Cloning and characterization of a species-specific repetitive DNA sequence from Loa loa

Molecular and Biochemical Parasitology, 45 ( 1991 ) 297-306 297

Elsevier

MOLBIO 01494

Cloning and characterization of a species-specific repetitive DNA sequence from Loa loa

A m y D. Klion, Ni thyakalyani Raghavan, Paul J. Brindley and Thomas B. Nutman Laboratory of Parasitic Diseases, National Institutes of Health, Bethesda, MD, U.S.A.

(Received 30 May 1990; accepted 30 October 1990)

A genomic DNA library ofLoa loa was constructed in ~.gtl I using EcoRI-digested DNA from microfilariae isolated from two West African patients, Screening with labeled L. Ioa DNA yielded several potential repetitive DNA clones. An MboI fragment of one of these, LL3M9, was identified and characterized. Sequence analysis of LL3M9 revealed an 839-bp fragment with an unusual 356-bp region containing 37 copies of the hexamer CTI'AGG, many of which are arranged in repeated motifs of 12, 27 and 63 bp. This region shares many of the characteristics of eukaryotic satellite DNA. A synthetic oligonucleotide corresponding to the 27-bp repeated motif, LL3M9REP, was found to be both sensitive and species-specific by dot hybridization• Species specificity of LL3M9REP was confirmed by amplification of the repetitive region using genomic DNA as a template in the polymerase chain reaction.

Key words: Loa loa; Repetitive DNA; Filariasis

Introduction

Transmitted by the tabanid fly Chrysops, the filarial parasite Loa loa has been estimated to cause chronic infection in as many as 13 million people in West and Central Africa [1]. While many microfil- aremic patients are asymptomatic, the character- istic picture of migratory angioedema ('Calabar swellings') is often debilitating. Serious compli- cations, such as endomyocardial fibrosis, nephro- pathy and fatal encephalitis, while rare, do occur and may be exacerbated by treatment with the an- thelmintic, diethylcarbamazine. Definitive diagnosis can only be made by morphologic identification of microfilariae in the peripheral blood or, rarely, by the removal of an adult worm during sub-

Correspondence address: Amy Klion, National Institutes of Health, Bldg. 4, Room 126, Bethesda, MD 20892, U.S.A.

Abbreviations: SDS, sodium dodecyl sulfate; PBS, phosphate- buffered saline.

Note." Nucleotide sequence data reported in this paper have • T M • . been submitted to the GenBank data base with the accessmn

number M34259.

conjunctival migration. The study ofL. loa has been limited by a paucity

of parasite material, primarily because of the lack of a suitable animal model. The difficulty in obtaining adult worms or sufficient quantities of microfilariae from infected patients is an additional ob- stacle. Consequently, little is known about the parasite genome or its phylogenetic relationship to the other filarial species.

Moderately and highly repetitive DNA sequences often represent non-coding regions of the genome that may undergo evolutionary change at a relatively rapid rate [2]. Sequence analysis of such repetitive families has revealed differences between closely related filarial species and subspecies [3,4], and has contributed to the determination of evolutionary relationships. Furthermore, a high degree of specificity together with the increased sensitivity conferred by high copy number has led to the exploitation of such repeat sequences as diag- nostic probes [5-7].

To begin to address these issues, we have constructed a genomic DNA library from L. loa and screened it for repeated sequences. A repetitive sequence that proved to be species-specific and able

0166-6851/91/$03.50 © 1991 Elsevier Science Publishers B.V. (Biomedical Division)

298

to detect single microfilariae was isolated and characterized.

Materials and Methods

Parasite material. L. loa microfilariae were isolated from the peripheral blood of two West African patients using a modification of previously described methods [8]. Briefly, peripheral blood en- riched for microfilariae was obtained by cytapheresis using a two-arm continuous flow procedure and centrifugal separation (Fenwall Cs-3000, 1400 rpm, 75 interface)• Further purification was achieved by differential centrifugation through Hyp- aque-Ficoll, red cell lysis with 0.9% ammonium chloride and filtration through 54tm polycarbonate Nuclepore T M filters (Nuclepore, Pleasanton, CA). Filters were incubated at 37°C overnight in RPMI supplemented with 25 mM Hepes, 80 gg ml -J gen- tamicin and 1% fetal calf serum. Free-swimming microfilariae were harvested in the supernatant and washed in phosphate-buffered saline (PBS). The microfilariae were resuspended in a minimal vol- ume of PBS and frozen in liquid nitrogen for future use.

