BWMK1 Responds to Multiple Environmental Stresses and Plant Hormones

Journal of Integrative Plant Biology 2007, 49 (6): 843−851

Received 12 Jan. 2007 Accepted 10 Mar. 2007

Supported, in part, by a Start-up Fund from the Ohio Agricultural Research

and Development Center and the Ohio State University, the National Natu-

ral Science Foundation of China (30470990), and Scientific Research Fund

of Hunan Provincial Education Department (04A024).

Publication of this paper is supported by the National Natural Science

Foundation of China (30624808).

*These authors contributed equally to the paper.

**Author for correspondence.

Tel: +1 614 292 9280;

Fax: +1 614 292 4455;

E-mail: <[email protected]>.

© 2007 Institute of Botany, the Chinese Academy of Sciences

doi: 10.1111/j.1672-9072.2007.00505.x

BWMK1 Responds to Multiple Environmental Stressesand Plant Hormones

Wai-Foong Hong1, 3*, Chaozu He2*, Lijun Wang2, Dong-Jiang Wang3, Leina M. Joseph3,

Chatchawan Jantasuriyarat1, Liangying Dai4, Guo-Liang Wang1, 4**

(1Department of Plant Pathology, The Ohio State University, Columbus OH 43210, USA;2National Key Laboratory of Plant Genomics, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100080, China;

3Temasek Life Sciences Laboratory, The National University of Singapore, Singapore 117604;4Rice Genomics Laboratory, Hunan Agricultural University, Changsha, Hunan 410128, China)

Abstract

Many plant mitogen-activated protein kinases (MAPKs) play an important role in regulating responses to bothabiotic and biotic stresses. The first reported rice MAPK gene BWMK1 is induced by both rice blast (Magnaporthegrisea) infection and mechanical wounding. For further analysis of its response to other environmental cues andplant hormones, such as jasmonic acid (JA), salicylic acid (SA), and benzothiadiazole (BTH), the promoter of BWMK1was fused with the coding region of the ß-glucuronidase (GUS) reporter gene. Two promoter-GUS constructs witha 1.0- and 2.5-kb promoter fragment, respectively, were generated and transformed into the japonica rice cultivarsTP309 and Zhonghua 11. Expression of GUS was induced in the transgenic lines by cold, drought, dark, and JA.However, light, SA, and BTH treatments suppressed GUS expression. These results demonstrate that BWMK1 isresponsive to multiple abiotic stresses and plant hormones and may play a role in cross-talk between differentsignaling pathways.

Key words: abiotic stresses; BWMK1; disease resistance; mitogen-activated protein kinase; Oryza sativa; promoter.

Hong WF, He C, Wang L, Wang DJ, Joseph LM, Jantasuriyarat C, Dai L, Wang GL (2007). BWMK1 responds to multiple environmentalstresses and plant hormones. J. Integr. Plant Biol. 49(6), 843−851.

Available online at www.blackwell-synergy.com/links/toc/jipb, www.jipb.net

Because plants have been exposed to a wide range of en-vironmental signals, they have developed sophisticated

mechanisms to recognize those signals and integrate them intospecific signaling pathways that moderate their output. Theseries of signal transductions that lead to modification of geneexpression patterns allow plants to adapt to changes in theirenvironment throughout their life cycle. Mitogen-activated pro-tein kinase (MAPK) pathways have been reported to be centralcomponents of such signal transduction pathways (Hirt 1997;Stratmann and Ryan 1997; Seo et al. 1999; Ichimura et al. 2002).MAPKs are known to respond to a wide variety of differentstimuli and to enable transmission of the signal from the recep-tors/sensors into the cytosol and nucleus (Ligterink et al. 1997;Lenormand et al. 1998; Kyriakis and Avruch 2001; Whitehurstet al. 2002). These signaling pathways generally direct cellularactivities ranging from gene expression, mitosis, cell division,cellular differentiation, development, and metabolism to defenseresponses.

All eukaryotic cells possess a set of MAPK cascades. Eachof these is preferentially recruited by distinct sets of stimuli,

844 Journal of Integrative Plant Biology Vol. 49 No. 6 2007

thereby allowing cells to respond coordinately to multiple anddivergent inputs. Typically, MAPK cascades consist of threekinase modules: (i) MAPK kinase kinase (MEKK); (ii) MAPK ki-nase (MAPKK); and (iii) MAPK. The MAPKKK enzyme activatesan MAPKK by phosphorylating two serine/threonine residueson its activation loop, which, in turn, is responsible for activat-ing both threonine and tyrosine by phosphorylation on an MAPK(Widmann et al. 1999). Such a multilevel phosphorylation cas-cade can serve to harmonize input from different sources andtransform them into specific positive or negative responses(Kryiakis and Avruch 2001). In mammals, based on sequencestructure and functionality, MAPKs have been classified intothree groups (Cano and Mahadevan 1995; Cobb and Goldsmith1995): (i) extracellular signal-regulated kinase (ERK)/MAPKs,which respond mainly to growth factors; (ii) c-Jun N-terminalkinase (JNK)/stress-activated protein kinase (SAPK), which isactivated by stress, inflammation, or cytokines; and (iii) thep38/Hog group, which is initiated by cytokines, endotoxins,and osmotic stress. As in the ERK group, the sequence activa-tion site is threonine-glutamic acid-tyrosine (TEY), whereasthe JNK/SAPK group has threonine-proline-tyrosine (TPY). Thesequence activation site of the p38/Hog group contains eitherthreonine-glycine-tyrosine (TGY) or threonine-aspartic acid-tyrosine (TDY). It should be noted that these three groups ofMAPK cascades have overlapping specificities such that acti-vation of one pathway may also modulate a function that ismore specifically regulated by others.

