Cloning and molecular characterization of vff1 gene

Cloning and molecular characterization of vff1 gene encoding Forisomes of Vicia faba

Von der Fakultät für Mathematik, Informatik and Naturwissenschaften der Rheinisch-

Westfälischen Technischen Hochschule Aachen zur Erlangung des akademischen Grades einer Doktorin der Naturwissenschaften genehmigte Dissertation

vorgelegt von

M. Sc. Maria Eugenia Fontanellaz

aus Rosario, Argentinien

Berichter: Universitätsprofessor Dr. rer. nat. R. Fischer Universitätsprofessor Dr. rer. nat. D. Prüfer Tag der mündlichen Prüfung: 7. Dezember 2006

Diese Dissertation ist auf den Internetseiten der Hochschulbibliothek online verfügbar.

Contents ___________________________________________________________________________

I

I INTRODUCTION

I.1 Phloem structure and function 1

I.1.1 Sieve element-companion cell complex 1

I.1.2 P-Proteins and regulation of phloem transport 2

I.1.3 Forisomes 5

I.1.4 Ca2+-binding motifs and secondary protein structures 7

I.1.4.1 EF-hand 7

I.1.4.2 Coiled-coil domains 8

I.2 Promoter sequences and regulation of transcription 9

I.2.1 Phloem-specific promoters 9

I.3 Aim of this thesis 12

II MATERIALS AND METHODS 14

II.1 Materials 14

II.1.1 Chemicals and consumables 14

II.1.2 Enzymes and reaction kits 14

II.1.3 Buffers, media and solutions 15

II.1.4 Matrices and membranes 15

II.1.5 Primary antibodies, secondary antibodies and substrates 15

II.1.6 Biological material 15

II.1.6.1 Bacterial strains 15

II.1.6.2 Plants 16

II.1.6.3 Animals 16

II.1.7 Vectors 16

II.1.7.1 Bacterial expression vector 16

II.1.7.2 Plant expression vectors 17

II.1.8 Oligonucleotides 17

II.1.9 Equipment and applications 18

II.2 Methods 20

II.2.1 Plant material and isolation of Forisomes 20

II.2.2 Peptides sequencing 20

II.2.3 Isolation of genomic plant DNA 21

Contents ___________________________________________________________________________

II

II.2.4 RNA isolation 21

II.2.5 Libraries construction and screening strategies 22

II.2.5.1 cDNA expression library 22

II.2.5.2 cDNA libraries 22

II.2.6 PCR technologies 24

II.2.6.1 Cloning of 5’ and 3’ ends of full-length cDNAs using

RACE-PCR 24

II.2.6.2 PCR amplification of cDNA 25

II.2.6.3 Identification of introns and genomic DNA cloning by

LD PCR 26

II.2.6.4 Genome Walking 26

II.2.7 Recombinant DNA technologies 27

II.2.7.1 Isolation of plasmid DNA from E.coli 27

II.2.7.2 Quantification of DNA 27

II.2.7.3 PCR amplification 27

II.2.7.4 Agarose gel electrophoresis of DNA 28

II.2.7.5 Preparative agarose gel electrophoresis 28

II.2.7.6 DNA sequence analysis 29

II.2.8 Preparation and transformation of E. coli 29

II.2.8.1 Preparation of electro-competent E. coli 29

II.2.8.2 Transformation of E. coli by electroporation 29

II.2.8.3 Culturing of E. coli and glycerol stock preparation 29

II.2.9 Preparation and transformation of Agrobacterium tumefaciens 30

II.2.9.1 Preparation of electro-competent Agrobacterium cells 30

II.2.9.2 Transformation of Agrobacterium by electroporation 30

II.2.9.3 Determination of the efficiency of recombinant bacteria

transformation 31

II.2.9.4 Growth of recombinant A. tumefaciens and preparation

of glycerol stocks 31

II.2.10 Generation and characterisation of transgenic plants 31

II.2.10.1 Transient transformation of tobacco leaves 31

II.2.10.2 Preparation of recombinant Agrobacteria 31

II.2.10.3 Vacuum infiltration of tobacco leaves 32

II.2.10.4 Stable transformation of tobacco plants 32

Contents ___________________________________________________________________________

III

II.2.10.5 Growth of N. tabacum cv. Petite Havana SR1 33

II.2.10.6 Measurement of GUS activity and histochemical analysis 33

II.2.11 Expression and purification of recombinant proteins 34

II.2.11.1 Expression and purification of Forisome-GST fusion

proteins from E. coli 34

II.2.11.2 Fermentation at 4-liter scale 35

II.2.12 Protein analysis 36

II.2.12.1 Quantification of proteins 36

II.2.12.2 SDS-PAGE and Coomassie brillant blue staining 36

II.2.12.3 2D-PAGE analysis 37

II.2.12.4 Immunoblot analysis 38

II.2.13 Polyclonal antibodies production 38

II.2.13.1 Mouse immunization 38

II.2.13.2 Chicken immunization 39

II.2.13.3 Rabbit antisera 39

II.2.14 Determination of antisera titers 39

II.2.15 Confocal immunofluorescence microscopy 41

III RESULTS 41

III.1 Molecular characterization of Forisome genes 41

III.1.1 Analysis of isolated Vicia faba Forisomes by SDS-PAA

gel electrophoresis 41

III.1.2 Generation and characterization of Forisome-specific

polyclonal antibodies 41

III.1.2.1 Immunoblot analysis of isolated Vicia faba Forisomes 41

III.1.2.2 Immunoblot analysis of isolated Vicia faba Forisomes

on 2D-gel electrophoresis 42

III.1.3 Screening of cDNA Libraries 43

III.1.4 Immunoscreening of cDNA expression library 45

III.1.5 PCR screening of cDNA expression library 46

III.1.6 Cloning full-length Forisome cDNA 46

III.1.7 Isolation of total RNA from Vicia faba 51

III.1.8 Identification of the transcription start sites for vff1 52

III.1.9 Molecular characterisation of the vff1 genomic clone 53

Contents ___________________________________________________________________________

IV

III.2 Molecular cloning and characterization of the vff1 promoter 54

III.2.1 Construction of genome walking libraries 54

III.2.2 Identification and cloning of vff1 gene 5’-flanking region 54

III.2.3 Potential regulatory sequences in the vff1 promoter 56

III.2.4 Characterization of vff1 promoter in transgenic tobacco 58

III.2.4.1 Cloning of vff1 promoter into the pTRAk-GUS vector 58

III.2.4.2 Expression of vff1 Promoter-GUS fusions in tobacco

plants 60

III.2.4.2.1 Tissue specificity of vff1 promoter in transgenic

plants 60

III.2.4.2.2 Developmental regulation of vff1 promoter in

transgenic plants 63

III.2.4.3 Deletion analysis of vff1 promoter in transiently

transformed tobacco leaves 65

III.3 Bacterial expression and characterization of VFF1 66

III.3.1 Cloning of vff1 into the bacterial expression vector

pGEX-5X-3 66

III.3.2 Bacterial expression and purification of VFF1 66

III.3.3 Characterization of GST-VFF1 fusion protein by

immunoreativity toward Forisome-specific mouse and

chicken antisera 68

III.4 Immunological characterization of native and recombinant

Forisomes 70

III.4.1 Reactivity of polyclonal anti-GST-VFF1 antibodies to isolated

Forisomes 70

III.4.2 Characterization of native Forisomes by immunofluorescence 71

III.4.2.1 Reactivity of Forisome-specific polyclonal antibodies to

native Forisomes 71

III.4.2.2 Reactivity of VFF1-specific polyclonal antibodies to native

Forisomes 73

IV DISCUSSION 75

IV.1 Molecular characterization of Forisome genes 75

IV.1.1 Analysis of Vicia faba Forisome subunits 75

Contents ___________________________________________________________________________

V

IV.1.2 Cloning and characterization of vff1 gene 76

IV.1.2.1 Screening of cDNA libraries 76

IV.1.2.2 Database search and cloning of vff1 gene 78

IV.1.2.3 Sequence analysis of vff1 gene 78

IV.1.2.4 Motifs identified within the vff1 gene 79

IV.1.3 Immunological evidence of vff1 gene encoding a Forisome

protein 82

IV.1.3.1 Expression and purification of recombinant VFF1

protein 82

IV.1.3.2 Immunoreactivity of Vicia faba Forisome-specific

polyclonal antibodies to recombinant VFF1 proteins

and native Vicia faba Forisomes 83

IV.1.3.3 Immunoreactivity of VFF1-specific polyclonal antibodies

to recombinant VFF1 proteins and native Vicia faba

Forisomes 84

IV.2 Molecular characterization of vff1 promoter 85

IV.2.1 Sequence analysis of vff1 promoter 85

IV.2.2 Phloem-specific expression pattern driven by vff1 promoter 86

IV.2.3 Differential expression pattern driven by vff1 promoter in the

sieve element-companion cell complex 88

IV.2.4 Developmental expression pattern of vff1 promoter in different

maturation stages 90

IV.2.4.1 Vff1 promoter expression pattern in roots of N. tabacum 90

IV.2.4.2 Vff1 promoter expression pattern in leaves of N. tabacum 91

IV.2.5 Vff1 promoter activation during the sink-source transition 92

IV.2.6 Vff1 promoter expression induced upon wounding 93

IV.2.7 Deletion analysis 94

IV.3 Conclusion and future prospects 95

V SUMMARY 97

VI REFERENCES 99

VII APPENDICES 116

VII.1 List of abbreviations 116

Contents ___________________________________________________________________________

VI

VII.2 Schematic presentation of vectors maps 119

VII.3 Figures 121

VII.4 Tables 122

Chapter I Introduction ___________________________________________________________________________

1

I Introduction

I.1 Phloem structure and function

In higher vascular plants, phloem is a highly specialized tissue for long distance transport of

metabolites and signaling components. In contrast, water and inorganic nutrients flow from

roots to shoots and leaves in the xylem. Topologically, xylem flux takes an apoplastic, i.e.,

extracellular path, as the xylem vessels consist of the lignified walls of dead cells. On the

other hand, products of photosynthesis travel from source to sink tissues in the sieve tubes of

the phloem, following a symplastic pathway (Behnke and Sjölund, 1990). Moreover, a wide

variety of other material is also transported through the phloem, including proteins, amino

acids, solutes, viruses, and various signaling molecules.

Sieve tubes consist of sieve elements (SEs), terminally differentiated cells that undergo

exceptional cytoplasmic reorganization to become functional phloem conductive cells capable

of long-distance translocation. Mature sieve elements are characteristically devoid of most of

the intracellular organelles, nuclei, central vacuole, Golgi bodies and dictyosomes (Oparka

and Turgeon, 1999; Cronshaw, 1981) as well as most of the ribosomes and microtubules that

are lost during the course of differentiation (Sjölund, 1997). Microfilaments also vanish

during sieve element maturation (Parthasarathy and Pesacreta, 1980). Reorganization of the

endomembrane system results from degeneration of the tonoplast and dictyosomes and

changes in the endoplasmic reticulum (Sjölund and Shih, 1983).

Having a common boundary, arranged end-to-end sieve elements develop numerous pores in

the cell walls between them. Plasmodesmata (PD) connecting SEs across the end walls

become greatly modified giving rise to the sieve plates that are characteristic of this tissue

(Behnke, 1989). Sieve plates ensure cytoplasmic continuity of the entire sieve-tube network,

enabling pressure-driven mass flow throughout the plant body (Knoblauch and van Bel, 1998;

van Bel et al., 2002). According to the mass flow concept of phloem transport (Münch, 1930),

the transport of materials through phloem sieve tubes is passive, nonselective, and driven

entirely by pressure gradients that are maintained by active loading of photosynthetic products

in source tissue and unloading of materials in sink tissue.

I.1.1 Sieve element-companion cell complex

After the first description of the SE by Hartig (1837) the typical sieve element/companion cell

complex of the phloems, became center of numerous investigations. Typically, each sieve

element in angiosperms is accompanied by one or more companion cells (CCs), which

interact intimately with the sieve element and play a crucial role in regulating phloem loading

and unloading and in the turnover of sieve element proteins and other components (Oparka

and Turgeon, 1999). Sieve elements and companion cells are derived from unequal


2

longitudinal division of a single fusiform mother cell (Esau, 1969). During the course of

differentiation, cytoplasmic degeneration include a disintegration of the nucleus together with

the loss of ribosomes which hinders its protein biosynthesis (Thompson and Schulz, 1999).

Thus, the cell that becomes the sieve element, gradually lose genetic and metabolic control.

As a consequence, these elongated conducting elements of the phloem, the SEs, become

intimately (structurally, developmentally, and functionally) associated with adjacent

companion cells between which are capable of exchanging information via specialized pore

plasmodesmata units (PPUs; van Bel and Kempers, 1996). These PPUs are different from

other plasmodesmata. The lateral (axial) plasmodesmata that connect the SE and CC (PPUs)

are always branched on the CC side of the shared wall only, thereby comprising one broader

pore-like channel at the sieve element side while several narrower branching out at the

companion cell side (Esau and Thorsch, 1985). The PPUs form a continuity between the sieve

element plasma membrane and that of the companion cell, hence, connecting their

cytoplasms. Because of these intimate structural and functional connections between SE and

CC, the SE-CC complex is frequently viewed as a single functional entity within the phloem.

During the differentiation of phloem sieve elements, the endoplasmic reticulum undergoes

unique modifications to form the sieve element reticulum (SER; Sjölund and Shih, 1983)

which persists in mature, functioning sieve tubes. Cisternae of the SER lack ribosomes and

are restricted to the periphery of the sieve element at late stages of development. Some of the

SER are seen as single cisternae in close contact with the sieve element plasma membrane.

Probably the companion cell ER is also in contact with the sieve element reticulum held

together by the PPUs. Both the PPUs and the SER possibly ensure the protein transport of the

companion cell to the sieve element (Fisher et al., 1992; Imlau et al., 1999).

I.1.2 P-Proteins and regulation of phloem transport

More than a hundred proteins were detected in phloem exudates of Cucurbita maxima,

Triticum aestivum, Ricinus communis and Oryza sativa (Eschrich and Heyser, 1975; Fisher et

al., 1992; Nakamura et al., 1993; Sakuth et al., 1993). These phloem proteins were considered

to maintain the physiological functions of sieve tubes, such as sieve plate occlusion, signal

transduction, redox regulation, and phloem loading, among others (Hayashi et al., 2000).

