

Leucine

Figure 3.14 Metabolite differences in Pi-depleted Arabidopsis cells. Selected cells treated

as in Figure 3.9 were harvested and the metabolites were profiled by GC-MS. The ratios of

metabolites in –P cells (day 9 after 4 mM Pi resupply, 2 days after subculture into fresh

medium lacking Pi) and +P (day 1 after 4 mM Pi resupply) are shown on the figure by

different colour boxes. Compounds that were not detected are indicated in italics. Colours

represent ≥2, ≥5, and ≥10 higher (red gradient) or lower (green gradient) amounts in –P

cells compared to +P cells. Mixed colours indicated different range in AMDIS and ME

analysis. The ratios obtained from AMDIS (left-hand box) and ME (right-hand box) are

shown next to the name of the metabolites. Whenever the ratio of metabolite was not

determined, it was indicated with a dash (-). Significant differences (*) were determined by

a t-test (p<0.05, n= 2 biological replicates with 3 technical replicates for each biological

replicate).

+5 +10 +2 -10 -5 -2

87

Pi-depleted cells took up a higher level of sucrose compared to cells that were supplied

with Pi

Sucrose amount left in the medium for selected time points was measured by anthrone

assay (Figure 3.15). The amount of sucrose detected in the medium was quite high at day 1,

a day after subculturing the cells into fresh medium containing sucrose. Sucrose amount in

the medium separated from the cells that was not supplied with Pi was 31 % lower

compared to the amount of sucrose in medium separated from the cells supplied with 4 mM

Pi. The lower amount of sucrose in the medium might indicates that more sucrose has been

taken up by the cells. There is also a possibility of extracellular sucrose hydrolysis into

hexose by extracellular acid invertase. This finding is in agreement with the high sucrose

level inside the cells determined by GC-MS as described previously.

0

5

10

15

20

25

30

35

Day 7 in

1mM Pi

Day 1 in

0mM Pi

Day 1 in

4mM Pi

Day 7 in

4mM Pi

Day 13 in

4mM Pi

Day 21 in

4mM Pi

Samples

Su

cro

se (

g/l

)

Figure 3.15 Higher amounts of sucrose were taken up by Pi-depleted cells. The medium

separated from Arabidopsis cells harvested at selected time points were assayed for sucrose

as described in Materials and Methods. Values are mean + SE (n=3 flasks). When not

visible, the error bars are too small to be seen outside the symbols for the data points.

88

Discussion

Pi-depletion and re-supply influenced the growth and P pools in Arabidopsis suspension

cells

A cell culture approach was used to understand how plant cells react to variations in Pi

status. Arabidopsis suspension cells were maintained in normal MS media containing 1

mM Pi by weekly subculturing. In this system, the Pi supply was cyclical and continuously

changing. Regardless of the Pi amount supplied, cells rapidly took Pi out of the media

within one day from subculture. Almost all Pi was removed out of culture media during day

1 for the 1 mM treatment. With higher Pi supplies (4 mM), cells took up about 90 % of the

Pi supplied. Rapid Pi uptake was also observed in tomato cell suspension cultures, as the

cells accumulate the highest amount of Pi two days after the subculture (Bozzo et al.,

2006). The reduction of Pi amount inside the cells and the increase in cell biomass over

time indicates an active utilisation of Pi for cell growth.

In this study, 50 % and 90 % of Pi was removed from the medium 7 days after the cells

were supplied 4 mM Pi in the first and second batch, respectively. Although the amount of

Pi inside the cells was about the same, the Po amounts for the second batch was 11 %

higher than the first batch. These discrepancies might be due to biological variations of the

cells grown in different batches.

The Pi level in cells supplied with just 1 mM Pi at day 0 was 0.59 µmol g FW-1

at day 11.

Since the Pi decreased to this level from about 25 µmol g FW-1

over the 11 days, the

transcripts of the PHT gene family members, which are repressed by high Pi, might be

expected to be up-regulated. However, only a very small increase in abundance for most of

the PHT transcripts by day 11 was observed. The inability of these genes to be highly up-

regulated as expected in Pi starved plants indicated that the cells were already experiencing

Pi deprivation at day 1 after exposure to 1 mM Pi. Some previous studies found that 1.25

mM Pi was insufficient to maintain the growth of Arabidopsis seedlings grown in liquid

media (Veljanovski et al., 2006) and other suspension cells, such as Brassica nigra, (Duff

et al., 1989; Lefebvre et al., 1990) Brassica napus (Carswell et al., 1997) and tomato

89

(Bozzo et al., 2002, 2004). However, 1 mM Pi was clearly sufficient for growth in this

study. In fact, in some situations, less than 1.25 mM Pi was also sufficient for growth of

Arabidopsis suspension cells (Shimaoka et al., 2004). Relationship between Pi

concentration and cell growth in these studies is important to further understand cell

responses under different P status.

Since the cells were Pi-deprived in 1 mM Pi, several amounts of Pi were tested to identify a

Pi-replete condition. Among them, 4 mM Pi in MS media was determined as the amount

that saturates cell storage capacity for Pi. However, this amount of Pi slightly lessens the

biomass accumulation at day 7. From the study of Veljanovski (2006), the highest cell

biomass was determined for 7-days-old Arabidopsis cells grown in MS medium containing

final concentration of 4.5 mM Pi. In the case of Catharanthus roseus cells grown in culture,

optimum growth was achieved in medium containing between 1.25 mM and 2.5 mM Pi.

There was an inhibition of growth observed in 5 mM Pi (Nagano and Ashihara, 1993). It

could be possible that too much Pi leads to P toxicity. In cell suspension culture, changes in

the appearance of cells might indicate the symptoms of toxicity. Catharanthus roseus for

example, changed colour from pale yellow to brown with some cells dying in high Pi.

Nevertheless, in my study, the reduction of biomass produced in cultures supplied with 4

mM Pi was most probably not due to P toxicity, as no colour changes observed for the

cultures. Rather, the lower biomass determined could be due to an inability of the cells to

cope with a big change in Pi supply, perhaps through the depletion of some other nutrient

that leads to unfavourable growth conditions. Taken together, it is necessary to determine

the amount of Pi needed for maximal growth in different plant systems.

Pi supplied at 4 mM at the beginning of a growth cycle was enough to sustain cell growth

until day 13, as long as fresh medium lacking Pi was added. When the Pi inside the cells

declined to 0.54 µmol g FW-1

, the cells stopped growing. When either 1 mM or 4 mM Pi

was supplied in fresh medium, the amount of Pi inside the cells was at its highest level at

day 1. The low Pi concentration remaining in the medium at day 1 increased again at day 3,

indicating a certain amount of Pi was contributed into the medium. There are two

mechanisms to explain this observation. It is most likely that excess Pi was secreted by the

cells, as was observed in barley roots (Mimura et al., 1996). The more Pi that was supplied

to the external medium, the more Pi was secreted from the roots prior to re-absorption for

90

translocation to the shoots (Mimura et al., 1996). Thus, Pi homeostasis in plants, and

perhaps cells in suspension culture, not only depends on Pi influx, but also on Pi efflux and

re-absorption. Alternatively, the re-appearance of Pi in the medium might be due to

phosphatase activities hydrolysing Pi that had stuck to the flask. Based on total P

measurement, a small amount of P was measured after flasks incubated with medium

containing P (without cells) were emptied, acid-digested and assayed. Just about 1 µmol P

had adhered to the flask, indicating that this source of Pi did not contribute to the spike in

Pi in the medium at day 3.

The amount of P in the Po form was dynamic and higher than Pi amounts during most of

the cell growth cycle. To explain the variation in the Po pool, the P mass balance was

determined for selected samples. The measurements suggested that a significant and

variable amount of P was not accounted for, as it was lost during the sample preparation

process. Looking across numerous studies, Po in the form of nucleic acids, phospholipids

and phosphate esters each increased proportionally to the total P content of plant tissues,

while the amount of Pi increased exponentially (Eric Veneklass, unpublished data). This

trend was also seen for Arabidopsis cells, which showed an exponential increase of Pi

inside the cells for up to 4 mM Pi supplied while the Po did not increase significantly.

Behaviour of various genes indicates the sum of the changes across the whole plant except

for PHT1;3 and PHT1;6

The PHT gene families, consisting of nine PHT1, one PHT2 and three PHT3 genes, are

responsible for much of the Pi transport in Arabidopsis (Okumura et al., 1998; Dong et al.,

1999). The transcript abundance for most of these genes was repressed when Pi-deprived

Arabidopsis plants were supplied with sufficient Pi (Morcuende et al., 2007). When

Arabidopsis cells that had depleted the culture media of an initial supply of 1 mM Pi were

re-supplied with 4 mM Pi, most of the PHT transcripts were repressed more than 2-fold

within a day. PHT1;4 was repressed to its lowest level within 24 h. PHT1;1 and PHT1;2

were a bit slower to be strongly repressed, while PHT1;7 was the slowest of the genes to

respond by repression. These genes remained repressed for a time and started to be induced

again when the cells were grown for an extended time without adding more Pi. The

physiological state of the cells will determine when the genes are induced. However, this

91

state is unknown and differs in a gene-dependent manner. PHT1;3 transcript was not

detected in all experiments. Troubleshooting showed that the primers work well for

detecting PHT1;3 transcripts in Arabidopsis plants.

The response to Pi status was mostly observed for the members of the PHT1 gene family,

while the transcript abundance for genes encoding transporters located to the organelles did

not change much in response to Pi supply or cellular Pi status. This could be due to cell

regulation, where the PHT1 members might react as the first response machinery in

transporting Pi across the plasma membrane before the Pi is distributed to the organelles.

In Arabidopsis plants, the expression of all PHT members could be detected in both shoots

and roots. These PHT genes responded quite strongly with Pi re-supply by repression of the

transcripts amounts except for PHT1;6 in shoots that showed little repression, PHT2 and

PHT3;1 showed a small induction and PHT3;3 was not significantly changed in either

shoots and roots (Morcuende et al., 2007). Results from my study have shown that PHT1;1,

PHT1;2, PHT1;4, PHT1;7, and PHT3;2 were the genes that were induced in low Pi with

PHT1;4 as the fastest gene to respond to low Pi conditions.

Pi homeostasis in plants is controlled by miRNA399, a small regulatory RNA that targets

transcripts of the PHO2 gene. miRNA399 was highly expressed in Pi deficient plants and

suppressed the PHO2 gene during low Pi (Fujii et al., 2005; Aung et al., 2006; Chiou et al.,

2006). Although lower Pi condition did not cause PHO2 transcripts to be repressed across

the cell culture growth cycle as expected, the relative amount of PHO2 transcripts was

always inversely correlated with primary miRNA399 transcripts except at day 21 where the

amounts were about the same. However, the transcript amounts for primary miRNA399 and

PHO2 transcripts were not significantly different except for day 1, day 5 and day 9. Higher

primary miRNA399 transcripts and lower amount of PHO2 transcripts was found at day 0

and later, 13 days after Pi re-supplied in the growth medium. At both day 0 and day 13, the

Pi amount inside the cells was low and these two genes were expected to have such

inversed abundance of transcript amounts.

In plants, the suppression of PHO2 correlates with the induction of the PHT genes.

However the response of most of the PHT genes (PHT1;1, PHT1;2, and PHT1;4) in the

92

suspension cells was earlier than the suppression of PHO2 transcripts. Since the timing of

transcript induction for PHT1;7, PHT1;8 and PHT1;9 was correlated with the repression of

PHO2 transcripts, it could be that these genes were regulated by primary miRNA399 and

PHO2 under low Pi status.

Apparently, the up-regulation of primary miRNA399 and repression of PHO2 was not

observed as expected at day 21 when the cells have the lowest Pi content that was observed.

At day 21, primary miRNA399 was anticipated to be up-regulated and PHO2 was expected

to be down-regulated to induce PHT genes expression. However, both transcripts stayed at

the same level. It looks like that the genes stop responding at this stage and this regulation

is different in homogenous cultures than in plants. In plants, miRNA399 and PHO2 regulate

a long distance signalling between shoots to roots in plants (Lin and Chiou, 2008).

However, there is no capacity for transports between tissues in homogenous cell cultures,

which might explain the inconsistency of both genes in responding to Pi status.

The repression of all responded PHT genes happened at day 1 when Po was at the lowest

level and Pi was at the highest level. Thus, Pi inside the cells seems to be triggering gene

repression. Most PHT gene members keep repressed while Pi inside the cells was dropping

and Po was increasing. At this stage, the repression could be triggered by cellular Po

amounts. Depending on the genes, some PHT members started to be induced as less P was

available. Overall, the repression might be triggered by local internal Pi amount, while the

induction were based on P status, either in Pi or Po pools available inside the cells.

Accumulation of some sugars, organic acids and amino acids in cells depleted of Pi

Plants change their biochemical and cellular metabolism to survive low Pi conditions

(Raghothama and Karthikeyan, 2005; Plaxton and Tran, 2011). In Arabidopsis suspension

cells deprived of Pi, some sugars, some amino acids and some organic acids associated with

citric acid cycle were increased in amount compared to cells containing the highest levels

of Pi. The breakdown of sucrose produces reducing sugars such as glucose and fructose

which can enter the glycolytic pathway. These reducing sugars were abundant in Pi-

deficient cells compared to Pi-replete cells. However, once the Pi deficient cells were re-

supplied with Pi, the amount of these sugars was lower. The accumulation of sugars was

93

also observed in the roots of Pi-deficient beans (Rychter and Randall, 1994; Hernandez et

al., 2007) and the tissues of Pi-deficient cucumber (Ciereszko et al., 2002).

Essentially, higher sugar content was found to facilitate the up-regulation of Pi-starvation

responsive genes, including PHT1;1 and PHT2 (Liu et al., 2005; Liu and Vance, 2010; Lei

et al., 2011) that were also used in this study. Although sucrose had been found to trigger

Pi-starvation responses, Pi- depletion was still the main factors that cause changes of cells

responses observed in this study. This is supported by the decreasing amounts of most of

the PHT transcripts for cells supplied with a constant amount of sucrose and several

concentrations of Pi. The more Pi supplied at day 0, the more repressed PHT transcripts

were determined at day 7. Pi-starvation responses were somehow still related to sucrose.

This is because lower amounts of sucrose were detected in the medium during cell growth,

indicating higher sucrose level inside the cells. This finding is consistent with the role of

sucrose as a regulator under low Pi condition.

The accumulation of organic acids in response to Pi status and supply varies between

species. Legume tissues were found to have a lower amount of organic acids under low Pi

conditions, perhaps because these compounds were secreted to solubilise Pi from the soil

(Johnson et al., 1996; Neumann and Romheld, 1999; Shen et al., 2002; Dong et al., 2004).

Similarly, strongly Pi-deficient barley plants had a lower amount of organic acids compared

to mildly Pi-deficient barley. This alteration may be the result of modifications to

carbohydrate metabolism that would reduce P consumption due to diminished amounts of

P-containing compounds (Huang et al., 2008). Arabidopsis plants, on the other hand,

showed a higher level of organic acids under low Pi condition compared to Pi sufficient,

which then may allow P to be recycled from the phosphorylated intermediates (Morcuende

et al., 2007). Organic acids content of these two plants were quite different as legumes and

grains have a natural capacity to exudates organic acid through cluster roots to acquire

more Pi (Raghothama, 1999; Cheng et al., 2011). In the context of this study which was

using Arabidopsis cells grown in culture, this condition might not reflect the differences in

plants metabolic profiles.

Most of the detected organic acids in this study were intermediates of the citric acid cycle.

High amounts of citric acid cycle intermediates suggest a possible disruption of

94

mitochondrial metabolism. During Pi deficiency, electron flow through the cytochrome

pathway might be restricted, slowing flux through the citric acid cycle (Vijayraghavan and

Soole, 2010). In the Arabidopsis cell culture system, the higher levels of lactate inside the

cells lacking Pi suggests fermentation was occurring due to an inability of flux through the

citric acid cycle to keep up with glycolytic demand. The production of ethanol and lactate

was previously proposed to be a prominent pathway during Pi starvation in Arabidopsis

plants (Wu et al., 2003). While fermentation by Pi-deficient plants is not fully understood,

low Pi condition had favoured higher fermentation rate in bakers yeast (Hayashibe, 1957).

Yeast Candida parapsilosis were capable of performing aerobic fermentation and cyanide-

resistant respiration as an alternative to cytochrome pathway respiration (Milani et al.,

2001). Another possibility that caused higher concentration of organic acids could be a

correlation with the known marked up-regulation and in vivo phosphorylation or activation

of PEP carboxylase of Pi-starved Arabidopsis suspension cells and seedlings (Gregory et

al., 2009).

For plants such as barley, the amino acids levels were much elevated with lower Pi

indicating protein degradation and repression of protein synthesis (Huang et al., 2008).

However, the amounts of most amino acids detected in Arabidopsis cells were less as Pi

was depleted, which was quite similar to Arabidopsis plants. In Arabidopsis plants, the

amount of glycine and valine were decreased after 24 hr of Pi-starvation (Morcuende et al.,

2007), the same trend observed in Arabidopsis cells after 9 days of Pi supplied. It could be

that less Pi retards the production of some amino acids. By Pi re-supply, most of the amino

acids were decreased, consistent with gradual activation of protein synthesis. Since Pi

deficiency caused oxidative stress to plants (Juszczuk et al., 2001), a higher level of GABA

in Pi-depleted cells may have adaptive value in improving stress tolerance (Bouché and

Fromm, 2004). A similar trend of amino-acid accumulation was found in glucose-starved

cells, contrasting with nitrogen-starved cells where most amino acids were depleted

(Klosinska et al., 2011). Although several metabolite ratios (i.e., glucose-6-phosphate and

some amino acids) were found to contradict general plant Pi-stress metabolite literature,

there were still agreement in many cases, such as amino acids (Morcuende et al.,2007).

Both AMDIS and ME were used for metabolite data processing, and gave the same trends

for most of the detected metabolites. The comparisons between these two software

95

packages on methanolic extracts of Arabidopsis suspension cells resulted to very similar

results with greater advantages in terms of statistical reliability by ME (Carroll et al., 2010).

The small variation seen between the results produced by the two packages could be due to

the choice of settings used before performing the analysis.

In conclusion, this study demonstrated that Pi-deficient Arabidopsis cell cultures were

responsive to Pi status. Physiologically, the responses were observed as changes in cell

growth. At the cellular level, changes in Pi utilisation and distribution to other P pools

were found correlated with transcriptional changes among various PHT gene family

members. Several PHT gene family members were repressed upon Pi-resupply, and the

kinetics of repression varied from gene to gene. Similarly, the induction of transcripts for

several Pi-responsive genes was gene dependent as Pi was depleted from the cells. Cells

seem to have experienced a severe stress condition during Pi deficiency as they switched

from aerobic respiration to aerobic lactic acid fermentation judged by some changes in

organic acids content. Most of these responses were similar to those in plants and

corroborates a variety of previous reports that Arabidopsis cell cultures are an excellent

model system to understand general plant responses to Pi deficiency.


Plant Materials

Arabidopsis thaliana accession Landsberg erecta cell suspension cultures (May and

Leaver, 1993) were maintained in Murashige and Skoog (MS) basal medium (Phytotechlab,

Shawnee Mission, KS USA) by weekly subculturing with the addition of 3 % (w/v)

sucrose, 0.5 mg/L naphthalene acetic acid (NAA) and 0.05 mg/L kinetin (Murashige and

Skoog, 1962). For various Pi treatments, 250 mM filter sterilised KH2PO4 was added to the

medium to the required final concentration. The pH was adjusted to 5.8 using 1 M KOH.