Many MAPKs in plants have been isolated and characterizedin recent years (Morris 2001; Ichimura et al. 2002; Agrawal etal. 2003). In Arabidopsis alone, at least 20 different MAPKshave been identified that are highly homologous to the ERKgroup of kinases in mammals (Ligterink and Hirt 2001; Ichimuraet al. 2002). In addition to phylogenetic analysis, the plant MAPKscan be divided into four separate groups, A–D, based on theconserved phosphorylation site containing the amino acid motifTXY. Groups A, B, and C contain the TEY activation site,whereas group D MAPKs contain a TDY motif and were alsonoted to have an extended C-terminal region. Group D kinasesclassically are analogous to the third group of MAPKs inmammals. Two well-characterized MAPKs from Arabidopsis,namely Atmpk3 and Atmpk6, belong to Group A and are mosthomologous to wound-inducible protein kinase (WIPK) and sali-cylic acid-induced protein kinase (SIPK) in tobacco. TheseMAPKs can be activated by a series of stimuli, such ashormones, wounding, salicylic acid (SA), pathogens, or patho-gen-derived elicitors. Each of their immediate partnering pro-teins has been identified (Asai et al. 2002). Atmpk3 is activatedby a pathogen-derived elicitor peptide Flg2, with the initial sig-nal coming from the flagellin receptor FLS2 via MEKK1 andMEKK4/5 before activating the final MAPK, Atmpk3. Atmpk3 thenbinds to a WRKY29/22 transcription factor to initiate the de-fense response. Overexpression of WIPK and SIPK in tobacco

also induces the expression of pathogenesis-related (PR) pro-teins (Seo et al. 1999). In terms of the defense response, Atmpk3and Atmpk6 in Arabidopsis or WIPK and SIPK in tobacco posi-tively reinforce each other in the manner of a dual regulation(Liu et al. 2003). For example, upon activation of SIPK, geneexpression of WIPK is also enhanced and WIPK protein accu-mulates because both SIPK and WIPK share common upstreamactivators (MEKKs and the MAPKK NtMEK2). The newly syn-thesized WIPK is also activated by NtMEK2, reinforcing the hy-persensitive reaction (HR) and pathogen defense. However, itis unclear whether WIPK is more specific than SIPK in its re-sponse to pathogens because the pathogen-derived HR re-sponse leads to a longer-lasting activation of WIPK geneexpression. Atmpk4, belonging to the B group of MAPKs inplants, appears to respond to abiotic and biological stressesand to cell division cues (Petersen et al. 2000). Disruption ofthis gene by a transposon insertion created a constitutive sys-temic acquired resistance (SAR) phenotype and suppressedgrowth of the mutant plant. Therefore, it is a negative regulatorfor both disease resistance and plant growth. Recently,Ekengren et al. (2003) reported that silencing of several MAPKsand MAPKKs, including the WIPK homolog, led to a comprise ofPto-mediated resistance, further demonstrating the functionalconservation of plant MAPKs in the defense response to dif-ferent pathogens.

BWMK1 was the first MAPK reported to be transcriptionallyactivated by blast and wounding (He et al. 1999). Recently,four more rice MAPKs have been identified. They are the WIPK-like gene belonging to the TEY Group A (OSMAPK5 (Xiong andYang 2003), OSMSRMK2 (Agrawal et al. 2002), OSMAPK2(Huang et al. 2002), OsMAP1 (Wen et al. 2002), and OsBIMK1(Song and Goodman 2002), the TEY Group B gene OsMAPK6(Lieberherr et al. 2005), the TEY Group C gene OSMSRMK3(Agrawal et al. 2003), and the TDY Group D OsWJUMK1 gene(Agrawal et al. 2003). Most are involved in abiotic and bioticstress responses. For example, disease resistance in plantswas enhanced when OSMAPK5 expression was suppressed(Xiong and Yang 2003). Compared with these MAPKs, BWMK1belongs to the same group as OsWJUMK1 because it containsa TDY (Group D) as the putative activation site and carries along C-terminal tail (He et al. 1999). Furthermore, it includes analcohol dehydrogenase (ADH)-like domain (Matton et al. 1990;Dolferus et al. 1994), a tyrosine kinase (TK) phosphorylationsite, and a putative leucine zipper motif in the C-terminus.Recently, Cheong et al. (2003) demonstrated that BWMK1 phos-phorylates OsEREBP1, which binds to the GCC box element(AGCCGCC) of the several basic PR gene promoters. Tran-sient coexpression of BWMK1 and OsEREBP1 in Arabidopsisprotoplasts elevates the expression of the ß-glucuronidase(GUS) reporter gene driven by the GCC box element. In addition,overexpression of the gene in tobacco plants resulted in anenhanced resistance to Phytophthora parasitica var. nicotianae

BWMK1 Responds to Multiple Stresses and Hormones 845

and Pseudomonas syringae pv. tabacci pathogens. Becausethese results were obtained in Arabidopsis and tobacco plants,whether a similar regulatory mechanism exists for BWMK1 inrice plants requires further investigation. In the present study,we found BWMK1 was induced by cold, drought, dark, andjasmonic acid (JA) treatments, but was repressed by light andsalicylic acid (SA)/benzothiadiazole (BTH) treatments. The re-sults from these experiments suggest that BWMK1 is an impor-tant signaling molecule responsive to different abiotic and bi-otic stresses.