Mature sieve elements retain a modified endoplasmic reticulum (ER), mitochondria,

numerous types of proteins, and specialized sieve element plastids. Most of these components

are arranged along the lateral walls of the sieve element and collectively constitute a system

known as the parietal layer (Ehlers et al., 2000). Based on electron micrographs and

descriptions of plastids from the sieve elements of many different species, two types of sieve

element plastids are distinguished (Behnke, 1991a). S-type plastids contain only starch

inclusions, while P-type plastids contain mainly protein inclusions along with some starch

inclusions. Furthermore, crystalloid proteins were present in these sieve elements. Behnke


3

(1991b) referred to “nondispersive” versus “dispersive” protein bodies, also called P-proteins

or structural sieve element proteins. These terms arose because of changes that are observed

during sieve element ontogeny. Early in the maturation process, many protein bodies are often

observed, some of which disperse as the sieve element matures and some that remain

unchanged in mature sieve elements. Early stages of sieve element differentiation are

characterized by the appearance of structurally distinct cytoplasmic proteins, in reference to

the P-proteins. Ultrastructural investigations originally defined P-proteins as idiosyncratic

components of the structural architecture of sieve elements (Cronshaw and Esau, 1967).

Depending upon the plant species, P-proteins form fibrillar, tubular, or crystalline inclusions

whose accumulation and structural state appear to be strictly controlled during differentiation.

Figure I-1 In vivo structure of sieve elements in Vicia faba (Knoblauch and van Bel, 1998). Sections of two sieve tubes with CCs, mostly in staggered position are depicted. SEs and CCs are mostly connected through numerous pore plasmodesma units. P-plastids, mitochondria, and ER are parietally positioned and evenly distributed. Parietal proteins are locally aggregated. Parietal proteins and ER are sometimes located on the sieve plates or the margins of the sieve pores but do not impede mass flow. A large spindle-shaped crystalline protein cluster rests close to the sieve plate. The massive protein body is a specialty of the Fabaceae. C, callose; CC, companion cell; CP, crystalline protein body; CW, cell wall; ER, endoplasmic reticulum; M, mitochondria; N, nucleus; P and Pl, plastids; PP, parietal protein; PPU, pore plasmodesma unit; SE, sieve element; SP, sieve plate; V, vacuole.

There are many shapes of non-dispersive fibrous and crystalloid protein bodies, also called P-

proteins, which may be quite large and are often observed in the lumen of sieve elements

(Figure I-1). Electron micrographic images sometimes show masses of fibrous or amorphous

protein located directly in front of or within the pores of sieve plates and that appear to block

transport through the pores. To date, the large crystalloid P-protein bodies that occur

exclusively in Fabaceae were classified as being non-dispersive (Behnke, 1991b).

Confocal laser scanning microscopy (CLSM) allowed the direct visualization of fluorescent

dyes moving in sieve tubes of V. faba (Knoblauch and van Bel, 1998), which provided

definitive evidence of unimpeded mass flow in intact plants. This study also reported that P-


4

type plastids in V. faba actually exploded upon injury of sieve elements, releasing their

protein contents, which, together with the dispersed crystalloid protein, rapidly occluded the

sieve plate pores. Furthermore, it was observed that crystalloid P-proteins of V. faba rapidly

disperse and occlude sieve plate pores after injury or osmotic shock (Knoblauch et al., 2001).

This process is rapidly reversible and controlled by calcium fluxes. Protein from the large

crystalloid protein bodies in V. faba sieve elements dispersed to plug the sieve plate pores

after injury from micropipette injection (Figure I-2) or osmotic shock induced by various

osmolytes.

Figure I-2 Conformational change of crystalline P-protein bodies in Vicia faba as a response to injury (Knoblauch et al., 2001). Crystalloid P-protein bodies were observed in CDMFDA-stained phloem tissue of broad bean (V. faba) by CLSM. (A) Condensed conformation before insertion of a micropipette (not visible; tip diameter of 2 mm). (B) Dispersed conformation after injury. Micropipette insertion triggers the transformation of the dense, elongate crystalloid into a sieve tube plug. Asterisks, crystalline P-protein bodies; CC, companion cell.

Addition of the chelating agent EDTA completely prevented crystalloid P-protein dispersal,

and repeated exchanges of Ca2+ and EDTA-containing media induced the alternate dispersal

and reassembly, respectively, of crystalloid P-proteins in injured sieve tubes. Furthermore, it

was also observed that the Ca2+ response could be mimicked partly by unphysiological pH

values (Knoblauch et al., 2003). Plugging of sieve plates to maintain turgor pressure within

the sieve tube after injury to a sieve element is the most generally accepted role for these

proteins, although other functions in pathogen and pest defence have been proposed (Read

and Northcote, 1983).

It has been suggested that not only these crystalloid P-proteins but also P-protein originating

from all sources within V. faba sieve elements (e.g., P-plastids, parietal proteins, and larger

crystalloid P-proteins) takes part in the occlusion of sieve plate pores after injury to cells

(Knoblauch and van Bel, 1998). Moreover, proteins in V. faba are much more sensitive to

perturbation than are the P-type plastids. Unlike the reversibility of crystalloid protein

dispersal, explosion and dispersal of the P-type plastids appears to be irreversible. Dispersal


5

of parietal proteins after injury has also been observed and was found to be more sensitive to

perturbation than was the explosion of P-type plastids (Knoblauch and van Bel, 1998).

P-protein, as a structural entity, has been observed in sieve elements of all dicotyledons

examined (Evert, 1990) and in the majority of monocotyledons, although conspicuously

absent in families such as the Poaceae (Eleftheriou, 1990). The lack of P-protein also appears

to be a consistent feature of gymnosperms (Schulz, 1990) and seedless vascular plants.

Large crystalloid P-proteins are a particular characteristic of the Fabaceae (legumes). Analysis

sieve elements of Urtica dioica (Urticaceae) and Rubus fruticosus (Rosaceae) in response to

wounding showed that the P-protein bodies present in these species failed to disperse and

occlude sieve pores, even when severely damaged in the presence of free Ca2+. P-type plastids

also appear to have somewhat limited distribution. Proteinaceous P-type plastids were

observed in just 64 of 382 dicot families studied by Behnke (1991a); the majority of families

contained starch-filled S-type plastids.

I.1.3 Forisomes

The conformational regulatory properties of the crystalline P-proteins in Vicia faba sieve

elements are the most remarkable in the field of long-distance transport in plants. Their

reversible change between a dispersed and a condensed condition adjusts the permeability of

the sieve plates and disposed the authors to give to these protein bodies the name Forisome

(lat. foris: gate, greek soma: body; Knoblauch et al., 2003).

In contrast to P-plastids that are long-establish organelles in the SEs of dicotyledons (Bhenke,

1981), Forisomes are not organelles in the strict sense, as they are not separated from the

cytosol by a membrane (Knoblauch and Peters, 2004). In vivo studies using a transient

fluorescence dye on the dispersed conformation adopted by the Forisomes (Knoblauch et al.,

2001) evidenced the presence of a distinctive protein body instead of a complete dissolution

into unordered fibrils observed by electronmicrographs. This implies that Forisomes consist

of fibrils that are organized quite differently in the condensed (longitudinally expanded) and

the dispersed (longitudinally contracted) state, however, held together after the induced

conformational change. In the latter, the fibrils form an irregular, loose network.

In addition, electronmicrographs of condensed Forisomes showed longitudinally arranged

fibrils with a perfectly regular perpendicular cross-striation (wavelength 12 to 15 nm)

(Knoblauch et al., 2001). This striation is always visible in longitudinal sections of expanded

Forisomes, regardless of the plane of section (radial or tangential). Therefore, the protein(s) in

expanded Forisomes must be organized in a series of transversal planes. The regular striation

pattern consistently has been found in earlier studies (Lawton, 1978a; Arsanto, 1982), and the

disordered appearance of Forisomes in the plug-forming state was documented as well.

Lacking any knowledge of the dynamics of Forisomes, these two conditions had been


6

interpreted as different stages of sieve element differentiation (Wergin and Newcomb, 1970;

Palevitz and Newcomb, 1971; Arsanto, 1982), or as preparation artefacts of little

physiological significance (Fisher, 1975; Lawton, 1978b). However, in the context of recent

findings (Knoblauch and Peters, 2004), available ultrastructural data rather seem to document

a remarkable example of rigorously regulated, rapid, and reversible molecular self-assembly.

The parallelization of fibrils and the establishment of the perpendicular striation during

Forisome expansion point to a lateral co-alignment of at least two types of structural domains

that alternate on each fibril. These domains might differ in physicochemical parameters such

as hydrophobic or electrical charge patterns, causing them to organize in alternating planes

that are oriented normal to the Forisome axis. If so, fibril co-alignment might actually play a

role in driving Forisome expansion. A paradigmatic example of such a process can be found

in nematode sperm cells, in which pH-controlled lateral interactions between MSP (major

sperm protein) subfilaments initiate the assembly of MSP filaments and filament bundles.

Notably, the reversible lateral coalignment of MSP filaments appears to provide the driving

force for nematode sperm motility (Bottino et al., 2001).

Further in vitro studies in Forisomes isolated from individual cells by micro-dissection

indicated that Ca2+ above a threshold of less than 100 nM induces a reversible doubling of

Forisome diameter and a reduction of Forisome length by almost one third (Knoblauch et al.,

2003). This anisotropic response results in a decrease of aspect ratio from 10 to 3 combined

with a more than threefold volume increase, which is the geometric basis for sieve tube

plugging. Contraction/expansion cycles can be induced in vitro by exchanging the incubation

medium. Therefore, no soluble factors are required for Forisome action, implying also that

reversible depolymerization, an important mechanism of motility in many cell types

(Mogilner and Oster, 2003), does not occur. Both Ca2+-induced contraction and chelator-

mediated expansion can be completed in less than 0.1 sec. Forisomes can be fixed between

pairs of glass fibers to form Forisome-powered micro-forceps. In such setups, they develop

forces of up to 0.1 µN in both contraction and expansion (Knoblauch et al., 2003).

Calcium is an important component of many signal transduction pathways, and calcium

regulation has been implicated in phloem function. Knoblauch et al. (2001) showed that an

influx of calcium into legume sieve elements stimulates the rapid and reversible dispersal of

crystalloid P-protein to occlude sieve plate pores. The concentration of free calcium in sieve

tubes of R. communis has been found to be significantly higher than that in surrounding tissue

(Brauer et al., 1998), and calcium-dependent protein kinases have been detected in rice

phloem sap (Nakamura et al., 1993). Volk and Franceschi (2000) showed evidence of a

calcium channel in the sieve element plasma membrane of tobacco and of the aquatic plant

Pistia stratiotes using immunolabeling with antibodies to a calcium channel protein. These

authors proposed that calcium channels become activated during wounding or pathogen

attack, facilitating calcium influx into phloem tissues. McEuen et al. (1981) detected a


7

calcium binding protein distinct from calmodulin in phloem exudates of C. maxima and

speculated that it might be associated with P-protein function.

On the other hand, given that in general the presence of ATP is a requirement for the majority

of motor-like biomolecules, it become evident that Forisomes might represent a previously

unknown class of mechano-proteins since their reversible conformational change is not driven

by ATP but energized by changes of the free Ca2+ concentration or pH variations. ATP-driven

motor proteins, the actuator of living cells, possess promising characteristics in micro- and

nanodevices, however, their dependence on a strictly defined chemical environment can be

disadvantageous. ATP-independency, together with a periodic reversible motion, are difficult

properties to ascertain. These two remarkable features are found in Forisomes, making them

one of the most promising proteins in the field of biomimetic engineering.

The wide range of applications for biomimetic smart materials underscored the need for the

molecular and biological investigation of the Forisome described in the available work.

I.1.4 Ca2+-binding motifs and secondary protein structures

I.1.4.1 EF-hand

The EF-hand is the most frequent motif found in Ca2+-binding proteins (Nakayama and

Kretsinger, 1994; Muranyi and Finn, 2001). The EF-hand family is a large class of Ca2+-

binding proteins that contain homologous Ca2+-binding sites within a characteristic helix-

loop-helix motif (da Silva and Reinach, 1991; Kawasaki and Kretsinger, 1994; Falke et al.,

1994; Chazin, 1995). EF-hands are generally found back-to-back in anti-parallel pairs with β-

sheet-like hydrogen bonding occurring between the loops of the coupled sites. These coupled

sites are often found to have cooperative metal ion binding, as in the case of calmodulin.

Within this characteristic helix-loop-helix motif, the Ca2+ is enclosed in the loop between two

α-helices, in a pentagonal, bipiramidal configuration.

Proteins containing the EF-hand Ca2+-binding motif, such as calmodulin and calcineurin B,

function as regulators of various cellular processes that are sensitive to Ca2+ (Nakayama and

Kretsinger, 1994; Kawasaki and Kretsinger, 1995; Ikura, 1996; Polans et al., 1996; Schafer

and Heizmann, 1996). Many essential cellular processes, such as cell cycle control, nucleotide

metabolism and signal transduction, are tightly regulated by calcium. In certain Ca2+-binding

proteins, regulatory domains undergo large conformational changes upon ion binding, and

this response modulates their overall intramolecular conformation and their interaction with

other proteins, including aggregation and dissociation (Rashidi, H.H. et al., 1999; Nakashima,

K. et al., 1999; Pal, G.P. et al., 2001).

Despite the dominance of the EF-hand motifs, other known Ca2+-binding motifs (Muranyi, A.

and Finn, B.E., 2001; Swairjo, M.A. and Seation, B.A., 1994; Nalefski, E.A. and Falke, J.J.,

1996; Rizo, J. and Südhof, T.C., 1998; Weis, W.I., 1996) are found in Ca2+-binding proteins.


8

I.1.4.2 Coiled-coil domains

The rodlike α-helical coiled-coil is one of the simplest yet most common structural motifs

occurring in proteins. Consisting of two to five α-helices twisted into a left-handed supercoil,

the occurrence of this structure is well documented, occurring in a wide variety of proteins

including motor proteins, DNA binding proteins, extracellular proteins, and viral fusion

proteins (Lupas, 1996; Kohn et al., 1997; Burkhard et al., 2001). The presence of a

continuous interface of hydrophobic amino acids along the length of the helices provides a

major source of stability to the fold as the hydrophobics pack in a knobs-into-holes fashion

shielded from the bulk solvent (Crick, 1953). The pattern of repeating hydrophobic residues at

positions a and d of the heptad repeat (denoted abcdefg) that are responsible for coiled-coil

formation was first identified by Hodges et al. (1972) from the amino acid sequence of

tropomyosin. Later, a dimerization domain of a family of transcription factors, the leucine

zipper (Landschulz et al., 1988), was also described comprising this structural motif.

Figure I-3 Structures of parallel coiled coils (Müller, K.M. et al., 2000). (A) Helical wheel diagram of a parallel, dimeric coiled coil illustrating the disposition of the characteristic heptad repeat. (B-C) X-ray crystal structures of dimeric and trimeric GCN4 leucine zipper variants. The backbone and interface residues are shown superimposed on the ribbon representation of the helices.


9

The coiled-coil domain is responsible for oligomerization of protein subunits and concomitant

folding of the proteins. The versatility of coiled coils for oligomerization derives from their

diversity of oligomeric structures. Coiled coils are gently twisted, ropelike bundles containing

two to five α-helices in parallel or antiparallel orientation. The N and C termini of the helices

are easily accessible, facilitating linkage to other proteins. Parallel dimers and trimers are by

far the most commonly observed coiled coils (Figure I-3).