For subculturing, 27 ml of a 7-day-old culture were transferred into 100 ml fresh MS basal

medium in a 250 ml Erlenmeyer flask under sterile conditions. Cells were grown under

continuous light at 22 oC with shaking at 140 rpm and harvested by vacuum filtration. Cells

were stored in -80 oC for analysis.

96

Inorganic phosphate assay

Pi was determined using an ascorbic acid-ammonium molybdate method (Bruce N, 1966).

Approximately 50 mg fresh cells were frozen in liquid nitrogen prior to the addition of 500

µl of 1 % (v/v) acetic acid. Cells were homogenised three times at 5000 rpm for 45 s in a

cell homogeniser (PrecellysR 24, Bertin Technologies, Montigny-le-Bretonneux, France).

The samples were placed on ice for 30 min and subjected to centrifugation at 16, 000 x g

for 15 min at 4 oC. The supernatant was transferred to a fresh tube and further clarified by

centrifugation at the same conditions. For the assay, 90 µl of the sample was added to 210

µl test solution (mixture of six parts 0.42 % ammonium molybdate in 1 N H2SO4 and one

part 10 % ascorbic acid in water). The mixture was incubated at 37 oC for 1 h. The samples

were prepared in a 96 well plate and the OD820 was measured (Thermo Multiskan Spectrum

spectrophotometer, Thermo Scientific, Vantaa, Findland).

Total phosphorus measurement

For total P measurement, 3 ml nitric acid (HNO3) was added to a known oven-dried mass

of Arabidopsis tissues in a 50 ml Erlenmeyer flask. A first digestion was performed by

heating 10 min at 100 oC. The samples were allowed to cool to room temperature and 1 ml

perchloric acid (HClO4) was added. The digestion was continued at 140-150 oC until the

vigorous reaction between HClO4 and organic residues was completed. The temperature

was raised to 170-180 oC and samples were heated for 10 min to dissolve the silica. The

digested samples were allowed to cool to room temperature before 3 ml water was added

and warmed to dissolve any KClO4 crystals. The solution was transferred to a plastic vial,

brought up to 10 ml with water. The sample was assayed for total P using a malachite green

method (Vanveldhoven and Mannaerts, 1987) in a 96-well format. The absorbance was

measured at OD630 (Thermo Multiskan Spectrum spectrophotometer, Thermo Scientific,

Vantaa, Findland).

Sucrose assay

Sucrose in the medium was assayed as described previously (Stepan-Sarkissian and Grey,

1990). 30 % (w/v) KOH was added to the samples, mixed well and placed in boiling water

97

bath for 10 min and cooled to room temperature. 3 ml of anthrone reagent was added and

the mixture was placed in 40 o

C water bath for 20 min. The absorbance at 620 nm was

recorded (UVmini-1240 UV-VIS spectrophotometer, Shimatzu Scientific Instruments,

Sydney, Australia).

mRNA preparation

Messenger RNA was isolated from cells using magnetic beads coated with oligo-dT (Jost et

al., 2007). About 70 mg Arabidopsis thaliana cells were lysed in lysis buffer (100 mM Tris,

500 mM LiCl, 10 mM EDTA, 1 % LiDS, 5 mM DTT) and incubated at room temperature

for 10 min. Samples were subjected to three cycles of homogenisation at 5000 rpm, 45 s

each, in a cell homogeniser (PrecellysR 24, Bertin Technologies, Montigny-le-Bretonneux,

France) before centrifugation for 10 min, 12,000 x g at 15 oC. The supernatant was

transferred to a new tube and further clarified by 5 min centrifugation at 12, 000 x g. In the

meantime, 10 µl of oligo-dT magnetic beads (Dynabeads® Oligo(dT)25, Invitrogen Dynal

AS, Oslo, Norway) were transferred into PCR tubes. The beads were washed twice with

lysis buffer and the supernatant was removed after each wash by magnetic separation

(Dynal® MPC-9600 Magnetic Particle Concentrator, Invitrogen Dynal AS, Oslo, Norway).

To the washed beads, 240 µl of the clarified cellular extract was added. Mixtures were

incubated at room temperature for 10 min to allow annealing of poly-A+ RNA to the beads.

The supernatant was removed after magnetic bead separation. The beads were washed

twice with washing buffer (10 mM Tris, 150 mM LiCl, 1 mM EDTA, 0.1 % LiDS), twice

with washing buffer lacking LiDS, and twice with ice-cold 1X RT buffer (50 mM Tris, 50

mM KCl, 10 mM MgCl2 x 6H2O, pH 8.3, 0.1 mM DTT). RNA was eluted from the beads

by incubating 5 min at 70 oC in 10 µl RT buffer, and chilled on ice prior to adding 10 µl 2x

RT mix (5x RT buffer (Bioline Aust Pty Ltd, New South Wales, Australia) 100 mM DTT,

dNTP-mix (40 mM each), RNasin (40 U/ µl) (Bioline Aust Pty Ltd, New South Wales,

Australia), MLV reverse ranscriptase (200 U/ µl) (Bioline Aust Pty Ltd, New South Wales,

Australia), DEPC-ddH2O). Samples were incubated at 42 oC

for 90 min. The cDNA on the

beads was washed twice with 1 X RT buffer. The mRNA was eluted by incubating the

beads in 25 µl elution buffer (2 mM EDTA, 10 mM Tris-HCl pH 8) for 10 min at 95 oC,

before chilling on ice for 1 min. The supernatant containing the mRNA was quickly

removed after magnetic separation and stored in a new tube. The RNA recovery was

98

measured using a spectrophotometer (ND-1000 UV-Vis Spectrophotometer, NanoDrop

Technologies, Wilmingon, DE, USA). The cDNA yield was assumed to be equivalent to

the mRNA eluted from the beads and was adjusted to 2 ng µl-1

by adding sterile distilled

water to the beads. The cDNA was stored in -80 oC.

Quantitative Real-Time Polymerase Chain Reaction

Primers for members of the PHT gene family, primary miRNA399 and PHO2 were

designed (Appendix 1; DNASTAR software, DNASTAR Inc, Madison Wisconsin, USA).

For qRT PCR, 2.5 µl cDNA diluted 1:10 with sterile distilled water was added to 2.5 µl

primer mix (1.2 µM each) and 5 µl real-time master mix (Power SYBR® Green PCR

Master Mix, Applied Biosystem, Foster City, CA, USA). The reaction was performed

(7500- Fast Real-Time PCR System Applied Biosystems, Scoresby, Victoria, Australia) by

40 X cycling at 2 min at 50 oC, 10 min at 95

oC, 15 min at 95

oC and 1 min at 60

oC.

Sample extraction, derivatisation and gas chromatoghraphy mass spectrometry (GC-

MS) analysis

Metabolites were extracted and derivatised using a protocol adapted from (Roessner-Tunali

et al., 2003). Approximately 30 mg fresh weight of Arabidopsis cells were extracted in 500

µl 20: 2:1 HPLC grade methanol: water: ribitol. Samples were incubated on a thermomixer

at 75 oC

with 1200 rpm for 20 min prior to centrifugation at 16,000 x g, 3 min, at 20

oC. A

100 µl aliquot of the supernatant was dried down for 1 h under vacuum (Labcon co, Kansas

City, MO, USA). For automated derivatisation and GC-MS run, 20 µl pyridine was added

to the dried sample, the sample was incubated at 65 oC, 750 rpm for 1 h (Agilent 5975C

inert XL MSD with Triple-Axis Detector, Forest Hill, VIC, Australia) before 30 µl N-

,methyl-N-(tri-methylsilyl) trifluoroacetamide (Derivatisation grade, Sigma) was added and

the samples was incubated at room temperature for a further 30 min.

For GC-MS run, 1 µl of derivatized sample was injected into the front inlet splitless

injector at 300 oC initial temperature, 9.13 psi pressure and 9.9 ml min

-1 purge flow, with

helium carrier gas with a constant flow of 1.0 ml min-1

(Capillary column Factor 4, Varian

Inc, Blackburn, VIC, Australia). The GC column oven was held at 70 oC initial

99

temperature for 1 min. The temperature was increased to 76 oC

at 1

oC

min

-1, followed by

325 oC at 6

oC

min

-1 in before being held for 8 min. Mass selective detector (MSD) transfer

line heater was used with initial temperature of 250 oC. For the mass spectrometry (MS),

the scan acquisition mode was used. The MS source temperature was 230 oC

and MS Quad

temperature was 150 oC. The solvent delay time was 8 min and the relative electron

multiplier voltage (EMV) mode was used. The low mass was 50 amu and the high mass

was 600 amu. The GC-MS analysis was conducted at Metabolomics Australia, The

University of Western Australia.

Statistical analysis of GC-MS data

With two biological replicates and at least three technical replicates of each samples, the

raw GC-MS data obtained were processed and the statistical analysis was performed using

AMDIS (http://chemdata.nist.gov/mass-spc-amdis) and METABOLOME-EXPRESS

software (version 1.0, http://www.metabolome-express.org) (Carroll et al., 2010).

References

Abel S (2011) Phosphate sensing in root development. Current Opinion in Plant Biology

14: 303-309

Abel S, Ticconi CA, Delatorre CA (2002) Phosphate sensing in higher plants. Physiologia

Plantarum 115: 1-8

Aung K, Lin SI, Wu CC, Huang YT, Su CL, Chiou TJ (2006) pho2, a phosphate



Bates TR, Lynch JP (2001) Root hairs confer a competitive advantage under low

phosphorus availability. Plant and Soil 236: 243-250

Bieleski RL (1973) Phosphate pools, phosphate transport, and phosphate availability.

Annual Review of Plant Physiology 24: 225-252

Bouché N, Fromm H (2004) GABA in plants: just a metabolite? Trends in Plant Science

9: 110-115

Bozzo GG, Dunn EL, Plaxton WC (2006) Differential synthesis of phosphate-starvation

inducible purple acid phosphatase isozymes in tomato (Lycopersicon esculentum)

suspension cells and seedlings. Plant Cell and Environment 29: 303-313

Bozzo GG, Raghothama KG, Plaxton WC (2002) Purification and characterization of

two secreted purple acid phosphatase isozymes from phosphate-starved tomato

(Lycopersicon esculentum) cell cultures. European Journal of Biochemistry 269:

6278-6286

100

Bozzo GG, Raghothama KG, Plaxton WC (2004) Structural and kinetic properties of a

novel purple acid phosphatase from phosphate-starved tomato (Lycopersicon

esculentum) cell cultures. Biochemical Journal 377: 419-428

Bruce N A (1966) [10] Assay of inorganic phosphate, total phosphate and phosphatases. In

VG Elizabeth F. Neufeld, ed, Methods in Enzymology, Vol Volume 8. Academic

Press, pp 115-118

Carroll AJ, Badger MR, Millar AH (2010) The MetabolomeExpress Project: enabling

web-based processing, analysis and transparent dissemination of GC/MS

metabolomics datasets. BMC Bioinformatics 11:376-388



67-74

Cheng L, Bucciarelli B, Shen J, Allan D, Vance CP (2011) Update on white lupin cluster

root acclimation to phosphorus deficiency update on lupin cluster roots. Plant


Chiou TJ, Aung K, Lin SI, Wu CC, Chiang SF, Su CL (2006) Regulation of phosphate

homeostasis by microRNA in Arabidopsis. Plant Cell 18: 412-421

Chiou TJ, Lin SI (2011) Signaling network in sensing phosphate availability in plants. In

SS Merchant, WR Briggs, D Ort, eds, Annual Review of Plant Biology, Vol 62, Vol

62. Annual Reviews, Palo Alto, pp 185-206

Ciereszko I, Barbachowska A (2000) Sucrose metabolism in leaves and roots of bean

(Phaseolus vulgaris L.) during phosphate deficiency. Plant Physiology 156: 640-644

Ciereszko I, Janonis A, Kociakowska M (2002) Growth and metabolism of cucumber in

phosphate-deficient conditions. Plant Nutrition 25: 1115-1127

Daram P, Brunner S, Rausch C, Steiner C, Amrhein N, Bucher M (1999) Pht2;1

encodes a low-affinity phosphate transporter from Arabidopsis. The Plant Cell

Online 11: 2153-2166

Dong B, Ryan PR, Rengel Z, Delhaize E (1999) Phosphate uptake in Arabidopsis

thaliana: dependence of uptake on the expression of transporter genes and internal

phosphate concentrations. Plant Cell and Environment 22: 1455-1461

Dong D, Peng X, Yan X (2004) Organic acid exudation induced by phosphorus deficiency

and/or aluminium toxicity in two contrasting soybean genotypes. Physiologia

Plantarum 122: 190-199

Duan, K., Yi, K., Dang, L., Huang, H., Wu, W. and Wu, P. (2008) Characterization of a

sub-family of Arabidopsis genes with the SPX domain reveals their diverse

functions in plant tolerance to phosphorus starvation. Plant J. 54, 965–975.

Duff SMG, Lefebvre DD, Plaxton WC (1989) Purification and characterization of a

phosphoenolpyruvate phosphatase from Brassica nigra suspension cells. Plant



inducible `bypasses' of adenylate and phosphate dependent glycolytic enzymes in

Brassica nigra suspension cells. Plant Physiology 90: 1275-1278

Fujii H, Chiou TJ, Lin SI, Aung K, Zhu JK (2005) A miRNA involved in phosphate-

starvation response in Arabidopsis. Current Biology 15: 2038-2043

Gregory AL, Hurley BA, Tran HT, Valentine AJ, She YM, Knowles VL, Plaxton WC (2009) In vivo regulatory phosphorylation of the phosphoenolpyruvate carboxylase

AtPPC1 in phosphate-starved Arabidopsis thaliana. Biochemical Journal 420:57-65

Hammond JP, Broadley MR, White PJ (2004) Genetic responses to phosphorus

deficiency. Annals of Botany 94: 323-332

101

Hayashibe M (1957) Alcoholic fermentation by intact cells of bakers yeast.1.Inhibition of

fermentation by phosphate. Biochemistry 44: 543-556

Hernandez G, Ramirez M, Valdes-Lopez O, Tesfaye M, Graham MA, Czechowski T,

Schlereth A, Wandrey M, Erban A, Cheung F, Wu HC, Lara M, Town CD,

Kopka J, Udvardi MK, Vance CP (2007) Phosphorus stress in common bean:

Root transcript and metabolic responses. Plant Physiology 144: 752-767

Huang CY, Roessner U, Eickmeier I, Genc Y, Callahan DL, Shirley N, Langridge P,

Bacic A (2008) Metabolite profiling reveals distinct changes in carbon and nitrogen

metabolism in phosphate-deficient barley plants (Hordeum vulgare L.). Plant and

Cell Physiology 49: 691-703

Johnson JF, Allan DL, Vance CP, Weiblen G (1996) Root carbon dioxide fixation by

phosphorus-deficient Lupinus albus - Contribution to organic acid exudation by

proteoid roots. Plant Physiology 112: 19-30

Jost R, Berkowitz O, Masle J (2007) Magnetic quantitative reverse transcription PCR: A

high-throughput method for mRNA extraction and quantitative reverse transcription

PCR. Biotechniques 43: 206-211

Juszczuk I, Malusà E, Rychter AM (2001) Oxidative stress during phosphate deficiency

in roots of bean plants (Phaseolus vulgaris L.). Plant Physiology 158: 1299-1305

Klosinska MM, Crutchfield CA, Bradley PH, Rabinowitz JD, Broach JR (2011) Yeast

cells can access distinct quiescent states. Genes and Development 25: 336-349

Lefebvre DD, Duff SMG, Fife CA, Julien-Inalsingh C, Plaxton WC (1990) Response to

phosphate deprivation in Brassica nigra suspension cells : Enhancement of

intracellular, cell surface, and secreted phosphatase activities compared to increases

in Pi-absorption rate. Plant Physiology 93: 504-511

Lei M, Liu Y, Zhang B, Zhao Y, Wang X, Zhou Y, Raghothama KG, Liu D (2011)

Genetic and genomic evidence that sucrose is a global regulator of plant responses

to phosphate starvation in Arabidopsis. Plant Physiology 156: 1116-1130

Li LH, Qiu XH, Li XH, Wang SP, Zhang QF, Lian XM (2010) Transcriptomic analysis

of rice responses to low phosphorus stress. Chinese Science Bulletin 55: 251-258

Lin S-I, Chiou T-J (2008) Long-distance movement and differential targeting of

microRNA399s. Plant Signaling and Behaviour 3: 730-732

Lin WY, Lin SI, Chiou TJ (2009) Molecular regulators of phosphate homeostasis in

plants. Experimental Botany 60: 1427-1438

Liu J, Vance CP (2010) Crucial roles of sucrose and microRNA399 in systemic signaling

of P deficiency: a tale of two team players? Plant signaling and Behavior 5: 1556-

1560

Liu JQ, Samac DA, Bucciarelli B, Allan DL, Vance CP (2005) Signaling of phosphorus

deficiency-induced gene expression in white lupin requires sugar and phloem

transport. Plant Journal 41: 257-268

Lynch JP, Brown KM (2008) Root strategies for phosphorus acquisition. The

Ecophysiology of Plant-Phosphorus Interactions. In PJ White, JP Hammond, eds,

Vol 7. Springer Netherlands, pp 83-116


thaliana suspension cultures. Plant Physiology 103: 621-627

Milani G, Jarmuszkiewicz W, Sluse-Goffart CM, Schreiber AZ, Vercesi AE, Sluse FE (2001) Respiratory chain network in mitochondria of Candida parapsilosis: ADP/O

appraisal of the multiple electron pathways. FEBS Letters 508: 231-235

102

Mimura T, Sakano K, Shimmen T (1996) Studies on the distribution, re-translocation and

homeostasis of inorganic phosphate in barley leaves. Plant, Cell and Environment

19: 311-320






of America 102: 11934-11939

Misson J, Thibaud M-C, Bechtold N, Raghothama K, Nussaume L (2004)

Transcriptional regulation and functional properties of Arabidopsis Pht1;4, a high

affinity transporter contributing greatly to phosphate uptake in phosphate deprived

plants. Plant Molecular Biology 55: 727-741

Morcuende R, Bari R, Gibon Y, Zheng WM, Pant BD, Blasing O, Usadel B,

Czechowski T, Udvardi MK, Stitt M, Scheible WR (2007) Genome-wide


to phosphorus. Plant Cell and Environment 30: 85-112

Muchhal US, Pardo JM, Raghothama KG (1996) Phosphate transporters from the higher

plant Arabidopsis thaliana. Proceedings of the National Academy of Sciences 93:

10519-10523

Mudge SR, Rae AL, Diatloff E, Smith FW (2002) Expression analysis suggests novel

roles for members of the Pht1 family of phosphate transporters in Arabidopsis. Plant

Journal 31: 341-353

Müller R, Morant M, Jarmer H, Nilsson L, Nielsen TH (2007) Genome-wide analysis of

the Arabidopsis leaf transcriptome reveals interaction of phosphate and sugar

metabolism. Plant Physiology 143: 156-171

Murashige T, Skoog F (1962) A revised medium for rapid growth and bio-assays with

tobacco tissue cultures. Physiologia Plantarum 15: 473-497

Nagano M, Ashihara H (1993) Long-term phosphate starvation and respiratory

metabolism in suspension-cultured Catharanthus roseus cells. Plant and Cell


Neumann G, Romheld V (1999) Root excretion of carboxylic acids and protons in

phosphorus-deficient plants. Plant and Soil 211: 121-130

Okumura S, Mitsukawa N, Shirano Y, Shibata D (1998) Phosphate transporter gene

family of Arabidopsis thaliana. DNA Research 5: 261-269

Oshima Y (1997) The phosphatase system in Saccharomyces cerevisiae. Genes and

Genetic Systems 72: 323-334

Plaxton W, Podest, Florencio (2006) The Functional organization and control of plant

respiration. Critical Reviews in Plant Sciences 25: 159-198

Plaxton WC (1996) The organization and regulation of plant glycolysis. Annual Review of

Plant Physiology and Plant Molecular Biology 47: 185-214



Raghothama K, Karthikeyan A (2005) Phosphate acquisition root physiology: from Gene

to Function. In H Lambers, T Colmer, eds, Vol 4. Springer Netherlands, pp 37-49

Raghothama KG (1999) Phosphate acquisition. Annual Review of Plant Physiology and

Plant Molecular Biology 50: 665-693

103

Rausch C, Zimmermann P, Amrhein N, Bucher M (2004) Expression analysis suggests

novel roles for the plastidic phosphate transporter Pht2;1 in auto- and heterotrophic

tissues in potato and Arabidopsis. Plant Journal 39: 13-28

Robinson D (1994) The responses of plants to non uniform supplies of nutrients. New

Phytologist 127: 635-674

Roessner-Tunali U, Hegemann B, Lytovchenko A, Carrari F, Bruedigam C, Granot

D, Fernie AR (2003) Metabolic profiling of transgenic tomato plants

overexpressing hexokinase reveals that the influence of hexose phosphorylation

diminishes during fruit development. Plant Physiology 133: 84-99

Rychter AM, Randall DD (1994) The effect of phosphate deficiency on carbohydrate

metabolism in bean roots. Physiologia Plantarum 91: 383-388

Shen H, Yan XL, Zhao M, Zheng SL, Wang XR (2002) Exudation of organic acids in

common bean as related to mobilization of aluminum- and iron-bound phosphates.