Results

The rice BWMK1 promoter contains several putativecis-acting regulatory elements that are involved inresponse to biotic and abiotic stresses

Using BWMK1 as the probe, a positive bacterial artificial chro-mosome (BAC) clone was obtained from the IR64 BAC library(Yang et al. 1997). The genomic sequence of a 3.0-kb regionupstream of the BWMK1 start site was obtained. Using variousmotif prediction computer programs, such as plantCARE (http://intra.psb.ugent.be:8080/PlantCARE/) and PLACE (http://www.dna.affrc.go.jp/htdocs/PLACE/), and visual examination of theBWMK1 promoter sequence, a number of DNA motifs poten-tially involved in the transcriptional regulation of the gene wereidentified. These included sequence-specific elements related

to responses to pathogen infection, SAR chemical inducers,cold, light, and drought or dehydration (Table 1).

In the BWMK1 promoter, a putative TATA box, which is knownfor its involvement in directing RNA polymerase II to the initiationsite, was found 39 bp upstream of the translational start site.When the BWMK1 promoter region was compared with pro-moters of other PR genes, a high level of structural similaritybetween these promoters and several known defense-relatedmotifs was found. For example, there are six putative TTGACW-box sequences within the 2 480 bp in the promoter region(Table 1). Two copies of the as-1/ocs element, which is re-sponsible for reactions to biotic and abiotic stresses, as wellas SA and JA, were found within the promoter region. In addition,the identification of a G box and H box, which are related tolight, stress, and developmental responses, has been reported(Giuliano et al. 1988; Schindler et al. 1992). In addition, PR/GCCboxes for the AP2/EREBP binding site, which are involved inpathogen/ethylene/JA responses, were located in the promoterregion between 1 023 and 1 144 bp. Interestingly, the cold,drought and pathogen-related motif drought-responsive ele-ment (DRE) was found at three separate locations between589 and 1 013 bp. All these findings support the hypothesis thatBWMK1 may be related to defense, stress, and development.

Promoter activity analysis at different growth stages

To examine the activity of the BWMK1 promoter in response todifferent environmental stresses and in different tissues, three

Table 1. List of the conserved motifs in the BWMK1 promoterMotif and sequence Position (bp) Putative function ReferencesW box (TTGAC) +290 Pathogen/wounding/JA/SA Eulgem et al. (2000)W box (TTGAC) +585 Pathogen/wounding/JA/SA Eulgem et al. (2000)W box (TTGAC) –613 Pathogen/wounding/JA/SA Eulgem et al. (2000)W box (TTGAC) –1 137 Pathogen/wounding/JA/SA Eulgem et al. (2000)W box (TTGAC) +2 365 Pathogen/wounding/JA/SA Eulgem et al. (2000)W box (TTGAC) –2 399 Pathogen/wounding/JA/SA Eulgem et al. (2000)as-1 (TGACG) –612 Pathogen/auxin/JA/SA Strompen et al. (1998); Xiang et al. (1996)as-1 (TGACG) –1 903 Pathogen/auxin/JA/SA Strompen et al. (1998); Xiang et al. (1996)G box (CACGTG) –1 989 Pathogen/light/stress/development Dröge-Laser et al. (1997); Foster et al. (1994);

Giuliano et al. (1988)H box (CCTACC) –1 121 Pathogen/stress/development Dröge-Laser et al. (1997); Faktor et al. (1996);

Loake et al. (1992)PR/GCC box (GCCGCC) +1 023 Pathogen/ethylene/JA Brown et al. (2003); Ohme-Takagi and Shinshi (1995);

Zhou et al. (1997)PR/GCC box (GCCGCC) –1 144 Pathogen/ethylene/JA Brown et al. (2003); Ohme-Takagi and Shinshi (1995);

Zhou et al. (1997)DRE (CCGAC) –589 Cold/drought Yamaguchi-Shinozaki and Shinozaki (1994)DRE (CCGAC) + 998 Cold/drought Yamaguchi-Shinozaki and Shinozaki (1994)DRE (CCGAC) +1 013 Cold/drought Yamaguchi-Shinozaki and Shinozaki (1994)JA, jasmomic acid; SA, salicylic acid; PR, pathogenesis-related; DRE, drought response element.


different fragments in the promoter region of the BWMK1 genewere fused with the coding region of the GUS gene (Jeffersonet al. 1987). Specific primers based on the promoter sequencewere designed to amplify either a 1.035-, 1.388- or a 2.480-kbpromoter region upstream of the start codon (see Materialsand Methods). Both japonica varieties TP309 and Zhonghua11 were used for the transformations via an Agrobacterium-mediated transformation technique described previously (Yinand Wang 2000). Only the 1.035- and 2.480-kb constructs(Figure 1) were used to transform TP309, whereas all threeconstructs were used to transform Zhonghua 11. Independenttransgenic rice plants from both TP309 and Zhonghua 11 wereobtained and tested for GUS activity. A summary of the trans-formation results and the number of plants selected for furtheranalysis is given in Table 2. Homozygous T2 or T3 lines wereidentified using Southern blot analysis (data not shown).

The first indication of GUS activity was shown in the scutel-lum of just-germinated transgenic seedlings and GUS activitycould be detected in most parts of 1.035 kb of 3-day-old plants(data not shown). Compared with the 1.388- and 2.480-kb pro-moter transgenic plants, the 1.035-kb plants with both TP309and Zhonghua 11 backgrounds had much stronger GUS ex-pression than did the 2.480-kb promoter lines (Figure 2A, B, E,F). The 1.035-kb promoter transgenic plants expressed GUSalmost throughout the entire seedling root, whereas the 2.480-kb transgenic plants expressed GUS at a lower level in a partof the root or at the ends of the roots, root tips, and root hairs(Figure 2G, H). Expression of GUS was observed in young leafapices, but, occasionally, very weak GUS activity was seen inmature leaves. This pattern was consistent in all three types oftransgenic lines. The GUS activity of the 1.388-kb lines (Figure2C, D) was not significantly different compared with the 2.480-kb lines (Figure 2G, H). At the flowering stage, both the 1.035-and 2.480-kb promoter lines also exhibited GUS activity afterthe entire panicle was placed into X-gluc solution (Figure 2I, J).In addition, GUS was generally first expressed only in new,growing tissues in both varieties, regardless of the size of thepromoter region. These results indicated that the BWMK1 pro-moter region between 1.388 and 1.035 kb upstream of the ATGsite contains some unknown suppression motifs and that pro-moter activity is high in young developing tissues.

