BIOTECHNOLOGY is the use of biological organisms processes

Presentazione standard di PowerPointto the processing of materials by microorganisms
BIOTECHNOLOGY is
Their genetic traits are used in genetic exchange, recombination and engineering
Many of them are suitable host for heterologous expression
they grow and multiply rapidly, it is possible to observe several generations in a fairly short time
microbes are endowed of highly useful features
sawubona Γ δ

Without them, biotechnology would not be as advanced as it is, nor would it include such a broad range of applications
they are used to study the common processes to all living organisms
Many microbial products can be useful (e.g. antibiotics, bioinsecticides bioherbicides, biofungicides, polymers…)
And, indeed, microbes actually are a fundamental element of biotechnology
BIOTECHs
The Rainbow code of biotechnology
The colour code one is the most popular classification of biotechnology
Most commonly only four, major colours are considered:
red, (medical)
green (agricultural)
white (industrial)
However, some classifications use, nearly all tones of rainbow
WHITE: Gene-based industry Is aimed to the transition from traditional biocatalytic processes (pharmaceuticals, cosmetics, fine chemicals and food additives)
Due to their peculiar metabolic features, microbes intervene in all the colours of biotechnology
production of biodegradable polymers (e.g. microbial carbon reserves such as the PHB -poly- hydroxy butyrrate- can be exploited to obtain bioplastics)
production of fuel starting from renewable resources or by the use of photosynthesizing microorganisms (including the genetically modified ones)
Microbes can act directly or serve as enzyme donors or be used as hosts for heterologous productions
RED (medical) • vaccines and antibiotics production
• Developing of new drugs, • molecular diagnostics techniques, • regenerative therapies • genetic engineering to cure diseases through genetic
manipulation microbes can act as:
delivery vectors
molecules donors
Inactivated pathogenic bacteria, able to enter the host cells, such as Salmonella, Shigella or Listeria can be used to deliver vaccines to the cytosol
GREEN Agricultural/ environment
Microbes are useful as
tools for the genetic manipulation of crops (Agrobacterium)
Selected microbial communities can be exploited to ameliorate soils and enter in synergistic interaction with plants
as molecule donors (e.g. B. thuringiensis)
GREY Environment protection 1) biodiversity maintenance
2) removal of contaminants
• molecular biology as applied to genetic analysis of populations and species in ecosystems, their comparison and classification
• cloning techniques aimed to preserve species and genome storage technologies
• pollutants removal or bioremediation
Besides to act as donors, hosts and vectors, microorganisms are used to isolate and dispose of different substances such as heavy metals and hydrocarbons
The Brown biotechnologies are devoted to study solutions and interventions to prevent and contain desertification
A good example of the possibilities offered by brown biotechnology is the fascinating project, developed by Magnus Larson, a Swedish architecture student, relaying on the studies of prof. Jason De Jong at University of California
In his thesis he proposed to use Bacillus pasteurii, which excretes gluing substances and calcium carbonate, to set the Sahara desert dunes as concrete within twenty four hours
Bacillus pasteurii is commonly found in wetlands regions, it is non- pathogenic and dies in the process of solidifying the sand
YELLOW Food production
yellow (nutraceutical) biotechnology is the more ancient one Its goal is to: Improve food by microbial processing eliminate allergens and intolerance-causing components Fortificate foods with health-promoting components
Special attention is paid to the “functional food” (health promoting or nutraceutical)
At the Bari University (South Italy) after long experimental trials, prof Gobbetti succeeded in creating a natural sourdoughable to destroy the wheat gluten while leaven the dough
His team uses a mixture of flour (wheat, rye, rice, etc…) and water, fermented by lactic acid bacteria and yeasts, which are able to leaven a dough, while
contemporarily acidifying it and eliminating the gluten
Sourdough lactic acid bacteria (LABs) and yeasts contribute to the organoleptic features of baked goods, by…
Of course, in yellow, so as in red microbial biotechnologies, microbes can also act as a marker
The NGS techniques offer the possibility to check the gut microbiota and study its dynamics
Microbes can also be the leading actors of probiotic-strategies (mainly lactobacilli and bifidobacteria have been studied)
exploitation of sea resources to create • products and • applications of industrial interest
BLUE Marine
2013 24 partners from academia established a consortium $13 million in European Union funding
DARK Warfare/ Bioterrorism
No comment… microbes are neither evil nor greedy; wickedness is in the hands of men
to identify microbes producing bioactive compounds for the production of drugs, food, and cosmetics
? Colour ? Microbial biotechnologies to save all the colours of art…
these works, and not only them, have been restored by using a bacterium
Fresco by Spinello Aretino at the monumental cemetery in Pisa
Pietà Rondanini (Michelangelo)
Milan cathedral steeples
The first traces of biological preservation methods (fermentation) date back to Neolithic (10000-6000 B.C.)