Environmental and Experimental Botany 48: 1-9

Shimaoka T, Ohnishi M, Sazuka T, Mitsuhashi N, Hara-Nishimura I, Shimazaki K-I,

Maeshima M, Yokota A, Tomizawa K-I, Mimura T (2004) Isolation of intact

vacuoles and proteomic analysis of tonoplast from suspension-cultured cells of

Arabidopsis thaliana. Plant and Cell Physiology 45: 672-683

Shin H, Shin H-S, Dewbre GR, Harrison MJ (2004) Phosphate transport in Arabidopsis:

Pht1;1 and Pht1;4 play a major role in phosphate acquisition from both low- and

high-phosphate environments. Plant Journal 39: 629-642



Stepan-Sarkissian G, Grey D (1990) Growth Determination and Medium Analysis Plant

Cell and Tissue Culture. In JW Pollard, JM Walker, eds, Vol 6. Humana Press, pp

13-27

Takabatake R, Hata S, Taniguchi M, Kouchi H, Sugiyama T, Izui K (1999) Isolation

and characterization of cDNAs encoding mitochondrial phosphate transporters in

soybean, maize, rice, and Arabidopsis. Plant Molecular Biology 40: 479-486

Uhde-Stone C, Zinn KE, Ramirez-Yáñez M, Li A, Vance CP, Allan DL (2003) Nylon

filter arrays reveal differential gene expression in proteoid roots of white lupin in

response to phosphorus deficiency. Plant Physiology 131: 1064-1079

Vance CP, Uhde-Stone C, Allan DL (2003) Phosphorus acquisition and use: critical

adaptations by plants for securing a nonrenewable resource. New Phytologist 157:

423-447

Vanveldhoven PP, Mannaerts GP (1987) Inorganic and organic phosphate measurements

in the nanomolar range. Analytical Biochemistry 161: 45-48





Vershinina OA, Znamenskaya LV (2002) The Pho regulons of bacteria. Microbiology

71: 497-511

Vijayraghavan V, Soole K (2010) Effect of short- and long-term phosphate stress on the

non-phosphorylating pathway of mitochondrial electron transport in Arabidopsis

thaliana. Functional Plant Biology 37: 455-466

104

Wasaki J, Yonetani R, Kuroda S, Shinano T, Yazaki J, Fujii F, Shimbo K, Yamamoto

K, Sakata K, Sasaki T, Kishimoto N, Kikuchi S, Yamagishi M, Osaki M (2003)

Transcriptomic analysis of metabolic changes by phosphorus stress in rice plant

roots. Plant Cell and Environment 26: 1515-1523

Williamson LC, Ribrioux S, Fitter AH, Leyser HMO (2001) Phosphate availability

regulates root system architecture in Arabidopsis. Plant Physiology 126: 875-882

Wu P, Ma L, Hou X, Wang M, Wu Y, Liu F, Deng XW (2003) Phosphate Starvation

Triggers Distinct Alterations of Genome Expression in Arabidopsis Roots and

Leaves. Plant Physiology 132: 1260-1271

105

CHAPTER 4:

Arabidopsis thaliana cells in suspension cultures alter their

physiological, transcripts and metabolites responses under

phosphite stress

106

Abstract

Phosphite (Phi) is widely used as a fungicide to combat oomycete pathogens. Being an

analog of phosphate (Pi), Phi disturbs Pi-starvation responses in plants. The mechanism of

plant responses towards Phi treatment at the transcript and metabolite levels are not well

characterised. Using Arabidopsis cell suspension cultures as a model system, detrimental

effects of Phi were clearly seen in Pi-depleted cells. Phi perturbed the growth of Pi-depleted

cells by reducing cell biomass. At high Phi supply rates, the cell colour changed from

yellow to whitish or brownish and irregular-shaped cell structures were detected during

viability staining. Distinct accumulation patterns of Pi, organic phosphorus (Po) and Phi

inside the cells were found in Pi-containing and Pi-deficient medium containing Phi. In Pi-

deficient medium, a higher amount of Pi was found inside Phi treated cells compared to the

non-Phi treated cells. Once the cells were subcultured into fresh medium containing Phi, Pi-

deficient cells took up more Phi into the cells. The amount of Phi inside the cells then

reduced to about the same concentration as Pi-sufficient cells. At the transcript level, the

induction of several PHT gene family members during Pi depletion was more pronounced

during Phi treatment. Metabolite profiling revealed that the amounts of sugars, some

organic acids and some amino acids were largely decreased by the presence of Phi in Pi-

deficient cells compared to the absence of Phi. In the absence of Phi, cells rapidly took up

Pi within a day after sub-culturing into fresh media, similar to the cells treated with Phi. Phi

in the medium did not affect the Pi concentration inside the cells, although Phi was also

taken up by the cells. The abundance of PHT gene family transcripts and the metabolites

detected in Pi-sufficient cells did not change significantly in the presence of Phi. In

conclusion, Phi affected Pi-deficient cells, but not Pi-sufficient cells, at the physiological,

transcript and metabolite levels.

107

Introduction

Phosphite (Phi) is a reduced form of phosphorus (P) and an analogue of phosphate (Pi). Phi

has been widely used as a fungicide to increase plant resistance towards oomycetes (Fenn

and Coffey, 1984; Guest and Grant, 1991). It is also claimed to be a source of P fertiliser

and probably suppresses parasitic and pathogenic soil microbes. However, the idea that Phi

is a P fertiliser has become a controversial issue. This is because Phi negatively effects

growth of Pi-deficient plants. In plants with low Pi status, the ability of Phi to mimic Pi

causes plants to react as if they had sufficient Pi. Plants will not establish Pi starvation

responses as they should, and this finally disrupts the whole plant system (Carswell et al.,

1997). Furthermore, although Phi can be oxidised to Pi by bacteria, this process is very

slow (Ohtake et al., 1996) and it is likely not to aid plant growth through Pi fertilisation in

the short term. There is no evidence that plants can metabolise Phi, which means that the

detrimental effects of Phi are retained in plant cells for a long time (Barrett et al., 2004).

Knowledge of the molecular response of plants to Phi treatment is limited. Due to their

analogous properties, both Pi and Phi are transported via Pi transporters (Varadarajan et al.,

2002) encoded by the PHT gene family members (Okumura et al., 1998). Some PHT genes

are part of the Pi-starvation response, which when induced, the encoded proteins move Phi

into the plant, and probably from cell to cell and into intracellular compartments. At the

transcript level, Phi seems to impede plant responses towards Pi deprivation by suppressing

the induction of Pi-starvation inducible genes (Ticconi et al., 2001; Varadarajan et al.,

2002).

The growth of several plant species treated with Phi has been examined. In most cases, Phi

did not give any benefit in improving plant growth and yield (Thao and Yamakawa, 2009).

In fact, Phi can be toxic to Pi-depleted plants (Ticconi et al., 2001). The effects of Phi on

plant metabolism are largely unknown, except Phi has the capacity to boost plant responses

towards pathogens (Eshraghi et al., 2011). The metabolic changes caused by Phi treatment

are better known in phytophthora (Niere et al., 1994) where the main target of Phi is the

inhibition of protein phosphorylation (Carswell et al., 1997). Phytophthora metabolism was

affected beginning at an early stage of growth, with changes in the composition of lipids,

108

water-soluble metabolites, macromolecules and cell wall fractions (Dunstan et al., 1990). In

yeast, several enzymes in the glycolytic and phosphogluconate pathways were inhibited by

Phi (Stehmann and Grant, 2000).

The ability of Arabidopsis suspension cells to mimic plant responses to low Pi status

(Chapter 3) makes it a good system to study the effects of Phi on plant cells. In this chapter,

the effects of Phi on Arabidopsis cells grown in culture were investigated at the

physiological and molecular levels, with special focus on changes to the transcript

abundance profiles of the PHT gene family members, and the metabolite profiles of cells.

These analyses gave insight into the responses of plants that occur upon Phi exposure.

Results

Concentration-dependent Phi toxicity for Arabidopsis suspension cells grown in culture

The amount of Phi that is non-toxic, yet prompts responses in Arabidopsis suspension cells

was investigated. Cells grown for 7 days in media initially containing 1 mM Pi have

completely depleted the external Pi supply (Chapter 3). These cells were re-supplied with

an initial concentration of 4 mM Pi in fresh media and various concentrations of Phi.

Previously, cells cultured in this way in the absence of Phi were found to be able to

continue growth for 14 days, but cell growth then ceased, presumably because the P status

of the cells dropped below the point that can sustain growth (Chapter 3).

In the current experiment, cell growth was monitored for 3 weeks with subculturing into

media lacking both Pi and Phi every 7 days. The exposure of Arabidopsis cells to Phi did

not influence the cell appearance at day 7 (Figure 4.1). For initial Phi concentrations lower

than 8 mM, culture biomass accumulated to about the same level as for cultures without Phi

treatment (Figure 4.2). By day 14, initial Phi supplies of 2 mM or more had altered cell

appearance. This could be seen as a change of colour of the cultures. Except for cells

initially supplied with 1 mM Phi, the symptoms of apparent toxicity became stronger

during the third week of Phi treatment (Figure 4.1). A fluorescent dye uptake assay that

assesses cell viability, however, did not detect significant cell death during the experiment.

In this assay, live cells would fluoresce green while dead cells would fluoresce red. Almost

109

100 % cells were visible in green, and whenever the colour of the cells in culture changed,

irregularly-shaped structures were observed under the microscope (Figure 4.1C). At day 14,

the accumulated biomass of cells supplied with Phi decreased as the concentration of Phi

increased. Although further biomass reduction was expected for all cells at day 21 due to

inability of cells to grow under Phi toxicity (based on the structure of the cells observed), a

higher amount of ‘biomass’ was obtained for cells supplied with 8 mM Phi. Loss of

biomass after 21 days in control cultures was expected due to Pi depletion. From the

changes of cell appearance, the production of unknown compounds might have contributed

to the apparent increase in ‘biomass’.

A

0 mM

Phi

4 mM

Phi

0.93/*0.79

hFructose

0.97/*0.79

iAMDIS/M

E

2mM

Phi

8 mM

Phi 1 mM

Phi

0 mM Phi 4 mM Phi 2 mM Phi 8 mM Phi 1 mM Phi

110

B

C

Figure 4.1 High Phi concentration altered the physical appearance of Arabidopsis

suspension cells. At day 0, 7-day-old Arabidopsis cells were subcultured into fresh MS

media to give 4 mM as the final Pi concentration, and the indicated concentrations of Phi.

Cells were subcultured into fresh media lacking both Pi and Phi at day 7 and again at day

14. Culture (top panel) and cell appearance (bottom panel) after A) 7 days, B) 14 days and

C) 21 days of growth. Arrows indicate the flasks where the colour of the cells had changed

0 mM

Phi

4 mM

Phi

2 mM

Phi

8 mM

Phi 1 mM

Phi

0 mM

Phi

4 mM

Phi

2 mM

Phi

8 mM

Phi 1 mM

Phi



111

0

2

4

6

8

10

12

14

16


Treatment

Fre

sh

we

igh

t (g

. fla

sk

-1)

Day 7 Day 14 Day 21

visibly. The bottom panel of each figure shows the corresponding cells after viability

staining using fluorescent diacetate and propidium iodide.

Figure 4.2 Estimation of the effect of Pi and Phi on the growth of Arabidopsis suspension

cells. Using the cultures shown in Figure 4.1, cell fresh weight was determined (n= cells

from 1 flask). Red arrows indicate cultures with cells that had abnormal colour.

Phi compromised the growth of Pi-depleted Arabidopsis cells

From the experiments in Chapter 3, an initial supply of 4 mM Pi was found to be enough to

saturate the cells with Pi. The results above showed that 1 mM Phi did not cause visible

toxicity, while 2 mM Phi was moderately toxic to cells after 14 days. Thus, a detailed

analysis of the effects moderate Phi on Pi-replete cells was done. Arabidopsis suspension

cells were initially supplied with 4 mM Pi and either 1 mM or 2 mM Phi. The growth was

determined every two days until day 9 (Figure 4.3). Cells in all treatments including the

minus-Phi control cultures went through a three-day lag phase before the biomass showed a

gradual increase. There was no significant difference in cell fresh weight for the different

treatments at day 9 (Figure 4.3).

112

Figure 4.3 Time course of Phi effects on growth of Pi-replete Arabidopsis suspension cells.

At day 0, 7-day-old Arabidopsis cells were subcultured into fresh media to get 4 mM Pi as

the final concentration. Phi was supplied to a final concentration of 0, 1 or 2 mM Phi. Cell

growth was determined every 2 days over a 9 day period by weighing cell mass. Arrow

indicates the initial cell fresh weight and day of subculture. Values are mean + SE (n=3


data points.

The effects of Phi on Pi-depleted cells were then investigated. Cells depleted of Pi by

growth for 7 days in medium initially containing 1 mM Pi were re-supplied with 4 mM Pi

without Phi, and grown for 7 days before being subcultured into fresh media lacking Pi but

supplemented with Phi. In absence of Phi, cells cultured on 4 mM Pi have enough Pi stores

to sustain growth for another 6 days after subculturing (Figure 4.4). However, Phi inhibits

this further growth that relies on the internal P pool. At day 11, cells without Phi treatment

have 3.3 g additional fresh weight, but cells treated with 1 mM Phi and 2 mM Phi have only

0.1 g and 0.5 g additional fresh weight, respectively. Previously, the inability of Pi deprived

Brassica napus and Lycopersicon esculentum (tomato) cells to grow in suspension culture

in the presence of low Phi concentration was reported (Carswell et al., 1997; Bozzo et al.,

2004).

0

5

10

15

20

1 3 5 7 9

Day

Fre

sh w

eig

ht

(g.

flas

k-1

)

0 mM Phi 1mM Phi 2 mM Phi

113

0

2

4

6

8

10

12

14

9 11 13 15 17 19 21

Day

Fre

sh w

eig

ht

(g.f

lask

-1)

0 mM Phi 1 mM Phi 2 mM Phi

Figure 4.4 Growth of Arabidopsis suspension cells depleted of Pi were inhibited by Phi.

Cells grown in 4 mM Pi for 7 days were subcultured into medium without Pi containing

either 1 mM or 2 mM Phi. The fresh weight was determined every 2 days. At day 14, cells

were subcultured into fresh medium lacking both Pi and Phi. Values are mean + SE (n=3


data points. Significant differences (*) between Phi treatment and the control culture (0 Phi)

at the same time point were determined by a t-test (p<0.05).

P pools in Arabidopsis cells changed with Phi treatment

Pi was rapidly taken up by the cells within a day of being transferred to fresh media

containing 4 mM Pi (Figure 4.5A), as shown in Chapter 3. Phi suppressed the size of the

internal Pi pool by about 20 % at day 1 for cells treated with 2 mM Phi, and by day 3 for

cells treated with 1 mM Phi. The Pi content inside the cells was depleted by day 3 to about

the same level for all the treatments and continued to decrease until day 7.

As the cells took up Pi with time, the available external Pi in the absence of Phi was

depleted from the initial supply of 4 mM by more than 70 % at day 1 (Figure 4.5B), as

observed in Chapter 3. Phi slowed the removal of Pi from the medium and the effect was

stronger for 2 mM Phi than for 1 mM Phi. As described in Chapter 3, the external Pi in the

cultures increased at day 3. At the times sampled, this increase in Pi in the medium was

highest for cells grown in medium containing 1 mM Phi. By day 5, the amount of Pi left in

* * * * *

* * * * * * * *

114

the medium had decreased and was largely depleted in all cultures by day 9. Thus, 1 mM

Phi slowed Pi removal and that 2 mM slowed Pi removal more than 1 mM Phi.

A)

0

20

40

60

80

100

1 3 5 7 9

Day

Pi in

sid

e t

he

ce

lls

(µ

mo

l. g

FW

1-))


B)

0

0.5

1

1.5

2

1 3 5 7 9

Day

Pi

left

in

med

ium

(m

M)


Figure 4.5 Effect of Phi treatment on Pi concentration inside Pi-sufficient Arabidopsis cells

(A) and Pi removed from the medium by Pi-sufficient Arabidopsis cells (B). Using the

cultures presented in Figure 4.3, the Pi concentrations inside the cells and left in the

medium were determined. Values are mean + SE (n=3 flasks). When not visible, the error

bars are too small to be seen outside the symbols for the data points. Significant differences

(*) between Phi treatment and the control culture (0 Phi) at the same time points were

determined by a t-test (p<0.05).

*

* *

*

* * *

* * *

*

115

The Pi concentration inside cells after 7-days growth in 4 mM Pi decreased with time until

day 15, regardless of the presence of Phi (Figure 4.6A). The internal Pi concentration was

more than 50 % higher for cells treated with Phi than the control cells by day 11, at both

Phi supplies. There was a very small amount of Pi in the media that might have been

carried over from the cells and medium during subculturing. This Pi in the medium was

removed by the cells by day 15 and was then maintained at a low concentration from day

15 (Figure 4.6B). Cells treated with Phi took longer to use this residual Pi than the control

cells.