Spatial and temporal response of BWMK1 transgeniclines to wounding and rice blast fungus

We have shown previously that BWMK1 gene expression isresponsive to both wounding and rice blast (He et al. 1999). Inthe present study, the regulation of the BWMK1 promoter towounding was further tested in the promoter transgenic lines.

Table 2. Summary of the transformation and plants selected for analysisName of Transformed No. independent No. independent No. independent linesconstructs plants lines lines tested for GUS evaluated for stress response1.035 kb TP309 37 4 1

Zhonghua II 6 6 01.388 kb TP309 0 0 0

Zhonghua II 5 5 02.480 kb TP309 15 15 2

Zhonghua II 1 1 0GUS, β-glucuronidase.

Figure 1. The BWMK1 promoter.

(A) A map of the 2.480-kb BWMK1 promoter::GUS construct.(B) List of locations of conserved motifs in three different-sizedBWMK1 promoter inserts.


Wounded leaves of TP309 transgenic plants harboring the 1.035- and 2.480-kb promoter region were stained with X-glucsolution immediately after the leaf tips had been excised. β-glucuronidase was immediately strongly expressed around theedges cut using scissors (Figure 3A, B). The GUS activity couldstill be observed at the cut edge at least 3 days after wounding(data not shown). A similar wound response was observed instem and root tissue, irrespective of the age of the plant (datanot shown). Similar to untreated plants, the 1.035-kb transgenicplants had a stronger response than did the 2.480-kb transgenicplants after cutting (Figure 3A, B).

In addition to wounding, BWMK1 is known to be transcriptionlyactivated by blast infection (He et al. 1999). To test this, entiretransgenic plants containing the 1.035- or 2.480-kb promoterregion were inoculated with M. grisea isolate PO6-6. ProminentGUS activity was observed 3 days after infection (Figure 3C,D). At approximately 4–7 days, the GUS staining became atypical blast spindle-shaped lesion (Figure 3E). These resultsshow that both the 1.035- and 2.480-kb promoters are respon-sive to both wounding and blast infection, indicating that thepromoter constructs are regulated by the rice blast pathogen,as reported previously for the endogenous gene (He et al.1999). Because both the 1.035- and the 2.480-kb promotertransgenic plants responded to wounding and to M. grisea, atleast one of those wounding and infection response elementsis likely to be within the 1.035-kb region from the start codon.One of the three W boxes found within the 1.035-kb promoter(–613 bp) may be enough to activate GUS expression in re-sponse to wounding and blast infection.

Responses to different environmental cues

Because the BWMK1 promoter contains a series of stressresponse elements, such as the G box (light-responsiveelement), the DRE box (dehydration and cold-responsiveelement), and the PR/GCC box (related to the response to JA),we tested the response of the 2.480-kb promoter transgeniclines to a variety of conditions, such as light, temperature, anddrought. At 25 °C, under long day conditions (18 h light and 6 hdark), the whole roots of transgenic seedlings displayed lessGUS activity than that seen in roots grown under regular 12 hlight and dark conditions (data not shown). Staining for GUSwas observed only in the root tips. However, with continuousdark or light, there was a greater difference in GUS expressionin the roots: GUS activity was strongly suppressed under con-ditions of 48 h continuous illumination and increased underconditions of 48 h continuous dark (Figure 3F), suggesting thatBWMK1 is negatively regulated by light.

Because the BWMK1 promoter region contained the DREelement, which is present in the promoter region of genes in-duced by low temperature (Shinozaki and Yamaguchi-Shinozaki2000), we tested the response of the BWMK1 promoter under

low and high temperatures. The expression of GUS was greaterin transgenic plants at 4 °C than at 25 °C. Plants kept at 4 °C for24 h in the dark started to have higher GUS expression, con-firming the previous results that BWMK1 is negatively regu-lated by light (Figure 3F). The GUS activity was further in-creased when plants were kept under the same conditions (4°C and dark) for 48 and 72 h. In contrast, higher temperaturesrepressed GUS activity because plants growing at 37 °C in thedark had significantly lower GUS expression (Figure 3G).

Because the DRE motif is also responsible for the activationof genes involved in the drought response (Shinozaki andYamaguchi-Shinozaki 2000), the 2.480-kb promoter transgenicplants were tested for their responses to drought treatments.When entire seedlings were dried on filter paper for 15 min,GUS expression was strong in the roots of these plants (Figure3H), suggesting that BWMK1 is involved in the droughtresponse.

One of the significant changes in SAR is the increase in SAcontent in infected plants (Ryals et al. 1995). As describedearlier, the BMWK1 promoter contains some putative elementssimilar to SAR enhancers and WRKY response motifs. Therefore,we tested whether SA or JA affected GUS expression in thetransgenic lines. When applying 10 mmol/L SA or 0.2 mmol/LBTH to the 2.480-kb promoter transgenic plants, GUS expres-sion was reduced significantly in the roots of 7-day-oldseedlings, but the expression in the shoot tip was apparentlynot affected (Figure 3I). In contrast, GUS expression was in-duced in roots following 25 μmol/L JA treatment of the promotertransgenic lines (Figure 3J). These results indicate that theSAR inducers SA and BTH negatively regulate the expressionof BWMK1, whereas JA has a positive effect on its expression.