I.2 Promoter sequences and regulation of transcription

The regulation of gene expression at the level of transcription is a key control point affecting

gene expression in response to a variety of extra- and intracellular signals, during

developmental processes and for tissue specificity. In eukaryotes, there are tens of thousands

of protein-coding genes, each of which has its unique program of transcription. The cis-acting

DNA sequences that encode these transcriptional programs include transcriptional enhancers,

proximal promoters, and core promoters also called minimal promoters. A typical eukaryotic

promoter consists of a minimal promoter and upstream cis-elements. The minimal promoter is

essentially a TATA box, an A/T-rich region located about 30 nucleotides (nt) upstream of the

transcription start site where RNA polymerase II, TATA-binding protein (TBP), and TBP-

associated factors (TAFs) bind to initiate transcription. However, minimal promoters alone

have no transcriptional activity. The cis-elements, to which tissue-specific or development-

specific transcription factors bind, individually or in combination, determine the spatio-

temporal expression pattern of a promoter at the transcriptional level. Enhancers and proximal

promoters are recognized by sequence-specific DNA-binding proteins that regulate

transcription (Blackwood and Kadonaga, 1998; Lee and Young, 2000; Lemon and Tjian,

2000; Malik and Roeder, 2000). Enhancers are often located many kilobase pairs (kbp)

upstream or downstream of the transcription start site, whereas proximal promoters are

typically within a couple hundred base pairs (bp) of the start site. Core promoters encompass

the transcription start site and specify the site of transcription initiation by the basal

transcriptional machinery (Orphanides et al., 1996; Smale, 1997; White, 2001). The core

promoter is at a unique and important position in the transcription process, as it is the eventual

target of the action of the many sequence-specific factors and co-regulators that control the

transcriptional activity of each gene.

I.2.1 Phloem-specific promoters

Regulation of transcription is achieved by the activity of multiple proteins that bind to

regulatory elements, many of which are upstream of the promoters and alter basal rates of

transcription initiation and/or elongation (Roeder, R.G., 1991; Yankulov, K. et al., 1994). To

understand the mechanisms of tissue-specific and constitutive gene expression in plants, a


10

number of promoters and transcription factors have been studied in recent years (Benfey, P.

N. and Chua, N.-H., 1989; Leyva, A. et al., 1992; Fujiwara, T. and Beachy, R. N., 1994;

Suzuki, M, 1995; Faktor, O. et al., 1996; Yin, Y. et al., 1997b; Ringli, C. and Keller, B.,

1998; Niggeweg, R. et al., 2000). It was shown that constitutive promoters, such as the

Cauliflower mosaic virus 35S promoter (CaMV 35S; Odell et al., 1985), a double-stranded

DNA virus belonging to the Caulimoviridae family, and the promoter from Cassava vein

mosaic virus (CsVMV; Verdaguer, B. et al., 1998), a plant pararetrovirus from the

Caulimoviridae family, are modular in organization and multiple cis-elements. These

elements, with specific transcription factors, apparently interact in an additive and/or

synergistic manner to confer gene expression in all plant tissues. Similarly, tissue-specific

promoters contain multiple elements that contribute to promoter activity in both positive and

negative ways (Leyva, A. et al., 1992; Fujiwara, T. and Beachy, R. N., 1994; Suzuki, M. et

al., 1995; Ellerstrom, M. et al., 1996; Ringli, C. and Keller, B., 1998; Hauffe, K. D. et al.,

1993). Among tissue-specific promoters, several promoters from plants (Yang and Russell,

1990; Brears et al., 1991; DeWitt et al., 1991; Ohta et al., 1991; Martin et al., 1993; Hérouart

et al., 1994; Shi et al., 1994; Truernit and Sauer, 1995; Tornero et al., 1996), Agrobacterium

(Schmülling et al., 1989; Sugaya et al., 1989; Guevara-García et al., 1993) and viruses

(Medberry et al., 1992; Bhattacharyya-Pakrasi et al., 1993; Rohde et al., 1995) have been

reported to drive expression of reporter genes in the phloem of transgenic plants, thus

designated as phloem-specific promoters. These tissue-specific promoters include the

glutamine synthetase 3A (GS3A) gene promoter (Brears et al., 1991), the Arabidopsis H+-

ATPase isoform 3 (AHA3) gene promoter (DeWitt et al., 1991), the Agrobacterium rolC

promoter (Schmülling et al., 1989), the Arabidopsis sucrose synthase gene (Asusl) promoter

(Martin et al., 1993), the maize sucrose synthase-1 (Shl) gene promoter (Werr et al., 1985;

Yang and Russell, 1990) and the rice tungro bacilliform virus (RTBV) promoter

(Bhattacharyya-Pakrasi et aL, 1993; Yin and Beachy, 1995).

Brears et al. (1991) found that when the GS3A promoter is deleted to nucleotide -132 relative

to the transcriptional start site, it can still direct tissue-specific expression, and a 17 bp

imperfect palindrome was identified as a putative cis-element by virtue of the binding of a

nuclear protein complex (Brears et al., 1991). Later on, Hehn and Rohde (1998) identified a

phloem specific motif of 13 bp in length which has been described to be highly conserved

among four phloem-specific promoters, originating from a pea glutamine synthase gene

(GS3A), coconut foliar decay virus (CFDV), rice tungro bacilliform virus (RTBV), and an

Agrobacterium rhizogenes rolC gene as well as the a Robinia pseudoacacia inner-bark lectin

gene (Rplec2; Yoshida et al., 2002).

Furthermore, the rice tungro bacilliformbadnavirus (RTBV) promoter (Qu, R.D. et al., 1991;

Hay, J. M. et al., 1991) and the transcription factors that interact with it served as a model

system to study plant tissue-specific gene expression. The virus, which replicates solely in

phloem tissues, has a single promoter that is active in transfected protoplasts and is phloem-


11

specific in transgenic rice plants (Yin, Y. and Beachy, R. N., 1995; Yin, Y. et al., 1997a;

Chen, G. et al., 1994; Klöti, A. et al., 1999). Within the promoter sequence, multiple cis-

elements, including motifs associated with tissue-specific expression like GATA box (Lam E

et al., 1989), were identified as being required for phloem-specific gene expression (Yin, Y.

and Beachy, R. N., 1995; Yin, Y. et al., 1997b; He, X. et al., 2000; Meisel, L. and Lam, E.,

1997). The GATA A(N)3GATA motif is known to be important for phloem-specific gene

expression not only from the rice tungro bacilliform virus RTBV promoter (Yin et al., 1997a)

but also the same motif was found in the promoters of GS3A (Brears et al., 1991), the

Arabidopsis plasma membrane H+-ATPase gene (AHA3; DeWitt et al., 1991), a potato

invertase gene (Hedley et al., 2000) and the Rplec2 (Yoshida et al., 2002).

The 13bp and GATA motifs are conserved between virus and plant promoters, implying an

important role for these motifs for gene expression in the phloem.

Here, the cloning of a promoter sequence for the vff1 gene encoding Forisomes in Vicia faba

is described, and its expression pattern using promoter-reporter fusion in transgenic plants

further analysed.


12

I.3 Aim of the thesis

The striking feature of Forisomes is the reversible and fast conformational change together

with their ATP-independency which make these structures interesting in the field of

nanotechnology biomaterials. Knoblauch et al. (2001) have reported that these conformational

changes are energized by modifications of the free Ca2+ concentration or pH variations.

Several other non-ATP based motors have been proposed, such as DNA-based nanoactuators

(Yurke, B. et al., 2000), flagella motors (Berg, H. C., 1974) and viral protein linear motors

(Dubey, A. et al., 2003). However, whereas all these have dimensions of the order of several

tens of nanometres, Forisomes are macroscopic assemblies whose size is in the order of

micrometers. Hence, although they could not be used to develop devices at the nanoscale,

they are easy to manipulate using current state-of-technology tools and their ‘technological

readiness’ is therefore higher than that of other non-ATP-based motors.

Taken together, these unique characteristics of Forisomes built up the framework of this

thesis. Hence, the objective of the present study was to clone the gene/s encoding Forisomes

in Vicia faba and to identify specific calcium-binding motives. Subsequent recombinant

expression of the isolated gene/s with their concomitant molecular and biochemical

characterization were employed to confirm gene-struture-funtion relationships. Finally, the

promoter sequences regulating the expression of Forisome proteins were identified and

studied in greater detail.

A schematic overview of this thesis is presented in Figure I-4.


13

Generation and characterization of Forisome-specific

polyclonal Abs

Isolation of Vicia faba Forisomes

Peptides sequencing

Amplification of vff1 full-length cDNA and genomic sequence

Cloning of vff1 full-length cDNA in

bacterial expression vectors

Expression and purification of VFF1-

GST proteins

Generation and characterization of VFF1-GST-specific

polyclonal Abs

Immunological evidence of vff1 gene encoding a Forisome

protein

Amplification of vff1 promoter sequence

Cloning of vff1 promoter into plant expression vectors

Generation of transgenic

plants expressing GUS under control of

vff1 promoter

Differential expression pattern driven by vff1

promoter

Figure I-4 Schematic outline of the thesis

Chapter II Material and Methods ___________________________________________________________________________

14

II Material and Methods

II.1 Material

II.1.1 Chemicals and consumables

The chemicals used throughout the work were purchased from the following companies:

Amersham Bioscience (Freiburg, D), Axis-Shield PoC (Oslo, Norway), Boehringer

Mannheim (Mannheim, D), Duchefa (Haarlem, NL), Fluka (Neu-Ulm, D), Gibco BRL

(Eggenstein, D), Invitrogen (Karlsruhe, D), Merck (Darmstadt, D), Molecular Probes (Leiden,

NL), New England Biolabs (Frankfurt, D), Roche (Mannheim, D), Roth (Karlsruhe, D), Serva

(Heidelberg, D), and Sigma-Aldrich (Taufkirchen, D).

The consumables were from: Amicon (Witten), BioRad (München, D), Biozym (Hess.

Oldendorf, D), Eppendorf (Hamburg, D), Genetix (New Milton, UK), Greiner (Solingen, D),

Kodak (Stuttgart), MilliPore (Schwalbach, D), Qiagen (Hilden, D), Schleicher&Schuell

(Dassel, D), Whatman (Bender & Hobein, Bruchsal, D) and Zeiss (Oberkochem).

II.1.2 Enzymes and reaction kits

Restriction enzymes either from New England Biolabs (Schwalbach) or GibcoBRL were used

for DNA digestion. ExpandTM high fidelity DNA Taq polymerase from Roche or Advantage®

2 Polymerase Mix from BD Biosciences Clontech were used for PCR amplification. TaqDNA

polymerase produced at the Fraunhofer IME (Aachen, D) was used for check-PCR

amplification.

The following kits were used:

Oligotex® mRNA isolation kit from Qiagen,

QIAprep® Spin Mini/Midiprep kit from Qiagen,

QIAquick® gel extraction kit from Qiagen,

QIAquick® PCR purification kit from Qiagen,

MinEluteTM PCR purification kit from Qiagen,

RNeasy mini kit from Qiagen,

SMART TM PCR cDNA Synthesis kit from BD Biosciences Clontech,

SMARTTM RACE cDNA Amplification Kit from BD Biosciences Clontech,

SUPERSCRIPTTM First-Strand Synthesis System for RT-PCR from Invitrogen,

Universal GenomeWalkerTM kit from BD Biosciences Clontech,

ECL Advance Western blotting detection kit from Amersham Biosciences,

Nucleon Phytopure Plant DNA extraction kit from Amersham Biosciences,

PCR-Select TM cDNA Subtraction kit from BD Biosciences Clontech.


15

II.1.3 Buffers, media and solutions

All standard solutions, buffers, and media were prepared according to Sambrook et al. (1989),

Ausubel et al. (1995) and Coligan et al. (1995). Compositions of otherwise special media and

solutions or buffers are listed at the end of the respective method section. Media for bacterial

and plant tissue cultures were sterilized by autoclaving (121oC/1-2 bar). Thermolabile

components were filter sterilised by passing through a 0.2 µm filter (Millipore) and added to

the autoclaved media or buffer after they were cooled down to 60-50°C.

II.1.4 Matrices and membranes

Glutathione sepharose 4B from AmershamPharmacia Biotech was used for purification of

GST fusion proteins (II.2.11).

HybondTM-C nitrocellulose membrane (0.45µm) from Amersham Life Science and Whatman

no.1 paper from Whatman (Maidstone, England) were used in immunoblot analysis

(II.2.12.4).

II.1.5 Primary antibodies, secondary antibodies and substrates

Mouse anti-GST monoclonal antibody provided by Dr. Michael Monecke (RWTH Aachen,

Institut für Biologie VII, Germany) was used for analyses of GST and GST fusion protein

expression. Alkaline phosphatase (AP) or horseradish peroxidase (HRP)-conjugated to goat

anti-mouse IgG (H+L, Fc), rabbit anti-chicken (Fc) and goat anti-rabbit (Fc) (Dianova)

antibodies were used as secondary antibody in immunoblot analysis (II.2.12.4) and ELISA

(II.2.14). NBT/BCIP (BioRad) and pNPP (BioRad) or ABTS-H2O2 [0.5 mg of 2,2’-azinobis

(3-ethylbenzthiazolinesulfonicacid) (ABTS)/ml, 0.002% H2O2, 0.1 M citrate-phosphate

buffer (pH 4.3)] were used as substrate for detection of immobilized proteins in immunoblot

(II.2.12.4) and ELISA (II.2.14), respectively.

Goat anti-mouse Alexa Fluor® 488 (Molecular Probes) was used as secondary antibody in

immunofluorescence studies.

II.1.6 Biological material

II.1.6.1 Bacterial strains

E. coli strains DH5α and XL1-Blue were used as a host cells for all intermediate cloning

constructs. The strain BL21(λDE3) was used for expression of VFF1-GST-fusion proteins

(II.2.11).


16

Agrobacterium tumefaciens GV 3101::pMP90RK (gentr, kanr), rifr (Koncz and Schell, 1986)

was used for Agrobacterium-mediated gene transfer into tobacco leaves (II.2.9) (Table II-1).

Table II-1 Name, suppliers and genotypes of bacterial strains used throughout this thesis

Strain Source Genotype

DH5α Ausubel et al., 1995 F- (f80d Lac 2∆M15) ∆(LacZYA-argF) U169end A1 rec1 hsdR17(rk

- mk+) deoR thi-1

supE44 gyrA96 relA1 λ-

BL21(λDE3) Novagen F- ompT hsdSB (rB – mB -) gal dcm (DE3)

XL1-Blue Stratagene recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB laclIq Z∆M15 Tn10 (Tetr)]

Agrobacterium Koncz and Schell, pMP90RK GmR, KmR, Rif R

tumefaciens 1986

GV 3101

II.1.6.2 Plants

Nicotiana tabacum L. cv. Petite Havana SR1 was used for transient protein expression after

vacuum infiltration of recombinant Agrobacteria (II.2.10.3) and for generation of stable

transformed plants (II.2.10.4).