A)

0

2

4

6

8

9 11 13 15 17 19 21

Day

Pi i

ns

ide

th

e c

ells

(µ

mo

l. g

FW

-1)


B)

0

0.01

0.02

0.03

0.04

9 11 13 15 17 19 21

Day

Pi l

eft

in m

ediu

m (

mM

)


Figure 4.6 Effects of Phi treatment on the Pi concentration inside Pi-depleted Arabidopsis

cells (A) and Pi removed from the medium by Pi-depleted Arabidopsis cells (B). Using the

*

* * * *

* * * * * *

* *

116

cultures shown in Figure 4.4, the Pi concentration inside the cells and Pi concentration left

in the medium was determined. Values are mean + SE (n=3 flasks). When not visible, the

error bars are too small to be seen outside the symbols for the data points. Significant

differences (*) between Phi treatment and the control culture (0 Phi) at the same time points

were determined by a t-test (p<0.05).

Phi accumulated to a higher level in plants depleted of Pi

The accumulation of Phi inside treated cells and the amount left in the medium were

determined. The amount of Phi taken up by the cells was dependent on Pi. For cells

supplied with Pi at the start of their growth cycle (day 1 to day 7 in Figure 4.7A), exposure

to 2 mM Phi caused the cells to accumulate more than twice the Phi as cells treated with 1

mM Phi. Phi inside the cells was maximal at day 1 and stayed constant until day 7. Based

on the results of a t-test (p<0.05), Arabidopsis cells depleted of Pi for 7 days before adding

Phi (day 9 to day 15 in Figure 4.7A) did not differ in Phi content compared to cells supplied

with Pi and Phi simultaneously, except at day 9. In Pi-depleted cells, the Phi concentration

inside the cells was about the same for both 1 mM and 2 mM Phi treatments, except for day

15, where the amount of Phi inside the cells supplied with 2 mM Phi was twice that in cells

supplied with 1 mM Phi. Phi inside the cells decreased from day 9 to day 13, and continued

to decrease at day 15, one day after subculturing into fresh medium lacking both Pi and Phi.

The amount of Phi left in the medium was very low for all time points for cells initially

supplied 1 mM Phi, but fluctuated for cultures supplied with 2 mM Phi (Figure 4.7B).

117

A)

0

5

10

15

20

25

30

35

40

1 3 5 7 9 13 15

Day

Phi

insi

de th

e ce

lls(µ

mol

.g F

W-1

)

1 mM Phi 2 mM Phi

B)

0

0.2

0.4

0.6

0.8

1

1 3 5 7 9 13 15

Day

Ph

i le

ft i

n t

he m

ed

ium

(m

M)

1 mM Phi 2 mM Phi

Figure 4.7 Phi status in Pi-replete and Pi-depleted Arabidopsis suspension cells. Using the

cells from Figure 4.3 (cells harvested at day 1 to day 7) and Figure 4.4 (cells harvested at

day 9 to day 15), the amount of Phi inside the cells (A) and the amount of Phi left in the

medium (B) was determined. Arrow indicates the day of subculture. Values are mean + SE

(n=3 flasks). ND= not detected.

Total P was determined for cells treated with Phi. In the acid digests conducted to

determine total P, Phi was quantitatively converted to Pi, and thus Phi contributed to the

total P measured inside the cells.

ND ND ND ND ND ND ND ND

118

For cells supplied with Pi, P in the form of Pi was at the highest level inside the cells at day

1 (Figure 4.8A, B and C). Starting from day 3, more P was incorporated into the organic P

(Po) pool than was present in the Pi pool. Phi contributed less than 10 % of the total P in

cells treated with 1 mM Phi (Figure 4.8B) and 10 % to 20 % of the total P in cells treated

with 2 mM Phi (Figure 4.8C). As shown in Figure 4.7A, the more Phi that was supplied to

cells, the more Phi was taken into the cells. For cells depleted of Pi, Po was always the

largest P pool, followed by Phi and Pi inside the cells (Figure 4.8B and C).

A)

0

20

40

60

80

100

120

1 3 5 7 9 13 15

Day

P i

nsid

e t

he c

ell

s (

µm

ol.

g F

W-1

)

Pi Po

B)

0

20

40

60

80

100

120

1 3 5 7 9 13 15

Day

P i

nsid

e t

he c

ell

s (

µm

ol.

g F

W-1

)

Pi Phi Po

0 mM Phi

1 mM Phi

119

C)

0

20

40

60

80

100

120

1 3 5 7 9 13 15

Day

P in

sid

e t

he

ce

lls

(µ

mo

l. g

FW

-1)

Pi Phi Po

Figure 4.8 The P pools of Phi-treated Arabidopsis suspension cells with different P status.

Using the cells from the cultures described in the legend to Figure 4.7, total P inside the

cells was determined. The amount of Po was calculated by subtracting Pi and Phi from total

P. Values are mean + SE (n=3 flasks). When not visible, the error bars are too small to be

seen outside the symbols for the data points. The cells were cultured in the presence of 0

mM Phi (A), 1 mM Phi (B) or 2 mM Phi (C). The values for Pi are those shown in Figure

4.5A and 4.6A. The values for Phi are those shown in Figure 4.7A.

Several members of the PHT gene family from Pi-depleted Arabidopsis cells respond to Phi

When cells lacking Pi were re-supplied with 4 mM Pi, PHT1;1, and PHT1;4 transcript

amounts were significantly repressed. Transcript amounts from PHT1;2, PHT1;7,and

PHT3;2 were also probably repressed but the results did not pass the significance test

(Figure 4.9). PHT1;8 and PHT1;5 transcripts were only slightly repressed by Pi. The only

gene tested that was not repressed by added Pi was PHT1;9. The magnitude and timing of

these trends was the same as described in Chapter 3. At day 7, PHT1;2, PHT1;5 and

PHT3;2 transcripts were slightly more abundant in the Phi-treated cells compared to non-

Phi-treated cells. The kinetics of repression for PHT1;1, PHT1;2, PHT1;4, PHT1;5,

PHT1;7 PHT1;8 and PHT3;2 was not affected by 2 mM Phi, as the transcript amounts did

2 mM Phi

120

not differ from the non-Phi treated cells at either day 1 or 7 after the addition of Pi and Phi

together.

The transcripts for most of the PHT genes began to be induced at day 9. That is, after 9

days growth in media initially containing 4 mM Pi and 2 days growth in fresh medium

lacking added Pi. Again, these trends were similar to as those described in Chapter 3. For

some of the genes, the transcript abundance was significantly affected by Phi treatment. Phi

accelerates the induction of PHT1;1, PHT1;5, PHT1;8, PHT1;9, and PHT3;2 transcripts,

slows the induction of PHT1;2 and PHT1;7 transcripts and attenuates the induction of

PHT1;4 transcripts.

25

30

35

40

45

50

PHT1;1 PHT1;2 PHT1;4 PHT1;5

Gene

40

-De

lta

Ct

Day 0 Day1 (0 mM Phi) Day 1 (2 mM Phi) Day 7 (0 mM Phi) Day 7 (2 mM Phi) Day 9 (0 mM Phi) Day 9 (2 mM Phi) Day 13 (0 mM Phi) Day 13 (2 mM Phi)

25

30

35

40

45

50

PHT1;7 PHT1;8 PHT1;9 PHT3;2

Gene

40

-De

lta

Ct

Day 0 Day1 (0 mM Phi) Day 1 (2 mM Phi) Day 7 (0 mM Phi) Day 7 (2 mM Phi) Day 9 (0 mM Phi) Day 9 (2 mM Phi) Day 13 (0 mM Phi) Day 13 (2 mM Phi)

Figure 4.9 Response to Pi and Phi status of PHT gene family transcript profiles from

Arabidopsis suspension cells. The cells described in the legend to Figure 4.3, sampled at

day 0, day 1 and day 7, and in the legend to Figure 4.4, sampled at day 9 and day 13, were

used. mRNA was isolated and cDNAs were prepared and used for quantitative real time

*

*

* *

121

polymerase chain reaction (qRT-PCR) assays. The y-axis is a log2 scale, where each

increment is equal to a 2-fold difference in transcript abundance. Values are mean + SE

(n=3). Significant differences (*) between Phi treatment and the control culture (0 Phi) at

the indicated time point were determined by a t-test (p<0.05).

Phi lowered the amount of most of the metabolites detected inside Pi-depleted Arabidopsis

cells

The effect of Phi on metabolite profiles in Arabidopsis cells was determined by GC-MS

(Figure 4.10 and Figure 4.11). The GC-MS raw data was processes using AMDIS and ME

analysis packages. Using AMDIS, it was found that the amounts of sugars such as sucrose

and fructose, were decreased in Phi-treated cells compared to non-Phi treated cells, a day

after Pi was supplied. Most amino acids detected were lower in amount in the Phi-treated

cells, except for glycine and GABA, which were slightly more abundant. Most of the

organic acids detected were lower in amount as well, except for lactate and succinate. The

changes in these metabolite levels, however, were small (Figure 4.10).

The metabolite profile for cells grown for 7 days in media with an initial concentration of 4

mM Pi followed by transfer to fresh media containing 2 mM Phi but no Pi (day 9 cells) was

compared to the day 1 cells grown without Phi treatment. The day 9 cells were Pi-depleted

(Figure 4.5), and had been grown for 2 days in Phi-containing medium. With AMDIS, the

amount of sucrose and fructose were increased in Phi treated cells compared to the

untreated cells. The amino acids serine, valine, glycine and GABA were reduced in

amount, while isoleucine was somewhat higher in amount in the Phi treated cells than in the

untreated cells. The amounts of the detected organic acids, citrate, succinate, fumarate and

malate were significantly lower in Phi-treated cells (Figure 4.11).

With ME analysis, a similar trend was detected for most of these metabolites (Figures 4.10

and 4.11). Details on the ratios of the metabolite changes in Arabidopsis cells treated with

Phi analysed using AMDIS and ME are presented in Appendix 5 and 6, respectively.

122

Fructose

Alanine

Asparagine

Acetyl-coenzyme A

Glutamine

Citrate

Glucose

Glucose 6-phosphate



Lactate

Day 1 Phi / Day 1

from AMDIS

Phenylalanine

*0.80- 0.88

0.92

0.84

1.26

0.79Sucrose 0.93

0.97

*0.63-

-

- 1.04 1.04

- 0.52

-

0.92 *0.75

0.90 -

- *0.840.66 -

0.88 0.74

0.84 0.76

1.34 1.11 0.91 1.24

1.071.30

0.88 -

Day 1 Phi / Day 1

from ME

ArginineProline


Succinate

Malate

Fumarate

Oxaloacetate

Aspartate

Isoleucine

Threonine

0.90

Isoleucine

Valine

Leucine

GlycineSerine

Phosphoenolpyruvate

Pyruvate


-

Leucine

0.64 -

Fructose

Alanine

Asparagine

Acetyl-coenzyme A

Glutamine

Citrate

Glucose

Glucose 6-phosphate



Lactate

Day 1 Phi / Day 1

from AMDIS

Phenylalanine

*0.80- 0.88

0.92

0.84

1.26

0.79Sucrose 0.93

0.97

*0.63-

-

- 1.04 1.04

- 0.52

-

0.92 *0.75

0.90 -

- *0.840.66 -

0.88 0.74

0.84 0.76

1.34 1.11 0.91 1.24

1.071.30

0.88 -

Day 1 Phi / Day 1

from ME

ArginineProline


Succinate

Malate

Fumarate

Oxaloacetate

Aspartate

Isoleucine

Threonine

0.90

Isoleucine

Valine

Leucine

GlycineSerine

Phosphoenolpyruvate

Pyruvate


-

Leucine

0.64 -

Figure 4.10 Metabolite differences in Pi-supplied Arabidopsis thaliana cell cultures treated

with Phi. Arabidopsis cells cultured for 7 days in 1 mM Pi were subcultured into media so

that the final Pi concentration was 4 mM and Phi concentration was 2 mM. One day after

subculturing, cells were harvested and the metabolites were profiled by GC-MS as

described in Materials and Methods. The ratios of metabolites in Phi-treated cells to non-

Phi treated cells are shown on the figure by different colour boxes. Compounds that were

not detected are indicated in italics. Colours represent ≥2, ≥5, ≥10 and ≥20-fold higher (red

gradient) or lower (green gradient) abundance in the Phi-exposed cells compared to the

unexposed cells. The ratios obtained from AMDIS (left-hand box) and ME (right-hand box)

are shown next to the name of the metabolites. Whenever the ratio of metabolite was not

determined, it was indicated with a dash (-). Significant differences (*) were determined by

a t-test (p<0.05, n= 2 biological replicates with 3 technical replicates for each biological

replicate).

+5 +10 +2 -10 -5 -2

123

Fructose

Alanine

Asparagine

Acetyl-coenzyme A

Glutamine

Citrate

Glucose

Glucose 6-phosphate



Lactate

Phenylalanine

*1.64- *2.66

*0.02

0.85

*1.4Sucrose 1.67

*2.09

0.71-

-

- *0.26 *0.17

- *0.05

-

*0.25 *0.19

1.24 -

- *0.06

*0.34 *0.31

*0.23 0.24

*0.12 - *0.09

*0.09*0.11

* 0.21 -

ArginineProline


Succinate

Malate

Fumarate

Oxaloacetate

Aspartate

Isoleucine

Threonine

1.24

Isoleucine

Valine

Leucine

GlycineSerine

Phosphoenolpyruvate

Pyruvate


Leucine

Day 9 Phi / Day 1

from AMDIS

Day 9 Phi / Day 1

from ME

*0.16

Fructose

Alanine

Asparagine

Acetyl-coenzyme A

Glutamine

Citrate

Glucose

Glucose 6-phosphate



Lactate

Phenylalanine

*1.64- *2.66

*0.02

0.85

*1.4Sucrose 1.67

*2.09

0.71-

-

- *0.26 *0.17

- *0.05

-

*0.25 *0.19

1.24 -

- *0.06

*0.34 *0.31

*0.23 0.24

*0.12 - *0.09

*0.09*0.11

* 0.21 -

ArginineProline


Succinate

Malate

Fumarate

Oxaloacetate

Aspartate

Isoleucine

Threonine

1.24

Isoleucine

Valine

Leucine

GlycineSerine

Phosphoenolpyruvate

Pyruvate


Leucine

Day 9 Phi / Day 1

from AMDIS

Day 9 Phi / Day 1

from ME

*0.16

Figure 4.11 Metabolic differences in Pi-deficient Arabidopsis thaliana cell cultures treated

with Phi. Arabidopsis cells cultured for 7 days in 4 mM Pi were subcultured into fresh

medium without Pi with 0 and 2 mM Phi. Two days after subculturing, cells were harvested

and the metabolites were profiled by GC-MS as described in Materials and Methods. The

ratios of metabolites in Phi-treated cells (day-9 Phi) to non-Phi treated (day-9 no Phi) cells

were shown in different colour boxes. Compounds that were not detected are indicated in

italics. Colours represent ≥2, ≥5, ≥10 and ≥20-fold higher (red gradient) or lower (green

gradient) abundance in the Phi-exposed cells compared to the unexposed cells. The ratios

obtained from AMDIS (left-hand box) and ME (right-hand box) are shown next to the

metabolite names. Whenever the ratio of metabolite was not determined, it is indicated with

a dash (-). Significant differences (*) were determined by a t-test (p<0.05, n= 2 biological

replicates with at least 3 technical replicates for each biological replicates).

+5 +10 +2 -10 -5 -2

124

Discussion

Phi affects the physiology of Pi-depleted Arabidopsis cells

Phi at certain concentration affects cell culture growth and cause toxicity. As seen in

Chapter 3, loading of cells with Pi allowed growth to occur for two 7-day culture cycles.

When more than 1 mM Phi was added to Pi-depleted cells, cell growth ceased at day 14.

However, supplying Pi together with either 1 mM or 2 mM Phi to Pi-deficient cells did not

inhibit growth up to 9 days. This was not unexpected because similar situation was

observed in Spinacia oleracia L (spinach) where the ratio of Pi to Phi is important in

determining the effects of Phi to plants (Thao et al., 2008). In Arabidopsis, growth was

inhibited by more than 2.5 mM Phi regardless of the Pi status of the plants (Ticconi et al.,

2001). A similar case of decreased cell culture density was observed in yeast (McDonald et

al., 2001).

In Arabidopsis cultured cells, high Phi concentrations did not only inhibit growth, but also

caused the cells to develop toxicity symptoms, indicated by the changes of the cultures

colour. In most conditions, cell toxicity could be seen through changes in colour of the cells

in suspension (Kristen U. 1997). However, there has been no research that demonstrates

there is an alteration of pigment composition in suspension cells. Similarly, symptom of Phi

toxicity such as leaf burning has also been detected in plants (Bachiega Zambrosi et al.,

2011). The present study has confirmed that the growth attenuating effects of Phi in plant

tissues, as well as its dependence on Pi status, is also seen in cell culture.

Phi toxicity might lead to either programmed cell death (PCD) or necrosis (Pilbeam et al.,

2000; Singh et al., 2003). PCD in Brassica napus suspension cells exposed to prolonged Pi

deficiency indicated by protoplast shrinkage, chromatin condensation and fragmentation of

nuclear DNA, and that was accelerated by Phi (Singh et al., 2003). The irregular shapes of

broken cells seen when Arabidopsis cells from discoloured cultures were stained for cell

viability indicated that the hallmark phenotypic symptoms of PCD were not observed.

Instead, it looks more like necrotic cell death that might be stimulated at high Phi. In

necrotic cell death, cells usually swell, lyse, lose their membrane integrity and have

125

lysosomal leakage (McCabe and Leaver, 2000; Reape et al., 2008). The apparent necrosis

observed in my study may be due to the lower Pi to Phi ratio in these cultures, which is

likely to be a harsher condition for the cells compared to cells at higher Pi to Phi ratio. Phi

may compete for the same transporter with Pi to enter cells (Carswell et al., 1997;

McDonald et al., 2001). With lower Pi to Phi ratio, the assimilation of Pi into cells is

decreased and Phi that accumulated due to inability of cells to metabolise Phi will interrupt

cells system and cause toxicity.

Perhaps at the higher Pi to Phi ratio, Phi did not kill the cells but rather arrested cell growth

by preventing cell division, which is similar to Phi that only slow the growth of pathogen,

permitting plants to wall off pathogen infection (Huberli et al.,2008). For example, in

certain fungi, such as Fusarium solani, Phi only had a fungistatic effect, instead of a

fungicidal effect (Lobato et al., 2010). The biostatic effect of Phi was also observed in Pi-

depleted yeast cells. These cells continued their growth when re-supplied with Pi,

indicating that Phi only retarded growth, but did not cause death (McDonald et al., 2001).

The application of low Phi concentration (1 mM and 2 mM) to cultured Arabidopsis cells

having different Pi status did not cause immediate toxicity. Apparently, Phi did not have a

beneficial or inhibitory effect on the growth of cells supplied with Pi, as biomass

accumulation continued at the same rate as in the control cultures. Some findings of

previous studies also showed that Phi did not stimulate growth in plants, for example in

strawberries (Moor et al., 2009) and komatsuna (Thao and Yamakawa, 2010), supporting

the idea of the inability of plants to metabolise Phi (Ratjen and Gerendas, 2009).