Discussion

Sequence analysis showed that the BWMK1 promoter con-tains several conserved response elements that are commonlyidentified in many PR-type promoters. One commonly conservedelement is the W box, TTGAC, the binding site for WRKY tran-scription factors. The WRKY factors constitute a large groupof plant-specific regulators implicated in responses to patho-gens and wounding (Eulgem et al. 2000). The W boxes havebeen described as positive cis-acting elements for theupregulation of transcription resulting from a wound responseor the wound signaling molecule JA (Eulgem et al. 2000).Interestingly, these W boxes have also been found in theArabidopsis PR1 gene as a negative regulator of SA (Lebel etal. 1998). The BWMK1 promoter contained six W boxes com-pared with an average of 4.3 in PR-type promoters (Maleck etal. 2000). In the analysis of the BWMK1 promoter lines, weconfirmed that JA positively regulates BWMK1, whereas SAand BTH negatively regulate its expression in rice. However,


we could not determine which W box(es) was responsive toJA and/or SA/BTH. One of the six W boxes is located within the1.035-kb promoter and could be responsible for wound andblast responses because the promoter lines also had strongGUS expression after wounding and blast infection similar tothat of the 2.480-kb promoter lines. In addition, we found someunknown suppressive elements in the BWMK1 promoter. Theexpression of GUS in the 2.480- and 1.388-kb transgeniclines at the seedling stage on both the TP309 and ZhonghuaII backgrounds was much lower than that in the 1.035-kblines. This may indicate that one or more of the identifiedelements between the 1.035- and 1.388-kb promoter regionare negative cis elements. A more detailed dissection of theBWMK1 promoter will identify the functions of these con-served motifs in response to different biotic and abioticstresses.

Because several motifs related to abiotic stresses, develop-mental processes, and hormones responses were also foundin the promoter of BWMK1, BWMK1 is likely to have a diversityof functions in these biological processes. In the present study,we confirmed that expression of BWMK1 was induced by cold,drought, dark, and JA, but it was suppressed by light. It isunclear whether this is related to plant development. As re-vealed by the GUS activity assay, BWMK1 was strongly ex-pressed specifically in fast-growing tissues, such as the

scutellum, root tips, shoot tips, and flowers, suggesting apossible role in developmental processes. The stunted pheno-type of anti-sense transgenic plants from our unpublished re-sults (Hong WF and Wang GL., unpubl. obs., 2003) indicatesthat knock-down of the gene could affect rice growth anddevelopment. The plant height of three characterized anti-senselines correlated well with the reduced expression of the en-dogenous BWMK1 gene. However, we cannot role out thepossibility that the stunted phenotype was caused by over- orunderexpression of downstream defense genes. For example,many defense genes are induced and suppressed in the

Figure 3. Abiotic and biotic stress responses of transgenic plantscontaining the BWMK1 promoter::GUS transgene in TP309.

(A, B) Leaves of the 1.035-kb (A) and (B) 2.480-kb promoter linetransgenic plants were cut with scissors.(C, D) Three days after blast inoculation of 1.035-kb BWMK1promoter::GUS (C) and 2.480-kb BWMK1 promoter::GUS (D)transgenic plants.(E) Seven days after blast inoculation of 2.480-kb BWMK1 promoter::GUS transgenic plants.(F) The 2.480-promoter line seedlings were treated with either 48 hcontinuous dark (left two seedlings) or 48 h continuous light (righttwo seedlings).(G) The 2.480-promoter line seedlings were treated with either 48 hcontinuous 37 °C (left) or 48 h continuous 4 °C (right).(H) The 2.480-promoter line seedling were either treated with droughtconditions for 15 min (right two seedlings), or not (left two).(I) The left two 2.480-promoter line seedlings were treated with 0.2mmol/L benzothiadiazole (BTH) with the wettable powder carrier.The two seedlings on the right were the negative control, treatedwith same amount of wettable powder carrier vehicle.(J) The left two 2.480-promoter line seedlings were treated 25 μmol/L jasmonic acid (JA), whereas the right two seedlings are the nega-tive control, without JA treatment.

Figure 2. β-Glucuronidase (GUS) activity assay in 1.035-, 1.388-,and 2.480-kb transgenic lines.

(A, E) Three-day-old 1.035-kb promoter line in Zhonghua 11 (A) andTP309 (E).(B, F) Five-day-old 1.035-kb promoter line in Zhonghua 11 (B) andTP309 (F).(C) Three- and (D) 5-day-old 1.388-kb promoter line in Zhonghua11.(G) Three and (H) 5-day-old 2.480-kb promoter line in TP309.(I, J) β-Glucuronidase staining of the 1.035-kb (I) and 2.483-kb (J)promoter line in TP309 rice flower.


anti-sense lines, as revealed by microarray hybridizations (HongWF and Wang GL., unpubl. obs., 2003). This was also ob-served in the Arabidopsis mutant AtMpk4, which not only hadenhanced resistance, but also reduced height (Peterson et al.2000).

