1

Cell, Volume 137

Supplemental Data Cytokine/Jak/Stat Signaling Mediates Regeneration and Homeostasis in the Drosophila Midgut Huaqi Jiang, Parthive H. Patel, Alexander Kohlmaier, Marc O. Grenley, Donald G.

McEwen, and Bruce A. Edgar

Supplemental Experimental Procedures: Fly stocks UAS transgenes: UAS-Rpr, UAS-Hop, UAS-Upd26.2, UAS-Upd2, UAS-Stat92E,

UAS-HepAct, UAS-P35, UAS-Nintra, UAS-Dl20, UAS-E2F1Dp1, UAS-Puc and UAS-

BskDN. RNAi transgenes: UAS-Stat92E RNAi, UAS-Dome RNAi and USA-N

RNAi (NIG, Japan and VDRC, Austria). Mutants: hep1, hop25, hopTumL, FRT82B

stat85C9 and FRT82B stat397. Reporters and Gal4 drivers: MyoIANP0001Gal4,

esgNP7097Gal4, esglacZ, MyoIAlacZ, 10XStat-DGFP, (Gas)3lacZ, DomeGal4,

pucE69lacZ, updlacZ, upd3Gal4, GbeSu(H)lacZ and DllacZ. MARCM stocks:

FRT42D: y w hsflp UAS-GFP tubGal4; FRT42D tubGal80; +, FRT82B: y w hsflp

UAS-GFP tubGal4; +; FRT82B tubGal80. Midgut Gal4 drivers: MyoIAGal4ts: w;

MyoIAGal4 tubGal80ts UAS-GFP; +; esgGal4ts: w; esgGla4 tubGal80ts UAS-GFP;

+.

Generation of UAS-puc RNAi To deplete puckered (puc), a transgenic RNAi targeting nucleotides 1369-1932

(564 bp; Accession. NM_079549), was generated from puc cDNA with the

following primer pair: 5’-GCTCTAGAGCACCTGAATAGTCCTAGCAATCC-3’ and

5’-GCTCTAGAACATGGTTAATCCTGCTATCCGG-3’. The product was

subcloned, sequenced, and digested with XbaI prior to cloning, in the antisense

orientation, into the AvrII site of pWIZ (Lee and Carthew, 2003). This XbaI

fragment was cloned in the sense orientation into the downstream NheI site,

2

creating a tail-to-head, head-tail arrangement separated by white intron 2.

Transgenic lines were established through standard P-element mediated

transformation.

Gut turnover rate analysis For midgut turnover under normal lab culturing conditions, 3-10 days old female

adult flies (raised and aged at 18°C) with the genotype: w; tub>CD2>Gal4 UAS-

CD8-GFP/esgGal4; UAS-flp/tubGal80ts were shifted to 29°C (to induce the

transgenes) and adult midguts were dissected and examined at specific time

points after transfer.

For gut turnover in hopTumL mutants: hopTumL/Basc virgin flies were crossed to the

esgtsF/O tester males with the genotype: w; esgGal4 tubGal80ts UAS-GFP; UAS-

flp Act>CD2>Gal4. The hemizygous mutant males (hopTumL/Y, esgtsF/O) and

control males (Basc/Y, esgtsF/O) were aged at 18°C for 3-10 days and examined

after shifting cultures to 29°C for 8 days.

For Pe- induced gut turnover in hop mutant (hop25), hop25/FM7 virgin flies were

crossed to the esgtsF/O tester. The hemizygous mutant males (hop25/Y, esgtsF/O)

and control males (FM7/Y, esgtsF/O) were aged 3-10 days at 18ºC before shifted

to 29ºC and fed Pe-laced food (1/2 ml 10X concentrated overnight Pe culture) for

one day and then their gut turnover were analyzed.

Overexpression and mutant clone experiments For ectopic expression experiments, 3-10 days old adults (raised at 18°C) were

shifted to 29°C to activate UAS-transgene expression in progenitor cells (esgts) or

ECs (MyoIAts).

For mutant ISC clonal assay, 3-10 days old adults were heat shocked for 45

minutes at 37°C to induce clones, then the flies were kept at 25°C until

dissection. For Stat92E rescue experiment, adult flies with the following

genotype: y w hsflp tubGal4 UAS-GFP/+ or Y; UAS-Stat92E/+; FRT82B

Stat397/FRT82B tubGal80 were used.