the Hammurabi‘s code (1792-1750 B.C.) decreed DEATH
for those who had: • prepared it out of the established rules
• Sold it without permission
The use of microbes is VERY ancient…
let’s think just of wine, beer, bread, or sauerkraut, cheese and fermented milk
It wasn’t until the mid-nineteenth century, indeed, that Pasteur demonstrated the role of yeasts in the alchoholic fermentation
While looking for the cause of beet juice turning sour instead of alcoholic
TODAY, biotechnology influences many aspects of our lives-The basic understanding of microbial genetics and physiology led to
more molecular biology tools
FOOD ADDITIVES (aa.; organic acids, fatty acids, vitamins) BIOFUELS
(ethanol, methane, hydrogen..)
SOLVENTS (acetone, butanol, ethanol..)
AGROCHEMICALS (feed additives, biopesticides..)
biochemicals, optically pure chiral molecules..)
natural isolates may be suitable but.. once taken from their native ecosystems, they could be not suitable for optimal biotechnology processes:
They could not be able to grow fast under the standard laboratory conditions
Or fail to produce high levels of the desired products
Which microbes for biotechnology?
Faster growing
Better producers
Well characterized strains are available in the international culture collections
But sometimes it’s a good idea to look for well suited microorganisms endowed of specific physiological features
By chasing them in their specific environments
THIS STRATEGY IS CALLED «BIOPROSPECTING»
AND/OR HYPERALINE
HOT
environments may be explored for microbes whose enzymes work optimally in those conditions
We could need enzymes suitable for processes at
COLD
CONDITIONS
Efficiently cellulase producing microbes will be looked for in cow’s or termites gut
New antimicrobials will be searched in highly competitive, stressing environments and so on
BAITING
E.g.: to isolate keratinolytic microorganisms, one could uses metal meshes, filled with wool and placed in the water
Sometimes, it’s possible to use specific substrates to attract and "capture" the desired microorganisms
Timely, the bait will be checked for the presence of adhering and
multiplying bacteria on it
Or, for cellulose degrading microorganisms the bait could be made of straw
Another baiting approach uses half glass-tubes
closed at both ends with filters of about 100 microns, so to stop insects and protozoa but let
the bacteria in
a suitable culture medium is poured into the devices
That are tied on the surface of trunks, branches or leaves
Timely, the devices are stamped on the surface of suitable media, to isolate the growing bacteria
Each stamp can be roughly regarded as a ten-fold dilution
A very good example of a successful bioprospecting approach, is the finding of the Penicillium isolate that allowed to produce penicillin on a large scale
The Fleming isolate (P. notatum) was a very poor penicillin producer
(<40 units/ml in the best culture conditions)
It was not able to grow in the submerged culture necessary for large scale production
Nor derivatives able to do so could be obtained
The second World war was underway and the ask for penicillin was very high
A scientist staff in Peoria (Illinois) started to look for a similar strain able
to grow well in submerged culture
everyone over the world was asked to send samples of blue-green molds
a young woman (Mary Hunt) was employed to scour the markets in Peoria
for blue-green or similar molds
military personnel scooped up soils from several exotic locations
She was used to be called "Moldy Mary”
At last, it was a moldy cantaloupe covered with a “pretty, goldy mold”,
that provided the desired strain
That mold turned out to be a highly productive strain of the related species Penicillium chrysogenum
Its yield, in submerged culture reached up to 70-80 units/ml
From this strain, an industrial highly producing mutant was obtained
up to 250 units/ml
but microbial strains, can be improved by
In microbial biotechnology, indeed, the production is ultimately limited by the genetic and physiological characteristic of the microbial strains
• modifying the metabolic characteristics of the strain
• introducing new genes • altering the expression of existing ones
the Peoria strain, as many other industrial microorganisms, was obtained with in vivo random mutagenesis
With UV or X rays and/or DNA- damaging chemicals
In vivo chemical mutagenesis induces changes across the entire genome
It has the advantage of selecting for non-lethal mutations, as the cells must replicate to detect the changes
A drawback is that we do not actually know how many mutations have been introduced and where, so that some unpredictable consequences could occurr
e.g. The Lenape potato, developed in the 1960s for the snack business, made a very fine potato chip. Unfortunately, it was also toxic..