Onchocerca volvulus adult worms were obtained from collagenase-digested nodules from Guat- emalan patients as has been described previously [9]. Brugia malayi adult worms were isolated from jirds infected intraperitoneally [10], and Wuch- ereria bancrofii microfilariae were purified from the peripheral blood of patients from Madras, India. Other parasite specimens (Acanthocheilonema viteae, Brugia pahangi, Caenorhabditis elegans, Di- rofilaria immitis, and Litomosoides carinii were supplied by John McCall (University of Georgia, Athens, GA).

Isolation of DNA. Cryopreserved microfilariae or adult worms were thawed and resuspended in 1- 2 ml of lysis buffer (50 mM Tris, pH 8.0/50 mM EDTA/100 mM NaC1) with 0.5% SDS, 0.1 mg m1-1 proteinase K and 50 mM 2-mercaptoethanol. The parasites were frozen and thawed three times before incubation at 65°C for 2 h. Lysis was confirmed by microscopic examination. Following phenol/chloroform extraction and ethanol precipi- tation, RNA was removed by incubation for 1 h at 37°C in the presence of 100 ~tg ml -J DNase-free

ribonuclease A (Boehringer Mannheim Biochemi- cals, Indianapolis, IN). The DNA was then re-ex- tracted with phenol/chloroform, ethanol precipi- tated and resuspended in TE buffer (10 mM Tris- HC1/I mM EDTA, pH 8.0). The average yield of L. loa DNA was 1 ~g per 100000 microfilariae. Human DNA contamination, assessed by dot blot [1 I] using total genomic human DNA, was less than 15 %.

DNA from Chrysops (provided by L. Lorenz, University of Maryland, Baltimore, MD) was isolated according to the method of Bender et al. [ 12] with the following modifications: a single abdo- men was disrupted mechanically in 50 ~tl of buffer (0.1 M NaC1/0.2 M sucrose/0.1 M Tris-HC1, pH 9.1/0.05 M EDTA/0.5% SDS) using a Kontes Te- flon pestle (Vineland, N J), and all subsequent vol- umes were doubled.

Construction and screening of L. loa genomic library in ~,gtll. A genomic expression library for L. loa was constructed using standard methods [13]. A complete EcoRI digest of total genomic DNA was ligated into the EcoRI site of ~,gtl 1 and packaged using Gigapack packaging extract (Strat- agene, La Jolla, CA). The resultant library was amplified in Escherichia coli Y 1088. Plaque lifts were screened with [o~-3zp]dATP-labeled [14] L.

. . . . 8 • I loa DNA (specific actwlty 10 dpm mln ), and 20 highly reactive clones were selected. None of these hybridized with labeled human DNA. Three of the clones (LL1, LL2 and LL3) were plaque-purified• A 0.9-kb MboI fragment ofLL3 (LL3M9) was sub- sequently subcloned into the BamHI site of pUC 13 (Pharmacia, Piscataway, NJ) for sequencing• Un- less otherwise indicated, restriction endonucleases were from New England Biolabs (Beverly, MA) and were used as recommended by the manufacturer.

Southern and dot hybridizations. Southern blot and DNA dot hybridizations were performed using

• 3 2 • peroxldase-labeled or P-radlolabeled DNA fragments as indicated [11,13]. Radiolabeled filters were hybridized overnight at 62°C in 6 × SSC/0.5% SDS and washed as described in Maniatis et al. [ 13]. Overnight hybridization of peroxidase-labeled DNA (Amersham, Arlington Heights, IL) was carried out in the presence of 0.5 M NaC1 and 6 M

urea at 42°C. Washes were performed as recommended by the manufacturer and the blots de- veloped using the enhanced luminol chemilumi- nescence procedure (ECL, Amersham).