Phi affects P partitioning in Arabidopsis cell suspension cultures

The allocation of P to different pools in Phi treated cells was quite distinctive from that of

cells not treated with Phi. This is because Phi contributed to the total amount of P inside the

cells, in addition to free Pi and Po. Phi was taken into cells, accumulated and was not lost

during growth, indicating that it is not used by the cells.

126

Arabidopsis cells are very responsive to the provided Pi. They take up Pi rapidly from the

medium and contained the highest amount of Pi one day after subculturing to fresh Pi-

containing medium. Within first few days Pi was removed from the medium and this

sustained growth for the next time period. During this time in Pi-deficient media when cells

had removed all Pi, Pi inside the cells decreased, either being allocated to Po or being

diluted by cell division. Pi taken up by the cells is used in numerous biochemical processes

and much of the Pi will be incorporated into organic compounds.

When Pi-deficient cells were subcultured into Pi-containing medium, the Pi level inside the

cells was low at day 1 and day 3 for cells treated with Phi. There was more free Pi in the

media of Phi-treated cells compared to non-Phi treated cells. This indicates that Phi inhibits

Pi uptake. This is in agreement with the condition in Brassica rapa var. Perviridis

(komatsuna) where Pi absorption was strikingly decreased by Phi treatment (Thao and

Yamakawa, 2010). Similarly, Pi concentration in Brassica napus suspension cells was also

reduced by Phi in various Pi:Phi ratios (Carswell et al., 1997).

Although Pi was diluted as it was utilised by the cells for growth, Phi acquisition was not

enhanced. In this study, the amount of Phi removed from the medium was about the same

in Pi-sufficient and Pi-deficient cells, except two days after cells that have been grown in

Pi-containing medium were subcultured into fresh medium with Phi. In a previous study in

komatsuna, the amount of Phi taken up by komatsuna plants supplied with Pi was higher

than the amount of Phi in Pi-depleted plants. Lower Phi uptake during low Pi was due to a

decrease in nutrient uptake capacity, including Phi, which occurred due to the effects of the

low Pi condition on root growth and function (Thao and Yamakawa, 2010).

It could be that the Phi detected inside the cells was actually in a different location than the

Pi, for example in the vacuoles and that was not used by the cells. Normally, excess Pi will

be stored in vacuoles, while cytoplasmic Pi accumulates to a much lesser extent (Mimura et

al., 1990). A 31

P-NMR study in Nicotiana tabacum suspension cultures has shown that Phi

was transported to vacuole (Danova-Alt et al., 2008). Phi was found to be transported

across the plasma membrane at a lower rate than Pi (Jost, unpublished data). Thus, it could

also be that Phi in Arabidopsis cultured cells was also transported at a lower rate than Pi

127

into the vacuole. This will need further clarification in the future as in this assay, Pi was

measured as total Pi in the cells, including the cytoplasmic and vacuolar Pi.

The structure of Phi that resembles Pi caused the competition of Pi and Phi uptake into the

cells by Pi transport system (McDonald et al., 2001; Thao et al., 2008). In cultures

containing Pi, cells preferably absorbed Pi rather than Phi, indicating that they have the

ability to discriminate between these anions. The discrimination of Phi and Pi were also

seen in plants (Plaxton, 1999). In medium depleted of Pi, higher amounts of Pi inside the

cells of Phi-treated cells were observed compared to non-Phi treated cells. This time,

cultured cells do not have added Pi except for the relatively small amount of Pi that was

brought across inside the cells and medium that was transferred during subculturing,

showing that Phi contributed to the increased amount of Pi inside the cells. This might due

to two possible reasons. Firstly, the presence of Phi might induce the capacity of cells to

absorb Pi, thus the P allocation and Pi mobilisation changed. A previous study in yeast

showed that Phi causes the coordinated reduction of polyP pools with increased amount of

Pi inside the cells, suggesting that Phi triggers mobilisation of internal P by the conversion

of organic P to Pi (McDonald et al., 2001). It is not clear if this occurs in cell culture or in

plants. The second possibility is the conversion of Phi to Pi that was taken up by the cells.

The oxidation of Phi to Pi has only been found to occur in the presence of bacteria. There is

no evidence that plants can metabolise Phi (Sukarno et al., 1993; Carswell et al., 1996;

Forster et al., 1998). Since the cells were grown in culture and was maintained in a sterile

condition, it is unlikely that Phi was oxidised to Pi.

PHT 1;1, PHT1;8 and PHT1;9 are highly induced by Phi treatment in Pi depleted cells

During Pi deficiency, the PHT gene family members in Arabidopsis are up-regulated to

increase the capacity of Pi uptake (Smith et al., 1997; Okumura et al., 1998; Morcuende et

al., 2007). As shown in Chapter 3, the transcript abundance for the PHT gene family

members tested are strongly repressed within one day of supplying Pi. One day after

Arabidopsis cells were supplied with Pi and Phi together, the transcript abundance for this

set of genes was repressed to the same magnitude as in the absence of the Phi treatment.

The repression of these genes might be regulated by internal Pi amount that was at the

128

highest level at this time point. This finding shows that external Phi did not interfere with

the transcript level of several PHT genes for cells in a dynamic Pi state that moved from Pi-

deficient to Pi-sufficient condition, at least at the Pi to Phi ratio that have been tested. The

tested PHT genes family members were more strongly repressed with time. Again, Phi did

not affect the Pi-dependent repression of the PHT transcript pools.

As seen in Chapter 3, transcripts from these genes started to be induced upon Pi-depletion

in gene dependent manner. Since Phi is thought to mimic Pi, and is thought to be hardly

discriminated from Pi by the cells (Carswell et al., 1997; McDonald et al., 2001), it was

expected that the up-regulation of PHT transcripts by a lack of Pi would be disrupted by

Phi. PHT1;8 and PHT1;9, whose transcripts did not change very much in response to Pi

status had strong responses towards Phi treatment. In Pi-depleted cells the transcript

abundance for these genes, together with those from PHT1;1, were more quickly induced

when Pi-deficient cells were treated with Phi. Previously, the suppression of several Pi-

starvation induced genes such as high affinity transporters, a novel acid phosphatase, and

purple acid phosphatases were observed in tomato and Arabidopsis (Varadarajan et al.,

2002), Similarly, phosphite has attenuate Pi-starvation response genes in Arabidopsis plants

(Ticconi et al., 2001) and in yeast (McDonald et al., 2001). The contradict expression of the

tested genes might be due to different treatments and conditions applied to the Arabidopsis

suspension cells especially the Pi: Phi ratios and the tested genes.

In this study, higher induction of these genes suggests that the cells treated with Phi

respond more strongly to the Pi-starvation. It could be that Phi has worsened the Pi-

deficient condition by masking the real P content of these cells and disturbing Pi starvation

response. Thus, the cells behave as if it has lower Pi than it really does. This might mean

that Phi is somehow interacting with the Pi sensor, preventing it from sensing the true Pi

content of the cell. In this study, a strong differences in Phi-treated and untreated Pi-

deficient cells at the later time points (starting from day 9) suggest that Phi effects might be

delayed at the transcripts level. This delay could be due to slower Phi transport inside the

cells, as Phi was not transported as quickly as Pi in plant tissues (Jost, unpublished results).

129

Thus, Phi may be used to dissect gene expression patterns in response to Pi status. This is

due to the ability of Phi to disrupt the ability of the Pi sensor to judge the amount of Pi that

is available during Pi deficiency.

Phi induced metabolic changes in Pi-depleted Arabidopsis cells

To date, not much is known about the metabolic changes of Phi-treated plants. In Brassica

napus suspension cells, Phi suppressed the induction of several Pi stress marker enzymes

such as phosphoenolpyruvate phosphatase and pyrophosphate-dependent

phosphofructokinase (Carswell et al., 1996; Carswell et al., 1997) which disrupted protein

phosphorylation. In Arabidopsis, Phi suppressed the activity of nucleolytic enzymes

(Ticconi et al., 2001).

From the GC-MS analysis of Arabidopsis cells subjected to Pi starvation, the amounts of

sugar and some organic acids were higher, while some amino acids were lower compared

to cells supplied with Pi (Chapter 3). Comparing the metabolic changes of Pi-sufficient

cells treated and not treated with Phi, most of the detected metabolites did not change in

amount. This might be because cells still have plenty of Pi, and Phi did not affect the

perception of the available Pi, in accordance with how these cells responded at the

physiological and transcript levels. However, the metabolism of cells depleted of Pi was

strongly affected by Phi.

From the results obtained, strong increases in sugars, and decreases in glucose-6-phosphate,

citrate, succinate and malate may suggest that sugar metabolism is compromised. This led

to the accumulation of sugars as substrates and caused the depletion of downstream

products. Phi has changed the activity of citric acid cycle due to the decreased amounts of

components involved in it. This possibly affects the energy balance inside the cells. A

number of the carbon compounds that linked to the TCA cycle or glycolysis are also

decreased, suggesting a depletion of carbon. Fermentation might occur due to slight

increase in lactate. Together, the results indicate that oxidative metabolism is compromised,

leading to an energy crisis, that indicated by the inhibition of the cell growth.

130

Normally, sucrose can be metabolised by two ways in plants; either by sucrose synthase

that convert sucrose to UDP-glucose and fructose, or invertase that converts sucrose to

glucose and fructose. In the presence of Phi, both glucose and fructose accumulated, so it

seems that sucrose cleavage is occurring in the presence of Phi. Glucose is converted to

glucose 6-phosphate by glucokinase and ATP. Since glucose 6-phosphate was decreased, it

seems likely that the process downstream is blocked. The same argument holds for

decreases of all amino acids from glycerate-3-phosphate indicates that the block is before

the formation of glycerate 3-phosphate.

The metabolic change in Phytophthora treated with Phi is more elucidated compared to

plants. The activity of several enzymes such as D-glyceraldehyde 3-phosphate:NAD+

oxidoreductase and 6-phospho-D-gluconate:NADP+ 2-oxidoreductase involved in the

phosphogluconate and glycolytic pathways in the Phytophthora, also in yeast were affected

(Stehmann and Grant, 2000) by Phi. The toxicity effect of Phi to Pytophthora was due to

the accumulation of poly-phosphate (poly-P) and inorganic pyrophosphate (PPi), which

inhibit their pyrophosphorylase reactions (Niere et al., 1994). Accumulation of these

compounds will divert ATP from other metabolite pathways and fungal growth inhibited.

Pyrophosphorylase reactions formed PPi by the cleavage of nucleotide triphosphate, the

reactions that normally occur in major biosynthetic pathway. However, the method used for

metabolite analysis in this study was not designed to detect Poly-P and PPi. Also in

phytophthora, inhibition of phosphorylation by Phi did not increase the level of ADP, AMP

and adenosine, although the pyrophosphate level increased, suggesting that adenylate

synthesis is the primary target site of Phi in fungi (Griffith et al., 1990). Since PPi also

could be formed in Arabidopsis, it is likely that the similar mechanism occurred, although

further investigation is needed. Other than that, changes in cell wall and lipid fractions, also

water-soluble metabolites such as amino acids were observed (Dunstan et al., 1990).

In conclusion, Arabidopsis cells grown in culture do somehow have the ability to recognise

and discriminate between Phi and Pi. Cells were much more affected by Phi when their

internal Pi status was low. These effects were observed in their growth, dynamics of P

pools, the transcripts level of several PHT gene family members and metabolite changes

when Phi was supplied to Pi-depleted cells.

131


Plant Materials

Arabidopsis thaliana ecotype Landsberg erecta cell suspension cultures (May and Leaver,

1993) were maintained in Murashige and Skoog (MS) basal medium (Phytotechlab,

Shawnee Mission, KS USA) by weekly sub-culturing with 3 % (w/v) sucrose, 0.5 mg/L

naphthalene acetic acid (NAA) and 0.05 mg/L kinetin (Murashige and Skoog, 1962). For

various Pi and Phi treatments, 250 mM filter sterilised KH2PO4 and 1 M KH2PO3 was

added to the medium, respectively, to the final concentration required. The pH was adjusted

to 5.8 using 1 M KOH. For subculturing, 27 ml of 7-day-old cells were transferred into 100

ml fresh MS basal medium in a 250 ml Erlenmeyer flask under sterile conditions. Cells

were grown under continuous light at 22 oC with shaking at 140 rpm and harvested by

vacuum filtration. Cells were stored in -80 oC for analysis.

Cell Viability Staining

For protoplasting, cells were subjected to centrifugation for 10 min, 500 x g at 25 ˚C. The

supernatant was removed and enzyme solution was added (0.4 M mannitol, 3 % sucrose, 8

mM CaCl2, 1 % cellulose, 0.25 % macrozyme). The mixed were kept horizontal in the dark

at 25 ˚C for 1 h, followed by 1 h gentle rocking, another 1 h horizontal and 1 h gentle

rocking. These cells were harvested by centrifugation for 5 min, 500 x g at 25˚C. For live-

dead cell staining, cells were resuspended in Phosphate Saline Buffer containing 2 µg/ml

fluorescein diacetate (FDA) and incubated for 5 min at 25 ˚C prior to 5 min incubation in

10 µg/ml propidium iodide (Jones and Senft, 1985). The images were captured using a

fluorescent microscope (Carl Zeiss, New South Wales, Australia).

Inorganic phosphate assay

Pi was determined using an ascorbic acid-ammonium molybdate method (Bruce N, 1966).

Approximately 50 mg fresh cells were frozen in liquid nitrogen prior to the addition of 500

µl of 1% (v/v) acetic acid. Cells were homogenised three times at 5000 rpm for 45 s in a

cell homogeniser (PrecellysR 24, Bertin Technologies, Montigny-le-Bretonneux, France).

132

The samples were placed on ice for 30 min and subjected to centrifugation at 16, 000 x g

for 15 min at 4 °C. The supernatant was transferred to a fresh tube and further clarified by

centrifugation at the same conditions. For the assay, 90 µl of the sample was added to 210

µl test solution (mixture of six parts 0.42 % ammonium molybdate in 1 N H2SO4 and one

part 10 % ascorbic acid in water). The mixture was incubated at 37 °C for 1 h. The samples

were prepared in a 96 well plate and the absorbance was measured at OD820 (Thermo

Multiskan Spectrum spectrophotometer, Thermo Scientific, Vantaa, Findland).

Total phosphorus measurement

For total P measurement, 3 ml nitric acid (HNO3) was added to a known oven-dried mass

of Arabidopsis cells in a 50 ml Erlenmeyer flask. A first digestion was performed by

heating 10 min at 100 oC. The samples were allowed to cool to room temperature and 1 ml

perchloric acid (HClO4) was added. The digestion was continued at 140-150 oC until the

vigorous reaction between HClO4 and organic residues was completed. The temperature

was raised to 170-180 oC and samples were heated for 10 min to dissolve the silica. The

digested samples were allowed to cool to room temperature before 3 ml water was added

and warmed to dissolve any KClO4 crystals. The solution was transferred to a plastic vial,

brought up to 10 ml with water. The sample was assayed for Pi using a malachite green

method (Vanveldhoven and Mannaerts, 1987) in a 96-well format. The absorbance was

measured at OD630 (Thermo Multiskan Spectrum spectrophotometer, Thermo Scientific,

Vantaa, Findland). The amount of total P was assayed based on dry weight basis and

calculated using the corresponding cell fresh weight.

Phi assay

Phi was measured using enzymatic fluorescent assay (Berkowitz et al 2011).

Approximately 50 mg of Arabidopsis cells were extracted using 1 % acetic acid. Cells were

homogenised three times at 5000 rpm for 45 s in a cell homogeniser (PrecellysR 24, Bertin

Technologies, Montigny-le-Bretonneux, France). The samples were placed on ice for 30

min and subjected to centrifugation at 16, 000 x g for 15 min at 4 °C. Supernatant was

assayed for Phi in the 96-well microtiter plate. The assay mix containing a final

concentration of 50 mM MOPS (pH 7.3), 100 µM NAD, 100 µM phenazine methosulfate,

133

100 µM resazurin, and 1 µg recombinant 6 X His-PtxD per well were prepared. The

microtiter plates were incubated in the dark at 37 °C for 1 h. The reaction product resofurin

was measured using a fluorescence reader (DTX880 Multimode Detector, Beckman

Coulter, Gladesville, Australia) at 535-nm excitation and 595-nm emission wavelengths.

The analysis was conducted at the Centre for Phytophthora Science and Management,

School of Biological Sciences and Biotechnology, Murdoch University.

mRNA preparation

Messenger RNA was isolated from cells using magnetic beads coated with oligo-dT (Jost et

al., 2007). About 70 mg Arabidopsis thaliana cells were lysed in lysis buffer (100 mM Tris,

500 mM LiCl, 10 mM EDTA, 1 % LiDS, 5 mM DTT) and incubated at room temperature

for 10 min. Samples were subjected to three cycles of homogenisation at 5000 rpm, 45 s

each, in a cell homogeniser (PrecellysR 24, Bertin Technologies, Montigny-le-Bretonneux,

France) before centrifugation for 10 min, 12,000 x g at 15 oC. The supernatant was

transferred to a new tube and further clarified by 5 min centrifugation at 12, 000 x g. In the

meantime, 10 µl of oligo-dT magnetic beads (Dynabeads® Oligo(dT)25, Invitrogen Dynal

AS, Oslo, Norway) were transferred into PCR tubes. The beads were washed twice with

lysis buffer and the supernatant was removed after each wash by magnetic separation

(Dynal® MPC-9600 Magnetic Particle Concentrator, Invitrogen Dynal AS, Oslo, Norway).

To the washed beads, 240 µl of the clarified cellular extract was added. Mixtures were

incubated at room temperature for 10 min to allow annealing of poly-A+ RNA to the beads.

The supernatant was removed after magnetic bead separation. The beads were washed

twice with washing buffer (10 mM Tris, 150 mM LiCl, 1 mM EDTA, 0.1 % LiDS), twice

with washing buffer lacking LiDS, and twice with ice-cold 1X RT buffer (50 mM Tris, 50

mM KCl, 10 mM MgCl2 x 6H2O, pH 8.3, 0.1 mM DTT). RNA was eluted from the beads

by incubating 5 min at 70 oC in 10 µl RT buffer, and chilled on ice prior to adding 10 µl 2x

RT mix (5x RT buffer (Bioline Aust Pty Ltd, New South Wales, Australia) 100 mM DTT,

dNTP-mix (40 mM each), RNasin (40 U/ µl) (Bioline Aust Pty Ltd, New South Wales,

Australia), MLV reverse ranscriptase (200 U/ µl) (Bioline Aust Pty Ltd, New South Wales,

Australia), DEPC-ddH2O). Samples were incubated at 42 oC

for 90 min. The cDNA on the

beads was washed twice with 1 X RT buffer. The mRNA was eluted by incubating the

134

beads in 25 µl elution buffer (2 mM EDTA, 10 mM Tris-HCl pH 8) for 10 min at 95 oC,

before chilling on ice for 1 min. The supernatant containing the mRNA was quickly

removed after magnetic separation and stored in a new tube. The RNA recovery was

measured using a spectrophotometer (ND-1000 UV-Vis Spectrophotometer, NanoDrop

Technologies, Wilmingon, DE, USA). The cDNA yield was assumed to be equivalent to

the mRNA eluted from the beads and was adjusted to 2 ng µl-1

by adding sterile distilled

water to the beads. The cDNA was stored in -80 oC.

