Bulb and Root Rot in Lily ( Lilium longiflorum ) and Onion ( Allium cepa ) in Israel

ORIGINAL ARTICLE

Bulb and Root Rot in Lily (Lilium longiflorum) and Onion (Alliumcepa) in IsraelSara Lebiush-Mordechai1, Orly Erlich1, Marcel Maymon2, Stanley Freeman2, Tslila Ben-David3, Tal Ofek3,Eric Palevsky3 and Leah Tsror (Lahkin)1

1 Department of Plant Pathology and Weed Research, Agricultural Research Organization (ARO), Gilat Research Center, M.P. Negev, Israel

2 Department of Plant Pathology and Weed Research, Agricultural Research Organization (ARO), Beit Dagan, Israel

3 Department of Entomology, Agricultural Research Organization (ARO), Newe-Ya’ar Research Center, Ramat Yishay, Israel

Keywords

bulb diseases, Fusarium, Pythium, Rhizoctonia

Correspondence

L. Tsror (Lahkin), Department of Plant

Pathology and Weed Research, Agricultural

Research Organization (ARO), Gilat Research

Center, M.P. Negev, Israel.

E-mail: [email protected]

Received: June 26, 2013; accepted: November

9, 2013.

doi: 10.1111/jph.12214

Abstract

In the past 10 years, there has been a substantial increase in reports, from

growers and extension personnel, on bulb and root rots in lily (Lilium lon-

giflorum) in Israel. Rot in these plants, when grown as cut flowers, caused

serious economic damage expressed in reduction in yield and quality. In

lily, the fungal pathogens involved in the rot were characterized as binu-

cleate Rhizoctonia AG-A, Rhizoctonia solani, Pythium oligandrum, Fusarium

proliferatum (white and purple isolates) and F. oxysporum, using morpho-

logical and molecular criteria. These fungi were the prevalent pathogens

in diseased plants collected from commercial greenhouses. Pathogenicity

trials were conducted on lily bulbs and onion seedlings under controlled

conditions in a greenhouse to complete Koch’s postulates. Disease symp-

toms on lily were most severe in treatments inoculated with binucleate

Rhizoctonia AG-A, P. oligandrum and F. proliferatum. Plant height was lower

in the above treatments compared with the control plants. The least

aggressive fungus was R. solani. In artificial inoculations of onion, seedling

survival was significantly affected by all fungi. The most pathogenic fun-

gus was F. proliferatum w and the least were isolates of F. oxysporum (II

and III). All fungi were successfully re-isolated from the inoculated plants.

Introduction

Commercial production of lily in Israel, cultivated

mainly in the Upper Gallile, encompasses

approximately 20% of the total flower-growing area

(Luria, Min. Agric., personal communication). Lilium

longiflorum comprises about 90% of the different vari-

eties and is grown in greenhouses (80 ha of nursery,

120 ha of cut flowers) (Luria, Min. Agric., personal

communication). During 2001–2005, there was a sub-

stantial increase in reports from growers and exten-

sion personnel regarding bulb and root rots of lily in

Israel, causing serious economic damage resulting in

reduction in yield and quality of the cut flowers.

The optimal conditions for lily production in green-

houses are also suitable for the development of vari-

ous phytopathogenic agents causing root and bulb

rot, which affect development of plants, flower qual-

ity and total yield. Among the fungal diseases of lily,

basal decay (bulb root) caused by a single infection of

Fusarium oxysporum or compound infections of F. oxy-

sporum with other pathogens is common and the most

serious observed (L€offler et al. 1995; Lawson and Hus

1996). The soil-borne fungi Rhizoctonia, Pythium and

Fusarium were previously reported as pathogens that

occur worldwide and cause serious diseases in Asiatic

lilies (Lawson and Hus 1996). The predominantly

reported symptoms include brownish rot at the base

of the bulb scales, which spreads over the whole bulb.

Plants from field-grown bulbs often continue to

express the disease complex rather than any one sin-

gle disease. If replanted and grown again under warm

conditions, the bulbs may be damaged and rotten by

Rhizoctonia, Pythium and Fusarium (Bald et al. 1971).

J Phytopathol 162 (2014) 466–471 � 2014 Blackwell Verlag GmbH466

J Phytopathol

In Israel, onion is produced in open fields on area of

ca 1200 ha all over the country, from the Golan

Heights in the north to Arava valley in the south.