Individual microfilariae were detected in peripheral blood using a field-applicable technique de- veloped by Poole et al. [ 15]. Approximately 1,20 or 50 cryopreserved L. loa microfilariae were added to l-ml aliquots of peripheral blood and processed as described. The filters were air-dried and baked in vacuo for 2 h at 80°C before hybridization. For the calculation of copy number, hybridization was quantified using a laser densitometer (LKB, Piscat- away, N J).

DNA sequence analysis and polymerase chain reaction. The nucleotide sequence was determined from pUC 13 subclones by the Sanger dide- oxy-nucleotide chain termination method [ 16]. The following synthetic oligomers (Synthecell, Rock- ville, MD) were used as sequencing primers (see Fig. 2) and in the polymerase chain reaction (PCR): (1) 5'-TGT-TAT-AAA-TGC-TGA-AA-3', (2) 5'- AAT-GTA-ATA-TAA-CAT-AA-3', and (3) 5'- TAG-TGC-TTT-AAC-CCG-AA-3'. The PCR was performed with the GeneAmp T M DNA amplification kit (Perkin Elmer Cetus, Norwalk, CT) under the conditions recommended by the supplier. The sequence was analyzed using University of Wisconsin Genetic Computer Group software (Version 6.1 ) [ 1711.

Results

Isolation of repeat clones. The constructed L. loa genomic library had a titer of 1.42 x 10 6 pfu ml -~. Replicates of 20000 recombinants were screened with either labeled L. loa or human DNA, and 20 highly L. loa-reactive clones that did not hybridize with human DNA were selected. Three were plaque-purified. The insert sizes ranged from 4.4 to 6 kb (Fig. 1A). Subsequent restriction mapping revealed LL2 and LL3 to be identical. Insert DNA from LL3 (4 kb) was gel-purified, peroxidase-labeled and used to probe a dot blot of phage DNA containing purified inserts from LL1 and LL3. As shown in Fig. 1 B, LL3 hybridized to both inserts. In a similar experiment, LL1 (6 kb) also hybridized to the LL3 insert (not shown).

299

A. Xhindlll LL1 LL2 LL3

kb

23.1- 9.4- 6.6- 4.4-

2.3- 2.0-

B. LL1

LL3

10 ng 1 ng 0.1 ng 0.01 ng

Fig. l. (A) Insert sizes of LL l, LL2 and LL3. DNA from Xgt I 1 clones containing LLI, LL2 and LL3 were digested with EcoRl, electrophoresed in a 1% agarose gel and visualized with ethidium bromide. XDNA/HindlII fragments were used as molecular size standards. (B) lnterrelatedness of LL1 and LL3. Labeled LL3 insert was used to probe 10, 1,0.1 and 0.01 ng of purified insert DNA from LL1 and LL3 spotted onto

nitrocellulose.

Peroxidase-labeled LL3 was used to probe a dot blot containing 20 ng of DNA from A. viteae, B. malayi, B. pahangi, C. elegans and D. immitis and decreasing concentrations ofL. loa DNA. Hybridiza- tion was species-specific, and as little as 40 pg of L. loa DNA could be detected (data not shown). In view of these results, further characterization of the repetitive unit was undertaken. LL3 was digested with restriction enzymes and probed with labeled L. loa DNA. An MboI fragment of approximately 0.9 kb (LL3M9) showed the strongest reactivity and was subcloned into pUC 13 for further analysis.