Quantitative Real-Time Polymerase Chain Reaction

Primers for members of the PHT gene family, were designed (Appendix 1; DNASTAR

software, DNASTAR Inc, Madison Wisconsin, USA). For qRT PCR, 2.5 µl cDNA diluted

1:10 with sterile distilled water was added to 2.5 µl primer mix (1.2 µM each) and 5 µl real-

time PCR master mix (Power SYBR® Green PCR Master Mix, Applied Biosystem, Foster

City, CA, USA). The reaction was performed (7500- Fast Real-Time PCR System Applied

Biosystems, Scoresby, Victoria, Australia) by 40 X cycling at 2 min at 50 oC, 10 min at 95

oC, 15 sec at 95

oC and 1 min at 60

oC.

Sample extraction, derivatisation and gas chromatoghraphy / mass spectrometry (GC-

MS) analysis

Metabolites were extracted and derivatised using a protocol adapted from (Roessner-Tunali

et al., 2003). Approximately 30 mg fresh weight of Arabidopsis thaliana cells were

extracted in 500 µl 20:2:1 HPLC grade methanol: water: ribitol. Samples were incubated on

a thermomixer at 75 oC

with 1200 rpm mixing for 20 min prior to centrifugation at 16,000 x

g, 3 min, at 20 oC. A 100 µl aliquot of the supernatant was dried down for 1 h under

vacuum (Labconco, Kansas City, MO, USA). For the automated derivatisation and GC-MS

run, 20 µl pyridine was added to the dried sample, the sample was incubated at 65 oC, 750

rpm mixing for 1 h (Agilent 5975C inert XL MSD with Triple-Axis Detector, Forest Hill,

VIC, Australia) before 30 µl N-,methyl-N-(tri-methylsilyl) trifluoroacetamide

(Derivatisation grade, Sigma) was added and the samples incubated at room temperature

for a further 30 min.

135

For GC-MS run, 1 µl of derivatized sample was injected into the front inlet splitless

injector at 300 oC initial temperature, 9.13 psi pressure and 9.9 ml min

-1 purge flow, with

helium carrier gas with a constant flow of 1.0 ml min-1

(Capillary column Factor 4, Varian

Inc, Blackburn, VIC, Australia). The GC column oven was held at 70 oC initial

temperature for 1 min. The temperature was increased to 76 oC

at 1

oC

min

-1, followed by

increasing to 325 oC at 6

oC min

-1 before being held for 8 min. A mass selective detector

transfer line heater was used with an initial temperature of 250 oC. For the mass

spectrometry, the scan acquisition mode was used. The MS source temperature was 230 oC

and MS Quad temperature was 150 oC. The solvent delay time was 8 min and the relative

electron multiplier voltage mode was used. The low mass was 50 amu and the high mass

was 600 amu. The GC-MS analysis was conducted at Metabolomics Australia, The

University of Western Australia.

Statistical analysis of GC-MS data

With two biological replicates and at least three technical replicates of samples, the raw

GC-MS data obtained were processed and the statistical analysis was performed using

AMDIS (http://chemdata.nist.gov/mass-spc-amdis) and METABOLOME-EXPRESS

software (version 1.0, http://www.metabolome-express.org) (Carroll et al., 2010).

References

Bachiega Zambrosi FC, Mattos D, Jr., Syvertsen JP (2011) Plant growth, leaf

photosynthesis, and nutrient-use efficiency of citrus rootstocks decrease with

phosphite supply. Plant Nutrition and Soil Science 174: 487-495

Barrett SR, Shearer BL, Hardy GES (2004) Phytotoxicity in relation to in planta

concentration of the fungicide phosphite in nine Western Australian native species.

Australasian Plant Pathology 33: 521-528

Berkowitz, O., Jost, R., Pearse, S.J., Lambers, H., Finnegan, P.M., Hardy, G.E., and

O’Brien, P.A. (2011). An enzymatic fluorescent assay for the quantification of

phosphite in a microtiter plate format. Analytical Biochemistry 412: 74-78.

Bozzo GG, Singh VK, Plaxton WC (2004) Phosphate or phosphite addition promotes the

proteolytic turnover of phosphate-starvation inducible tomato purple acid

phosphatase isozymes. FEBS Letters 573: 51-54

Bruce N A (1966) [10] Assay of inorganic phosphate, total phosphate and phosphatases. In

VG Elizabeth F. Neufeld, ed, Methods in Enzymology, Vol Volume 8. Academic

Press, pp 115-118

136

Carroll AJ, Badger MR, Millar AH (2010) The MetabolomeExpress Project: enabling

web-based processing, analysis and transparent dissemination of GC/MS

metabolomics datasets. BMC Bioinformatics 11: 376-388

Carswell C, Grant BR, Theodorou ME, Harris L, Niere JO, Plaxton WC (1996) The

fungicide phosphonate disrupts the phosphate-starvation response in Brassica nigra




67-74

Danova-Alt R, Dijkema COR, De Waard P, KÖCk M (2008) Transport and

compartmentation of phosphite in higher plant cells – kinetic and 31P nuclear

magnetic resonance studies. Plant, Cell and Environment 31: 1510-1521

Dunstan RH, Smillie RH, Grant BR (1990) The effects of sub-toxic levels of

phosphonate on the metabolism and potential virulence factors of Phytophthora

palmivora. Physiological and Molecular Plant Pathology 36: 205-220

Eshraghi L, Anderson J, Aryamanesh N, Shearer B, McComb J, Hardy GES, O’Brien

PA (2011) Phosphite primed defence responses and enhanced expression of defence

genes in Arabidopsis thaliana infected with Phytophthora cinnamomi. Plant

Pathology 60: 1086-1095

Fenn ME, Coffey MD (1984) Studies on the in vitro and in vivo antifungal activity of

fosetyl-al and phosphorus acid. Phytopathology 74: 606-611

Forster H, Adaskaveg JE, Kim DH, Stanghellini ME (1998) Effect of phosphite on

tomato and pepper plants and on susceptibility of pepper to Phytophthora root and

crown rot in hydroponic culture. Plant Disease 82: 1165-1170

Griffith JM, Smillie RH, Grant BR (1990) Alterations in nucleotide and pyrophosphate

levels in Phytophthora plamivora following exposure to the antifungal agent

potassium phosphonate (phosphite). General Microbiology 136: 1285-1291

Guest D, Grant B (1991) The complex action of phosphonates as antifungal agents.

Biological Reviews 66: 159-187

Huberli D, Shearer BL, Calver MC, Paap T, Moore NA, Barrett S,Freebury

G,Howard K, O'Gara E, Dunstan W, Bowen B, Gower K, Palmer B, Long N,

Crane C, Spadek T, Dell B, O'Brien P, McComb JA and Hardy G.E.St.J (2008)

Research into natural and induced resistance in Australian native vegetation of

Phythopthora cinnamomi and innovative methods to contain and/or eradicate within

localised incursions in areas of high biodiversity in Australia. Does physiological

status of the plant at the time of spraying affect the efficacy of phosphite? Prepared

by the Centre for Phytophora Science and Management for the Australian

Government Department of the Environment Water, Heritage and the Arts.

Jones KH, Senft JA (1985) An improved method to determine cell viability by

simultaneous staining with fluorescein diacetate-propidium iodide. Histochemistry

and Cytochemistry 33: 77-79

Jost R, Berkowitz O, Masle J (2007) Magnetic quantitative reverse transcription PCR: A

high-throughput method for mRNA extraction and quantitative reverse transcription

PCR. Biotechniques 43: 206-211

Kristen U. (1997): Use of higher plants as screens for toxicity assessment. Toxicology in

vitro. 11: 181-191

137

Lobato MC, Olivieri FP, Daleo GR, Andreu AB (2010) Antimicrobial activity of

phosphites against different potato pathogens. Plant Diseases and Protection 117:

102-109


thaliana suspension cultures. Plant Physiology 103: 621-627

McCabe PF, Leaver CJ (2000) Programmed cell death in cell cultures. Plant Molecular

Biology 44: 359-368

McDonald AE, Grant BR, Plaxton WC (2001) Phosphite (phosphorous acid): Its

relevance in the environment and agriculture and influence on plant phosphate

starvation response. Plant Nutrition 24: 1505-1519

McDonald AE, Niere JO, Plaxton WC (2001) Phosphite disrupts the acclimation of

Saccharomyces cerevisiae to phosphate starvation. Canadian Journal of

Microbiology 47: 969-978

Mimura T, Dietz KJ, Kaiser W, Schramm MJ, Kaiser G, Heber U (1990) Phosphate

transport across biomembranes and cytosolic phosphate homeostasis in barley

leaves. Planta 180: 139-146

Moor U, Põldma P, Tõnutare T, Karp K, Starast M, Vool E (2009) Effect of phosphite

fertilization on growth, yield and fruit composition of strawberries. Scientia

Horticulturae 119: 264-269

Morcuende R, Bari R, Gibon Y, Zheng W, Pant BD, BlÄSing O, Usadel B,

Czechowski T, Udvardi MK, Stitt M, Scheible W-R (2007) Genome-wide


to phosphorus. Plant, Cell and Environment 30: 85-112

Murashige T, Skoog F (1962) A Revised Medium for Rapid Growth and Bio Assays with

Tobacco Tissue Cultures. Physiologia Plantarum 15: 473-497

Niere JO, Deangelis G, Grant BR (1994) The effect of phosphonate on the acid soluble

phosphorus components in the genus phytophthora. Microbiology-UK 140: 1661-

1670

Ohtake H, Wu H, Imazu K, Anbe Y, Kato J, Kuroda A (1996) Bacterial phosphonate

degradation, phosphite oxidation and polyphosphate accumulation. Resources,

Conservation and Recycling 18: 125-134

Okumura S, Mitsukawa N, Shirano Y, Shibata D (1998) Phosphate Transporter Gene

Family of Arabidopsis thaliana. DNA Research 5: 261-269

Pilbeam RA, Colquhoun IJ, Shearer B, Hardy GES (2000) Phosphite concentration: its

effect on phytotoxicity symptoms and colonisation by Phytophthora cinnamomi in

three understorey species of Eucalyptus marginata forest. Australasian Plant

Pathology 29: 86-95

Plaxton WC (1999) Metabolic aspects of phosphate starvation in plants. In: Deikman J,

Lynch J (eds) Phosphorus in plant biology: regulatory roles in molecular, cellular,

organismic, and ecosystem processes. American Society of Plant Physiologists,

Rockville, pp164–176

Ratjen AM, Gerendas J (2009) A critical assessment of the suitability of phosphite as a

source of phosphorus. Plant Nutrition and Soil Science 172: 821-828

Reape TJ, Molony EM, McCabe PF (2008) Programmed cell death in plants:

distinguishing between different modes. Experimental Botany 59: 435-444

Roessner-Tunali U, Hegemann B, Lytovchenko A, Carrari F, Bruedigam C, Granot

D, Fernie AR (2003) Metabolic profiling of transgenic tomato plants

138

overexpressing hexokinase reveals that the influence of hexose phosphorylation

diminishes during fruit development. Plant Physiology 133: 84-99

Singh VK, Wood SM, Knowles VL, Plaxton WC (2003) Phosphite accelerates

programmed cell death in phosphate-starved oilseed rape (Brassica napus)

suspension cell cultures. Planta 218: 233-239



Stehmann C, Grant BR (2000) Inhibition of enzymes of the glycolytic pathway and

hexose monophosphate bypass by phosphonate. Pesticide Biochemistry and


Sukarno N, Smith SE, Scott ES (1993) The effect of fungicides on vesicular–arbuscular

mycorrhizal symbiosis. New Phytologist 125: 139-147

Thao H, Yamakawa T, Shibata K, Sarr P, Myint A (2008) Growth response of



Thao HTB, Yamakawa T (2009) Phosphite (phosphorous acid): Fungicide, fertilizer or

bio-stimulator? Soil Science and Plant Nutrition 55: 228-234



Ticconi CA, Delatorre CA, Abel S (2001) Attenuation of phosphate starvation responses

by phosphite in arabidopsis. Plant Physiology 127: 963-972

Vanveldhoven PP, Mannaerts GP (1987) Inorganic and organic phosphate measurements

in the nanomolar range. Analytical Biochemistry 161: 45-48

Varadarajan DK, Karthikeyan AS, Matilda PD, Raghothama KG (2002) Phosphite, an

analog of phosphate, suppresses the coordinated expression of genes under

phosphate starvation. Plant Physiology 129: 1232-1240

139

CHAPTER 5:

General Discussion and Conclusion

140

Introduction

Cell suspension cultures have been used in many basic studies on plant cell functions.

Understanding plant responses to various environmental conditions also have been made

easier with this approach as it avoids the challenges caused by the complexity of plant

vascular system. Previously, Arabidopsis cells grown in culture have been used to

understand cells responses under Pi stress. For instance, the transcripts abundance of

glycerol 3-phosphate permease gene family during Pi-deficiency was profiled (Ramaiah et

al., 2011) and the proteins that have changed under Pi-sufficient and Pi-deficient condition

have been identified (Tran and Plaxton, 2008). Besides Arabidopsis, Brassica nigra

suspension cells have also been used to study the metabolite levels of Pi-starved plants

(Duff et al., 1989). The importance of Pi for various functions in plants makes it an

essential nutrient and Pi limitation causes stress to plants. With three different genomes to

coordinate, plant adaptation to stress can be complex. All genomes need to be expressed to

sustain plant survival in different conditions. Thus, knowledge on the coordination of

processes that happen in plants at the genomic, transcriptomic, proteomic and metabolomic

levels is important, yet currently it is limited.

This research was aimed to increase our understanding of plant responses towards Pi

depletion using cell suspension cultures as a model system. Arabidopsis thaliana accession

Landsberg erecta was used in a series of experiments to study plant responses at both the

physiological and molecular levels. Findings from this research have improved our

knowledge on how plants react towards Pi depletion, Pi resupply, also their responses

towards Pi depletion in the presence of Phi, an analog of Pi. Changes in culture growth, P

allocation patterns and transcript abundance of selected genes involved in Pi transport and

homeostasis were studied across a time course, while metabolite profiles were studied for

cells at selected time points. Focusing on the processes controlled by the plant genomes,

major findings from this research can be discussed at the levels of transcriptomic,

proteomic, metabolomic, and physiological states of Arabidopsis suspension cells in

response to Pi stress.

141

Summary of major findings

This thesis has contributed to knowledge through major findings as discussed below.

1. Several higher density proteins identified from Arabidopsis thaliana cells grown

in culture have nucleic acid binding capacity

Mitochondrial nucleic acid-binding proteins are likely to be important in regulating the

processes inside mitochondria during normal and stress conditions. However, their identity

and functions are not well characterised. In chapter 2, I have developed a method for

separation of proteins that have a greater density than the bulk of mitochondrial proteins

using centrifugation techniques. These proteins have either previously reported to have the

capacity to bind nucleic acid; GR-RBP5 (Vermel et al., 2002), chaperonin 20 (Saibil,

2008), malate dehydrogenase (M.C. Freeman and D.G Muench, unpublished data) or

associate with nucleic acid metabolism such as endoribonuclease L-PSP (Elo et al., 2003).

Since these proteins were identified from the mitochondria of 7-days old Arabidopsis cells

grown in media initially supplied with 1 mM Pi, these cells were actually subjected to Pi

depletion (Chapter 3). Genevestigator was used to find publicly available microarray data

to determine if transcript of the genes encoding these proteins changed depending on Pi

status (Zimmermann et al., 2004). Except for chaperonin 20 that had a weak respond to Pi

level, the transcript abundance for the genes encoding other proteins found in Chapter 2 did

not appear to change in response to Pi (Figure 5.1). Most probably these genes are likely to

be unresponsive to Pi status in cell culture. However, this hypothesis needs to be tested by

profiling their transcripts abundance by qRT-PCR.

142

1) GR-RBP5

2) Malate dehydrogenase 1

3) Malate dehydrogenase 2

4) Endoribonuclease L-PSP

143

5) Chaperonin

Figure 5.1 The expression of genes encoding identified putative mitochondrial nucleic

acid-binding proteins under low Pi condition from Genevestigator database.

2. Redox active proteins in non-formaldehyde fixed mitochondrial lysates

separated by CsCl gradient centrifugation have been identified

Most of the proteins identified in denser fractions of non- formaldehyde fixed

mitochondrial lysates from Pi-limited cells were redox active proteins, apart from several

protein that have the capacity to bind nucleic-acids. The presence of redox active proteins

in the dense fractions could be due to the ability of these proteins to form complexes with

other molecules (Prudencio and Ubbink, 2004), perhaps the covalently bound co-factors

have the ability to increase protein density that is apparent on CsCl gradients (Thirkettle-

Watts, unpublished results). Since redox active proteins were involved in the regulation of

transcription in plant mitochondria (Konstantinov et al., 1995; Wilson et al., 1996), their

presence in mitochondrial lysates is not unexpected. Due to lacking of nucleic acid-binding

proteins identified with high confidence using this assay, this part of study was not being

continued.

3. P was a limiting factor for cell growth and P was re-allocated into organic pool

during cell growth, similar to responses reported in plants

The amount of Pi that is enough to maintain the growth of different plant species varies.

This study has extended the information on the amount of Pi that is sufficient for

Arabidopsis thaliana suspension cells, beyond supply the optimal Pi amount needed for

144

Arabidopsis cultured cells reported in previous work (Veljanovski et al., 2006). In Chapter

3, I have found that an initial supply of 4 mM Pi was enough to saturate the cells with Pi

under the culture conditions used and enough to load cells to the extent that they could

continue to grow for a further 7 days without additional Pi. Inorganic (Pi) and organic P

(Po) pools were redistributed during the growth cycle, confirming the dynamic mobilisation

of P from one pool to the other. Po made up the largest P pool in the cells throughout the

culture cycle, except at the very start of the cycle. The same trend of P pool allocation

happens in most plant tissues (Veneklaas, unpublished data). Pi secretion into the medium

from cells supplied with high Pi might indicate that a Pi efflux mechanism is also present in

this system, similar to those in plants supplied with high P (Mimura et al., 1996).

4. The response to Pi status of several PHT gene family members in Arabidopsis

suspension cells is similar to the response in plants.

Genes involved in a variety of functions were differentially expressed in response to Pi

deficiency (Misson et al., 2005). Whilst much of the data available at the moment are based

on microarray results that provide information on the changes in transcript abundance for

many genes expression, I have focused this study on the transcript abundance of the

members of only three of the PHT gene families. PHT1, PHT2 and PHT3 genes are

important set of genes encoding the proteins involved in transporting Pi across the plasma

membrane of cells, plastid and mitochondria (Okumura et al., 1998). Changes in the

transcript abundance of the genes upon Pi depletion and re-supply were profiled through

time course analysis. I have found that, as in plants, most of the PHT gene transcripts were

repressed when Pi-depleted cells were re-supplied with Pi. Repression continued for a

certain time until these genes were induced again. The timing of the repression and

induction was gene dependent, although the factor that facilitates the variation of induction

is unknown.

PHT1 family members located to the plasma membrane responded proactively to Pi status.