Rotting and wilting of onion bulbs and plants are

common. Wilting of onion plants with rot of the

basal plate of the bulb has been related mostly to

F. oxysporum f. sp. cepae (Lacy and Roberts 1982).

However, F. proliferatum was recently reported as the

predominant fungal species isolated from root and

bulbs of onion and garlic plants (Stankovic et al.

2007).

The objectives of the current study were to identify

and characterize the causal agents of bulb and root rot

in lily plants grown under greenhouse conditions and

onions grown in open fields in Israel.

Materials and Methods

Isolation and identification of pathogens from diseased

lily and onion plants

Random samples of diseased lily plants including

bulbs were collected from 51 greenhouse locations

and examined for the presence of pathogens; each

sample consisted of 5–10 plants. Stems, roots and

bulbs were washed, surface-sterilized with 0.3%

sodium hypochlorite for 10 min and dried in a lami-

nar flow cabinet. Segments (5 mm long) from roots,

bulb basal plate, scale leaf and stems were sampled

using a scalpel and plated on potato dextrose agar

(PDA; Difco Laboratories, Detroit, MI, USA) medium

supplemented with 100 ppm streptomycin sulphate,

on a minimal medium containing 2 g/l sorbose,

18 g/l agar and 100 ppm streptomycin sulphate, and

cornmeal agar (CMA; Difco Laboratories). After

incubation of the Petri dishes for 4–5 days at 27°C in

the dark, the fungi were identified microscopically.

In addition, diseased onion plants including their

bulbs were sampled from two locations (open field)

and examined for the presence of pathogens as

described previously for lily; each sample consisted of

25–40 plants.

All fungal isolates (Table 1) were classified to the

genus level by means of taxonomic keys including

macroscopic characteristics of the colony, as well as

microscopic structures. Binucleate Rhizoctonia was

identified by the Identification Service Central bureau

voor Schimmel cultures, Utrecht, Netherlands. Fusari-

um spp. isolates were molecularly identified using

the translation elongation factor EF-la, nuclear ribo-

somal internal transcribed spacer (ITS), b-tubulin and

H3 histone genes. Portions of the genes were PCR-

amplified and sequenced.

Isolation and purification of fungal DNA

Mycelia from 25 ml of potato dextrose broth cultures

were collected by vacuum filtration and lyophilized

until dry. DNA was extracted and purified as previ-

ously described (Freeman et al. 1993). The purified

DNA was dissolved in 0.5 ml of Tris–EDTA buffer

(10 mM Tris–HCl, 1 mM EDTA at pH 8.0) to a concen-

tration of 200–500 lg/ml and diluted to a concentra-

tion of 100 ng/ll for PCR.

PCR amplification

Translation elongation factor (EF-1a) gene was ampli-

fied using the primers EF 1a (5′ATGGGTAAGGA(AG)GACAAGAC 3′) and EF 2a (5′GGA(AG)GTACCAGT(GC)ATCATGTT 3′) as previously described (O’Don-

nell et al.1998).

Universal PCR primers ITS5 (5′ GGAAGTAAAAGTCGTAACAAGG 3′) and ITS4 (5′ TCCTCCGCTTATTGATATGC 3′) were used for the amplification of ITS1

and ITS2 regions between the small and large nuclear

rDNA, including the 5.8S rDNA, as described by

White et al. (1990). The b-tubulin gene was amplified

using the primers T1 (5′ AACATGCGTGAGATTG

TAAGT 3′) and T22 (5′ TCTGGATGTTGTTGGGAATCC3′) (O’Donnell and Cigelnik 1997). The H3 histone

gene was amplified using the primers H3-1a (5′ACTAAGCAGACCGCCCGCAGG 3′) and H3-1b (5′ GCGGGCGAGCTGGATGTCCTT 3′) as previously described

(Steenkamp et al. 2000).

Nucleotide sequence accession numbers

DNA sequences determined in this study have been

deposited in GenBank under accession numbers

KF222553 to KF222576.