DNA sequence analysis of pLL3M9. The DNA sequence of LL3M9 is 839 bp in length (Fig. 2A). It is A+T-rich (61% AT, 39% GC), as has been reported for other filarial parasite DNAs [ 19]. The region between-base pairs 163 and 531 consists of 37 copies of the hexamer CTTAGG, many of which are arranged in longer repeated motifs. Four of these are illustrated in increasing order of com- plexity in Table I. The longest internal repeat is 63 bp in length and is present in two tandemly arranged copies. Fragments of this 63-bp sequence are found

300

A. ! gatcaaatac ctgatacgct cgtataaccg tgtcatccgg atatttatta

51 tattaattat taaag5gtta atcaaacatg agcaaaactt tttcgacgac

I01 gcaaattaca ttcctcgttt tagtgcttta accc~aatqt aatataacat

151 a~caaccatt tgCTTAGGCT TAGGTTTTTC GGGTTTATGC TTAGGCTTAG

201 GTTTTTCGGG TTTATGCTTA GGCTTAGGCT TAGGTTCTTC GGGTTTATGC

251 TTAGGCTTAG GCTTAGGTTT CTCGGGTTTA TGCTTAGGTT CATGCTTAGG

301 CTTAGGCTTA GGCTTGGGCT TAGGCTTAGG CTTAGGCTTA GGTTTTTCGG

351 GTTTATGCTT AGGCTTAGGC TTAGGCTTGG GCTTAGGCTT AGGCTTAGGC

401 TTAGGTTTTT CGGGTTTATG CTTAGGCTTA GGCTTAGGCT TAGGCTTGGG

451 CTTAGGCTTA GGCTTAGGCT TAGGCTTAGG CTTAGGTTTT TCGGGTTTAT

501 GCTTAGGTTT ATGCTTAGGG TTTATGCTTA Gttttttttt gaacactgtt

551 cgataaccat ataagtatca taaatgtaaa catgtaaa~t ttcaqcattt

601 ataac4agaa gcaccaaaaa acaccgatgg atgaagcaaa agcggacgat

651 cagtgaggag ctgttaagcg acttcgtgct gctacaaatt tgcattatgc

701 aatggattac gagcatgcca agtaatccat tgttggatac agtgttgttt

751 tctgatttgt agtaatccat cacagtaatt cagcaaagtg aagtgtactc

801 tgttgaaagc gtaagtattg cattggtgat attatgatc

B.

I i I i i I o kb ~ ~ 0 . 9 k b

i00 bp

Fig. 2. Nucleotide sequence (panel A) and sequencing strategy (panel B) ofLL3M9. (A) Upper case letters indicate the highly repetitive region between nucleotides 163 and 531. Oligonucleotide primers used in sequencing (primers 1 and 2) are boxed. (B) LL3M9 and pUC 13 are represented by the solid and dashed lines, respectively. The positions and orientations of the four primers used in the

sequencing reactions are indicated by arrows.

dispersed throughout the repetitive region in copy numbers that increase with decreasing size of the fragment. The remainder of the sequence from this region consists of incomplete or slightly altered copies of these fragments.

The G+C content of the repetitive region is 46%, in comparison to 32% in the flanking regions and 28% in an unrelated 0.9-kb fragment of LL3 (sequence not shown). No open reading frame was evi- dent. Examination of the sequence for homology to sequences in the GenBank Genetic Sequence Bank (Release 59.0, Los Alamos, NM and Mountain View, CA) and the EMBL Data Library (Heidel-

berg, F.R.G.) revealed no similarities to known sequences.

Organization in the genome. The copy number of LL3M9 was estimated by comparing hybridization of LL3M9 to decreasing amounts of itself or total genomic L. loa DNA. Assuming a haploid genome size similar to that found in other filariae (approx. 108 bp) [7], this result suggests a copy number of approximately 4800 per haploid genome. To evaluate further the genomic organization of this repetitive motif, DNA was digested to completion with restriction enzymes with sites flanking the repetitive

301

TABLE I Nucleotide sequences and copy numbers of the 6-bp, 12-bp, 27-bp and 63-bp LL3M9 internal repeats