It is worth noting that the endogenous SA level is higher inrice than in other plants; even exogenous SA (50 mmol/L) is stillable to induce the expression of PR genes (Agrawal et al.2001). In addition, JA is an elicitor released in response towounding and pathogen attack and is probably antagonistic tothe SA response in plants (Doares et al. 1995; Dong 1998).Previous studies have shown that BWMK1 is induced by me-chanical wounding and the rice blast fungus (He et al. 1999).Consistently, we showed that the BWMK1 promoter is acti-vated after exogenous application of JA. Conversely, theexpression of BWMK1 was reduced by SA or BTH. Thehigh endogenous level of SA may perhaps inhibit BWMK1until the plant is damaged or attacked by pathogens, whichmay induce a JA response that overrides this repression.Measuring the levels of endogenous SA or JA in the anti-sense transgenic plants should provide the answer to thisquestion.

Materials and Methods

Promoter sequencing and construct construction

A 3.0-kb fragment upstream of the BWMK1 gene was isolatedfrom a BAC clone (He et al. 1999) and was sequencedcompletely. The 2.480-kb promoter region of BWMK1 was ob-tained from a polymerase chain reaction (PCR) amplificationu s i n g t h e p r i m e r p a i r P B - R 1 ( 5 ' -TTCCACTGTGTTCTACAAGATCAC-3') and PB-F4 (5'-CTAAACGATGGGGACCGTAGTATT-3'), which were designedbased on the 3.0-kb genomic sequence of the BWMK1 pro-moter region. The 1.388-kb promoter region was amplified us-i n g t h e p r i m e r p a i r P B - R 1 a n d P B - F 6(AGATCCTGCTACTTCTTCCCCATC). The 1.035-kb promoter re-gion was obtained using the primer pair PB-R1 and PB-F7(CGAGGAGGCCGCCTCCTCCGACCT). The amplified fragmentswere cloned into the pGEM-T system II (Promega, Madison, WI,USA) and sequenced.

Using restriction enzymes NcoI and Pst1, the 35S promoterof GUS reporter gene was released from the transformationvector pCAMBIA 1301 (CAMBIA, Canberra, ACT, Australia). Inorder to replace the 35S promoter in pCAMBIA 1301 with theBWMK1 promoter, NcoI and PstI were used to cut the BWMK1promoter from the pGEM vector for cloning into the NcoI andPstI site of the pCAMBIA 1301 vector. In this way, the promoterfragments were fused with the GUS reporter gene in thepCAMBIA 1301 vector.

Plant materials and pathogen inoculation

The virulent isolate PO6-6 of Magnaporthe grisea from the Phil-ippines was used to inoculate the control plant TP309 andtransgenic plants. The fungus was cultured on oatmeal agar-ose for approximately 2 weeks in the dark. The culture wasthen flattened with an L-shaped, sterilized glass rod and wasthen exposed to light for 4–5 d. Three-week-old rice plantswith nine plants in each line were sprayed evenly (Bonman etal. 1986) with 10×105 spores/mL and kept in a dew chamber for24 h in the dark at 25 °C. Plants were then transferred to agrowth chamber under 12 h light and 12 h dark, at 26 °C for 6–7 d.

Chemical and abiotic treatment

For SA (Sigma, St Louis, MO, USA) and BTH (Actigard, Syngenta,Wilmington, DE, USA) treatment, 5- to 7-day-old plants fromseeds germinated on filter paper were dipped into a 2 mmol/LSA solution (Agrawal et al. 2001) for 2 min. Plants were re-moved from the solution and kept on a plastic plate with a thinlayer of water under a piece of filter paper overnight at roomtemperature. Drought stress was induced by withholding wa-ter from 5–7-day-old seedlings for 10–15 min. For temperaturetreatments, seeds were germinated on half-strength Murashige-Skoog (MS) medium and grown for 10 d; then, seedlings weretransferred to a growth chamber for 24, 48 or 72 h at a con-stant temperature of either 4, 25, or 37 °C. In each treatment,two independent lines were tested. Each line included betweeneight and 22 plants with two to three replications performed.When two-thirds of the sample size was significantly differentfrom the control at the same conditions, the response wasconsidered to be positive.

Histochemical staining for GUS

Tissues were stained with X-gluc solution as described byTopping et al. (1991). Chlorophyll was removed by repeatedwashing with 95% ethanol.

Acknowledgements

The authors thank Drs Megan Griffith at Latrobe University inAustralia and Beth Hazen at American Journal of Botany forsuggestions and help with the preparation of the manuscript,and Maria Billizzi for technical assistance.

References

Agrawal GK, Rakwal R, Jwa N-S, Agrawal VP (2001). Signalling


molecules and blast pathogen attack activates rice OSPR1aand OSPR1b genes: A model illustrating components partici-pating during defense/stress response. Plant Physiol. Biochem.39, 1095–1103.

Agrawal GK, Rakwal R, Iwahashi H (2002). Isolation of novel rice(Oryza sativa L.) multiple stress responsive MAP kinase gene,OsMSRMK2, whose mRNA accumulates rapidly in response toenvironmental cues. Biochem. Biophys. Res. Commun. 294,1009–1016.

Agrawal GK, Agrawal SK, Shibato J, Iwahashi H, Rakwal R (2003).Novel rice MAP kinases OsMSRMK3 and OsWJUMK1 involvedin encountering diverse environmental stresses and develop-mental regulation. Biochem. Biophys. Res. Commun. 300, 775–783.

Asai T, Tena G, Plotnikova J, Willmann MR, Chiu WL, Gomez-Gomez L et al. (2002). MAP kinase signalling cascade inArabidopsis innate immunity. Nature 415, 997–983.

Bonman JM, Vergel de Dios TI, Khin MM (1986). Physiologic spe-cialization of Pyricularia oryzae in the Philippines. Plant Dis.70, 767–769.

Brown RL, Kazan K, McGrath KC, Maclean DJ, Manners JM (2003).A role for the GCC-box in jasmonate-mediated activation of thePDF1.2 gene of Arabidopsis. Plant Physiol. 132, 1020–1032.