1) Random Mutagenesis
2) Site directed Mutagenesis
Besides the in vivo mutagenesis, performed on living cells, molecular biology has provided us with powerful tools for in vitro mutagenesis
To obtain casual mutations, and screen for favourable ones
.
In vitro Random Mutagenesis
Whenever the encoding gene is known, it’s possible to apply an in vitro approach to obtain several mutants of an enzyme. To achieve this goal,
we can employ different techniques
amplify the gene
Introduce the random mutations
screen
CHEMICAL MODIFICATION In 2004 Lai et al. described the use of the alkylating agent ethyl
methanesulfonate (EMS) for in vitro mutagenesis in the coding region of a gene
EMS results in G-T mismatches through introduction of AT to GC and
GC to AT transitions
Nitrous acid is another mutagenic agent which acts by deaminating adenine and cytosine residues and causing
transversion point mutations (A/T to G/C and vice versa)
The extent of mutagenesis can be altered by changing the reactions conditions incubation time and temperature
pH
Mutagen concentration
ERROR-PRONE PCR a “sloppy” version of PCR, in which the polymerase has a fairly high
error rate (up to 2%). This can be done by
increasing MgCl2
adding MnCl2
The process can be repeated through many rounds of selection
point mutations ( ) are the most common ones in EP-PCR, but deletions and frameshift mutations are also possible
EP-PCR EP-PCR
Chemical methods avoid the bias that PCR-based mutagenesis has toward AT to GC transversions, but the last one is easier and does not employ dangerous substances
After the amplification, the library of mutants-coding sequences has to be cloned into a suitable plasmid vector
The efficiency of the cloning step limits the library size
excessively altered conditions poor amplification and undesired amplicons
Possible drawbacks
Taq polymerase has a bias toward inducing mutations in A and T bases
ERROR-PRONE ROLLING CIRCLE AMPLIFICATION (RCA) is a variant of EP-PCR
The wild-type sequence is cloned into a plasmid
the whole plasmid is amplified under error-prone conditions
The EP-RCA eliminates the ligation step that limits the library size in conventional error-prone PCR
Giving rise to plasmid concatemers
Once trasformed, the concatemers circularize in the cell by “in vivo” intramolecular homologous recombination
and a mutants library is obtained in the host strain
EP-RCA Transformation
MUTATOR STRAINS
A commercially available mutator strain, is the E. coli “XL1-Red” (Stratagene)
Are deficient for one or more genes of the primary
DNA repair pathways
So that they make errors while replicating their DNA, including
the cloned plasmid
of mismatches)
activity of the DNA pol.III)
mutT, encoding a phosphatase which specifically dephoshorilates 8oxo dGTP to the corrisponding monophosphate
8oxo dGTP is a oxidatively damaged form of guanine which is inserted opposite dA and dC residues of template DNA with almost the same efficiency thus leading to A/T to G/C transversions.
MUTATOR STRAINS
And then used to transform the mutator strain
In a mutator strain a wide variety of mutations can be obtained including substitutions, deletions and frame-shifts
BUT.. As more and more mutations
accumulate in their genome, many cells stop growing or transforming
MOREOVER To keep stock cultures of a mutator
strain becomes by and by more difficult
each copy of the plasmid is potentially different from the
wild-type one
TEMPORARY MUTATOR STRAINS
…are not commercially available but can be built “in the lab”
mutD5 is a dominant negative version of mutD which limits the cell’s ability to repair DNA lesions
allow the cells to cycle
between: the overexpressing of mut5D from an inducible promoter
Mutator (mutD5 ON)
Normal (mutD5 OFF)
During the normal growth the cells can recover, differently from the conventional mutator strains
mutD5
Inducible promoter
The following steps (culturing, analyzing and screening, of the mutants require a strict shut-off of mutD5
A further possibility is..