II.1.6.3 Animals

6-8 weeks old female BALB/c mice as well as White Leghorn chicken about 12 weeks old

were used for immunization (II.2.13.1 and II.2.13.2) with isolated Forisomes from Vicia faba.

II.1.7 Vectors

II.1.7.1 Bacterial expression vector

pGEX-5X-3 from Amersham Pharmacia Biotech, modified at the multiple cloning site by

insertion of a NcoI site was used for subcloning the vff1 gene, together with partial fragments

(amino/carboxy terminus, center domains), and amplification of the resulting plasmids in E.

coli DH5α. After confirmation of the DNA sequences, pGEX-VFF1 along with the plasmids

harbouring the different protein domains were introduced into E. coli BL21 and expression of

the GST-fusion proteins was carried out.


17

II.1.7.2 Plant expression vectors

pUC103 - GUS (K. Fritze, MPIZ, Köln, Deutschland) containing the GUS-term construct

(III.2.4.1) was used for subcloning of the GUS-term reporter gene.

pTRA (Thomas Rademacher, Institut für Biologie VII, RWTH Aachen, Germany) is a

optimized plant expression vector containing the Cauliflower mosaic virus (CaMV) 35S

promoter with duplicated enhancer region (35SS) or the phloem-specific promoter of the

Coconut foliar decay virus (CFDV) and the pA35S untranslated region from Cauliflower

mosaic virus (CaMV). A matrix attachment region was introduced to improve transcription.

This binary vector was used for subcloning the vff1 promoter (III 2.4.1) as well as series of

thirteen truncated vff1 promoter fragments (III 2.4.3) in replacement of the 35SS promoter.

Schematic presentation of the vector maps are presented in the Appendix VII.2.

II.1.8 Oligonucleotides

Oligonucleotides used for sequence analysis and amplification of DNA are listed below

(Tables II-2, II-3, II-4) . All oligonucleotides were synthesized by Metabion International AG

(Martinsried, Germany).

Table II-2 Primers used for PCR amplification in deletion analysis of vff1 Promoter in Vicia faba

forward f-P-pTRAk-1 5′ -TTG GCG CGC CTT GAC TTG TAG ATA TGT TG - 3′

f-P-pTRAk-2 5′ -TGG GCG CGC CTC TAT AAA CGT TAA TGT TTG - 3′

f-P-pTRAk-3 5′ -TTG GCG CGC CTG AAA CAA CTC AAA CTT ATA - 3′

f-P-pTRAk-4 5′ -TTG GCG CGC CCA GTG GTG ACT CTT GCT ATC- 3′

f-P-pTRAk-5 5′ -TTG GCG CGC CCG GAT GAA AAT GGT ACT AAC- 3′

f-P-pTRAk-6 5′ -TTG GCG CGC CCT ACA TTC TCA ACG ATG CGA G - 3′

f-P-pTRAk-7 5′ -TTG GCG CGC CTT GTA TAC ATT CTC AAC GAT G - 3′

f-P-pTRAk-8 5′ -TTG GCG CGC CCA AAC ATT TTG TAT ACA TTC - 3′

f-P-pTRAk-9 5′ -TTG GCG CGC CAT ATA GTA CTA TCT AAA GG - 3′

f-P-pTRAk-10 5′ -TTG GCG CGC CTC CTC GAT GAC CCT TCA ATG- 3′

f-P-pTRAk-11 5′ -TTG GCG CGC CAT AAA ACA CTT TGC ACA CTT G - 3′

f-P-pTRAk-12 5′ -TTG GCG CGC CGT AAT AAC ATA TGA TAT TTA AA - 3′

f-P-pTRAk-13 5′ -TTG GCG CGC CAT TTC TCC TTC ATT TTT ATA TTT - 3′

reverse r-P- pTRAk 5′ -CAT GCC ATG GTG ACT CAA ATT TCA GAG AA - 3′


18

Table II-3 Primers used for cDNA amplification in RACE-PCR

5’-RACE-GSP1 5′ -CTC ACC TCC ATC ACA CGT CCA CAA GTA GGA TTT GG - 3′

5’-RACE-GSP2 5′ -ACT CTT CAA TGC TCT GAA CCG TTC CTT GCG GAT ATC GTC - 3′

5’-RACE-GSP3 5′ -CAC AAT GGG GAT CCA CAA AAT CTT GAA GTC TTC TTT CTT - 3′

5’-RACE-GSP4 5′ -TGG GCT TAT CGA AGA TCT TCC TGC GGT TAA ATA AAT CGT - 3′

5’-RACE-GSP5 5′ -GGA ATT TCC AAT TGG GTC TGT TGC TGT GAC CCT ATT AAG T - 3′

3’-RACE-GSP1 5′ -GGT GTA GAA AGG AAG AAA CAA AAC AAG AAG CAT CAA G - 3′

Table II-4 Primers used for PCR amplification and subclone Vicia faba forisome cDNA, N-terminal, C-terminal and central domains

Namec Sequencea Product size (kb) b

vff1 fw: 5’- CAT GCC ATG GGA ATG TCC TTT TCT AAC TCA -3’ 2.1

bw: 5’- TAA AGC GGC CGC AAC ACC AAA GTT ATT TGG -3’

N- vff1 fw: 5’- CAT GCC ATG GGA ATG TCC TTT TCT AAC TCA -3’ 1.2

bw: 5’- TAA AGC GGC CGC GTT CCT TGC GGA TAT CGT -3’

M- vff1 fw: 5’- CAT GCC ATG GGT TCC TTG AGA CAA CTG AAT -3’ 1.1

bw: 5’- TAA AGC GGC CGC ACG TTT CAG AGT CTC GTG -3’

C- vff1 fw: 5’- CAT GCC ATG GGA TTC AGA GCA TTG AAG AGT -3’ 0.9

bw: 5’- TAA AGC GGC CGC AAC ACC AAA GTT ATT TGG -3’

a letters in bold represent restriction endonuclease sites (NcoI and NotI) introduced into each primer to allow efficient cloning of the PCR product into the appropriate vector. b The product size is that resulting from PCR using the matching set of sense and antisense primers with the corresponding template. c Designation of the oligonucleotide as “fw” indicates the sense primer, whereas “bw” indicates the antisense primer. vff1, N-vff1, C- vff1 and M-vff1 stand for full-lengh forisome cDNA, NH3-terminal, COOH-terminal and central-domains respectively.

II.1.9 Equipment and applications

BioBench stainless steel reactor (Applikon Dependable Instruments, Schiedam, The

Netherlands).

Biomek 2000 with 384 High Density Replica Tool (HDRT) (Beckmann Coulter, Fullerton,

US).

Cameras and scanner: MP4 (Polaroid, Cambridge, MA, USA). E.A.S.Y 429K camera

(Herolab, Wiesloch), Arcus II Scanner with AGFA FotoLook 3.5 Software (AGFA, Köln),

Fujifilm LAS-1000 (Fujifilm, Tokyo, Japan).


19

Centrifuges: AvantiTM 30, AvantiTM 20 and AvantiTMJ-25 (Beckman, California, USA),

Biofuge A (Heraeus, Hanau), Sigma 3-10 and Sigma 4-10 (Sigma, St. Louis, Missouri, USA),

RC5C and RC5B plus (Sorval instruments, Du Pont, Bad Homburg). Rotors: F0650, F2402H,

JLA 8.1000, JLA 10.500 and JA 25.50 (Beckman), #1140 and #11222 (Sigma), RLA-300,

SS-34 and GS-3 (Du Pont).

Confocal Fluorescence Microscope: Leica TCS SP (Leica, Wetzlar, Germany).

DNA gel electrophoresis apparatus: wide mini and mini cells for DNA agarose

electrophoresis and power supplies (BioRad).

DNA sequencer: ABI Prism 3730 DNA Analyzer and BigDyeTM cycle sequencing

terminator chemistry apparatus (Applied Biosystems, Foster, CA, USA).

Electroporation apparatus: “Gene pulserTM”, “Pulse controller” unit, Extender unit

(BioRad) and 0.2 cm cuvettes (BioRad).

Fluorescent Image Analyzer: Phosphorimager FLA-3000 (Fujifilm, Tokyo, Japan).

InnovaTM 4340 incubator shaker (New Brunswick Scientific, Nürtingen).

Light Microscope: Leica DMLFS (Leica, Wetzlar, Germany) with a JVC camera TK-C1360

(Tokio, Japan).

PCR Thermocyclers: Primus and Primus 96 plus (MWG-Biotech).

Photometer: Eppendorf biophotometer with Printer DPU 414 (Eppendorf, Hamburg), and

multi-channel spectrophotometer Spectromax 340 (Molecular Devices, Sunnyvale,

California).

Probe sonicator: Bandelin Sonoplus sonicator UW2070 with Titan Microtip MS72

(Bandelin Electronic, Berlin).

Protein gel electrophoresis and electroblotting equipment: Mini-PROTEAN IIITM

electrophoresis system (Bio-Rad), Mini Trans-Blot Cell (Bio-Rad), Gel Air, Dryer (Bio-Rad).

QPix picking/gridding robot (Genetix, New Milton, UK)

Software: Windows NT 4.0 operating system (Microsoft); Microsoft Office 2000

(Microsoft); Adobe Photoshop 6.0 (Adobe); Chromas; Origin 6.0 (Data analysis and technical

graphics, Microcal Software, Inc.); Align IR, version 1.2 (LI-COR); GCG (Wisconsin

Package v10.2 TM, Genetic Computer Group Madison, Wisc.).

Speed-Vac centrifuge: Eppendorf Concentrator 5301 (Eppendorf)

UV-Transilluminators: wavelength 302 nm and UVT-20M (Herolab). UV-chamber (Bio-

Rad).

Vibrating-blade Microtome: Leica VT 1000S (Leica Microsystems Wetzlar GmbH,

Germany).


20

II.2 Methods

All experiments related to the genetic engineering were performed according to the

regulations of “S1-Richtlinien” and were officially approved by the Regierungspräsidium des

Landes NRW” (RP-Nr.: 23.203.2 AC 12, 21/95) and “BGA” [AZ 521-K-1-8/98:AI3-

04/1/0866/88 (S1) and 55.8867/-4/93 (greenhouse)].

General recombinant DNA techniques, i.e. PCI (phenol/chloroform/isoamyl alcohol) and CI

(chloroform/isoamyl alcohol) extraction, DNA precipitation, restriction enzyme digestion,

DNA ligation, DNA agarose gel electrophoresis, were performed according to the standard

protocols described in Sambrook et al. (1989) and Ausubel et al. (1995).

II.2.1 Plant material and isolation of Forisomes

Vicia faba L. cultivar Witkiem major (Nunhem Zaden, Haelen, The Netherlands) were grown

in a greenhouse at 20 °C and a 14/10 h light/dark period (daylight plus additional lamp light).

The first three internodes of up to 60 plants were excised 6 weeks after germination. The rind

was pulled off the central wood cylinder in two strips; the phloem tissue was then scratched

off these strips with scalpels and transferred to Ca2+-free medium (50 mM KCl, 10 mM, 10

mM of either HEPES or Tris/HCl, pH 7.3). The collected tissue was frozen in liquid nitrogen,

homogenized in a mortar, thawed in Ca2+-free medium, and passed through a 60-µm-mesh

filter. The filtrate was centrifuged at 2,500g and 20 °C for 30 min. The pellet was resuspended

in 11.25 ml Ca2+-free medium and 3.75 ml of an 80% Nycodenz® (Axis-Shield PoC, Oslo,

Norway) solution were added. Using another 15 ml of the Nycodenz® solution, a density

gradient (20 to 80% Nycodenz®) was produced with a custom-built gradient mixer. The

gradient was centrifuged at 150,000g and 20 °C for 3 h in an ultracentrifuge (OTD75B

Sorvall, Wilmington, Delaware, USA). Forisomes accumulated in a layer corresponding to

roughly 1.2 gml–1. This layer was extracted and washed by adding a threefold volume of Ca2+-

free medium. The sample was centrifuged at 2,500g and 20 °C for 30 min, and the pellet

containing the Forisomes was resuspended in a small volume of medium. With the aim of

avoiding the presence of membrane-bound proteins, which normally contaminate the isolation

of Forisomes, the sample was washed two times by adding a threefold volume of 1 mM Na2-

EDTA, 0,1% (v/v) Triton X-100 medium. The sample was centrifuged at 2,500g and 20 °C

for 10 min after each washing step and the pellet was resuspended in 500 µl of 1xPBS.

II.2.2 Peptides sequencing

A sample of the isolated Forisomes was separated by SDS-PAGE (sodium dodecyl sulfate-

polyacrylamide gel electrophoresis; II.2.12.2). Coomassie blue staining demonstrated two


21

predominant bands migrating at ~ 70kDa. These bands were excised from the gel, digested

with trypsin and analyzed by peptide mass fingerprinting following nanoLC-ESI-MS/MS and

MALDI-TOF-MS. Peptide sequencing was done by different companies (Proteome Factory

AG, Berlin; TopLab, Munich; Fraunhofer IME, Aachen) and the sequences obtained were

subject to comparison against a Medicago truncatula public EST data base (http://medicago.

toulouse.inra.fr/Mt/EST).

II.2.3 Isolation of genomic plant DNA

Genomic DNA was isolated from young Vicia faba leaves using the Nucleon Phytopure Plant

DNA extraction Kit (Amersham).

II.2.4 RNA isolation

Total RNA was isolated from a powdered pool of young leaves and stems using hot borate

method with modifications, as described by Moser et al. (2004). 1g of the plant tissue was

extracted in 3.5 ml of pre-warmed (80°C) RNA extraction buffer. The homogenate was mixed

thoroughly, incubated at 80°C for 5 min and then distributed in 2 ml microcentrifuge tubes

(1.4 ml of sample per tube). To inactivate contaminating ribonucleases, 1 mg of proteinase K

(2.2 mg of proteinase K for 1 g of tissue) was added following incubation at 42°C for 1 h.

After adding 2 M KCl to final concentration of 160 mM, the samples were kept on ice for 45

min. The samples were centrifuged at 13,000 rpm at 8°C for 15 min to enable pelleting of

insoluble particulates. The supernatant was then transferred to a new 2 ml microcentrifuged

tube, where 8 M LiCl to a final concentration of 2 M was added to allow RNA precipitation.

The samples were incubated on ice at 4°C overnight. The precipitated RNA was obtained by

centrifugation at 13,000 rpm at 8°C for 25 min. After discarding the supernatant, the RNA

pellet was washed with 1 ml of ice cold 2 M LiCl and then centrifuged at 13,000 rpm and 8°C

for 15 min. The RNA pellet was then resuspended with 600 µl of 10 mM Tris-HCl (pH 7.5)

and mixed thoroughly at room temperature. For removal of polysaccharides, 1/10 vol. of 2 M

potassium acetate (pH 5.5) was added to each sample following incubation for 10 min on ice.