Table 1 Collection sites and plant hosts for the fungi isolates used in

this study

Fungi species

Isolate

number

Isolate

colour Host Site

Fusarium oxysporum I White Onion Beit She’an

Fusarium oxysporum II Purple Lilly Be’erotayim

Fusarium oxysporum III Dark purple Onion Beit She’an

Fusarium proliferatum W White Onion Beit She’an

Fusarium proliferatum W White Lilly SdeYitzhak

Fusarium proliferatum P Purple Lilly Ahituv

Rhizoctonia solani Lilly Ein Habesor

Binucleate

Rhizoctonia AG-A

Lilly Kfar ha-Ro’e

Pythium oligandrum Lilly Kfar ha-Ro’e

J Phytopathol 162 (2014) 466–471 � 2014 Blackwell Verlag GmbH 467

S. Lebiush-Mordechai et al. Bulb and root rot in lily and onion in Israel

Pathogenicity tests on lily

Two pathogenicity tests (experiments A and B) to

complete Koch’s postulates were conducted under

controlled conditions in a greenhouse (25 � 3°C).Many disease-free lily bulbs, variety ‘Osnat’, obtained

from a commercial farm, were used for the experi-

ments after testing a sample of 10 bulbs of 150. The

bulbs were planted in 1.5-L pots containing per liter,

and 1 month later, inoculation with the tested

pathogens (Table 1) was carried out by adding coni-

dia (for Fusarium) or mycelium (for Rhizoctonia and

Pythium) at a concentration of 104–106 cfu/ml for

each fungus. The experimental design was a com-

plete randomized block with nine replicates for each

pathogen. Height and foliar disease symptoms of the

plants were monitored during 75 days. At the end of

the experiment, disease symptoms that developed on

bulbs and roots were assessed visually on an ordinal

scale from 0 to 10 (0 = healthy; 10 = completely rot-

ten), and pathogens were re-isolated. In an addi-

tional pathogenicity test (experiment C), using the

same experimental design, pathogen-free lily bulbs

from tissue culture were used. Inoculation was

conducted by placing 0.5-cm plugs of freshly grown

5-day-old mycelial PDA cultures on the wounded

bulb base, 16 bulbs for each pathogen. The bulbs

were incubated in a moist chamber (25 � 1°C, RH

95%) for 3 weeks. The experimental design was a

randomized block with four replications. Experi-

ments were conducted twice.

Pathogenicity tests on onion

Pathogenicity tests on onion seedlings were carried

out, in eight replicates, with the following fungi:

isolate of Fusarium proliferatum (white), Pythium

oligandrum, three isolates of F. oxysporum (I-III) and

binucleate Rhizoctonia AG-A (Table 1). Twelve seeds

of onion (Cv. ‘Ada 781’) were sown in a soil mix of

70% peat and 30% perlite (Shacham Givat Ada,

Israel) containing a slow release fertilizer 0.06 g/l

Osmocote (Scotts Miracle-Gro, Marysville, OH, USA)

in pots (360 ml). For the Fusarium isolates, 4 ml of

conidial suspension was added to each pot (4 9 105

conidia/pot), whereas for P. oligandrum, PDA plugs

of mycelium from 3-day-old colonies (1.8 9 103 per

pot) were used, covered by a thin layer of soil mix.

The experiment was conducted in a temperature-

controlled greenhouse set at 25°C �2°C. Forty days

later, the number of seedlings per pot was counted.

Surface-sterilized plant material was then placed on

PDA to assess fungal re-isolation. Experiments were

conducted twice.

Statistical analysis

Disease symptoms were analysed by analysis of vari-

ance (ANOVA). Means were compared with Student’s

multiple-range test at a significance level of P < 0.05.

Percentages were arcsine-transformed before analysis.

Results

Isolation and identification of pathogens from diseased

lily and onion plants

Symptoms on lily plants collected from commercial

greenhouses included chlorosis of leaves, wilting,

brown lesions on stem bases, bulbs and roots followed

by rotting of the roots and bulbs. Several fungi were

isolated from diseased plants (Table 2). In general,

the most prevalent fungi were F. proliferatum p and

Rhizoctonia spp (98% and 78% of samples,

Table 2 Prevalence of isolated fungi from lily plants sampled from commercial greenhouses in Israel (2001–2005)

Sampling

Region

Number of

samples

Incidence of infected bulbs (%)

Rhizoctonia solani

and Rhizoctonia

binucleate AG-Aa

Pythium

oligandruma

Fusarium

oxysporumb

Fusarium

proliferatum wb

Fusarium

proliferatum pbRhizoglyphus

robinic

North 30 97 37 60 25 93 70

Centre 16 56 7 20 56 100 38

South 5 80 40 20 20 100 80

78 28 33 34 98 63

aRhizoctonia spp. and P. oligandrm were isolated from root and basal plate.bFusarium spp. were isolated from root and basal plate and also from scale leaf, except F. proliferatum white, which was isolated from a basal plate

and scale leaf only.cPresence of Rhizoglyphus robini was visually evaluated.