3

RT-qPCR

The following were used to examine relative gene expression by RT-qPCR.

upd: Forward: 5’ CCACGTAAGTTTGCATGTTG 3’

ReverseN: 5’ CTAAACAGTAGCCAGGACTC 3’

upd2: Forward: 5’ ACTGTTGCATGTGGATGCTG 3’

ReverseN: 5’ CAGCCAAGGACGAGTTATCA 3’

upd3: Forward: 5’ GAGCACCAAGACTCTGGACA 3’

ReverseN: CCAGTGCAACTTGATGTTGC 3’

Socs36E: Forward: 5’ CAGTCAGCAATATGTTGTCG 3’

ReverseN: 5’ ACTTGCAGCATCGTCGCTTC 3’

Dl: Forward: 5’ TGTGAACATGGACATTGCGA 3’

ReverseN: 5’ GTCTGTGGTTGGTGCAGTAG 3’

puc: Forward: 5’ CATGTGGCTAGCAATTTGA 3’

ReverseN: 5’ GTCTTCGAAAAACGTACAGC 3’

E(spl): Forward: 5’ AGGTGGCTCAGGAAGAACAA 3’

ReverseN: 5’ CGTTGACGGCATTCATGTAG 3’

E(spl)mα: Forward: 5’ AGAATCCGTCGACAATCTGC 3’

ReverseN: 5’ GCTCCTCGACAATCTCGAAC 3’

E(spl)mδ: Forward: 5’ AATTGGGTCACCAGCTCAAG 3’

ReverseN: 5’ ATATGGAATGCCCTTCACCA 3’

E(spl)m7: Forward: 5’ GTGGCTTTTGGAACCACACT 3’

ReverseN: 5’ GACTGATGGAGGAGCAGGAG 3’

Quantification of adult gut cells Quantification of the marked cells, including Dl+, PH3+, GbeSu(H)lacZ+ and Pros+

cells were performed on double immunostained midguts from Rpr-induced EC

cell death or Pe-induced gut regeneration.

4

Supplemental Tables Table S1: Distribution of mitoses by cell type in control and regenerating Drosophila adult midguts after Reaper-mediated enterocyte ablation.

Genotype Marker(s) PH3+ cells scored

% of total PH3+ cells

PH3+ Delta+ 24 100% MyoIAts>GFP (N=24, n=4) PH3+ Delta- 0 0%

PH3+ Pros+ 0 0% MyoIAts>GFP (N=24, n=4) PH3+ Pros- 24 100%

PH3+ Delta+ 314 88% MyoIAts>rpr (N=357, n=4) PH3+ Delta- 43 12%

PH3+ Pros+ 0 0% MyoIAts>rpr (N=357, n=4) PH3+ Pros- 357 100%

N, total number of PH3+ cells counted; n, total number of midguts counted; SD, standard deviation; MyoIA, brush border myosin IA; rpr, reaper; PH3, phospho-histone 3; Pros, Prospero.

5

Table S2: Cell types in control (mock), Pe infected, and regenerating Drosophila adult midguts.

Treatment Genotype Marker(s) Cells scored

Percentage

PH3+ Delta+ 10 100% w1118 (N=10, n= 4) PH3+ Delta- 0 0%

PH3+ Pros+ 0 0%

Mock 2 days

w1118 (N=10, n= 4) PH3+ Pros- 10 100%

PH3+ Delta+ 132 85% w1118 (N=156, n=4) PH3+ Delta- 24 15%

PH3+ Pros+ 0 0% w1118 (N=156, n=4) PH3+ Pros- 156 100%

PH3+ GFP+ 134 97% esgts>GFP (N=138, n=4) PH3+ GFP- 4 3%

PH3+ lacZ+ 0 0% GbeSu(H)lacZ (N=146, n=4) PH3+ lacZ- 146 100%

Delta+ lacZ- 84 94% GbeSu(H)lacZ (N=89, n=10) Delta+ lacZ+ 5 6%

GFP+ (large) pros- 3310 90%

Pe 2 days

esgtsF/O (N=3685 n=10) GFP+ pros+ 375 10%

PH3+ Delta+ 6 100% w1118 (N=6, n= 4) PH3+ Delta- 0 0%

PH3+ Pros+ 0 0%

Mock 2 days +

antibiotics 2 days

w1118 (N=6, n= 4) PH3+ Pros- 6 100%

PH3+ Delta+ 341 88% w1118 (N=387, n=4) PH3+ Delta- 46 12%

PH3+ Pros+ 0 0%

Pe 2 days + antibiotics 2

days w1118 (N=387, n=4) PH3+ Pros- 387 100%

N, total number of PH3+, Delta+, or GFP+ cells counted; n, total number of midguts counted; SD, standard deviation; Pe, Pseudomonas entomophila; PH3, phospho-histone 3; Pros, Prospero; esg, escargot; GbeSu(H)lacZ, Grainyhead, Suppressor of Hairless lacZ reporter (Notch activity).