Then it’s possible to remove the mutagenic plasmid, restoring the normal repair systems
to clone mutD5 in a plasmid with a temperature-sensitive origin of replication…
Making easier to grow, analyze and screen the mutants obtained during the mutator
phase
Olga Selifonova et al. Appl. Environ. Microbiol. 2001;67:3645-3649
Transformation With pmut
Growth, mutagenesis
selection curing
Acceleration of the evolution of a microorganism by using a mutator plasmid
multiple rounds of growth and selection
Often, natural enzymes are not so well suited for biotechnology applications, because of the distinct conditions and different demands
Laboratory evolution methods are now used widely to fine-tune the selectivity & activity of enzymes
DIRECTED EVOLUTION
Generation of ‘large’ variant libraries
Rapid screen or selection for desired function
DNA SHUFFLING: homologues genes are recombined in vitro.
Different members of the gene family are fragmented using DNase
the fragments are then randomly re-joined by self-priming PCR
And amplified again with external primers
Shuffling allows to test the effects of different
combinations of mutations
Due to the screening methods (activity in the desidered conditions) this method promotes the selection of favourable mutations and eliminates the negative ones
PRE-DETERMINED, NON CAUSAL MUTATIONS CAN BE INTRODUCED BY SITE DIRECTED MUTAGENESIS
First introduced by Michael Smith (Canada, late 70s)
The techniques can be divided in two main groups
enzymatic extension of a mutagenic oligonucleotide annealed to a DNA template
cassette mutagenesis
In cassette mutagenesis a gene is constructed by ligating a series of synthetic oligonucleotides, cloned and transformed
Anneal two synthetic complementary oligonucleotides
Ligate with the plasmid transform
Cut and remove the WT fragment
Unfortunately, unique, conveniently spaced restriction endonuclease recognition sites in the desired place are not usually available
ssDNA cloning vector + source DNA
transformation
This procedure derived from a series of experiments which demonstrated that:
a single-stranded DNA template can be converted to a double- stranded molecule in vitro
ssDNA
extension Heteroduplex
ds DNA
Mutants selection
the DNA polymerase needed a short oligonucleotide primer to initiate the synthesis of DNA
This method does not yield an high frequency of mutants
enzymatic extension of a mutagenic oligonucleotide
Another method is the “megaprimer PCR”
The first PCR round (PCR1) is performed with
an external fwd Low Tm primer (a)
The mutagenic primer (m)
The mutagenic product (megaprimer - Mp) acts as the reverse primer in the second step
By adding another external (High Tm) primer “b”
Which uses three primers and two PCR rounds
PCR1 (low annealing temp) a
m
Mp
b
Mp
PCR2 (high annealing temp)
A further modification is the “Quickchange” technique that employs DsDNA, overlapping primers and template degradation
Two identical complementary mutagenic primers (~ 40-50 mer) are designed, and annealed to the region to be modified
The primers are extended with an high fidelity DNA polimerase; the two
complementary amplimers anneal by homology
DpnI (GATC) digests the parental methylated and hemimethylated DNA as it cuts the specific
sequence only if A is methylated (m6A)
After transforming, the E. coli DNA ligase repairs the nicks
SUBSTITUTIONS: the desired nucleotide change(s) are incorporated in the center of the Fwd primer, with at least 10 complementary nts at the 3’ side of the mutation(s)
The reverse primer is designed to anneal back to back with the fwd one
DELETIONS are simply created with a standard couple of primers flanking the region to be deleted
≥ 10 nts
Several effects can be obtained by muddling around the primers
SMALL INSERTIONS: up to 6 nts can be added to the 5’ end of the fwd primer
≥ 10 nts
The reverse primer is designed to anneal back to back with the 5’ end of the complementary region of the fwd one
LARGE INSERTIONS: are obtained by incorporating half of the nts to be added to the 5’ end of each primer
≥ 10 nts
≥ 10 nts
“TRADITIONAL” HOSTS
Escherichia coli
Bacillus subtilis
many vectors and expression systems available