Bulb and root rot in lily and onion in Israel S. Lebiush-Mordechai et al.

respectively). Rhizoctonia solani, binucleate Rhizoctonia

AG-A (Ceratobasidium cornigerum), Pythium oligandrum,

Fusarium oxysporum and F. proliferatum were fre-

quently isolated from the roots. The most common

species isolated from lesions on the basal plate of the

lily bulb were white and purple isolates of F. prolifera-

tum, binucleate Rhizoctonia AG-A and P. oligandrum.

From the external scales of the lily bulbs, Fusarium

oxysporum and the purple and white- F. proliferatum

isolates were frequently isolated. In 38–80% of the

diseased plants, large populations of the bulb mite

Rhizoglyphus robini were observed in rotting tissue

(Ben-David et al., 2005; Ofek et al. 2013).

Symptoms on onion plants sampled from commer-

cial open fields included brown lesions on stem bases,

bulbs and roots followed by rotting of the roots and

bulbs. The most prevalent fungi isolated from lesions

on the basal plates were white and dark purple iso-

lates of F. oxysporum and white isolate of F. prolifera-

tum (Table 1).

Pathogenicity tests

In artificial inoculations with each pathogen on lily,

symptoms appeared 1 week after inoculation as

chlorosis on lower leaves. Eight weeks later,

symptoms became more severe and were accompa-

nied by wilting (Fig. 1). Plants inoculated with binu-

cleate Rhizoctonia AG-A and P. oligandrum caused wilt

symptoms, emerging in the first month. At the begin-

ning of the second month of the assay, plants inocu-

lated with Fusarium and R. solani began to develop

disease symptoms (Fig. 1). Symptom development in

plants inoculated with Rhizoctonia AG-A was signifi-

cantly higher compared with those inoculated with

the other fungi and the control, 3–5 weeks after inoc-

ulation (Fig. 1). However, 8 weeks after inoculation,

symptoms on plants inoculated with Rhizoctonia AG-A

as well as with both F. proliferatum isolates (w, p) were

significantly higher than in the noninoculated control

plants. In plants inoculated with binucleate Rhizocto-

nia AG-A and P. oligandrum, rotting of the stem base

was also observed. Stem height was reduced in all

treatments (plants were 3–9 cm shorter); however,

significant reduction in stem height was seen only in

inoculation with Rhizoctonia AG-A (Fig. 1).

In experiment A, root symptoms were significantly

higher in all treatments compared with the control

(Table 3). The highest symptoms (DI >5) were seen in

plants inoculated with Rhizoctonia AG-A, P. oligandrum

and F. proliferatum w. Root weight of inoculated

plants was significantly reduced compared with the

ab

b

ab

ab

ab

ab

a

6

8

10

12

14

16

18

20

1 2 3 4 5 8

Stem height (cm)

ab

a

ab

ab

aa

b0

1

2

3

4

5

1 3 4 5 8

Disease symptoms (0–10)

R. solani R. AG-AP. oligandrum F. oxysporumF. proliferatum w F. proliferatum p

Weeks post inoculation

Fig. 1 Disease symptoms scale: 0 = healthy;

10 = completely rotten. One-way analysis of

variance (ANOVA) at P = 0.05 was carried out

with data taken 8 weeks postinoculation.

Means were separated by Student’s multiple-

range tests. Different letters indicate signifi-

cant differences.



control, except for those inoculated with F. prolifera-

tum p. Bulb symptoms were significantly higher in

plants inoculated with Rhizoctonia AG-A, P. oligandrum

and both F. proliferatum isolates as compared to the

control. The highest symptoms were observed in inoc-

ulations with Rhizoctonia AG-A and F. proliferatum w

(Table 3). Stem symptoms in plants inoculated with

all fungi, except R. solani, were significantly higher

than in the control, with the highest levels in F. prolif-

eratum w.

In experiment B, the overall disease symptoms

were lower than in experiment A. Root symptoms

were the highest in plants inoculated with P. oligan-

drum and F. proliferatum w, bulb symptoms were the

highest in F. oxysporum inoculation, whereas stem

symptoms were the highest in P. oligandrum and

F. proliferatum p inoculations (Table 3).

In the pathogenicity test on tissue-cultured patho-

gen-free lily bulbs, symptoms of rotting first appeared

at the base of the bulb scales, spreading later to the

whole scales 1 week after inoculation (Table 4). All

inoculated bulbs were significantly different from the

noninoculated control, regardless of the inoculated

pathogen. The levels of rotten tissue in bulbs inocu-

lated with Rhizoctonia AG-A and P. oligandrum were

higher than those inoculated with R. solani (Table 4).