The samples were centrifuged at 13,000 rpm and 8°C for 15 min. The supernatant was

transferred into new 1.5-ml microcentrifuge tubes, mixed with 0.9 vol of cold (4°C)

isopropanol and then stored at -20°C for 1 h to allow RNA precipitation. As a final step, the

RNA precipitate was centrifuged at 13,000 rpm and 8°C for 25 min. After washing the

obtained RNA pellet with 1 ml of cold (4°C) 80% (v/v) ethanol and centrifugation at 13,000

rpm and 8°C for 10 min, the samples were dried out in ice under sterile flow cabinet. The

RNA was resuspended in 30-50 µl of RNase-free water, pooled together in a new 1.5-ml

microcentrifuge tube and stored at -80°C. The mRNA was isolated using the Oligotex mRNA

isolation kit (Qiagen USA, Valencia, CA).


22

RNA extraction buffer: 0.2 M sodium tetraborate decahydrate, 0.03 M EDTA (pH 8.0), 1%

(w/v) SDS, 1% (w/v) deoxycholate acid sodium salt, 2% (v/v) β-

mercaptoethanol, 0.5% (w/v) spermidine, 2% (w/v) PVP (mol wt

40000), 1% (w/v) IGEPAL.

II.2.5 Libraries construction and screening strategies

II.2.5.1 cDNA expression library

A custom cDNA Expression Library of Vicia faba plant tips constructed in λTriplEX2TM

phagemid was purchased from Clontech (Cat. # CS1009u, BD Biosciences Clontech, Palo

Alto, USA). Total RNA was isolated from plant tips using the acid-guanidinium-phenol-

chloroform method (Sambrook et al., 1989) and 5µg of poly(A)+ RNA was purified using

Oligotex mRNA isolation kit (Qiagen USA, Valencia, CA). A library of 3.6x106 independent

clones was obtained with an average insert size of 1.5 kb and an insert size range between 0.5-

3.8 kb.

Library screening

The amplified cDNA expression library was subjected to immuno and PCR screenings as

described in the protocol suggested by the manufacturer (BD Biosciences Clontech, Palo

Alto, CA).

Polyclonal antiserum from chicken and mice was raised against isolated Forisomes (II.2.1).

Absorption of non-specific antibodies that react with E. coli proteins was carried out using a

lysate of E. coli XL-1Blue as described in the protocols provided with the picoBlue

immunoscreening kit (Stratagene). These pre-absorbed sera (dil. 1:30000) were used for

immunoscreening of the cDNA Expression Library using species-specific, horseradish

peroxidase-conjugated goat anti-mouse IgG (H+L, Fc) or rabbit anti-chicken (Fc) (Dianova)

antibodies as secondary antibody.

PCR screening of the amplified cDNA expression library was carried out using a mixture of

primers designed according to the Forisome sequenced peptides (II.2.2).

II.2.5.2 cDNA libraries

Construction of subtracted cDNA library

PCR-select cDNA subtraction was employed using PCR-SelectTM cDNA Subtraction Kit (BD

Biosciences Clontech, Palo Alto, CA) according to the manufacturer's protocol. The tester

(samples prepared from Vicia faba plant leaves) and driver (samples from the Vicia faba root

tips) cDNA were reverse transcribed from 2 µg mRNA of leaves and root tips, respectively,


23

digested with RsaI and then ligated to different adaptors. Two rounds of hybridization and

PCR amplification were performed to enrich the differentially expressed sequences.

Construction of not subtracted cDNA library

Total RNA was isolated from Vicia faba young root tips by the acid-guanidinium-phenol-

chloroform method (Sambrook et al., 1989) and used for cDNA library construction

following the SMART TM PCR cDNA Synthesis Kit protocol (BD Biosciences Clontech, Palo

Alto, CA).

The subtracted and non subtracted cDNAs were inserted directly into the TOPO TA Cloning

strategy (InvitrogenTM) followed by TOP10F´ transformation (InvitrogenTM), producing the

resultant cDNA libraries.

Both unamplified libraries were plated onto LB agar 230 mm x 230 mm Vented QTray with

cover plates (Cat. # X6023, Genetix, New Milton, UK) containing LB agar, 50 µg/ml

kanamycin, spreaded with 40 µl of 100 mM IPTG in addition to 40 µl of 40 mg/ml X-gal on

each LB plate) and grown at 37oC overnight. Using a QPix (Genetix, New Milton, UK)

picking/gridding robot a blue/white screening was carried out and the white colonies were

arrayed into 384-well microtiter plates (384 Well Low Profile Microplate, flat bottom with

cover, Cat.#X6001, Genetix, New Milton, UK) containing LB medium supplemented with

freezing mix [0.4 mM Mg SO4, 1.5 mM Na3-citrate, 6.8 mM (NH4)2SO4, 3.6% (v/v) glycerol,

13 mM KH2PO4, 27 mM K2HPO4, pH 7.0]. Bacteria were grown in microtitre plates wells at

37oC overnight and the clones were gridded onto 222 mm x 222 mm Nylon filters membranes

(Hybond-N+, Amersham) in duplicate pattern for DNA hybridizations.

cDNA libraries screening

Hybridization screening was carried out on subtracted and non-subtracted Vicia faba cDNA

libraries using mixtures of isotope labeled ([γ32P]ATP) oligonucleotides designed according to

Forisome sequenced peptides (II.2.2) as probes.

Approximately 30,000 clones from the subtracted cDNA library and 20,000 clones from the

not subtracted cDNA library were transferred using a Biomek 2000 with 384 High Density

Replica Tool (HDRT) (Beckmann Coulter, Fullerton, US) to Hybond-N+ (Amersham)

membranes placed over LB-Kan-X-Gal plates and incubated at 37°C overnight. After 30 min

of incubation positioned face up onto Whatman 3MM paper soaked with denaturation buffer

(0.5 M NaOH; 1.5 M NaCl), the membranes were washed with neutralization buffer (1.5

NaCl; 0.5 M Tris-HCl pH 7.2) for another 5 min. Following softly cleaning of the cells debris

with a paper, the membranes were washed with 2XSSC buffer and air dried on Whatman


24

3MM paper. The nylon filters were exposed at 50 mJoule under UV cross linker (GS Gene

Linker UV Chamber, Bio-Rad). Prehybridization was carried out with hybridization buffer

[5X SSC, 10X Denhardt solution, 1% (w/v) SDS and 10 µg/ml of denatured salmon sperm

DNA (Boehringer, Mannheim)] at 48°C for 1 h with gentle shaking in waterbath and the

membranes were hybridized overnight in the same conditions upon addition of the labeled

probes in 300 µl of hybridization buffer (90°C). After hybridization, membranes were washed

by gently shaking twice for 10 min in 2XSSC containing 0.1% (w/v) SDS at RT and another

two times at 48°C. Radioactivity on the membranes was detected by placing the membranes

on a support, sealing them with Saran wrap and then exposing to imaging plates for 12 h.

Hybridization signals were detected by a phosphorimager (FLA-3000, FUJI).

100X Denhardt solution: 2% (w/v) Ficoll, 2% (w/v) PVP and 2% (w/v) BSA

II.2.6 PCR technologies

II.2.6.1 Cloning of 5’ and 3’ ends of full-length cDNAs using RACE-PCR

3’- and 5’- RACE-Ready cDNA populations were synthesized from mRNA using BD

SMARTTM RACE cDNA amplification kit (BD Biosciences Clontech, Palo Alto, CA).

Primer design and PCR for detection of expression of hypothetical Forisome gene

Gene-specific primers 3’-RACE-GSP1 and 5’-RACE-GSP1 were designed based on an EST

fragment from Medicago truncatula containing the identified Forisome peptides. These

primers were used for the first round of 3’- and 5’- RACE-PCR, repectively. The criteria for

primer design was that they should be 23 to 28 nucleotides long (optimum 25 nucleotides)

having 50% to 70% GC content with melting temperature ~ 70°C, which enables touchdown

PCR. PCR conditions for detection of the gene expression from 3’- and 5’- RACE-Ready

cDNA populations were as follows: 5 cycles of 94°C for 30 sec, 72°C for 3 min, 5 cycles of

94°C for 30 sec, 70°C for 30 sec, and 72°C for 2 min, 20 cycles of 94°C for 30 sec, 67°C for

30 sec, 72°C for 2 min, followed by 72°C for 10 min. The performance of each PCR reaction

was checked by running 5 µl of each reaction on agarose gels (II.2.7.4), with appropriate

DNA markers.

5’-RACE. The 5’-most Forisome-related sequences were obtained by performing 5’RACE

(rapid amplification of cDNA ends) with a SMART RACE cDNA amplification kit (BD

Biosciences). First-strand cDNA was synthesized from poly(A)+ RNA at 42°C for 1 h with

PowerScript reverse transcriptase by using 5’- RACE CDS primer [T25VN, where N is A, C,

G or T and V is A, G or C]. The SMART II A oligonucleotide (5’-AAGCAGTGGTATCAAC


25

GCAGAGTACGCGGG-3’) was included. This oligonucleotide anneals to the C-rich cDNA

3’ tail and serves as a primer for second strand DNA synthesis. After the first PCR

amplification with 5’-RACE-GSP1 primer, different gene-specific backward primers (5’-

RACE-GSP), derived from the hypothetical Forisome sequence obtained, were used to

perform four additional rounds of 5’-RACE-PCR, along with a universal primer (5’-

CTAATA CGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAG T-3’) that can

anneal to the SMART II A oligonucleotide sequence.

3’ RACE. The 3’-most Forisome-related sequences were obtained by performing 3’-RACE

with a SMART RACE cDNA amplification kit. First-strand cDNA was synthesized from

poly(A)+ RNA at 42°C for 1 h with reverse transcriptase by using the oligo(dT)-based 3’-

RACE CDS primer A [AAGCAGTGGTATCAACGCAGAGTAC(T)30VN, where N is A, C,

G, or T and V is A, C, or G]. Different gene-specific forward primers (3’RACE-GSP) were

derived from the hypothetical Forisome sequence obtained in the first round of amplification.

These specific primers were used in the subsequent PCRs along with the universal primer that

can anneal to primer A.

After examination by gel electrophoresis (II.2.7.4), RACE reaction products were cloned into

pCR® 2.1-TOPO® (Invitrogen) (please refer to the appendices VII.2). White colonies were

selected and the verification of inserts was done by colony PCR. PCR conditions were as

follows: 94°C for 4 min, 25 cycles of 94°C for 30 sec, 53°C for 30 sec, 72°C for 1 min, and

72°C for 10 min. Four to five independent clones for each of the 5’- and 3’-RACE products

were sequenced from both ends using generic sequencing primers. The assembled cDNA

sequences were aligned with the Forisome genomic sequence using the Wisconsin Package

v10.2, Genetics Computer Group (GCG), Madison, Wisc.

II.2.6.2 PCR amplification of cDNA

Polymerase chain reaction (PCR) was used for amplification of Forisome gene from a Vicia

faba RACE-Ready cDNA population (II.2.6.1). Double-stranded cDNA was amplified, based

on the protocol of Sambrook et al. (1989), using high fidelity DNA-polymerase and DNA

polymerase buffer from Roche. Two specific primers, 5’-CATGCCATGGGAATGTCCTTTT

CTAACTCA-3’ and 5’-TAAAGCGGCCGCAACACCAAAGTTATTTGG-3’ corresponding

to amino-terminal and carboxyl-terminal regions respectively (III.3.1), were used in the

amplification to introduce the NcoI and NotI restriction sites. The reactions were performed in

0.2 ml PCR reaction tubes (Biozym Diagnostik GmbH, Hessisch Oldendorf), using a DNA

thermal Cycler (MWG). PCR reactions were carried out in a total volume of 50 µl under the

following conditions: 95°C for 2min, 35 cycles of 95°C for 1 min, 53°C for 1 min, 72°C for 2


26

min 50 sec, and 72°C for 5 min. The performance of each PCR reaction was checked by

running 5 µl of each reaction on agarose gels (II.2.7.4), with appropriate DNA markers.

II.2.6.3 Identification of introns and genomic DNA cloning by LD PCR

Intron sequences were identified by LD PCR with the Expand Long Template PCR System

(Roche) using 100 ng of genomic DNA as a template; thermocycling was performed at 95°C

for 2 min, 95°C for 10 sec, 53°C for 30 sec and 68°C for 5 min, for 10 cycles; 95°C for 15

sec, 53°C for 30 sec and 68°C for 5 min, for 25 cycles followed by 68°C for 7 min. The

performance of each PCR reaction was checked by running 5 µl of each reaction on agarose

gels (II.2.7.4), with appropriate DNA markers. The amplified fragments were cloned into

pCR® 2.1-TOPO® (Invitrogen) (please refer to the appendices VII.2) and sequenced. Intron

delimitation within genomic sequences was done by comparing with the putative Forisome

cDNA sequence using the Wisconsin Package v10.2, Genetics Computer Group (GCG),

Madison, Wisc.

II.2.6.4 Genome Walking

Genomic DNA was extracted from Vicia faba young leaves as described before and was used

for genome walking experiments. Genome-walking PCR was performed using a Genome

Walker kit (BD Biosciences Clontech Laboratories, Palo Alto, CA) according to the

manufacturer’s manual. Briefly, Vicia faba genomic DNA was digested by DraI, HpaI and

SspI restriction enzymes. Adaptor DNA provided in the kit was ligated to the blunt-end DraI-,

HpaI- and SspI-digested genomic DNA fragments generating three Genome Walking

Libraries. The first PCR was conducted using an adaptor primer (5’-GTAATACGACTCACT

ATAGGGC-3’) provided by the kit and a GSP1 (5’-CACAATGGGGATCCACAAAATCTT

GAA-3’) that was complementary to the 5’ region of Forisome cDNA. Second-round PCR

was done using the nested adaptor primer (5’-ACTATAGGGCACGCGTGGT-3’) and GSP2

(5’-TCTGAACCGTTCCTTGCGGATATCGTC-3’) complementary to the upstream

sequence of Forisome. The conditions used for the first and second PCR were 7 cycles at

94°C for 25 sec and at 72°C for 3 min, 32 cycles at 94°C for 25 sec and at 67°C for 3 min

followed by one cycle at 67°C for 7 min, five cycles at 94°C for 25 sec and at 72°C for 3

min, and 20 cycles at 94°C for 25 sec and at 67°C for 3 min followed by one cycle at 67°C for

7 min, respectively. The DNA amplified by PCR was cloned into pCR® 2.1-TOPO®

(Invitrogen) and was sequenced.

The performance of each PCR reaction was checked by running 5 µl of each reaction on

agarose gels (II.2.7.4), with appropriate DNA markers.