Length (bp) Repeat sequence First copy No. copies from base

6 CTTAGG 163 37 12 CTTAGGCTTAGG 163 15 27 CTTAGGCTTAGGTTTTTCGGGTTTATG 163 5 63 CTTAGGCTTAGGCTTAGG/../TTCGGGTTTATG 295 2

region (EcoRI, MboI and TaqI). After transfer to nitrocellulose, the DNA was probed with radiolabeled LL3M9REP, an oligonucleotide corresponding to the 27 bp repetitive motif shown in Table I. As shown in Fig. 3, LL3M9REP hybridized to two discrete fragments, corresponding to the insert sizes of LL1 and LL3, in EcoRI-digested L. loa DNA. Similarly, several fragments were detected in both the MboI and TaqI digests, including a 0.9- kb MboI fragment and a 0.45-kb TaqI fragment as predicted by the sequence analysis of LL3M9. When a Southern blot of a 0.3% agarose gel electrophoresis of partial EcoRI digests ofL. loa DNA was probed with LL3M9REP, no additional fragments were detected (data not shown). Three restriction endonucleases were found to cut within the repetitive region of LL3M9. Two of these, DdeI and CviJI, cut >31 times. The third, AvaI, cut only once

kb

23.1 D 9.4

m 6.6 ~ 4.4

2.3 m

2.0

1.4 1.1 0.9 0.6

ili!iii!iii!i ~ ~! !iiii!~i ~ ) !<iiii~ii! i¸

ii!~!!iii~iiiiii!%

0.3 Aval EcoRI Hhal Mbol Taql

Fig. 3. Southern blot analysis ofL. loa DNA. 200 ng of DNA was digested to completion with Aval, EcoRI, HhaI, MboI and TaqI and probed with the radiolabeled oligonucleotide, LL3M9REP. Molecular weight markers, M-/indlll and 0X

HaellI, are as indicated. Exposure time was 2 weeks.

within the repetitive region. Southern hybridization of LL3M9REP to L. loa DNA cut with AvaI or HhaI, an enzyme useful in the cloning of a Bru- gia repeat family [7], again revealed only two fragments (Fig. 3).

In order to explore the interrelationship between LL 1 and LL3, oligonucleotide primers 2 and 3, corresponding to sequences in the regions flanking the repetitive region, were used in the polymerase chain reaction to amplify ~gtl 1 clones containing these two inserts. Fragments of approximately 750 and 550 bp were obtained from LL1 and LL3, respectively. On Southern blot analysis, LL3M9REP hybridized to both of these PCR products and to a 1500 bp dimer of the 750 bp fragment (Fig. 4).

Sensitivity and specificity. The sensitivity of LL3M9 was assessed by dot blot analysis (Fig. 5). Peroxidase-labeled LL3M9 was used to probe decreasing amounts of total genomic DNA. As shown in Fig. 5, as little as 310 pg was detectable. A single Bm microfilaria has been estimated to contain 700

MW LL3 LL1

kb

1.4 1.1 0.9

0.6

0.3

Fig. 4. Interrelatedness of LLI and LL3. LL3M9REP was used to probe a Southern transfer of the PCR products of ~,gt 11 clones, LL 1 and LL3, amplified using oligonucleotide primers 2 and 3, derived from sequences flanking the repetitive region. Molecular weight markers (MW), 0X Haelll, are as indicated.

302

LL DNA (ng)

20 10 5 2.5 1.25 0.63

0.31 0.16 0.08 0.04 0.02 0.01

Fig. 5. Sensitivity of LL3M9. Doubling dilutions of 20 ng of L. Ioa DNA were dotted onto nitrocellulose and probed with peroxidase-labeled LL3M9 at a concentration of 20 ng ml '. Standard hybridization and wash conditions were used (ECL, Amersham). Maximum sensitivity was achieved with an ex-

posure time of 5 rain.

pg ofDNA [ 18]. If one assumes the DNA content of microfilariae to be comparable, it would be ex- pected that LL3M9 should be able to detect individual microfilariae. To test this hypothesis directly, blood samples containing decreasing numbers of microfilariae were filtered onto nitrocellulose membranes and probed with peroxidase-labeled LL3M9 (Fig. 6). Individual microfilariae were ea- sily identified. Radiolabeled LL3M9REP showed comparable sensitivity (data not shown).