In artificial inoculations of onion, seedling survival

was significantly affected by all fungi (Table 5). The

most pathogenic fungus was F. proliferatum w,

whereas the least pathogenic fungi were F. oxysporum

II and III.

Discussion

Leaf chlorosis, wilting and root and bulb rot of lily

plants grown in commercial greenhouses in Israel are

predominantly caused by binucleate Rhizoctonia AG-A,

P. oligandrum and F. proliferatum. Pathogenicity tests

completing Koch’s postulates on lily and onion were

successfully demonstrated. All fungi were re-isolated

from inoculated plants. Based on the data collected

from these trials, it can be concluded that binucleate

Rhizoctonia AG-A, P. oligandrum and F. proliferatum

were the most pathogenic in lily (Lilium longiflorum)

and the white strain of F. proliferatum in onion seed-

ling. Fusarium proliferatum affecting Lilium crops was

recently reported in Spain (Prados-Ligero et al. 2008).

Table 3 Effect of artificial inoculation with fungal pathogens on disease

and dry root weight of lily, 8 weeks postinoculation

Disease symptoms (0–10)Root Weight

(mg)Root Bulb Stem

Experiment A

Rhizoctonia solani 3.9 ab 2.7 bc 2.0 bc 642.5 b

Rhizoctonia AG-A 5.9 a 6.9 a 3.6 ab 523.8 bc

Pythium oligandrum 5.8 a 4.0 b 4.4 ab 358.6 c

Fusarium oxysporum p 4.2 ab 2.7 bc 3.3 ab 633.8 b

Fusarium proliferatum w 5.2 ab 5.0 ab 5.0 a 511.3 bc

Fusarium proliferatum p 3.4 ab 3.9 b 3.2 ab 680.6 ab

Control 0.3 c 0.6 c 0.6 c 890.0 a

Experiment B

Rhizoctonia solani 1.8 bc 0.6 ab 1.3 c 699.2 ab

Rhizoctonia AG-A 2.3 bc 0.6 ab 1.2 bc 605.8 b

Pythium oligandrum 3.0 ab 0.9 ab 3.1 a 465.8 b

Fusarium oxysporum p 1.7 c 1.2 a 2.2 abc 907.5 a

Fusarium proliferatum w 4.2 a 0.6 ab 1.3 c 684.2 ab

Fusarium proliferatum p 1.8 bc 1.1 ab 2.6 ab 676.7 ab

Control 1.2 c 0.4 b 0.4 c 912.5 a

Disease symptoms scale: 0 = healthy; 10 = completely rotten. One-way

analysis of variance (ANOVA) was carried out at P = 0.05. Means were

separated by Student’s multiple-range tests. Different letters within a

column indicate significant differences.

Table 4 Effect of artificial inoculation on tissue-cultured pathogen-free

lily bulbs with fungal pathogens on disease

Experiment C

Disease symptoms (0–10)

Bulb Scale leaf

Rhizoctonia solani 5.8 b 2.3 b

Rhizoctonia AG-A 8.1 a 3.9 ab

Pythium oligandrum 8.4 a 4.9 a

Fusarium oxysporum p 7.3 ab 2.9 b

Fusarium proliferatum w 7.4 ab 5.1 a

Fusarium proliferatum p 7.3 ab 3.9 ab

Control 0.5 c 0.3 c

Disease symptoms scale: 0 = healthy; 10 = completely rotten. One-way

analysis of variance (ANOVA) was carried out at P = 0.05. Means were

separated by Student’s multiple-range tests. Different letters within a

column indicate significant differences.

Table 5 Onion seedling survival (%), 40 days postinoculation with fungal

pathogens

Experiment A Experiment B

Pythium oligandrum 52.3 b 66.7 b

Binucleate Rhizoctonia AG-A 59.1 b nd

Fusarium oxysporum w I 65.2 b 57.3 b

Fusarium oxysporum p II nd 89.6 a

Fusarium oxysporum dp III nd 83.3 a

Fusarium proliferatum w 48.0 b 9.4 c

Control 91.8 a 87.5 a

Percentages were arcsine-transformed before analysis. One-way analy-

sis of variance (ANOVA) was carried out at P = 0.05. Means were sepa-

rated by Student’s multiple-range tests. Different letters within a column

indicate significant differences.