Transcript abundance for the plastid and mitochondrial Pi transporters were not strongly

changed by Pi amount except for PHT3;2, a mitochondrial transporter that responded in Pi

deficiency. This gene was also changed in respond to other types of stresses found in

previous studies such as H2O2, ozone, ultraviolet and some other tested stress conditions

145

(Van Aken et al., 2009). A relatively low involvement of the Pi transporters located to

organelles compared to cytoplasmic genes could be due to re-distribution of intracellular Pi

under Pi shortage. It also suggests that the mechanism of cell adaptation during Pi

deficiency relies mostly on processes that happen at the plasma membrane. Overall, the

general transcript patterns of the PHT gene families were similar to those observed in

plants; they tended to be up-regulated during low Pi conditions and down-regulated during

Pi sufficient conditions.

5. Primary miRNA399 and PHO2 transcripts accumulated in a pattern similar to

most of the PHT gene family members in Arabidopsis suspension cells

In Chapter 3, transcript amounts for the primary miRNA399 and PHO2 genes were

determined. Pi depletion caused the primary miRNA399 and PHO2 to be induced in

Arabidopsis cell cultures and the transcripts amounts for PHT1;7, PHT1;8 and PHT1;9

were induced. In regulating Pi homeostasis in plants however, miRNA399 is up-regulated

upon Pi starvation, directing the down-regulation of PHO2 (Chiou et al., 2006). This is

thought to cause the induction of some of the PHT gene family transcripts and increase the

capacity of Pi uptake (Aung et al., 2006; Bari et al., 2006). In plants, the up-regulation of

PHT1;8 and PHT1;9 were observed when PHO2 was down-regulated during Pi stress

(Doerner, 2008). It could be that miRNA399 and PHO2 are involved in Pi signalling in

homogenous cell cultures, although their interaction is somewhat different. The difference

could be due to a partial complementary sequence of At4/ IPS1, non-coding RNA that

might suppress the cleavage of miRNA399 on PHO2 (Franco-Zorrilla et al., 2007).

6. Metabolic profiles for Pi-depleted and Pi-resupplied Arabidopsis cells revealed

dynamic changes compared to plants

Metabolic changes as a result of variations in Pi concentration in cultured cells were

profiled. The abundance of some of the detected compounds from GC-MS from cells with

different Pi status varied, when compared to the other cultured cells or in real plants. This is

expected as the metabolism occurs in plant tissues like leaves and roots may not be the

same as in cultures. Even for the cells grown in culture itself, tissue of cultures origin, plant

species of origin, treatment conducted during experiments, time of harvest, type of nutrients

146

supplied and many other factors will contribute to these differences. The comparisons

between cell cultures from Catharanthus roseus (Ukaji and Ashihara, 1987) and

Arabidopsis thaliana (Chapter 3) have shown that both cultures exhibit dynamic metabolite

profiles under Pi-stress.

7. Phi caused toxicity to Pi-deficient Arabidopsis cells and altered the P pool in

the cells

Arabidopsis cells had the ability to assimilate Phi to a certain extent, depending on Pi

availability (Chapter 4). A high ratio of Pi to Phi did not affect Arabidopsis cells during the

early stage of growth. However, Phi toxicity effects could be observed once the cells were

Pi-depleted in the later stages of growth. P allocation was found to be different for Pi-

sufficient and Pi-depleted cells treated with Phi. From the analysis of total P and internal Pi,

Phi seems to influence P distribution in parallel. Phi reduced the capacity of Pi uptake in Pi-

sufficient cells while in Pi-deficient cells, Phi contributes to a higher amount of Pi inside

the cells. While the concentration of Pi inside the cells was depleted with cell growth, Phi

concentration was stable in Pi-sufficient cells. In contrast, for Pi-depleted cells, Phi

amounts inside the cells decreased as the cell biomass increased marginally. Alteration of P

allocation was also observed in plants treated with Phi, for example in komatsuna (Thao et

al., 2008; Thao and Yamakawa, 2010; Avila et al., 2011). Taken together, whether or not

plants have enough Pi, the application of Phi will affect growth and P allocation to a certain

extent.

8. Some members of the PHT gene family responded to Phi stress while others

only responded to Pi stress

In the Pi-starvation response of Arabidopsis cells, PHT1;1, PHT1;2, PHT1;4 and PHT1;7

were up-regulated under low Pi conditions (Chapter 3). PHT1;8 and PHT1;9 transcript

abundance did not change significantly with changes in Pi status over the same period of

time. However, in Phi treated cells, PHT1;1, PHT1;8 and PHT1;9 were up-regulated

significantly more quickly than in non-Phi treated cells. These three genes behave similarly

to one another, but differently to other genes in the same family suggesting that they could

be part of a separate regulatory circuit. Among these three genes, PHT1;8 and PHT1;9

147

were found to be regulated by miRNA399 and PHO2 that are involved in the control of Pi

remobilisation and translocation in plants (Chiou et al., 2006; Peter, 2008). Clear

explanation of Phi effects to the action of primary miRNA399 and PHO2 genes in cell

cultures is unknown.

9. Phi reduced the abundance of detected metabolites in Pi-depleted cells

Pi-deficiency causes some of the detected metabolites to be increased and the amounts of

these compounds were reduced when cells re-supplied with Pi. However, addition of Phi

instead of Pi into the medium caused the detected metabolites to be further reduced in

amount, including compounds that are involved in the citric acid cycle, as well as other

pathways in the cells. Other by-pass enzymes such as PPi dependent phosphofructokinase

(PPi-PFK), phosphoenol pyruvate (PEP) phosphatase, and PEP carboxylase (PEPCase)

(Plaxton 2004) might also contribute to the shift in metabolite pools. However, it has to be

examined using techniques other than GC-MS. Phi brings the amounts of citric acid cycle

intermediates way down to low level, which perhaps removing the symptoms of low Pi

physiologically. This situation suggests that Phi has an impact on oxidative metabolism of

the cells. In aerobic respiration, Pi is required to produce ATP. However, if there was no Pi

available, alternative non-phosphorylating respiration pathways may be activated

(Theodorou and Plaxton, 1993), which could be tested by respiratory measurements

(Gonzàlez-Meler et al., 2001). In this case, Phi appeared to worsen stress condition by not

allowing the cells to respire, or even to ferment properly. In phytophthora, Phi treatment

reduces the ability of the cells to generate energy and scavenge ROS under oxidative stress

(Daniel and Guest, 2005).

Limitations

Several novel findings have been achieved as discussed above. However, there were also

some limitations encountered during this research.

1. The development of an assay to identify mitochondrial nucleic acid-binding proteins

from Arabidopsis thaliana cell culture proved difficult. Two centrifugation based

methods were tested and CsCl gradient centrifugation was found to be the most

148

promising approach, with good protein recoveries compared to glycerol gradient

centrifugation or the combination of glycerol gradient centrifugation followed by

CsCl gradient centrifugation. In developing this assay, I identified several issues:

a. The number of proteins species co-purifying with mitochondrial nucleic acid

and identified by mass spectrometry was very low, probably due to the low

abundance of these kinds of proteins in the sample.

b. While some proteins co-purifying with nucleic acid were identified; only

five out of the 19 identified proteins were predicted to have nucleic acid

binding capacity, according to either their annotated functions or the

proximity of their properties with known nucleic acid-binding proteins.

c. Nucleic acid binding properties of the detected proteins are not proved. It

could be confirmed using suitable assay such as electrophoretic mobility

shift assay (EMSA).

2. The full accounting of P in the cell system was not able to be done due to a small

amount of P that binds to glassware and certain amounts of Pi that have been lost in

the pellet during sample preparation for Pi assay. This has restricted a full analysis

to monitoring the fate of the entire added Pi after it was incorporated into cells.

3. The transcript-profiling study was narrowed to the analysis of the PHT gene

families, PHO2 and primary miRNA399. Thus a wide range of genes that responded

to Pi is still to be studied in the future.

4. In this study, I have measured the transcript abundance for the primary miRNA399,

not the miRNA399 itself. Thus, the transcript profile for the active RNA molecule

of this gene is still unknown.

5. Measurement of Pi and Phi are based on the total amount of Pi and Phi inside the

cells. Details on the intracellular locations and the amount of the Pi or Phi are

unknown.

6. The GC-MS method enables the detection of a very small number of hydrophilic

aqueous metabolites from the samples. However, the sensitivity is limited and

149

prevents detection of a wide range of metabolites. Some compounds produced

weak signals and certainly there were many metabolites that were present below the

instrument’s detection limit.

Future Work

To address the limitations discussed above, there are several research directions that could

be conducted in the future:

1. Develop a new approach that could potentially identify more mitochondrial nucleic

acid-binding proteins from Arabidopsis cell culture, for example by using affinity

chromatography. Affinity chromatography is one of the liquid chromatography

techniques that allow protein purification using suitable columns based on the

nucleic acid-binding properties of the protein (Gadgil et al., 2001). It has been used

previously to purify mitochondrial RNA binding proteins in potato (Vermel et al.,

2002).

2. Confirm the nucleic acid-binding activities for proteins identified through LC/MS-

MS by EMSA. Using EMSA, protein-nucleic acid complexes will move more

slowly compared to free linear DNA or RNA during non-denaturing polyacrylamide

or agarose gel electrophoresis (Hendrickson and Schleif, 1985), making complexes

distinguishable from free proteins.

3. Perform 31

P nuclear magnetic resonance (NMR) (Shanks, 2001) or HPLC analysis

(Liu et al., 2006) to identify and quantify the metabolites not amenable to GC-MS,

notably the phosphorylated compounds such as ATP, ADP, AMP, NAD(P)H. The

quantitative metabolic profiles of these P-compounds will help to improve our

knowledge in metabolic changes related to mitochondrial functions during Pi stress.

31P-NMR analysis also can be used to measure the amount of Pi in various

compartments of the cell, for example cytosolic and vacuolar spaces (Rebeille et al.,

1983), besides being capable of distinguishing Pi and Phi (Danova-Alt et al., 2008).

150

4. Profile the kinetics of transcript abundance for more Pi-starvation responsive genes

under Phi stress by quantitative real time-PCR. The determination of PHR1, PHO2,

miRNA399, and SPX domain gene expression will broaden our knowledge on the

regulation of Pi-starvation in plants.

5. Previously, there were contrasting effects of oxidative stress on mitochondrial

respiration. Tiwari et al (2002) found that mitochondrial respiration was generally

increased by oxidative stress from the treatment of Arabidopsis cell culture with

chemicals such as rotenone and Antimycin A. On the other hand, the respiratory

capacity was maintained, although oxidative stress was induced by treatment of

chemicals such as H2O2, menadione or Antimycin A to Arabidopsis cells

(Sweetlove et al., 2002). Specific to Pi stress, respiration rate in bean roots was

reduced (Rychter and Mikulska, 1990). In this study, Phi treatment brought on

effects that were opposite to those caused by Pi-starvation responses in cultured

cells. The abundance of some detected components in cell metabolic pathways,

including in aerobic respiration, specifically referred to the citric acid cycle

intermediates were altered, thus it would be interesting to measure the respiration

rate of isolated mitochondria from the cells to get insights on how Phi affects

respiratory processes in plants.

6. Since the transcript changes do not always correlate well with changes in the

amount of the encoded proteins (Tran and Plaxton 2008; Plaxton and Tran 2011),

there is a need for future research to assess the amounts or activities of the

corresponding PHT transporter proteins.

Conclusion

Taken together, this work has made significant contributions to knowledge of basic genetic

research that has applications to agricultural research. Pi stress leads to changes at

physiology and molecular level in plants. Our understanding of the complexity of the

mechanisms involved during plant responses to Pi depletion and resupply have been

increased using a cell culture approach as a simplified system. Collectively, the kinetics of

Pi mobilisation, gene expression, protein abundance and metabolic changes are controlled

151

by the coordinated expression of all genomes to sustain plant survival under Pi stress. Phi

was found to have negative affects on plant cell function, making the usage of Phi in

agriculture practise questionable. Findings from this work will help the community,

especially farmers, make better evidence based decisions before adding Phi to crops as a Pi

fertiliser.

References

Aung K, Lin S-I, Wu C-C, Huang Y-T, Su C-L, Chiou T-J (2006) pho2, a phosphate



Avila FW, Faquin V, Araujo JL, Marques DJ, Ribeiro PM, Lobato AKD, Ramos SJ,

Baliza DP (2011) Phosphite supply affects phosphorus nutrition and biochemical

responses in maize plants. Australian Journal of Crop Science 5: 646-653

Bari R, Pant BD, Stitt M, Scheible W-R (2006) PHO2, microRNA399, and PHR1 define

a phosphate-signaling pathway in plants. Plant Physiology 141: 988-999

Chiou TJ, Aung K, Lin SI, Wu CC, Chiang SF, Su CL (2006) Regulation of phosphate

homeostasis by microRNA in Arabidopsis. Plant Cell 18: 412-421

Daniel R, Guest D (2005) Defence responses induced by potassium phosphonate in

Phytophthora palmivora-challenged Arabidopsis thaliana. Physiological and

Molecular Plant Pathology 67: 194-201

Danova-Alt R, Dijkema COR, De Waard P, KÖCk M (2008) Transport and

compartmentation of phosphite in higher plant cells – kinetic and 31

P nuclear

magnetic resonance studies. Plant, Cell and Environment 31: 1510-1521

Doerner P (2008) Phosphate starvation signaling: a threesome controls systemic Pi

homeostasis. Current Opinion in Plant Biology 11: 536-540


inducible bypasses of adenylate and phosphate dependent glycolytic enzymes in

Brassica nigra suspension cells. Plant Physiology 90: 1275-1278

Elo A, Lyznik A, Gonzalez DO, Kachman SD, Mackenzie SA (2003) Nuclear genes that

encode mitochondrial proteins for DNA and RNA metabolism are clustered in the

Arabidopsis Genome. The Plant Cell Online 15: 1619-1631

Franco-Zorrilla JM, Valli A, Todesco M, Mateos I, Puga MI, Rubio-Somoza I, Leyva

A, Weigel D, Garcia JA, Paz-Ares J (2007) Target mimicry provides a new

mechanism for regulation of microRNA activity. Nature Genetics 39: 1033-1037

Gadgil H, Oak SA, Jarrett HW (2001) Affinity purification of DNA-binding proteins.

Biochemical and Biophysical Methods 49: 607-624

Gonzàlez-Meler MA, Giles L, Thomas RB, Siedow JN (2001) Metabolic regulation of

leaf respiration and alternative pathway activity in response to phosphate supply.

Plant, Cell and Environment 24: 205-215

Hendrickson W, Schleif R (1985) A dimer of AraC protein contacts three adjacent major

groove regions of the AraI DNA site. Proceedings of the National Academy of

Sciences of the United States of America 82: 3129-3133

152

Konstantinov YM, Lutsenko GN, Podsosonny VA (1995) Genetic functions of isolated

maize mitochondria under model changes of redox conditions. Biochemistry and

Molecular Biology International 36: 319-326

Liu H, Jiang YM, Luo YB, Jiang WB (2006) A simple and rapid determination of ATP,

ADP and AMP concentrations in pericarp tissue of litchi fruit by high performance

liquid chromatography. Food Technology and Biotechnology 44: 531-534

Mimura T, Sakano K, Shimmen T (1996) Studies on the distribution, re-translocation and

homeostasis of inorganic phosphate in barley leaves. Plant Cell and Environment

19: 311-320






of America 102: 11934-11939

Okumura S, Mitsukawa N, Shirano Y, Shibata D (1998) Phosphate transporter gene

family of Arabidopsis thaliana. DNA Research 5: 261-269

Peter D (2008) Phosphate starvation signaling: a threesome controls systemic Pi

homeostasis. Current Opinion in Plant Biology 11: 536-540

Plaxton W.C. (2004) Plant response to stress: biochemical adaptations to phosphate

deficiency. In Encyclopedia of Plant and Crop Science (ed. R.Goodman) pp. 976–

980. Marcel Dekker, Inc., New York, USA



Prudencio M, Ubbink M (2004) Transient complexes of redox proteins: structural and

dynamic details from NMR studies. Molecular Recognition 17: 524-539

Ramaiah M, Jain A, Baldwin JC, Karthikeyan AS, Raghothama KG (2011)

Characterization of the phosphate starvation-induced glycerol-3-phosphate

permease gene family in Arabidopsis. Plant Physiology 157: 279-291

Rebeille F, Bligny R, Martin JB, Douce R (1983) Relationship between the cytoplasm

and the vacuole phosphate pool in Acer-pseudoplanatus cells. Archives of

Biochemistry and Biophysics 225: 143-148

Rychter AM, Mikulska M (1990) The relationship between phosphate status and cyanide-

resistant respiration in bean roots. Physiologia Plantarum 79: 663-667

Saibil HR (2008) Chaperone machines in action. Current Opinion in Structural Biology 18:

35-42

Shanks JV (2001) In situ NMR systems. Current issues in molecular biology 3: 15-26

Sweetlove LJ, Heazlewood JL, Herald V, Holtzapffel R, Day DA, Leaver CJ, Millar

AH (2002) The impact of oxidative stress on Arabidopsis mitochondria. The Plant

Journal 32: 891-904

Thao H, Yamakawa T, Shibata K, Sarr P, Myint A (2008) Growth response of





Theodorou ME, Plaxton WC (1993) Metabolic adaptations of plant respiration to

nutritional phosphate deprivation. Plant Physiology 101: 339-344

Tiwari BS, Belenghi B, Levine A. (2002) Oxidative stress increased respiration and

generation of reactive oxygen species, resulting in ATP depletion, opening of

153

mitochondrial permeability transition, and programmed cell death. Plant Physiology

128 : 1271-1281

Tran HT, Plaxton WC (2008) Proteomic analysis of alterations in the secretome of

Arabidopsis thaliana suspension cells subjected to nutritional phosphate deficiency.

Proteomics 8: 4317-4326

Ukaji T, Ashihara H (1987) Effect of inorganic phosphate on the levels of amino acids in

suspension cultured cells of Catharanthus roseus. Annals of Botany 60: 109-114

Van Aken O, Zhang B, Carrie C, Uggalla V, Paynter E, Giraud E, Whelan J (2009)

Defining the mitochondrial stress response in Arabidopsis thaliana. Molecular Plant

2: 1310-1324





Vermel M, Guermann B, Delage L, Grienenberger J-M, Maréchal-Drouard L,

Gualberto JM (2002) A family of RRM-type RNA-binding proteins specific to

plant mitochondria. Proceedings of the National Academy of Sciences 99: 5866-

5871

Wilson SB, Davidson GS, Thomson LM, Pearson CK (1996) Redox control of RNA

synthesis in potato mitochondria. European Journal of Biochemistry 242: 81-85

Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W (2004)

GENEVESTIGATOR. Arabidopsis Microarray Database and Analysis Toolbox.