Parasite, human and vector DNAs were dotted onto nitrocellulose and probed with peroxidase-labeled LL3M9 (data not shown). Hybridization was not observed to 1000-fold excess concentrations of human or Chrysops DNA. the family Filarioidiae, however, hybridization was detectable when LL3M9 was tested against a 100-fold excess of B. malayi, D. immitis and O. volvulus, even under conditions of high stringency. In order to determine whether the observed cross-reactivity was due to sequences flanking the repetitive region or to the re- ~2etitive region itself, this blot was reprobed w~th

P-labeled LL3M9REP (Fig. 7). hybridization was limited to L. loa DNA. Species-specificity of

Fig. 7. Specificity ofLL3M9REP. Radiolabeled LL3M9REP was used to probe a nitrocellulose dot blot containing 2 ng of L. loa DNA, 200 ng of various parasite DNAs (A. viteae (Av), B. malayi (Bin), D. irnrnitis (Di), M. perstans (Mp), O. volvulus (Ov) and W. bancrofti (Wb)) and 2 pg each of human (Hu) and Chrysops (Chr) DNA. Hybridization and washing conditions were identical to those used for sensitivity determinations (see

Materials and Methods). Exposure time was 2 days.

LL3M9REP was confirmed by using genomic DNA from these filarial species as templates in the polymerase chain reaction with the primers 2 and 3. Although products of varying sizes were detected on an ethidium bromide stained agarose gel (Fig. 8A), LL3M9REP hybridized only to those gener- ated using L. loa DNA as a template (Fig. 8B).

Discussion

Among the filarial species of humans, L. loa has been one of the least well studied, because of the difficulty in obtaining parasite material. The use of cytapheresis to concentrate microfilariae from the peripheral blood of infected patients provided sufficient quantities of DNA to construct a genomic library in kgtl 1. While human contamination of parasite DNA is unavoidable using this technique, differential screening with human and L. loa DNA allowed the identification of several repeated sequences of parasite origin. Two of these, LL1 and

MF# 0 1 20 50 Fig. 6. Detection of individual L. loa microfilariae (MF) using the cloned DNA probe LL3Mg. 1-ml Aliquots of peripheral blood containing approximately 50, 10, 1 or 0 microfilariae were filtered onto nitrocellulose and probed with peroxidase-labeled LL3M9.

The arrow indicates a single microfilaria.

303

kb

1.4 1.1 0.9

0.6

0.3 0.28 0.23 ' 0.19 0.12

17 mer p r i m e r ~

MW Av Bm Di Mp Chr Hu LL MW Av Bm Di Mp Chr Hu LL

Fig. 8. Specificity of LL3M9REP using the polymerase chain reaction. (Left) 3% agarose gel electrophoresis of the products of PCR amplification ofL. Ioa DNA (20 ng), human DNA (200 ng) and DNA (200 ng) from other Filarioidiae (abbreviations as in Fig. 7) using primers 2 and 3.20 ~1 of each 100-I.tl reaction was loaded per lane. (Right) Hybridization of LL3M9REP to a Southern transfer

of the amplification products shown on the left. Exposure time was I h.

LL3, appeared to be interrelated as determined by their crossreactivity in dot blots.

Sequence analysis of LL3M9, a 0.9-kb MboI fragment of LL3, revealed a 357-bp region composed of multiple copies of the hexamer, CTTAGG, arranged in a pattern similar to that described for eukaryotic satellite DNA [20]. Satellite DNA is thought to be the result of a combination of mutation and lateral amplification of a very short sequence. Like satellite DNA, the repetitive region of LL3M9 has an unusual GC content and lacks an open reading frame. Amplification of this region with synthetic primers derived from the flanking sequences gave fragments of different size when LL1 or LL3 were used as templates in the polymerase chain reaction. Hybridization of the amplified fragments with the repetitive oligonucleotide, LL3M9REP, suggests that LL1 and LL3 contain repetitive regions of different size with identical flanking nucleotide sequences. A similar conservation of flanking sequences has been observed in a highly repetitive sequence from Leish- mania donovani [121 ].