Bulb and root rot in lily and onion in Israel S. Lebiush-Mordechai et al.

Rhizoctonia solani had less effect than the other fungi,

as previously reported by Smith and Maginnes

(1996), who observed that although R. solani was

common on upper parts of the scales, it appeared to

cause minimal damage.

In conclusion, lily bulb rots are most serious as they

can result in total crop loss. The F. proliferatum purple

isolates were the most common species isolated from

lesions, mainly from the basal plate, but were not as

virulent compared to Rhizoctonia AG-A, P. oligandrum

and the white isolates of F. proliferatum.

Acknowledgements

The research was supported by the Chief Scientist of

The Ministry of Agriculture and Rural Development,

Israel. This paper is a contribution of the Agricultural

Research Organization, Institute of Plant Protection,

Bet Dagan, Israel.

References

Bald JG, Suzuki T, Doyle A. (1971) Pathogenicity of Fusari-

um oxysporum to Easter lily, narcissus and gladiolus. Ann

Appl Biol 67:331–342.

Ben-David T, Tsror L, Palevsky E. (2005) Developing an

action threshold for the bulb mite, Rhizoglyphus robini on

lily, onion and garlic. IOBC/wprs Bull 28:11–14.

Freeman S, Pham M, Rodriguez RJ. (1993) Molecular

genotyping of Colletotrichum species based on arbitrarily

primed PCR, A+T-rich DNA, and nuclear DNA analyses.

Exp Mycol 17:309–322.

Lacy ML, Roberts DL. (1982) Yields of onion cultivars in

midwestern organic soils infested with Fusarium oxyspo-

rum f. sp. cepae and Pyrenochaeta terrestris. Plant Dis

66:1003–1006.

Lawson RH, Hus HT. (1996) Lily diseases and their control.

Acta Hort 414:175–187.

L€offler HJM, Straathof TP, Mouris JR, Baayen RP.

(1995) Durability of resistance in lily to basal rot:

evaluation of virulence and aggressiveness among

isolates of Fusarium oxysporum f. sp.lilii. Eur J Plant

Pathol 102:261–271.

O’Donnell K, Cigelnik E. (1997) Two divergent intrage-

nomic rDNA ITS2 types within a monophyletic lineage

of the fungus Fusarium are nonorthologous. Mol Phylo-

gen Evol 7:103–106.

O’Donnell K, Kistler HC, Cigelnik E, Ploetz RC. (1998)

Multiple evolutionary origins of the fungus causing

Panama disease of banana: concordant evidence from

nuclear and mitochondrial gene genealogies. Proc Natl

Acad Sci USA 95:2044–2049.

Ofek T, Gal S, Inbar M, Lebiush-Mordechai S, Tsror L,

Palevsky E. (2013) The role of onion-associated

fungi in bulb mite infestation and damage to onion

seedlings. Exp Appl Acarol 61. doi: 10.1007/

s10493-013-9750-2.

Prados-Ligero AM, Basallote-Ureba MJ, Melero-Vara JM.

(2008) First report of Fusarium oxysporum f. sp. lilii and

F. proliferatum affecting Lilium crops in Spain. Trop Plant

Pathol 33:235–236.

Smith JD, Maginnes EA. (1996) Scale rot test for hybrid

lilies. Can Plant Dis Surv 46:92–94.

Stankovic S, Levic J, Petrovic T, Logrieco A, Moretti A.

(2007) Pathogenicity and mycotoxin production by

Fusarium proliferatum isolated from onion and garlic in

Serbia. Eur J Plant Pathol 118:165–172.

Steenkamp E, Britz H, Coutinho T, Wingfield B, Marasas

W, Wingfield M. (2000) Molecular characterization of

Fusarium subglutinans associated with mango malforma-

tion. Mol Plant Pathol 1:187–193.

White TJ, Bruns T, Lee S, Taylor J. (1990) Amplification

and direct sequencing of fungal ribosomal RNA genes

for phylogenetics. In: Innis MA, Gelfand DH, Sninsky

JJ (eds) PCR Protocols, A Guide to Methods and

Applications. San Diego, CA, Academic Press,

pp 315–322.



Documents

Bulb and Root Rot in Lily ( Lilium longiflorum ) and Onion ( Allium cepa ) in Israel