Cano E, Mahadevan LC (1995). Parallel signal processing amongmammalian MAPKs. Trends Biochem. Sci. 20, 117–122.

Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, Kim IH et al.(2003). BWMK1, a rice mitogen-activated protein kinase, lo-cates in the nucleus and mediates pathogenesis-related geneexpression by activation of a transcription factor. Plant Physiol.132, 1961–1972.

Cobb MH, Goldsmith EJ (1995). How MAP kinases are regulated. J.Biol. Chem. 270, 14 843–14 846.

Dellaporta SL, Wood J, Hicks JB (1985). Molecular biology ofplants: A laboratory course manual. In: M Russell, ed. Cold SpringHarbor Laboratory Press, New York. pp. 36–37.

Doares SH, Narvaers-Vasquez J, Conconi A, Ryan CA (1995).Salicylic acid inhibits synthesis of proteinase inhibitors in to-mato leaves induced by systemin and jasmonic acid. PlantPhysiol. 108, 1741–1746.

Dolferus R, Jacobs M, Peacock, WJ, Dennis E (1994). Differentialinteractions of promoter elements in stress responses of theArabidopsis Adh gene. Plant Physiol. 105, 1075–1087.

Dong X (1998). SA, JA, ethylene, and disease resistance in plants.Curr. Opin. Plant Biol. 1, 316–323.

Dröge-Laser W, Kaiser A, Lindsay WP, Halkier BA, Loake GJ,Doerner P et al. (1997). Rapid stimulation of a soybean protein-serine kinase that phosphorylates a novel bZIP DNA-bindingprotein, G/HBF-1, during the induction of early transcription-dependent defenses. EMBO J. 16, 726–738.

Ekengren SK, Liu Y, Schiff M, Dinesh-Kumar SP, Martin GB (2003).Two MAPK cascades, NPR1, and TGA transcription factors playa role in Pto-mediated disease resistance in tomato. Plant J. 36,

905–917.Eulgem T, Rushton PJ, Robatzek S, Somssich IE (2000). The

WRKY superfamily of plant transcriptional factors. Trends PlantSci. 5, 199–206.

Faktor O, Kooter JM, Dixon RA, Lamb CJ (1996). Functional dis-section of a bean chalcone synthase gene promoter in transgenictobacco plants reveals sequence motifs essential for floralexpression. Plant Mol. Biol. 32, 849–859.

Foster R, Izawa T, Chua NH (1994). Plant bZIP proteins gather atACGT elements. FASEB J. 8, 192–200.

Frye CA, Tang D, Innes RW (2001). Negative regulation of defenseresponses in plants by a conserved MAPKK kinase. Proc. Natl.Acad. Sci. USA 98, 373–378.

Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA,Cashmore AR (1988). An evolutionary conserved protein bind-ing sequence upstream of a plant-light regulated gene. Proc.Natl. Acad. Sci. USA 85, 7089–7093.

He C, Fong S, Yang D, Wang GL (1999). BWMK1, a novel MAPkinase induced by fungal infection and mechanical woundingin rice. Mol. Plant Microbe In. 12, 1064–1073.

Hirt H (1997). Multiple roles of MAP kinases in plant signaltransduction. Trends Plant Sci. 2, 11–15.

Huang HJ, Fu SF, Tai YH, Chou WC, Huang DD (2002). Expressionof Oryza sativa MAP kinase gene is developmentally regulatedand stress-responsive. Physiol. Plant. 114, 572–580.

Ichimura K, Shinozaki K, Tena G, Sheen J, Henry Y, Champion Aet al. (2002). Mitogen-activated protein kinase cascades in plants:A new nomenclature. Trends Plant Sci. 7, 301–308.

Jefferson RA, Kavanagh TA, Bevan MW (1987). GUS fusions: β-Glucuronidase as a sensitive and versatile gene fusion marker inhigher plants. EMBO J. 6, 3901–3907.

Kauffman HE, Reddy APK, Hsieh SPY, Merca SD (1973). An im-proved technique for evaluating resistance of rice varieties toXanthomonas oryzae. Plant Dis. Rep. 57, 537–541.

Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR(1993). CTR1, a negative regulator of the ethylene responsepathway in Arabidopsis, encodes a member of the raf family ofprotein kinases. Cell 72, 427–441.

Kyriakis JM, Avruch J (2001). Mammalian mitogen-activated pro-tein kinase signal transduction pathways activated by stress andinflammation. Physiol. Rev. 81, 807–869.

Lebel E, Heifetz P, Thorne L, Uknes S, Ryals J, Ward E (1998).Functional analysis of regulatory sequences controlling PR-1gene expression in Arabidopsis. Plant J. 16, 223–233.

Lenormand P, Brondello JM, Brunet A, Pouyssegur J (1998).Growth factor-induced p42/p44 MAPK nuclear translocation andretention requires both MAPK activation and neosynthesis ofnuclear anchoring proteins. J. Cell Biol. 142, 625–633.

Lieberherr D, Thao NP, Nakashima A, Umemura K, Kawasaki T,Shimamoto K (2005). A sphingolipid elicitor-inducible mitrogen-activated protein kinase is regulated by the small GTPase OsRac1and heterotrimetric G-protein in rice. Plant Physiol. 138, 1644–


(Handling editor: Xiangdong Fu)

1652.Ligterink W, Hirt H (2001). Mitogen-activated protein (MAP) kinase

pathways in plants: Versatile signaling tools. Int. Rev. Cytol.201, 209–275.

Ligterink W, Kroj T, zur Nieden U, Hirt H, Scheel D (1997). Recep-tor-mediated activation of a MAP kinase in pathogen defense ofplants. Science 276, 2054–2057.