Southern blot analysis ofL. loa DNA digested to completion with restriction enzymes that rec- ognize sites flanking or within the repetitive region of LL3 revealed distinct bands when LL3M9 or LL3M9REP were used as probes, consistent with

either an interspersed or tandem arrangement of large repetitive blocks. In order to clarify this issue, LL3M9REP was used to probe a Southern blot of partial EcoRI digests of L. loa DNA. No additional bands were detected, suggesting an interspersed organization in the genome. The lack of additional restriction enzymes that cut infrequently within the repetitive region and the paucity of parasite material have hampered further investigation of the genomic organization of this unusual repetitive el- ement.

Repetitive DNA sequences probably undergo mutation at a more rapid rate than other regions of the genome and can be used to differentiate between closely related species and subspecies [4,24,25]. Such sequences have been used as probes to detect and identify filarial parasites in both peripheral blood [ 15] and insect vectors [26]. While Loa-specific DNA probes, such as LL3M9REP, are unlikely to replace standard diag- nostic techniques in most situations, they may be useful in the rapid screening of large numbers of samples for epidemiologic studies, as well as in the identification ofL. loa microfilariae in the blood of patients with concomitant infection with Man- sonella perstans, in whom large numbers of Man- sonella microfilariae may obscure the diagnosis of loiasis and thus impede appropriate treatment. In

304

the future, we hope to use the polymerase chain reaction to increase the sensitivity of parasite detection in the peripheral blood of infected patients.

The role of subspeciation in the geographic vari- ation observed in the epidemiology and clinical manifestations of certain parasitic infections has been difficult to determine because of the lack of morphologic differences between subspecies. As is the case for O. volvulus, the existence of different biologic variants of L. loa, based on transmission patterns and vector preference, has been the subject of controversy [22,23]. The identification ofa DNA sequence that can distinguish between the forest and savannah forms of O. volvulus has helped clarify this issue in onchocerciasis [24]. Although we did not find differential hybridization of LL3M9 or LL3M9REP to three geographic isolates tested (data not shown), sequence analysis of homologous repeats may reveal subtle strain differences, as has been described for both O. volvulus [24] and for Trypanosoma brucei [25].

Finally, the availability of a L. loa genomic expression library provides an alternative source of normally scarce parasite material. Further characterization of recombinants from this library should add appreciably to our understanding of this filarial pathogen.

Acknowledgements

The authors wish to thank Drs. E. Ottesen, F. Per- ler and S. Williams for their constructive sugges- tions and Dr. P. Romans for preparation of the Chrysops DNA.

References

1 Sasa, M. (1976) Human Filariasis. University Park Press, Tokyo.

2 Emmons, S.W., Klass, M.R. and Hirsch, D. (1979) Analy- sis of the constancy of DNA sequences during develop- ment and evolution of the nematode Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 76, 1333-1337.

3 Perler, F.B. and Karam, M. (1986) Cloning and characterization of two Onchocerca volvulus repeated DNA sequences. Mol. Biochem. Parasitol. 21,171-178.

4 Williams, S.A., DeSimone, S.M. and McReynolds, L.A. (1988) Species-specific oligonucleotide probes for the identification of human filarial parasites. Mol. Biochem. Parasitol. 28, 163-170.

5 Meredith, S.E.O., Unnasch, T.R., Karam, M., Piessens,

W.F. and Wirth, D.F. (1989) Cloning and characterization of an Onchocerca volvulus specific DNA sequence. Mol. Biochem. Parasitol. 36, 1-10.

6 Murray, K.A., Post, R.J., Crampton, J.M., McCall, P.J. and Kouyate, B. (1988) Cloning and characterization of a species-specific repetitive DNA sequence from Oncho- cerca armillata. Mol. Biochem. Parasitol. 30, 209-216.

7 McReynolds, L.A., Desimone, S.M. and Williams, S.A. (1986) Cloning and comparison of repeated DNA sequences from the human filarial parasite Brugia malayi and the animal parasite Brugia pahangi. Proc. Natl. Acad. Sci. USA 83,797-801.