6

Supplemental Figure Legends

Figure S1. Recovery from midgut hyperplasia induced by JNK signaling. Punctate cytoplasmic Delta (Dl) staining (red) marks the ISCs and nuclear PH3

staining (red) marks the mitotic cells. Blue is DNA.

(A) Control midgut at day 0 (0 D) prior to HepAct induction.

(B) Hyperplastic midgut caused by prolonged JNK activation (MyoIAts>HepAct,

4D). The gut contains more large epithelial cells and small Dl+ progenitor cells.

(C) 2 days after transgene shutoff, the PH3 staining is still high in the midgut,

indicating that the progenitor cells continued to proliferate.

(D) 4 days after transgene shutoff, the midgut morphology reverted to normal and

the elevated proliferation of the progenitor cells ceased. The number of Dl+

progenitor cells also returned to normal.

Figure S2. ISCs defective in Jak/Stat signaling fail to differentiate into mature ECs. MARCM clones were induced in young, 3-10 days old adults, and

midguts were dissected 8 days after clone induction. The clones, which occur

only in dividing cells (therefore ISCs) were marked by GFP expression (green).

Blue is DNA.

(A) FRT82B control. Asterisks indicate mature differentiated enterocytes (ECs) in

a control MARCM clone.

(B-E) ISC MARCM clones with defective Jak/Stat signaling were comprised

mostly of small progenitor-like cells. Clones were generated using the MARCM

FRT82B control and FRT82B stat85C9 (B), UAS-Dome RNAi (C) or UAS-Stat

RNAi (D) with FRT82B and FRT82B stat397 (E). Note the absence of large GFP

positive cells.

(F) The differentiation defects of Stat397 mutant ISCs were rescued by ectopic

expression of UAS-Stat92E. Asterisks indicate mature differentiated ECs in a

MARCM clone. Genotype: y w hsflp tubGal4 UAS-GFP/+ or Y; UAS-Stat92E/+;

FRT82B Stat397/FRT82B tubGal80.

7

Figure S3. Ectopic Delta (Dl) does not rescue the differentiation defect of ISCs lacking Jak/Stat signaling. (A-C) The Dl gene expression pattern in the wildtype midgut epithelium, detected

using the DllacZ insertion reporter. DllacZ (red) is highly expressed in about half

of the esgGal4 positive progenitor cells (green, arrows), which we believe to be

ISCs. DllacZ expression is low or absent in the remaining esgGal4 positive cells,

which are usually paired with an ISC and are most likely EBs (arrowheads).

(D) FRT82B Control. 3-10 days old adult flies were heat shocked for 1 hour to

induce MARCM clones in ISCs, and midguts were analyzed after 8 days. A

typical MARCM clone containing one Dl+ ISC (arrow) is shown. Genotype: yw

hsflp UAS-GFP tubGal4; +; FRT82B tubGal80/FRT82B.

(E) A typical MARCM clone ectopically expressing Dl. In most such clones, Dl

was highly visible in small progenitor cells (indicated by arrows), but was low or

absent in differentiated ECs. Since UAS-Dl20 and UAS-GFP are being driven by

tubGal4 in this situation, this suggests that Dl is post-transcriptionally

downregulated in ECs. In this assay, ectopic Dl did not effect the ISC proliferation

or differentiation. Genotype: yw hsflp UAS-GFP tubGal4; UAS-Dl20/+; FRT82B

tubGal80/FRT82B.

(F) A typical stat85C9 MARCM clone overexpressing Dl. Such clones contained

many small progenitor cells that were all positive for ectopic Dl, indicating that Dl

is not sufficient to rescue the block to differentiation imposed by loss of Stat92E

function. Genotype: yw hsflp UAS-GFP tubGal4; UAS-Dl20/+; FRT82B

tubGal80/FRT82B stat85C9.

Figure S4. Induction of Delta and Notch activity in the midgut after Pseudomonas entomophila (Pe) ingestion. 3-10 days old adult flies were fed either food containing Pe (B, D) or

uncontaminated food (A, C) for 2 days, and then their midguts were dissected

and analyzed for expression of the Delta reporter DllacZ (A, B), or the Notch

reporter GbeSu(H)lacZ (C, D), or GbeSu(H)lacZ and endogenous Delta (E-E''').

8

(A, B) DllacZ is normally high in ISCs (A, S3), but after Pe ingestion it is highly

induced and expressed in many more gut epithelial cells (B).