27

II.2.7 Recombinant DNA technologies

All procedures for nucleic acid manipulation were done according to standard methods

(Sambrook et al., 1989) unless otherwise described.

II.2.7.1 Isolation of plasmid DNA from E.coli

Recombinant plasmid DNA was purified using QIAgen plasmid DNA Mini-and Midi- prep

kits according to the manufacturer’s instructions based on the alkaline lysis method

(Sambrook et al., 1989). Quality and yield of plasmid DNA was examined by

spectrophotometric analysis (II.2.7.2) and agarose gel electrophoresis (II.2.7.4). Isolated

plasmid DNA was stored at -20°C.

II.2.7.2 Quantification of DNA

The DNA concentration was evaluated by optical density (1 OD260nm unit = 50 µg/ml of

double stranded DNA) according to Sambrook and Russell (2000). The DNA purity was

determined by the OD260nm/OD280nm ratio of the measured optical density, which is 1.8 for

pure DNA.

II.2.7.3 PCR amplification

For rapid identification of recombinant E. coli and Agrobacteria control PCR was carried out

to detect plasmids as described by Jesnowski et al. (1995).

The optimal annealing temperature (Tp) of the primers was experimentally optimised or

calculated based on the empiric formula (Wu et al., 1991):

Tp = 22 + 1,46 [2X (G + C) + (A + T)]

PCR reactions were carried out in a total volume of 50 µl as described in table II-5.

Amplification was carried out under the following conditions: initial denaturation at 95°C for

2 min, 35 cycles of denaturation at 95°C for 1 min, primer annealing at 55°C for 1 min,

primer extension at 72°C for 1 min, and final extension at 72°C for 5 min. The annealing

temperature and the time for denaturation were changed according to Tp value of primers and

the length of the target gene. The performance of each PCR reaction was checked by running

5 µl of each reaction on agarose gels (II.2.7.4) with appropriate DNA markers.


28

Table II-5 PCR reactions

Components Volume Final concentration 10X PCR buffer 5 µl 1X

50 mM MgCl2 1.5 µl 1.5 mM

10 mM dNTPs 1 µl 0.2 mM each

10 pmol forward Primer 0.5-1 µl 10 pmol

10 pmol backward primer 0.5-1 µl 10 pmol

Template DNA 0.5-5 µl 10-100 ng

Taq DNA polymerase (5U/µl) 0.25 µl 1.25 units

dd H2O to 50 µl

II.2.7.4 Agarose gel electrophoresis of DNA

Plasmid DNA, and PCR-fragments were separated in 0.8-1.2% (w/v) agarose gels prepared in

TBE buffer containing 0.1 µg/ml of ethidium bromide. Agarose gels and electrophoresis of

the samples were carried out as described by Sambrook et al., (1989). Known amounts of

DNA molecular markers such as 1 Kb ladder (New England Biolabs), 100 bp ladder (New

England Biolabs) were used for evaluation and determination of DNA concentration and size.

The DNA samples were loaded onto the agarose gels after the addition of DNA loading

buffer. The visualization of the DNA bands and documentation of the gels was performed

using a UV transilluminator at 302 nm and a black and white E.A.S.Y 429K camera (Herolab)

together with a photo printer (Mitsubishi).

TBE buffer (pH 8): 90mM Tris base, 90mM boric acid, 0.2 M EDTA

DNA loading buffer: 1x TBE, 5% (w/v) sucrose, 0.04% (w/v) bromophenol blue, 2% (w/v)

SDS

II.2.7.5 Preparative agarose gel electrophoresis

Preparative gel electrophoresis was used for large scale purification of a particular DNA

fragment from a mixture of DNA fragments after restriction enzyme digestion. The DNA

fragment of interest was excised from the gel on an UV transilluminator with a sterile scalpel.

The DNA extraction was performed with QIAquick gel extraction kit according to the

manufacturer’s instructions. The concentration of recovered DNA was measured by

spectrophotometer or determined by agarose gel electrophoresis and was used in further

experiments.


29

II.2.7.6 DNA sequence Analysis

The cloned fragments were sequenced by the dideoxy-chain termination method (Sanger et

al., 1977) using the Bigdye Terminator Cycle Sequencing kit v3.1 (ABI Prism 3730 DNA

Analyzer Applied Biosystems) according to the manufacturer’s instructions; sequence data

were analyzed using the Wisconsin Package v10.2, Genetics Computer Group (GCG),

Madison, Wisc.

II.2.8 Preparation and transformation of E. coli

II.2.8.1 Preparation of electro-competent E. coli

E. coli strains DH5α and BL21(DE3) were used to prepare electro-competent cells as

described by Dower et al. (1988). 5 ml LB-broth were inoculated with a single bacterial

colony isolated from an LB plate and incubated at 37°C o/n. Three ml of fresh o/n culture was

transferred into 500 ml of LB broth. The mid-log phase (OD600nm = 0.5-0.8) was reached after

incubating at 37°C with shaking (180 rpm) for 3-4 hours. Then the cells were placed on ice

for 15-20 min. and harvested by centrifugation (3000g/4°C/10 min). A three times washing

step with sterile water followed and the cells were resuspended in ice-cold 10% (v/v) glycerol

to a 300-fold concentration from the original culture volume (at >1010 cells/ml). 40 µl aliquots

were stored at -80°C.

II.2.8.2 Transformation of E. coli by electroporation

50-200 ng of DNA were used for the transformation of freshly thawed electro-competent cells

(II.2.8.1). The mixture was transferred to the bottom of a prechilled (0.2 cm) cuvette. The

electroporation was performed using a BioRad Gene Pulser II® under the following

conditions: capacitance 25 µF, the pulse controller set to 200 Ω and the potential difference

set to 2.50 kV. After application of the pulse, 0.8-1 ml of SOC medium was added and the

cells were incubated at 37°C with shaking for 1 h to allow expression of the antibiotic

resistance genes. Finally, 50-100 µl of each transformation were plated onto prewarmed

selective LB-agar plates and incubated at 37°C o/n.

II.2.8.3 Culturing of E. coli and glycerol stock preparation

Selected positive colonies of all strains were streak on a separate LB agar plate to obtain

individual bacterial colonies. After o/n incubation at 37oC the plates were stored at 4oC for

short periods (less than 2 weeks). LB medium containing the suitable antibiotics and 2%

(w/v) glucose was inoculated with a single recombinant colony of E. coli and grown o/n at


30

37°C with vigorous shaking. Bacteria glycerol stocks were prepared by mixing 600 µl of a

fresh overnight culture with 600 µl of 40% (v/v) sterile glycerol and stored at -80°C.

II.2.9 Preparation and transformation of Agrobacterium tumefaciens

II.2.9.1 Preparation of electro-competent Agrobacterium cells

Agrobacterium tumefaciens strain GV3101 was streaked on YEB-agar plate containing 100

µg/ml Rifampicin (Rif) and 25 µg/ml Kanamycin (Km) (YEB-Rif-Km) and grown at 28°C

during 2-3 days). 5 ml of YEB-Rif-Km medium, placed in a 100 ml Erlenmeyer flask, were

inoculated with an isolated colony and incubated at 28°C for two days with continuous

shaking (250 rpm). 1 ml of the culture was transferred into 100 ml of YEB-Rif-Km medium

and grown at 28°C for 15-20 h with shaking (250 rpm) until the OD600nm reached 1-1.5. The

cells were chilled on ice for 15 min and collected by centrifugation at 4000g for 5 min at 4°C.

The bacterial pellet was washed three times with 10 ml of dH2O and resuspended in 500 µl of

sterile 10% (v/v) glycerol. 45 µl-aliquots of the cell suspension were transferred into

prechilled sterile microcentrifugation tubes, frozen immediately in liquid nitrogen and stored

at -80°C.

YEB medium (pH 7.4): 0.5% (w/v) nutrient broth; 0.1% (w/v) yeast extract; 0.5% (w/v)

Bacto-Trypton; 0.5% (w/v) sucrose; sterile 2 mM MgCl2 after

autoclaving.

YEB selection medium: YEB medium supplemented after autoclaving with 50 µg/L

Rifampicin (rif), 50 µg/L Carbenicillin (carb) and 25 µg/L

Kanamycin (kan).

II.2.9.2 Transformation of Agrobacterium by electroporation

An aliquot of electrocompetent Agrobacterium cells (II.2.9.1) was thawed on ice and mixed

with 0.2-1.0 µg of plasmid DNA (II.2.7.1). After incubation on ice for 3 min, the bacteria

cell/DNA mixture was transferred into a prechilled electroporation cuvette (0.2 cm) and

assembled into a safety chamber. An electric pulse (25 µF, 2.5 kV, 200Ω) was applied and the

cells were resuspended in 0.8-1 ml of SOC medium. Following this, the cells were incubated

at 28°C with shaking (250 rpm) for 1 h. Finally, 1-10 µl of the cells were plated on YEB-agar

selection media plates (100 µg/ml Rifampicin, 25 µg/ml Kanamycin and 100 µg/ml

Carbenicillin) and incubated at 28°C for 2-3 days. As a negative control, transformation of

Agrobacterium cells was carried out by replacing the DNA with sterile water.


31

II.2.9.3 Determination of the efficiency of recombinant bacteria transformation

Known concentrations of supercoiled plasmid pUC19 for E. coli and pSSH1 for A. tumefaciens

cells were used to transform each new batch of prepared competent cells with the aim of

testing the efficiency of transformation. The following transformation rates were obtained;

electro-competent E. coli >108/µg pUC19 and A. tumefaciens >103/µg pSSH1.

II.2.9.4 Growth of recombinant A. tumefaciens and preparation of glycerol stocks

To determine the presence of plasmid, single colonies of A. tumefaciens were examined by

control PCR (II.2.7.3) and the selected positive colonies were inoculated into 10 ml of YEB

selection medium (II.2.9.1). The cells were grown at 28°C for 2-3 days with vigorous shaking

at 250 rpm. After transferring the cell culture to Falcon tubes, the Agrobacteria cells were

spun down by centrifugation at 4000g for 10 min at 15°C. The cell pellet was resuspended in

a 1:1 volume of YEB selection medium and glycerol stock media (GSM). 100 µl-aliquots

were stored at –80°C for further experiments.

glycerol stock medium (GSM): 50% (v/v) glycerol, 100 mM MgSO4, 25 mM Tris pH7.4;

filter sterilised.

II.2.10 Generation and characterisation of transgenic plants

II.2.10.1 Transient transformation of tobacco leaves

Growth of recombinant Agrobacterium (II.2.9.2) and vacuum infiltration of tobacco leaves

was performed as described by Kapila et al. (1997).

II.2.10.2 Preparation of recombinant Agrobacteria

100 ml of YEB selection medium was inoculated with 100 µl of glycerol stock (II.2.9.4) of

the selected recombinant Agrobacteria carrying a plant expression vector. After an overnight

growth at 28°C under vigorous shaking, the culture was centrifuged during 10 min at 5000g

and 15°C. The cells were then resuspended in 250 ml of induction media and incubated at

28°C o/n. The next day the culture was centrifuged (4000g and 15°C for 15 min) and the

bacterial pellet was resuspended in 50 ml of MMA containing 200 µM acetosyringone and

left for induction for 2 h at room temperature. After a 1:10 dilution in MMA medium, the

OD600nm of the bacterial suspension was measure and adjusted to an OD600nm of 1. The diluted

bacterial suspension was used for vacuum infiltration of tobacco leaves (II.2.10.3).


32

Induction medium (pH 5.6): YEB medium; 10 mM MES. Sterile 2 mM MgSO4, 20 µM

acetosyringone, 100 µg/ml Rifampicin, 100 µg/ml

Carbenicillin, 25 µg/ml Kanamycin were added after

autoclaving.

MMA medium (pH 5.6): 0.43% (w/v) MS-salts (Murashige & Skoog, basic salt

mixture); 10 mM MES; 2% (w/v) sucrose. Sterile 200 mM

acetosyringone was added after autoclaving and directly

before use.

II.2.10.3 Vacuum infiltration of tobacco leaves

For each construct (P-pTRAk-1 to P-pTRAk-13; III.2.4.3) 4 young leaves of N. tabacum cv.

Petite Havana SR1 were immersed in 100 ml of A. tumefaciens suspension. Continuous

vacuum was applied decreasing the pressure to approximately 60 mbar for 15-20 min. The

pressure was then released slowly and the leaves were briefly rinsed in tap water. To incubate

the infiltrated leaves, a plastic tray with moistened Whatman paper no. 1 was used where the

leaves were placed with adaxial side upwards. The plastic tray was sealed with saran wrap to

maintain humidity and placed at 25°C with a 16 h photoperiod for 2-3 days. As control, leaves

were infiltrated with Agrobacteria suspension, which did not contain pTRAk vff1P-GUS

plasmid.

II.2.10.4 Stable transformation of tobacco plants

Recombinant A. tumefaciens transformed with pTRAk-vff1P-GUS plasmid carrying the

putative Forisome promoter was used for the generation of transgenic tobacco plants by leaf

disc transformation. Transgenic T0 plants were regenerated from transformed callus (Fraley et

al., 1983; Horsch et al., 1985). Young leaves from 4-5 week old wild type N. tabacum cv.

Petite Havana SR1 grown on MS medium (Murashige and Skoog, 1962) were cut into 1 cm2

squares and transferred into 50-100 ml Agrobacteria suspension (II.2.10.2). After incubation

at RT for 30 min the leaf pieces were transferred onto sterile wet Whatman 3MM paper in

petri dishes. The petri dishes were then closed with saran wrap and incubated at 26-28°C in

the dark for two days. As following step, the leaf squares were washed with distilled water

containing 100 µg/ml Kanamycin, 200 µg/ml Claforan and 200 µg/ml Betabactyl

(Ticarcillin/Clavulanic acid, 25:1) and transferred onto MS II-plates. The plates were placed

at 25°C in the dark for one week followed by incubation for 2-3 weeks with a 16 h

photoperiod. The newly formed shoots were cut and transferred onto MS III-plates and

cultured for another 10-14 days under the same conditions until roots began to grow. The

small plantlets were transferred into larger sterile pot containing MS III medium and


33

incubated at 25°C during 2 weeks (16h photoperiod) before transfer into soil. Young leaves

from regenerated transgenic plants were used for the measurement of GUS activity.

Integration of the chimeric genes into the N. tabacum genome was examined by PCR. In all

tested transgenic plants, the PCR product had the expected size, indicating that the promoter

fragment and the GUS gene were linked in the genomic DNA and that each transgenic plant

contains at least one copy of the respective chimerical gene.

MS medium (pH 5.8): 0.43% (w/v) MS salts (Duchefa, No. M0221); 0.01% (w/v)

Myo-inositol (Serva); 2% (w/v) sucrose; thiamine-HCl 0.4

mg/L; 0.8 % (w/v) agar; 500 µl/L vitamine I.