154

APPENDICES

155

Appendix 1: List of primers for qRT-PCR

Gene

Forward primer Melting

temperature (Tm)

Reverse primer Melting temperature

(Tm)

Product size (bp)

PHT1;1

CCAAAGGCAAGTCCCTTGAAGAACT

54.7 AACAAAACCAAACATCGCACTCCAAATA

A

57.6 109

PHT1;2

AGGGCAAGTCCCTCGAAGAACT

57.3 ATCAAACAAACCACAAACAACTCCACAT

56.7 109

PHT1;3

CCAAAGGCAAGTCCCTTGAAGAACT

57.37 CAAAGAACGTAAAACGTAAAAGTAGTAC

ACCATT

57.15 141

PHT1;4

TTGCTCCTAATTTTCCTGATGCT

54.7 TGTGCCGGCCGAAATCT

57.6 80

PHT1;5

CGCCGATATCCCATGACAAG

55.7 GACCTAATGCGACG

ACGTTTG

56.3 80

PHT1;6

ACGTTATACATCATGGCAGGAATCAAT

55.13 AAGCTCCTCAAGTGATTTCCCATTAGT

56.25 90

PHT1;7

TGGAGGATATCCATGCTCTGTCT

57.2 CGCGGCTTCTGGAAAATTAG

54.3 100

PHT1;8

TTATCCCGAAGTAAACCGTATGAGAA

53.9 AATACGTCACCAAGATTCCAGCAA

54.84 80

PHT1;9

TGGAGCTGCAGGGAAGTTTG

55.2 ATCTGGAAAACCGTCCTCTTCAT

54.8 88

PHT2

AATGCATCAGGAGATTT

GTTTACAGT

53.55 AGGCTAAGGCTTGT

GATAGAGCTAT

55.14 156

PHT3;1 GCAACCGTTGGAGATG

CGGTGA

59.99 AACACCACCAGTGG

TTGGCA

56.54 159

PHT3;2

CGTTGCTGATGCAGTAA

AGAGGCTA

57.43 TTGACAGCATCATA

GATAACCCACT

53.82 120

PHT3;3

AGTCTTAAGCGGATTCC

CTACAA

53.24 CCTTCTAATCGCTAC

ACAACGCCT

57.10 183

PHO2

CATCTCAAAATGCTTTG

GAGGCT

56 CGAGCCGAGGGAG

AGAAAAA

57 103

pri-miRNA399

CCTCTCCATTGGCAGGTCCTTTACTT

60.8 GCAACTCTCCTTTGGCAGGTCATT

59.5 104

PDF2 TTGGCCACGTTAAATTTGATGTT

53.9 GCAGCATATAGTTCCTCAGGTTCTAGA

57.5 187

ACT7 GTGGTTGCACCGCCAGAGAGA

59.7 CCACATCTGTTGGAAGGTGCTGA

58.6 84

YLS8 CATCCATCTGCATACAGGTCTCA

56.4 CTCCGGTTGGGCTGTTGA

57.8 101

156

Appendix 2: List of compounds and their retention time determined from AMDIS and ME

Compounds from AMDIS Compounds from ME Retention time

(min)

RI=974.8, 8.4840 min, 1 8.4837

RI=980.6, 8.6198 min, 1 8.6255

RI=985.6, 8.7373 min, 1 8.7395

RI=989.5, 8.8309 min, 1 8.8337

Lactic Acid (2TMS) 9.5344

Glycolate (2TMS) 10.0746

RI=1049.7, 10.2450 min, 1 10.2472

RI=1079.6, 10.9483 min, 1 10.9217

L-Alanine 10.936

Glycine (2TMS) 11.4858

RI=1125.5, 12.0277 min, 1 12.0189

RI=1129.9, 12.1302 min, 1 12.1232

RI=1129.5, 12.1214 min, 1 12.124

Pentasiloxane, dodecamethyl-, MS92, RI1152.7 12.707

RI=1168.7, 13.0413 min, 1 13.0456

Phosphoric acid, bis(trimethylsilyl)monomethyl ester, MS91, RI1170.6, Putative but Unconfirmed

13.048

Dodecamethylpentasiloxane-c 13.8096

L-Valine (2TMS) L-Valine 14.0440

gamma-Hydroxybutyric acid Gamma-hydroxybutyric acid (2TMS), MS89, RI1236.5, Putative but Unconfirmed

14.6491

Ethanolamine (3TMS), MS90, RI1265.4, Putative but Unconfirmed

15.331

Ethylolamine (3TMS) 15.3322

Phosphoric acid 15.524

Glycerol (3 TMS) 15.5849

RI=1273.8, 15.5130 min, 1 15.6451

L-Isoleucine (2 TMS) 16.0574

RI=1299.7, 16.1226 min, 1 16.1281

L-Proline 16.149

L-Proline (2 TMS) 16.1506

Nicotinic acid (TMS) 16.1689

Nicotinic acid 16.225

Glycine 16.35

Succinic acid (2TMS) 16.6190

Succinic acid 16.622

D-(+)-Glyceric acid (3 TMS) 16.9302

Fumaric acid 17.482

Fumaric acid (2TMS) 17.4847

L-Serine (3 TMS) 17.6574

RI=1388.6, 18.2122 min, 1 18.2115

157

4,4'-Bipyridine 19.7353

Peak from Glutamine 1 20.1779

L-Malic acid 20.472

L-(-)-Malic acid (3 TMS) 20.4829

Meso-erythritol 20.8271

D-Threitol (4 TMS) 20.8300

L-Aspartic acid (3 TMS) 21.1369

L-Proline- 5-Oxo (TMS) = L-Pyroglutamic acid (2TMS)

21.1857

Hydroxyproline 21.188

Pyroglutamic acid 21.196

Gamma-Aminobutyric acid 21.301

Butanoic acid 4amino 21.3028

L-Cysteine (3 TMS) 21.8129

L-Threonic acid 21.8992

2-Ketoglutaric acid methoxime (2TMS)

22.3008

L-Glutamic acid (3 TMS) 23.1109

L-Phenylalanine (2 TMS) 23.2189

L-Phenylalanine 23.219

Gluconic acid, 2-methoxime, tetra(TMS)-, TMS ester

23.6098

Unknown Probable Sugar Acid Derivative, RI1653.9 23.68

1,4 Butanediamine (4TMS) 25.2072

Xylonic acid Lacton (3TMS) 25.2680

2-Keto-l-gluconic acid, penta(O-trimethylsilyl)-, MS81, RI1747.6

25.459

Ribonic acid (5TMS) 25.4625

Galactonic acid (6TMS), MS90, RI1980.7 29.523

Phosphoric acid (2TMS) 25.7054

Phosphoric acid, bis(trimethylsilyl) 2,3-bis[(trimethylsilyl)oxy]propyl ester

25.7069

Allantoin 25.798

Arabinofuranose, 1,2,3,5-tetrakis-O-(trimethylsilyl)-

25.8153

Fructose 5TMS 26.3793

Citric acid (4TMS) 26.7069

D-Mannopyranoside, methyl 2,3,4,6-tetrakis-O-(trimethylsilyl)-, MS80, RI1844.6

27.254

Tetradecanoic acid (1TMS), MS93, RI1849.4, Putative but Unconfirmed

27.312

RI=1867.0, 27.6355 min, 1 27.5937

RI=1865.7, 27.6110 min, 1 27.6075

RI=1866.5, 27.6267 min, 1 27.6194

D-Fructose 27.625

158

RI=1875.6, 27.7957 min, 1 27.7596

D-Galactose 27.823

D-Glucose 27.949

RI=1893.3, 28.1236 min, 1 28.0425

RI=1907.2, 28.3598 min, 1 28.2957

Sorbitol 28.555

D-Sorbitol (6 TMS) 28.5635

Gulose 5-O-TMS 28.6655

Maltose (8TMS) 29.0104

D-Glucose (5-O-TMS) 29.3734

D-Gluconic acid 29.5486

Palmitelaidic acid (TMS) 30.0890

Hexadecanoic acid (1TMS) 30.5191

Palmitic acid 30.52

myo-Inositol (6TMS)-mpimp 31.0080

Inositol, scyllo- (6TMS), MS88, RI2078.2, Putative but Unconfirmed

31.009

Sedoheptulose methoxime (6TMS), MS86, RI2116.9 31.617

Sedoheptulose methoxime (6TMS), MS84, RI2122.6 31.705

Gulose, 2,3,4,5,6-pentakis-O-(trimethylsilyl)-, MS82, RI2171.7

32.479

Octadecadienoic acid (1TMS) 32.9876

9,12-Octadecadienoic acid (Z,Z)-, trimethylsilyl ester, MS92, RI2208.2

32.995

RI=2212.4, 33.0739 min, 1 33.0759

Linolenic acid (TMS) 33.0798

Oleic acid, trimethylsilyl ester, MS89, RI2214.4 33.082

Oleic acid (TMS) 33.1661

Stearic acid 33.454

2-O-Glycerol-à-d-galactopyranoside, 6TMS

34.2740

Glucose 6-phosphate 34.318

D-Glucose-6-P-1 34.3230

D-glycero-D-gulo-heptose methoxime (6TMS), MS77, RI2350.8

34.841

D-Glucuronic acid (5TMS) 35.1361

Inositol monophosphate, MS94, RI2407.7, Putative but Unconfirmed

35.574

D-Myo-Inositol, 1,2,4,5,6-pentakis-O-(trimethylsilyl)-, bis(trimethylsilyl) pho

35.5747

Sucrose 38.418

D-(+)-Sucrose 38.4233

RI=2627.2, 38.4281 min, 1 38.4382

RI=2628.8, 38.4491 min, 1 38.4440

RI=2628.6, 38.4471 min, 1 38.4514

159

RI=2627.7, 38.4355 min, 1 38.4565

Galactinol Dihydrate 39.3756

Cellobiose 39.573

RI=2716.6, 39.5828 min, 1 39.5819

Maltose methoxime (8TMS) EZ Peak 1, MS92, RI2717.6

39.585

D-(+)-Trehalose 39.6444

Trehalose 39.661

D-Maltose 39.899

Unknown Probable Disaccharide, RI2748.9 39.978

Gentiobiose 40.7701

RI=2918.7, 41.9351 min, 1 41.9349

Galactinol (9TMS) 42.6599

RI=3103.0, 43.9153 min, 1 43.9137

alpha-Tocopherol 44.2466

Campesterol (TMS) 45.4560

Sitosterol (TMS) 46.3070

160

Appendix 3: Metabolite ratios for Pi-deficient and Pi-resupplied cells from AMDIS

analysis

Compounds Ratio (Day0/Day1) Ratio (day 9/day 1)

Lactic Acid (2TMS) *1.84+0.19 *3.44+0.18

Glycine (2TMS) 0.95+0.21 *0.18+0.02

L-Valine (2TMS) 1.19+0.26 *0.61+0.06

L-Isoleucine (2 TMS) 0.85+0.24 0.87+0.10

L-Proline (2 TMS) *0.45+0.17 *0.25+0.03

Succinic acid (2TMS) *2.36+0.1 *2.29+0.15

L-Threonine (2 TMS) *0.16+0.11 *0.09+0.08

Fumaric acid (2TMS) *3.86+1.03 *7.37+0.73

L-Serine (3 TMS) *0.72+0.06 *0.24+0.02

Glutamine 1 1.33+0.44 -

L-(-)-Malic acid (3 TMS) *3.67+0.21 *8.06+0.56

L-Aspartic acid (3 TMS) 1.37+0.17 *0.17+0.01

Butanoic acid 4amino(TMS) GABA 1.71+0.38 *0.60+0.05

L-Cysteine (3 TMS) 7.00+3.3 -

L-Glutamic acid (3 TMS) 4.23+2.64 -

L-Phenylalanine (2 TMS) 1.8+0.73 -

Citric acid (4TMS) *4.58+0.27 *2.73+0.18

D-(-)-Fructose-2 (TMS) 7.99+1.87 *5.05+0.20

D-Glucose (5-O-TMS) 14.6+3.03 *5.6+0.41

D-(+)-Sucrose 1.44+0.18 *2.32+0.27

D-(+)-Trehalose - *6.23+1.04

Whenever the ratio of metabolite was not determined, it was indicated with a dash (-).

Significant differences (*) were determined by a t-test (p<0.05, n= 2 biological

replicates with 3 technical replicates for each biological replicate).

161

Appendix 4: Metabolite ratios for Pi-deficient and Pi-resupplied cells from ME analysis

Ratio (Day0/Day1) Ratio (Day9/Day1)

Chemical Class Metabolite Name

Amino Acids

L-Alanine 1.01+0.1 *0.35+0.04

L-Valine 0.81+0.11 *0.53+0.06

Glycine 0.78+0.21 *0.17+0.01

Hydroxyproline 0.88+0.09 *2.7+0.25

Pyroglutamic acid 1.41+0.19 0.59+0.08

Gamma-Aminobutyric acid 1.20+0.11 *0.51+0.02

L-Phenylalanine 1.01+0.17 0.21+0.01

L-Proline *0.47+0.08 *0.36+0.04

Nicotinic acid *0.04+0.004 0.06+0.004

Unknown

Pentasiloxane, dodecamethyl-, MS92, RI1152.7

0.76+0.02 1.22+0.05


*0.29+0.09 *1.5+0.17


*0.52+0.06 *0.13+0.02


*4.98+0.53 *31.15+0.93


*1.55+0.15 *4.65+0.27


*10.98+1.55 *7.35+0.26

Galactonic acid (6TMS), MS90, RI1980.7

0.9+0.12 *2.94+0.2

Sedoheptulose methoxime (6TMS), MS86, RI2116.9

*3.14+0.55 *7.3+0.55


*0.67+0.09 *2.19+0.18


1.27+0.40 1.36+0.22

Allantoin 0.62+0.09 *0.27+0.02

Oleic acid, trimethylsilyl ester, MS89, RI2214.4

*0.63+0.05 2.02+0.03

Gamma-hydroxybutyric acid (2TMS), MS89, RI1236.5, Putative but Unconfirmed

*0.35+0.03 *3.25+0.31


1.00+0.07 *5.98+0.38


*0.68+0.06 *2.94+0.06

Unknown Probable Disaccharide, RI2748.9

1.42+0.22 *5.88+0.39


*4.97+0.63 *7.63+0.64


*1.57+0.15 *4.96+0.20

162

Unknown Probable Sugar Acid Derivative, RI1653.9

*3.31+0.39 *14.80+2.02


1.03+0.11 *1.68+0.21

Inorganic Ions and Gases Phosphoric acid

*0.17+0.04 *0.66+0.04

Dicarboxylic Acids

Succinic acid *2.10+0.18 *2.04+0.21

Fumaric acid 2.17+0.55 5.73+0.63

L-Malic acid *3.09+0.22 *6.17+0.28

Fatty Acids

Palmitic acid - -

Stearic acid - -

Carbohydrates

Sucrose *1.67+0.10 *1.74+0.02

D-Maltose 6.55+1.18 *6.23+0.23

D-Fructose *8.21+0.40 *4.63+0.24

D-Galactose 2.72+0.16 *1.84+0.14

D-Glucose *2.59+0.07 *2.81+0.05

Cellobiose *9.51+1.26 *6.16+0.11

Trehalose *1.73+0.22 *3.6+0.32

Alcohols and Polyols Sorbitol

*0.69+0.06 1.29+0.09

Sugar Phosphates Glucose 6-phosphate

0.92+0.10 *13.75+1.14




163

Appendix 5: Metabolite ratios for Phi-treated and non-treated cells from AMDIS analysis

Compounds Ratio (Day1 Phi/Day1) Ratio (Day 9 Phi/Day 1)

Lactic Acid (2TMS) 1.26+0.15 0.85+0.08

Glycine (2TMS) 1.04+0.09 *0.26+0.02

L-Valine (2TMS) 0.92+0.05 *0.25+0.02

L-Isoleucine (2 TMS) 0.90+0.08 1.24+0.06

L-Proline (2 TMS) 0.91+0.05 -

Succinic acid (2TMS) 1.34+0.17 *0.16+0.02

Fumaric acid (2TMS) 0.84+0.06 *0.23+0.06

L-Serine (3 TMS) 0.84+0.03 *0.02+0.001

L-Threonine (3 TMS) 0.92+0.04 -

Glutamine 1 0.64+0.09 -

L-(-)-Malic acid (3 TMS) 0.88+0.11 *0.34+0.06

L-Aspartic acid (3 TMS) 0.66+0.10 -

Butanoic acid 4amino(TMS) GABA 1.30+0.11 *0.11+0.004

L-Cysteine (3 TMS) - -

2-Ketoglutaric acid methoxime (2TMS) - -

L-Glutamic acid (3 TMS) - -

L-Phenylalanine (2 TMS) - -

Citric acid (4TMS) 0.88+0.07 *0.21+0.03

D-(-)-Fructose-2 (TMS) 0.97+0.09 *2.09+0.09

D-Glucose-6-P-1 - -

D-(+)-Sucrose 0.93+0.07 1.67+0.23

D-(+)-Trehalose 1.43+0.38 -




164

Appendix 6: Metabolite ratios for Phi-treated and non-treated cells from ME analysis

Chemical Class Metabolite Name Ratio (Day 1 Phi/Day 1) Ratio (Day 9 Phi/Day 1)

Amino Acids L-Alanine *0.84+0.03 *0.06+0.01

L-Valine *0.75+0.06 *0.19+0.02

Glycine 1.04+0.12 *0.17+0.01

Hydroxyproline 0.69+0.09 *0.68+0.06

Pyroglutamic acid 0.58+0.06 *0.03+0.002

Gamma-Aminobutyric acid

1.07+0.06 *0.09+0.01

L-Phenylalanine 0.52+0.18 *0.05+0.01

L-Proline 1.24+0.12 *0.09+0.01

Nicotinic acid *0.64+0.12 0*.04+0.002

Unknown Pentasiloxane, dodecamethyl-, MS92, RI1152.7

1.02+0.07 *1.73+0.06


0.8+0.09 *1.49+0.16


1.05+0.06 *0.12+0.01


1.04+0.11 *16.27+1.11


0.93+0.03 *4.65+0.35


1.01+0.07 *1.75+0.21

Galactonic acid (6TMS), MS90, RI1980.7

*0.76+0.05 1.02+0.14


*0.85+0.03 *3.63+0.54


*0.72+0.05 1.03+0.16


*0.7+0.06 0.65+0.12

Allantoin 0.64+0.10 *0.24+0.05

Oleic acid, trimethylsilyl ester, MS89, RI2214.4

0.91+0.06 *3.00+0.12

165

Gamma-hydroxybutyric acid (2TMS), MS89, RI1236.5, Putative but Unconfirmed

1.21+0.19 *0.14+0.01


*0.83+0.04 *4.59+0.37


0.99+0.04 *2.95+0.11

Unknown Probable Disaccharide, RI2748.9

0.91+0.10 *4.51+0.69


0.86+0.05 *3.46+0.5


0.94+0.03 3.4+0.61

Unknown Probable Sugar Acid Derivative, RI1653.9

0.95+0.25 2.36+0.55


0.80+0.03 *1.62+0.13

Inorganic Ions and Gases

Phosphoric acid 0.99+0.03 0.96+0.04

Dicarboxylic Acids Succinic acid 1.11+0.12 *0.12+0.02

Fumaric acid 0.76+0.06 0.24+0.04

L-Malic acid 0.74+0.14 *0.31+0.08

Fatty Acids Palmitic acid - -

Stearic acid - -

Carbohydrates Sucrose 0.79+0.08 *1.4+0.07

D-Maltose 0.93+0.05 *1.92+0.17

D-Fructose *0.8+0.06 *1.64+0.16

D-Galactose 0.77+0.11 0.8+0.19

D-Glucose 0.88+0.12 *2.66+0.27

Cellobiose 1.05+0.09 *1.62+0.16

Trehalose 0.78+0.07 0.86+0.09

Alcohols and Polyols Sorbitol 0.85+0.09 0.71+0.12

Sugar Phosphates Glucose 6-phosphate *0.63+0.09 0.71+0.10




Documents

Arabidopsis thaliana cell suspension culture as a model system to … · Arabidopsis thaliana cell suspension culture as a model system to understand plant responses under phosphate