(C, D) The N activity reporter, GbeSu(H)lacZ, is normally expressed in EBs (C),

but after Pe infection LacZ was detected in many more gut epithelial cells (D). In

both cases, the presence of LacZ in large differentiated cells could be due to

perdurance of this stable protein and the high regeneration rate of ECs during

infection.

(E-E''') During regeneration strong cytoplasmic punctuate Delta accumulation

and Notch activity are largely mutually exclusive (94%, see Table S2) as

measured by Delta and lacZ staining in GbeSu(H)lacZ reporter flies fed with PE

for 1.5 days. Figure S5. Midgut epithelial turnover as detected using the esgts F/O system. 3-10 day old female (A-C) or male (D, E) adult flies (raised at 18°C) were shifted

to 29°C for various times as indicated. Midguts were analyzed for CD2

expression (A-C), which is lost from progenitor cells following the temperature

shift, and GFP (A'-C') that is simultaneously activated. Genotype: w;

tub>CD2>Gal4 UAS-CD8-GFP/esgGal4; UAS-flp/tubGal80ts.

(A) One day after induction at 29°C, only small progenitor cells are GFP+. The

CD2 staining is also stronger in the progenitor cells. We attribute this to higher

activity of the tub>CD2>Gal4 transgene in progenitor cells.

(B) Due to Flp-mediated recombination, CD2 expression disappeared from

progenitor cells after 7 days. The large GFP+, CD2- cells are newly generated

ECs.

(C) By 12 days the majority of epithelial cells in the posterior midguts of females

were GFP+, indicating that the posterior midgut had largely renewed itself. The

epithelial replacement rate was much slower in wildtype males, as shown below

(D) and in Fig 7.

(D, E) Gut turnover in hop (Jak) gain-of-function mutants as measured using the

esgts F/O system. Control (D) and hopTumL/Y (E) males were shifted to 29°C for 8

9

days before the midguts were dissected and analyzed. In control male midguts,

GFP expression was confined mostly to small progenitor cells (D), indicating little

or no replacement of the midgut epithelium during this 8-day experiment.

However, midguts from hopTumL contained numerous GFP positive cells,

including mature epithelial cells (E), suggesting significant gut turnover in these

mutant flies. Genotypes: hopTumL/Y or FM7(+)/Y; esgGa4 tubGal80ts UAS-GFP/+;

UAS-flp Act>CD2>Gal4 UAS-GFP/+.

(F, G) hop25 loss-of-function mutant midguts failed to turnover in response to Pe

infection. Males 3-10 days old were fed Pe for 1 day and gut turnover was

analyzed using the esgtsF/O system. Many newborn, GPF+ ECs are present in

the control midgut (G) indicating a high rate of replacement, whereas the midguts

in hop25 mutants showed virtually no renewal of the midgut epithelium (F). Later

time points were not assayed because the hop25 mutants died from the infection.

Genotypes: hop25/Y or Basc(+)/Y; esgGa4 tubGal80ts UAS-GFP/+; UAS-flp

Act>CD2>Gal4 UAS-GFP/+.

Figure S6. Distribution of Delta+ cells during regenerative stem cell division The number and spatial distribution of Delta+ or PH3+ cells in MARCM stem cell

clones was analyzed in control animals and after feeding Pe. Clones were

analyzed about 1d after clone induction. (A-D) Representative immunostainings

in control (no Pe) MARCM42D (A, B, D) or MARCM40A flies (C) showing

observed patterns of pairing of Delta+ cells. Single Dl+ cells are indicated by

asterisks in (A, B and D), Dl+ pairs are indicated by double arrows in (B). Cells

with high intensity of Delta staining are shown with solid arrows, weak Dl+ staining

cells are indicated by dotted arrows in (B). Several Delta+ cells residing in

spatially distinct pairing centers can be observed within an irregularly shaped

large clone, that is potentially two fused clones (D). (E) The average frequencies

of Dl+ cells appearing as singlets, pairs or triplets within a given clone was

determined and based on the sum Σ of all Dl+ cells counted in clones induced in

MARCM42D and MARCM40A control (-Pe, 100%=Σ=56 Dl+ cells) or Pe fed flies

(+Pe, Σ=35). (F) The average frequencies of Dl+ cells appearing as singlets or in

10

clusters was determined for all Dl+ staining cells in the posterior midgut region of

MARCM42D and hsFlp;Frt82b controls (-Pe, Σ=157 Dl+ cells) or Pe fed (+Pe,

Σ=254 Dl+ cells) flies irrespective of clone boundaries. Both analyses suggest that

Pe infection does not promote stem cell duplication.

11

Figure S1

12

Figure S2

13

Figure S3

14

Figure S4

15

Figure S5

16

Figure S6