MS II medium (pH 5.8): MS medium supplemented after autoclaving with sterile

1mg/L BAP (in DMSO, from Sigma); 0.1 mg/L NAA

(Sigma); 100 mg/L Kanamycin; 200 mg/L Claforan; 0.8 %

(w/v) agar; 200 mg/L Betabactyl.

MS III medium (pH 5.8): MS medium supplemented after autoclaving with 100 mg/L

Kanamycin; 200-250 mg/L Claforan; 200-250 mg/L

Betabactyl, 0.8 % (w/v) agar.

Vitamine I solution: 0.4% (w/v) glycin; 0.1% (w/v) nicotinic acid; 0.1% (w/v)

pyridoxine. The vitamine I solution was filter sterilised

through a 0.2 µm filter (Millipore) and stored at 4°C.

II.2.10.5 Growth of N. tabacum cv. Petite Havana SR1

Tobacco plants were grown in ED73 standard soil (Patzer, Sinntal-Jossa) with 0-30% (v/v)

sand under the following conditions: 16 h artificial light, 20-27°C, 10K Lux and 30-65%

humidity. To prevent pollination from other plants, flowers were covered with plastic bags

with micro pores. Mature, dried seeds were stored in paper bags at RT.

II.2.10.6 Measurement of GUS activity and histochemical analysis

Tobacco plants and young T1 seedlings grown from tissue culture were used for the

measurements of GUS activity. For the histochemical analysis, tobacco plants were

transferred to soil and grown in a greenhouse. GUS activities were measured in situ on

greenhouse plants, 40 to 50 cm tall and before flower initiation. Sections of leaves and thin

cross-sections of tobacco leaves, stem, roots and flower were cut by hand with a scalpel blade,

and placed in a small amount of staining buffer in Eppendorf tubes. GUS activity was

histochemically detected according to the method described by Jefferson (1987), but with


34

0.5mM of potassium ferri- and ferrocyanide added to limit diffusion of GUS reaction products

(Caissard et al., 1994). Hand-cut fresh tissue sections were subjected to an overnight

incubation at 37°C in staining solution consisted of 1 mM X-gluc (100µl of X-Glucuronide

stock solution diluted in 8 ml of staining buffer). For analysis of young T1 seedlings, whole

plantlets were collected about 1 week after germination and immersed in the buffer containing

X-gluc followed. Slight vacuum was applied before incubation to facilitate substrate

infiltration. After staining, chlorophyll was extracted from photosynthetic tissues with 100%

(v/v) methanol at 65°C for 1 h followed by 70% (v/v) ethanol. Ethanol was changed 2-3 times

over a 24 h period and the tissue samples were incubated at room temperature until they were

bleached and the blue GUS stain were clearly visible. The GUS expression was detected

microscopically by the distinct blue color which results from the enzymatic cleavage of X-

GlcA. Samples were stored at 4°C [in 70% (v/v) ethanol].

X-Glucuronide stock solution: 80 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide

cyclohexylammonium salt (X-GlcA; Sigma-Aldrich,

Munich, Germany) disolved in dimethylformamide. The

stock solution was kept at -20 oC wrapped in plastic foil.

Staining buffer (pH 7.0): 100 mM NaH2PO4; 10 mM NaEDTA; 0.5mM potassium

ferricyanide and 0.5 mM potassium ferrocyanide; 0.1%

(v/v) Triton X-100.

II.2.11 Expression and purification of recombinant proteins

II.2.11.1 Expression and purification of Forisome-GST fusion proteins from E. coli

The expression and purification of GST-fusion proteins were carried out according to a

modified protocol based on Smith (1993).

An isolated colony of E. coli strain BL21(λDE3) (Novagen) transformed with the

recombinant vector pGEX-VFF1 (II.1.7.1) was used for the inoculation of 50 ml 2YT

medium supplied with 1% (w/v) glucose and 100 µg/ml ampicillin. The culture was grown

o/n at 37 oC under vigorous shaking. The recombinant bacteria o/n grown culture was diluted

1:100 into 500 ml of fresh pre-warmed 2YT/amp medium containing 0.1 %(w/v) glucose.

After incubation at 28oC for 6-7 hs until an OD600nm of 0.8-1, the temperature was gradually

reduced to 16oC and the expression of the GST-fusion protein was induced by adding IPTG to

a final concentration of 0.1 mM. The induction of the protein expression was taken place o/n

at 4oC. The following day the cells were harvested by centrifugation at 7700g and 4oC for 10

min. The supernatant was discarded, the bacterial pellet was drained and placed on ice until

resuspension with 25 ml of ice cold 1 X PBS buffer. The resuspended cells were transferred


35

into a 50-100 ml plastic beaker and disrupted by sonication on ice 2-3 times for 30 sec (150W

with 30 sec intervals). Triton X-100 20% (v/v) was added to a final concentration of 1% (v/v)

and stirred gently for 30 min to aid in solubilization of the fusion protein. The bacterial lysate

was cleared of cellular debris by centrifugation at 12000g for 10 min at 4oC. The supernatant

was subjected to glutathione affinity chromatography according to the manufacturer’s

instructions (AmershamPharmacia Biotech).

II.2.11.2 Fermentation at 4-liter scale

A fed-batch aerated fermentation of an isolated colony of E. coli strain BL21(λDE3)

(Novagen) transformed with the recombinant vector pGEX-VFF1 (II.1.7.1) was conducted

with a 7-liter BioBench stainless steel reactor (Applikon Dependable Instruments, Schiedam,

The Netherlands). A starter culture was grown in 400 ml of LB medium supplemented with

100 µg/ml ampicillin. After reaching late exponential phase at 37°C and being shaken at 100

rpm, the culture was used for inoculation into the 7-liter vessel containing 3.6 liters of a

starting growing medium. The culture was grown overnight at 37°C and agitated at 500-750

rpm. Once the glucose was exhausted from the starting medium after 13 h (as indicated by a

sudden decrease in the oxygen requirement of the culture), the bacterial culture was

supplemented with 3% (2,12ml/L.h) of feeding medium containing glucose and

MgSO4.7H2O. Upon reaching the active growing phase (OD600nm of 41.85), the temperature

was reduced to 16°C within 2 h (-5°C each 30 min) and the expression of the GST-fusion

protein was induced by adding IPTG to a final concentration of 0.1 mM. Thirty min later a

peristaltic pump started to deliver 2% (1.41 ml/L.h) of the feed medium to avoid the depletion

of glucose. Growth was conducted at 37°C and induction at 16°C with pH maintained at 6.8

throughout the experiment with concentrated NH4OH (25%). Aeration was maintained at 0.5

vvm (vol.broth/vol medium.min) and agitation was controlled at 500 to 750 rpm to maintain

the level of dissolved oxygen above 30% air saturation. After 15 h of expression the cells

were harvested by centrifugation at 10000g and 4°C for 30 min. 289.5g of pellet was

obtained, resuspended in 200 ml of 1XPBS buffer and subject to cell disruption using a

Microfluidizer® processor M-110L (Microfluidics, Newton, MA). Triton X-100 20% (v/v)

was added to a final concentration of 1% (v/v) and stirred gently for 30 min. The GST-fusion

protein was recovered by centrifugation at 12000g for 20 min at 4oC. The supernatant was

subjected to glutathione affinity chromatography according to the manufacturer’s instructions

(Amersham Pharmacia Biotech) and the purified protein was analysed by SDS-PAGE.

Starting growing medium: 122 mM KH2PO4; 35 mM NH4(H2PO4); 0.48 mM

CaCl2.2H2O; 0.5 mM FeSO4.7H2O; 139 mM Glucose; 6.1

mM MgSO4.7H2O; 10.9 mM Citric acid; 0.95mM L-


36

arginine.HCl; 0,1% (v/v) Ptm1 trace metals; 0,2 g/l

Methionine and 100 mg/l ampicilin.

The salt solution [KH2PO4, NH4(H2PO4), CaCl.2H2O, FeSO4.7H2O] in the fermentation

apparatus was autoclaved, whereas the additional feed components (glucose, MgSO4.7H2O,

Citric acid, L-arginin.HCl, trace metals, and Methionine) were filter sterilized and added

aseptically prior to inoculation along with 100 µg/ml ampicillin.

Feeding medium: 2.78 M glucose and 60 mM MgSO4.7H2O. The

feeding medium was filter sterilized.

Pichia trace metals solution, PTM1: 24 mM CuSO4.5H2O, 0.53 mM NaI, 19.87 mM

MnSO4. H2O, 0.83 mM Na2MoO4.2H2O, 2.10 mM

CoCl2, 0.15 mM ZnCl2, 0.32 mM H3BO3, 0.23 M

FeSO4.7H2O, 0.82 mM Biotin, 0.5% (v/v) H2SO4.

II.2.12 Protein analysis

II.2.12.1 Quantification of proteins

The estimation of the concentration of isolated Forisomes was determined by SDS-PAA gel

electrophoresis and Coomassie staining comparing with known concentrations of loaded

bovine serum albumin (BSA) as standard.

II.2.12.2 SDS-PAGE and Coomassie brillant blue staining

Protein samples were separated by polyacrylamide gel electrophoresis (SDS-PAGE, stacking

gel: T = 4%, C = 2.6%, pH 6.8; separating gel: T = 12%, C = 2.6%, pH 8.8) (Ausubel et al.,

1995) under 20V/cm for 1 hour. Before loading onto the gel, protein samples were

denaturated in the presence of SDS and β-mercaptoethanol for 5 min at 100°C. A pre-stained

broad range protein marker (P7708S, New England BioLabs Inc.) was used. Protein bands

were revealed by staining with Coomassie brilliant blue or transfer to nitrocellulose

membrane for further analysis (Ausubel et al., 1995). The detection of the bands was

performed by staining the polyacrylamide gel for 30 min and RT with Coomassie staining

solution followed by incubation with destaining solution until the protein bands were clearly

visible.


37

Protein loading buffer, 6x: 8% (w/v) SDS, 40% (v/v) glycerol, 200 mM Tris-

HCl (pH6.8), 5% (v/v) β-mercaptoethanol, 0.05%

(w/v) bromophenol blue.

Electrophoresis running buffer(pH 8.3): 25 mM Tris; 192 mM glycin; 0.5% (w/v) SDS.

Coomassie staining solution: 50% (v/v) methanol; 10% (v/v) glacial acetic acid;

0.05% (w/v) Coomassie Brilliant Blue R-250.

Coomassie destaining solution: 5% (v/v) methanol; 7.5% (v/v) glacial acetic acid.

II.2.12.3 2D-PAGE analysis

Isolated Forisomes were quantified and then precipitated by adding 2 volumes of 50 % (w/v)

TCA in acetone, followed by incubation on ice for 1 h. Samples were centrifuged for 45 min

at 15300 rpm and 4°C, pellets were resuspended in 500 µL chilled (-20°C) acetone and

incubated at -20°C for 1 h. Samples were spun again at 15300 rpm and 4°C and resuspended

in the same volume of acetone. All acetone was removed and the pellets left to dry at 30°C.

The pellets were then redissolved in 125 µl of Lysis buffer and loaded onto a 7 cm

immobilized pH 3–10 linear gradient strip (BioRad). Actively rehydratation was carried out

for 16 hours in the IEF-cell (BioRad) at 25Vh. Then, the sample was pipetted into the cleft;

the IEF-strips were applied bubble free and covered with mineral oil. Next morning the

isoelectrofocusing was performed according to the following program: 500V RampR 250Vh,

1000V RampR 500Vh, 8000V RampR 6500 Vh and holding at 500V. After the IEF-run, the

strips were reduced at 20°C by incubation in equilibration buffer I for 15 min and alkylated at

20°C by an incubation in equilibration buffer II for another 15 min. Strips were shortly

washed with H2O and placed on a 12% PA-gel, next to a piece of Whatman paper along with

prestained protein marker, and fixated with 52°C pre-warmed LM-agarose. Second-dimension

electrophoresis was carried out at RT using 120V for 20 min followed by 180V for 40 min

(until the bromophenol blue dye had run off the end of the gel). Protein spots were visualized

by silver staining.

Lysis buffer: 9 M urea, 4% (w/v) CHAPS, 0,4% (w/v) ampholytes 3–10, 65 mM

DTT, 0.1% (w/v) bromophenol blue. The ampholytes, DTT and

bromophenol blue were freshly added before use.

Equilibration buffer I: 6 M urea, 30% (v/v) glycerol, 2% (w/v) SDS, 0.05 M Tris pH8.8

and 64mM DTT.

Equilibration bufferII: 6 M urea, 30% (v/v) glycerol, 2% (w/v) SDS, 0.05 M Tris pH8.8

and 2,5% (w/v) iodoacetamid.


38

II.2.12.4 Immunoblot analysis

Electrophoretically separated proteins (II.2.12.2) were transferred to Protran BA 85

nitrocellulose membrane (Schleicher&Schuell) for 1 h by electroblotting (250 mA) using the

Mini Trans-blot cell from BioRad. After blotting, the membrane was blocked by shaking for

1h at RT with 5% (w/v) skim milk powder (Roth) dissolved in PBS-T buffer. The

immunodetection was carried out either with Forisome specific mouse antiserum in a dilution

of 1:2000 in 1XPBS buffer, Forisome specific chicken antiserum in a dilution of 1:6000,

GST fusion VFF1 protein specific rabbit antiserum, or monoclonal anti GST antibody raised

in mouse (dilution 1:5000). The appropriate secondary polyclonal antibody couple either to

alkaline phosphatase (AP) or horseradish peroxidase (HRPO) was used for colorimetric or

chemiluminescence detection. Primary antibodies were diluted in blocking buffer while the

secondary antibodies were diluted in 1xPBS buffer. Membranes were revealed with substrate

solution (NBT/BCIP from BioRad or ABTS substrate tablets from Roche). For the

chemiluminescence detection a LAS-1000 (Fujifilm, Tokyo) was used.

Electrotransfer buffer (pH 8.3): 25 mM Tris; 192 mM glycin; 0.5% (w/v) SDS; 20% (v/v)

methanol.

PBS buffer (pH 7.4): 137 mM NaCl; 2.7 mM KCl; 8.1 mM Na2HPO4.12H2O;

1.5 mM KH2PO4

PBST buffer(pH 7.4): 137 mM NaCl; 2.7 mM KCl; 8.1 mM Na2HPO4.12H2O;

1.5 mM KH2PO4; 0.1% (v/v) Tween 20

AP buffer (pH 9.6): 100 mM Tris-HCl, pH 9.6, 100 mM NaCl, 5 mM MgCl2

II.2.13 Polyclonal antibodies production

II.2.13.1 Mouse immunization

Mouse immune sera to Forisomes were prepared by subcutaneous immunization of two

BALB/c mice with 50 µg of isolated Forisomes (II.2.1) previous denaturalization at 100°C for

15 min and emulsified in 40 µl of Freund’s complete adjuvant (GERBU Biochemicals,

Gaiberg). The mice were subsequently boosted three times at 2-week intervals with same

quantity of denaturated Forisomes. For the first and second boost, 20 µl of Freund’s

incomplete adjuvant were used while no adjuvant was added in the last boost. Blood was

taken after the second and last boosts from the tail vein using a 26 gauge needle (1-2 µl) and a

capillary for picking up blood. The blood was diluted 1000-fold with PBS for determination

of antibody titers.