Bacteria
«PROMISING» HOSTS endowed of interesting features and deserving further studies
Streptomycetes
BACTERIA
FUNGI
There is still a poor choice of vectors and expression systems…
Lactic Acid Bacteria (LABs)
Bacterial advantages
Aploidia (easy to manipulate)
“equipped” transcription cosmids translation artificial
chromosomes
LPS (Gram-negative
human use
number regulation
recombinant cells
«MANAGEMENT» OF THE CLONED DNA (particular features e.g. those need to DNA transfer, fusion
with reporter genes or tags, phage display…)
plasmids can be single-, multi- and high-copy, depending on the average number of copies found in each host cell
whichever the bacterial host, the plasmids used for engineering are characterized by
the average number of copies is ruled by the replication origin
Plasmid replication is controlled by positive and negative regulators
Partition proteins are involved in distribution between the
daughter cells
If the positive regulator is a protein
The plasmid depends upon protein production to replicate
If the positive regulator is an RNA
The plasmid still replicates even if protein production stops
RELAXED CONTROL (usually medium-high copy number)
The plasmid replicates independently from the bacterial
chromosome
STRINGENT CONTROL (usually low copy number)
By culturing under low chloramphenicol concentrations (10–20 μg/ml)
relaxed low copy plasmids, can be amplified by halting protein production with chloramphenicol, which inhibits the protein synthesis of the host
the plasmid goes on replicating for several hours, due to the long lasting already present polymerases
By adding chloramphenicol when the culture reaches a high density and then continuing
incubation for a number of hours
The inhibition of protein synthesis is only partial, but positively biases the plasmid replication
resulting in a 5–10- fold greater yield of plasmid DNA up to 2000–3000 copies/cell
plasmids fall into “incompatibility groups” basing on their replication strategy
If two different plasmids, share the same replication mechanism, they cannot coexist in the same cell, due to the competition for the replication factors
Cell cycle 1 plasmid
Cell cycle 2 plasmids
The two plasmids have different origins: both
plasmids replicate
The cell grows and prepares to divide: two plasmid origins must be available for the partitioning
Each daughter cell is endowed with a copy of each
plasmid
Cell divides
The cell doesn't distinguish between the identical origins, which are regarded as two copies of the same plasmid
any further replication is prevented
Cell cycle 2 plasmids same group
until the two plasmids have been segregated to different cells, to create the correct pre-replication copy number
Each daughter cell receives 1 copy of the same origin, but a different plasmid
this can be exploited to perform a plasmid shuffling
It is possible to dislodge a plasmid with another one belonging to the same group
And applying the right selection for the desired one. By using T
sensitive origins it is possible to eliminate the second plasmid too
plasmids usually advantage their hosts by enhancing fitness and/or resistance, so that it is often possible to select the bacterial cells which bear them
the artificially designed vectors, aimed to be used in microbial biotechnology, always include a selection marker
In bacteria, this is usually an antibiotic resistance, unless different requirements have to be satisfied
SCREENING MARKERS
Besides to the marker needed to select the trasformed bacterial cells, it is highly wishable to detect the trasformants harbouring a charged plasmid
A screening marker will cause the cells that received the cloned gene, to grow or to look in a different manner
Trasformation
selection
screening
the most frequently used screening markers are those conferring features that can be detected by hystochemical techniques
Whichever the microbial host, occasional yield difficulties could be due to
CODON USAGE
INCLUSION BODIES
METABOLIC STRESS
the Universal code is not always so universal as it could seem.
mycoplasms translate UGA as «Tryptophan»
So as some protozoa (e.g.) Toxoplasma gondii
MOREOVER..