8 Cesbron, J-Y., Chandenier, J., Taelman, H., Henry, D. and Capron, A. (1986) Density gradient separation of Loa loa and Dipetalonema perstans microfilariae from infected patients. Ann. Soc. Belg. Med. Trop. 66, 77-78.

9 Schultz-Key, H., Albiez, E.J. and Bi.ittner, D.W. (1977) Isolation of living adult Onchocerca volvulus from nodules. Tropenmed. Parasitol. 28,428-430.

10 McCall, J.W., Malone, J.B., Ah, H. and Thompson, P.E. (1973) Mongolian jirds (Meriones unguiculatus) infected with Brugia malayi by the intraperitoneal route: A rich source of developing larvae, adult filariae, and microfilariae. J. Parasitol. 59,436.

11 Kafatos, F.C., Jones, C.W. and Efstratiadis, A. (1979) De- termination of nucleic acid sequence homologies and rela- tive concentrations by a dot hybridization procedure. Nu- cleic Acids Res. 7, 1541-1552.

12 Bender, W., Spierer, P. and Hogness, D.S. (1983) Chromo- somal walking and jumping to isolate DNA from the Ace and rosy loci and the bithorax complex in Drosophila mel- anogaster. J. Mol. Biol. 168, 17-33.

13 Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Mol- ecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

14 Rigby, P.W., Dieckmann, M., Rhodes, C. and Berg, P. (1977) Labeling DNA to high specific activity in vitro by nick translation with DNA polymerase I. J. Mol. Biol. 113, 237-251.

15 Poole, C. and Williams, S. (1990) A rapid DNA assay for the species-specific detection and quantification of Brugia in blood samples. Mol. Biochem. Parasitol. 40, 129-136.

16 Sanger, F., Nicklen S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467.

17 Devereux, J., Haeberli, P. and Smithies, O. (1985) A com- prehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12,387-395.

18 Sim, B.K.L., Piessens, W.F. and Wirth, D.F. (1986) A DNA probe cloned in Escherichia coli for the identification ofBrugia malayi. Mol. Biochem. Parasitol. 19, 117- 123.

19 Rothstein, N., Stoller, T.J. and Rajan, T.V. (1988) DNA base composition of filarial nematodes. Parasitology 97, 75-79.

20 Frommer, M., Prosser, J., Tkachuk, D., Reisner, A.H. and Vincent, P.C. (1982) Simple repeated sequences in human satellite DNA. Nucleic Acids Res. 10, 547-563.

21 Ellis, J. and Crampton, J. (1988) Characterization of a sim-

pie, highly repetitive DNA sequence from the parasite Leishmania donovani. Mol. Biochem. Parasitol. 29, 9-18.

22 Gouteux, J.P. and Noireau, F. (1989) The host preferences of Chrysops silacea and C. dimidiata (Diptera:Tabanidae) in an endemic area of Loa Ioa in the Congo. Ann. Trop. Med. Parasitol. 83, 167-172.

23 Rodhain, F. (1980) Hypoth6ses concemant l'6cologie dy- namique des infections h Loa. Bull. Soc. Pathol. Exp. 2, 182-191.

24 Erttmann, K.D., Unnasch, T.R., Greene, B.M., Albiez, E.J., Boateng, J., Denke, A.M., Ferraroni, J.J., Karam, M., Schulz-Key, H. and Williams, P.N. (1987) A DNA se-

25

26

305

quence specific for forest form Onchocerca volvulus. Na- ture 327,415-417. Hide,G., Cattand, P., LeRay, D., Barry, J.D. and Tait, A. (1990) The identification of Trypanosoma brucei subspecies using repetitive DNA sequences. Mol. Biochem. Para- sitol. 39, 213-226. Sim, B.K.L., Mak, J.W., Cheong, W.H., Sutanto, I., Kurni- awan, L., Marwoto, H.A., Franke, E., Campell, J.R., Wirth, D.F. and Piessens, W.F. (1986) Identification of Brugia malayi in vectors with a species-specific DNA probe. Am. J. Trop. Med. Hyg. 35,559-564.

Documents

Cloning and characterization of a species-specific repetitive DNA sequence from Loa loa