Liu Y, Jin H, Yang KY, Kim CY, Baker B, Zhang S (2003). Interac-tion between two mitogen-activated protein kinases during to-bacco defense signaling. Plant J. 34, 149–160.

Loake GJ, Faktor O, Lamb CJ, Dixon RA (1992). Combination of H-box [CCTACC(N)7CT] and G-box (CACGTG) cis elements is nec-essary for feed-forward stimulation of a chalcone synthase pro-moter by the phenylpropanoid-pathway intermediate p-coumaricacid. Proc. Natl. Acad. Sci. USA 89, 9230–9234.

Maleck K, Levine A, Eulgem T, Morgan A, Schmid J, Lawton KAet al. (2000). The transcriptome of Arabidopsis thaliana duringsystemic acquired resistance. Nat. Genet. 26, 403–410.

Matton DP, Constabel P, Brisson N (1990). Alcohol dehydroge-nase gene expression in potato following elicitor and stresstreatment. Plant Mol. Biol. 14, 775–783.

Morris PC (2001). Map kinase signal transduction pathways in plants.New Phytol.151, 67–89.

Ohme-Takagi M, Shinshi H (1995). Ethylene-inducible DNA bind-ing proteins that interact with an ethylene-responsive element.Plant Cell 7, 173–182.

Petersen M, Brodersen P, Naested H, Andreasson E, Lindhart U,Johansen B et al. (2000). Arabidopsis map kinase 4 negativelyregulates systemic acquired resistance. Cell 103, 1111–1120.

Ryals J, Lawton KA, Delaney TP, Friedrich L, Kessmann H,Neuenschwander U et al. (1995). Signal transduction in sys-temic acquired resistance. Proc. Natl. Acad. Sci .USA 92, 4202–4205.

Sambrook J, Fritsch EF, Maniatis TA (1989). Molecular Cloning: ALaboratory Manual. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

Santamaria M, Thomson CJ, Read ND, Loake GJ (2001). Thepromoter of a basic PR1-like gene, AtPRB1, from Arabidopsisestablishes an organ-specific expression pattern and respon-siveness to ethylene and methyl jasmonate. Plant Mol. Biol. 47,641–652.

Seo S, Sano H, Ohashi Y (1999). Jasmonate based woundingsignal transduction requires activation of WIPK, a tobacco mito-gen-activated protein kinase. Plant Cell 11, 289–298.

Shinozaki K, Yamaguchi-Shinozaki K (2000). Molecular responsesto dehydration and low temperature: Differences and cross-talkbetween two stress signaling pathways. Curr. Opin. Plant Biol. 3,

217–223.Song F, Goodman RM (2002). OsBIMK1, a rice MAP kinase gene

involved in disease resistance responses. Planta 215, 997–1005.Stratmann JW, Ryan CA (1997). Myelin basic protein kinase activity

in tomato leaves is induced systemically by wounding and in-creases in response to systemin and oligosaccharide elicitors.Proc. Natl. Acad. Sci. USA 94, 11085–11089.

Strompen G, Gruner R, Pfitzner UM (1998). An as-1-like motif con-trols the level of expression of the gene for the pathogenesis-related protein 1a from tobacco. Plant Mol. Biol. 37, 871–883.

Topping JF, Wei W, Lindsey K (1991). Functional tagging of regu-latory elements in the plant genome. Development 112, 1009–1019.

Wen JQ, Oono K, Imai R (2002). Two novel mitogen-activatedprotein signaling components, OsMEK1 and OsMAP1, are in-volved in a moderate low-temperature signaling pathway inrice. Plant Physiol. 129, 1880–1891.

Whitehurst AW, Wilsbacher AJL, You Y, Luby-Phelps K, MooreMS, Cobb MH (2002). ERK2 enters the nucleus by a carrier-independent mechanism. Proc. Natl. Acad. Sci. USA 99, 7496–7501.

Widmann C, Gibson S, Jarpe MB, Johnson GL (1999). Mitogen-activated protein kinase: Conservation of a three-kinase modulefrom yeast to human. Physiol. Rev. 79, 143–180.

Xiang C, Miao ZH, Lam E (1996). Coordinated activation of as-1-type elements and a tobacco glutathione S-transferase gene byauxins, salicylic acid, methyl-jasmonate and hydrogen peroxide.Plant Mol. Biol. 32, 415–426.

Xiong L, Yang Y (2003). Disease resistance and abiotic stress toler-ance in rice are inversely modulated by an abscisic acid-induc-ible mitogen-activated protein kinase. Plant Cell 15, 745–759.

Yamaguchi-Shinozaki K, Shinozaki K (1994). A novel cis-actingelement in an Arabidopsis gene is involved in responsivenessto drought, low-temperature, or high-salt stress. Plant Cell 6,251–264.

Yang DC, Parco A, Nandi S, Subudhi P, Zhu YG, Wang GL et al.(1997). Construction of a bacterial artificial chromosome (BAC)library and identification of overlapping BAC clones with chro-mosome 4-specific RFLP markers in rice. Theor. Appl. Genet.95, 1147–1154.

Yin Z, Wang GL (2000). Evidence of multiple complex patterns ofT-DNA integration into the rice genome. Theor. Appl. Genet. 99,461–470.

Zhou J, Tang X, Martin GB (1997). The Pto kinase conferring resis-tance to tomato bacterial speck disease interacts with proteinsthat bind a cis-element of pathogenesis-related genes. EMBOJ. 16, 3207–3218.

Documents

BWMK1 Responds to Multiple Environmental Stresses and Plant Hormones