ARG (AGA)
LEU (CUA)
ILE (AUA)
PRO (CCC)
GLY (GGA)
E. coli B 2,1 2,4 3,4 5,0 2,4 8,2 E. coli K12 1,2 2,1 3,9 4,3 5,5 7,9 Anabaena 2,6 8,3 14,0 8,3 13,0 12,4 B.megaterium 2,7 9,1 10,9 10,3 2,9 26,2 B.subtilis 3,9 10,5 4,8 9,3 3,3 21,8 Caulobacter 2,2 0,8 1,4 0,6 18,7 4,3 S.carnosus 0,4 7,9 4,6 9,8 0,8 16,7 S. lividans 4,0 1,1 0,6 0,8 22,7 6,5 Arabidopsis 10,9 18,9 9,9 12,6 5,3 24,2 Caenorhabditis 4,0 15,4 7,9 9,4 4,4 31,6 C. tetani 5,0 25,5 11,2 67,4 1,8 34,6 Drosophila 6,3 5,2 8,2 9,5 18,0 17,7 Homo sapiens 11,9 12,0 7,2 7,4 19,9 16,5 H. sapiens (mit) 0,4 0,4 70,4 44,5 33,9 18,9 Plasmodium 3,3 17,0 5,3 40,8 3,0 20,0 Pichia pastoris 6,6 20,2 10,9 11,7 6,7 19,1 S. cerevisiae 9,3 21,3 13,4 17,8 6,8 10,9
The usage frequency is uneven among different organisms
CATATT! TGGCATGCTACT TCTCCAGAATGTATTGAATCT ATTTCT
Just 36.2% homology shared
If the rare codons in a cloned fragment are >15/1000 the fragment itself will be hardly expressed in E. coli
Frequences of codon usage in E. coli: some codons are quite rarely used
So, the probability to succeed in the over-expression of a gene, depends also upon the compatibility of codon usage between the heterologous DNA and the host
The tRNA pool composition, in a cell, depicts its codon usage and rare codons can bias the translation process
Mathematical methods can be applied to get an approximate indication of the likely success of the heterologous gene expression
While choosing an host, this should be kept in mind
Causing the ribosome to stall, an early termination of translation, frameshifts and mutations due to erroneous incorporation of aminoacids
The most frequently used method is the “Codon Adaptation Index” (CAI)
Proposed by Sharp e Lee (1986)
That assigns to each codon a statistical value (RSCU) according to usage frequency in an organism
The RSCU (Relative Synonymous Codon Usage) value is the observed frequency of a codon divided by the expected frequency under
the assumption of an equal codon usage
RSCU values for E. coli
RSCU
AGA 0.04 0.21
AGG 0.02 0.21
CGA 0.06 0.11
CGC 0.4 0.18
CGG 0.1 0.20
CGT 0.38 0.08
ONE OF THE MAIN CHALLENGING DIFFERENCE IN CODON USAGE BETWEEN HUMAN AND BACTERIAL GENES CONCERNS ARGININE
To do this, the RSCU is raised to the nth power, where n is the number of times that a certain codon is used within the analysed ORF
Finally, we have to multiply all of the obtained powers
The RSCU value is needed in order to calculate the single observed CAI value (CAIobs) for each aminoacid (CAIobs-a)
E.g. in one peptide, Ala is coded 7 times by a GCA codon
The first CAIobs (a) will be 1,0997= 1.9363 Its RSCU value is = 1.099
is the “CAIobs” of the peptide.
CAIobs (a1) x CAIobs (a2) x.. CAIobs (an)
3 more Ala residues are encoded by GCC (0.228)
The second value we are looking for is 0.2283 = 0.0118
And raise them to 1/n*
When computing «n», of course, the aa coded by a unique triplet (M, W) are not taken in account
The product of all the powers
Es.: 7 Alanine GCA+3 Ala GCC 1.9363 x 0.118 = 0.0228
The first CAImax (a) value is 1,877 (7+3) =542.80
The best RSCU for Ala (1.877) is the GCT one
Is the “CAImax” of the peptide
CAImax(a1) x CAImax (a2) x.. CAImax (an) =CAImax
Now the CAI max (a theoric value) must be calculated, by assuming that every aminoacid in the peptide is encoded by the best possible codon
Raised to 1/n
CAIobs CAImax = CAI
As it is a ratio, the maximum possible value is «1»
In Saccharomyces, Tipically the proteins with CAI values ranging from 0.1
to 0.3, are the regulative ones
Usually, in E. coli The CAI value of A highly expressed protein is in the range 0.7 - 1 A moderately expressed protein is about 0.5 A scarcely expressed protein is lower than 0.3
RESUMING..
CAIobsa= the RSCU value of a codon ^n° of times that it is actually used
CAIobs: the product of all the obtained powers, raised to 1/N (N= number of the residues other than M and W, in tha peptide)
CAI maxa: RSCUmax, raised to the total number of residues of an aminoacid, found in the peptide
CAI max: product of the CAImaxa powers
CAI: CAIobs /CAI max
The more the CAI value approximates 1 the higher the likelihood of expression in that host
The peptide “AN ALARMING DIARRHEAL DISEASE” Is equally coded by the “A”
Or the “B” fragment
GCG AAC GCG CTG GCG CGT ATG ATT AAC GGT GAT ATT GCG CGT CGT CAC GAA GCG CTG A N A L A R M I N G D I A R R H E A L
GAT ATT AGC GAA GCG AGC GAA D I S E A S E
GCC AAT GCC CTA GCC AGG ATG ATA AAT GGA GAC ATA GCC AGG AGG CAT GAG GCC CTA A N A L A R M I N G D I A R R H E A L
GAC ATA TCA GAG GCC TCA GAG D I S E A S E
the two peptides are identical but the CAI value of the two DNA fragments, with the E. coli RSCU values, are 0.97 and 0.3, respectively
A good yield of ANALARMINGDIARRHEALDISEASE in E. coli, is likely with the nucleotidic sequence «A»
The «B» fragment is not suitable for the expression in E. coli
but it could still be expressed in a satisfactory manner by choosing another host as Saccharomyces cerevisiae (where the CAI value would be 0.65)
Complete RSCU tables are available for the more frequent employed hosts
such as E. coli, B. subtilis and S.cerevisiae
See for example: http://www.biologicscorp.com/tools/CAICalculator#.VhavOHrtmko
It is possible to engineer a heterologous DNA fragment to lower the rare codons amount. This is especially useful when
they concentrate in one or a few regions
TGTATAATGGAAACTACA GACCGCGACATA…
Silent mutations can cause expression variations up to 40 percent
With these procedures, very often the yield increases
WHY?
Welch et al (2009): demonstrated that the yield is also biased by the ability of tRNAs to stay amino-acylated
And observed a better improvement in the first case
They tried to substitute the negative codons with:
2) More frequent tRNAs
1) Stabler tRNAs
This phenomenon seems to be mainly linked to some Serine, leucine and threonine codons, that are rather rare but very stable
but, sometimes, it does not
antibody fragment obtained with optimized codons (A) Vs the same fragment, from the original sequence (B)
INCLUSION bodies
densely packed denatured protein molecules in the form of particles
They must be treated in vitro to renaturate and solubilize the proteins, but the extent of success is hardly predictable
Some strategies are: To lower the incubation temperature
To Secrete the proteins into the periplasm
To employ engineered hosts
METABOLIC BURDEN
is the amount of resources (raw material and energy) that are taken from the host cell metabolism for foreign DNA
maintenance and replication
When producing plasmid DNA in E. coli, a number of biological restraints, triggered by plasmid maintenance and replication as well as culture conditions, are responsible for
limiting the final biomass and the product yields:
Host metabolic stress and plasmid stability cannot be dissociated from each other since the
presence of plasmids can impose a metabolic burden on the host cell
Copies number
Integrate the foreign DNA in the chromosome
Use of a low copies number plasmid
Some possible solutions:
By increasing the plasmid copies number, indeed, the growth rate decreases, so limiting the yield of
plasmid DNA or heterologous proteins
Relative growth rate
Low oxygen levels
An excessive increase in the number of copies of the plasmid
An excess of heterologous protein accumulated in the cell
Some possible consequences are:
Proteases activation
Mistranslations
Uneven distribution of both oxygen and nutrients to the cells
Diapositiva numero 1

Documents

BIOTECHNOLOGY is the use of biological organisms processes