39

II.2.13.2 Chicken immunization

Polyclonal antiserum from chicken was raised against isolated Forisomes (II.2.1). For the first

immunization, 100 µg of Forisomes in 500 µl of 1XPBS buffer subject to 100°C for 15 min

were used along with 40 µl of Freund’s complete adjuvant (GERBU Biochemicals, Gaiberg).

Two further injections in the breast muscle were given at three weekly intervals with the same

amount of antigen and 20 µl of Freund’s complete adjuvant. Polyclonal IgY antibodies were

purified from eggs yolk (Polson, A. et al., 1985) ten days after the second injection to

estimate the antibody titers.

II.2.13.3 Rabbit antisera

Rabbit immune sera to full-length recombinant GST-VFF1 were prepared by Eurogentec s.a.

(Liège Science Park, Belgium) following their standard immunization protocol. Purified

fusion protein (II.2.11) was denatured in SDS and electrophoretically separated on a

denaturing 12.5% polyacrylamide gel and subsequent polyacrylamide gel electrophoresis

(PAGE) (II.2.12.2). A single band of recombinant GST-VFF1 fusion protein revealed by

brief staining with Coomassie blue was excised from the gel. The acetic acid from the

Coomassie destaining solution was washed out by rinsing the band slice in destilled water for

2 h at RT and the antigen included in the polyacrylamide gel slice was submitted for

immunization to Eurogentec. Approximately 100 µg of protein was used for immunization

and boosting of a rabbit.

II.2.14 Determination of antisera titers

The determination of polyclonal antibody titers from sera of mice and rabbit was performed

by direct ELISAs using isolated Forisomes (II.2.1) after denaturalization at 100°C for 15 min

(mice antisera determination) and overexpressed GST-VFF1 protein (II.2.11) (rabbit antisera

determination) as antigens. To determine the titer of VFF1 protein specific antibodies,

10 µg/ml of GST-VFF1 protein were coated to high binding ELISA plates. GST (10 µg/ml)

was included as control. In the evaluation of Forisomes specific mice antibodies 10 µg/ml of

antigen were used. Antigens in 0.1 M carbonate buffer (pH 9.6) were coated overnight at 4oC

and blocked with 1% (w/v) BSA in 1XPBS. Serial dilutions of sera samples in blocking

buffer in an appropriate range for the particular analysis were added to the coated plates and

incubated at 37°C for 1.5 hours. After three washes with PBST bound antibodies were

detected by addition of 1:5000 diluted AP-labeled goat anti-rabbit polyclonal antibodies or

HRPO-labeled goat anti-mouse polyclonal antibodies in blocking buffer. The substrates used

for developing of AP labeled secondary antibodies and HRPO conjugated goat anti mouse

antibodies were p-nitrophenyl phosphate (pNPP) (Sigma) and ABTS-H2O2 [0.5 mg of 2,2’-


40

azinobis(3-ethylbenzthiazolinesulfonicacid) (ABTS)/ml, 0.002% (v/v) H2O2, 0.1 M citrate-

phosphate buffer (pH 4.3)] (Roche), respectively. ELISA plates were incubated at 37°C for

1 h followed by measurement of the OD at 405 nm with a Spectra Max® 340 microplate

reader (Molecular devices, CA).

The evaluation of chicken polyclonal antisera was carried out by immunoblot (II.2.12.4).

II.2.15 Confocal immunofluorescence microscopy

Vicia faba stems were cut with a razor blade into small sections alongside the phloem and

fixed overnight in fixative solution [4% (w/v) paraformaldehyde, 0.2% (v/v) glutaraldehyde in

0.1 M phosphate buffer, pH 7.4] at 4°C. The stem sections were then subject to washing five

times for 15 min with 0.1 M phosphate buffer (pH 7.4) at 4°C. Thick longitudinal and cross

sections (~30µm) from fixed Vicia faba stems were obtained using a vibratome (Leica VT

1000S) and collected on slides coated (5 min at RT and dried for 1 h at 60°C) with poly-L-

lysine. To improve the penetration of reagents across thick sections, the tissue was dehydrated

and rehydrated through ethanol series. Dehydration was carried out at RT by immersing the

sections in a solution of 50% (v/v) ethanol for 5 min, followed by increasing concentrations of

ethanol [70% (v/v), 96% (v/v) and 100% (v/v)] for 5 min each. Rehydration was performed

through an ethanol series [100% (v/v), 95% (v/v), 70% (v/v), 50% (v/v) for 5 min each] and a

final washing with dH2O. Cell wall digestion was carried out for 1 h with 2% (w/v) cellulose

in 0.1 M phosphate buffer (pH 7.4) followed by a disruption of the cell membrane with 0.5%

(v/v) Triton-100X in the same buffer for 1 h. Non-specific binding sites were blocked with a

solution of 3% (w/v) BSA in 0.1 M phosphate buffer (pH 7.4) buffer for 10 min. Forisome

specific mouse polyclonal antibodies (II.2.13.1) in a dilution 1:2 in 0.1 M phosphate buffer

(pH 7.4) was incubated for 2 h at RT for epitopes recognition. After washing three times with

0.1 M phosphate buffer (pH 7.4) for 5 min, the antigen-antibody binding reaction was

revealed by adding 1:30 fold diluted goat anti-mouse Alexa Fluor® 488 (Molecular Probes) in

0.1 M phosphate buffer (pH 7.4). The sections were then washed first with 0.1 M phosphate

buffer (pH 7.4) and then with distilled water. A confocal fluorescence microscope (Leica TCS

SP) was used for analyses of immunofluorescence.

Phosphate buffer 0.1 M (pH 7.4): 19% (v/v) of 200 mM NaH2PO4.H2O with 81% (v/v) 9.9

mM Na2HPO4.2H2O.

Chapter III Results __________________________________________________________________________

41

III Results

III.1 Molecular characterization of Forisome genes

III.1.1 Analysis of isolated Vicia faba Forisomes by SDS-PAA gel electrophoresis

SDS-PAA gel analysis (Figure III-1) of isolated Vicia faba Forisomes (II.2.1) revealed the

presence of several bands with different molecular weights indicating that Vicia faba

Forisomes might be protein complexes consisting of several subunits. A major band of

approximately 70kDa could be detected as well as several minor bands of lower and higher

molecular weights which might represent dimerization and multimerization derivates. The

70-kDa protein was extracted from the gel, digested with trypsin and analyzed by peptide

mass fingerprinting following nanoLC-ESI-MS/MS and MALDI-TOF-MS (II.2.2).

Figure III-1 SDS-PAGE analysis of isolated Vicia faba Forisomes. Approximately 5µg of isolated V. faba Forisomes (II.2.1) were resolved on 12% (w/v) SDS-PAA gel (II.2.12.2) and stained with Coomassie brilliant blue (II.2.12.2). M: protein marker.

III.1.2 Generation and characterization of Forisome-specific polyclonal antibodies

III.1.2.1 Immunoblot analysis of isolated Vicia faba Forisomes

Polyclonal antisera were raised against native Forisomes (II.2.1) in mouse and chicken

(II.2.13.1 and II.2.13.2). After the third boost, polyclonal antibodies were obtained from sera

and the titer was determined by immunoblot analysis (II.2.12.4). Antigen specificity of

mouse and chicken antisera against isolated V. faba Forisomes is shown in figure III-2A and

B demonstrating a specific binding of mouse antiserum to the major band of approx. 70kDa as

well as another band of slightly lower molecular weight and the upper bands running at >100

kDa resolved by SDS-PAGE analysis. Chicken polyclonal antibodies showed a strong

reaction mainly to the major band of approx. 70kDa while the immunoreativity against the

kDa

62

83

175

47,5

32,5

25

16,5

M FkDa

62

83

175

47,5

32,5

25

16,5

M F

62

83

175

47,5

32,5

25

16,5

M F


42

bands of higher molecular weights was less evident. Degradation products and/or proteins of

lower molecular weights were observed between 50 and 72 kDa. A total protein extraction

from tobacco was used as negative control. No cross hybridization of preimmunized mouse

and chicken antisera to V. faba Forisomes could be detected (data not shown).

Figure III-2 Immunoblot analysis of isolated Vicia faba Forisomes with mouse and chicken antisera. Approximately 5µg of isolated V. faba Forisomes (II.2.1) were separated on a 12% SDS-PAA gel (II.2.12.2) and blotted onto nitrocellulose membrane for immunoblot analysis (II.2.12.4). Blotted Forisome proteins were incubated with mouse (dil. 1:2000) (A) and chicken antisera (dil. 1:5000) (B) for 1 hour followed by addition of a 1:5000 dilution of GAMHRPO(H+L) and RACHRPO polyclonal antibodies, respectively. 1: isolated V. faba Forisomes; 2: tobacco total protein extraction as negative control. Detection was carried out by chemiluminescence using a LAS-1000 (Fujifilm, Tokyo).

III.1.2.2 Immunoblot analysis of isolated Vicia faba Forisomes on 2D-gel

electrophoresis

In order to identify proteins difficult to resolve on Coomassie brilliant blue-stained one-

dimensional PAGE, a two-dimensional-gel electrophoresis was performed (II.2.12.3).

Approximately 10µg of isolated V. faba Forisomes were resolved by this technique (Figure

III-3A). Furthermore, an immunoblot analysis was performed with the aim of characterize

their antigenicity toward Forisome-specific mouse and chicken antisera (Figure III-3 B and

C).

After two-dimensional PAGE, V. faba Forisomes are separated into at least 8 forms spanning

the pI values from 6.0 to 7.5 (Figure III-3A). The major band of ~70kDa observed on one-

dimensional PAGE is composed of two and three proteins running at the same molecular

weight. This heterogeneity might indicate the result of post-translational modifications (e.g.

glycosylations). Despite the observed high degree of complexity of Forisomes preparation, a

simplified pattern appears after immunoblot analysis in which the Forisome proteins

kDa

62

83

175

47,5

32,5

25

16,5

1 2kDa

62

83

175

47,5

32,5

25

16,5

1 2

A B

kDa

62

83

175

47,5

32,5

25

16,5

1 2kDa

62

83

175

47,5

32,5

25

16,5

kDa

62

83

175

47,5

32,5

25

16,5

1 2kDa

62

83

175

47,5

32,5

25

16,5

kDa

62

83

175

47,5

32,5

25

16,5

1 2

A B


43

molecules of higher molecular mass are of less acidic pI, whereas those migrating as lower

molecular mass forms are apparently more acidic. As shown in Figure III-3B, the

immunodetection with mouse polyclonal antibodies revealed the presence of three groups of

proteins running at a molecular weight of ~70kDa. Among two of them the presence of two

distinct isoforms is confirmed. Figure III-3C represents the immunodetection with polyclonal

chicken antibodies. In this case, two groups of proteins migrating as ~70 kDa were observed.

However, in this population the less acidic forms are better represented. Also the 150 kDa

species, resolved into two charge forms, were indicated displaying exclusively basic pI (8–9).

Not only with mouse but also with chicken polyclonal anitbodies the major ~70 kDa band was

observed migrating as barely detectable multiple spots of pI 5-6.

Figure III-3 2D-gel electrophoresis and immunoblot analysis of isolated V. faba Forisomes. Approximately 10µg of isolated V. faba Forisomes (II.2.1) were subjected to 2D-gel electrophoresis analysis (II.2.12.3). (A) pH 3 to 10 gel of V. faba Forisomes. Sample was solubilized and resolved by IEF (II.2.12.3). The second dimension was carried out on a 12% SDS-PAA gel (II.2.12.2) and silver stained (II.2.12.2). (B) Immunoblot analysis with Forisome-specific mouse antiserum (dil. 1:2000) followed by addition of a GAMHRPO(H+L) polyclonal antibodies (dil. 1:5000). (C) Immunoblot analysis with Forisome-specific chicken antiserum (dil. 1:5000) followed by addition of a RACHRPO polyclonal antibodies polyclonal (dil. 1:5000). Detection was carried out by chemiluminescence using a LAS-1000 (Fujifilm, Tokyo).

III.1.3 Screening of cDNA Libraries

For identification of Forisome-encoding genes, subtracted and non-subtracted Vicia faba

derived cDNA libraries (II.2.5.2) were screened by hybridization to specific DNA probes. The

screening of the recombinant E. coli clones in these arrayed libraries was performed as

described previously in the Materials and Methods section (II.2.5.2).

C

50

75

150

50

75

B

150

kDa

50

75

A

150100

pH 3 pH 10

C

50

75

150

C

50

75

150

50

75

B

150

50

75

B

150

kDa

50

75

A

150100

kDa

50

75

A

150100

pH 3 pH 10

Chapter III Results ___________________________________________________________________________

44

DNA probes

Peptide sequences (EVTSV and VMEVSWHYK) (II.2.2) of isolated Forisomes, which had a

relatively low codon degeneracy, were used to design mixtures of oligonucleotide probes for

arrayed Vicia faba cDNA libraries screening. Eight different probes (15-mer of 768-fold

degeneracy corresponding to EVTSV, 27-mer of 1536- fold degeneracy corresponding to

VMEVSWHYK, 24-mer of 768-fold degeneracy corresponding to VMEVSWHY and 24-mer

of 384-fold degeneracy corresponding to MEVSWHYK; Table III-1) were synthesized by

Metabion International AG (Martinsried, Germany) and end-labelled with 30 MCi of

[γ32P]ATP (Harrison, B. and Zimmerman, 1986).

Table III-1 Oligonucleotides used for hybridization screening

Peptide sequence E V T S V (N) 15-mer 5´ GAR GTN CAN WSN GTN 15-mer 5´ NAC NSW NGT NAC YTC

Peptide sequence V M E V S W H Y K 27-mer 5´ GTN ATG GAR GTN WSN TGG CAY TAY AAR 27-mer 5´ YTT RTA RTG CCA NSW NAC YTC CAT NAC 24-mer 5´ GTN ATG GAR GTN WSN TGG CAY TAY 24-mer 5´ RTA RTG CCA NSW NAC YTC CAT NAC 24-mer 5´ ATG GAR GTN WSN TGG CAY TAY AAR 24-mer 5´ YTT RTA RTG CCA NSW NAC YTC CAT

Y = C or T; N = A, G, T, or C; and R = A or G

Figure III-4 Hybridization screening on arrayed Vicia faba cDNA libraries. Subtracted and non-subtracted Vicia faba cDNA libraries were screened by hybridization to ([γ32P]ATP) isotope labelled oligonucleotides. These specific probes were designed according to Forisome peptide sequences (EVTSV and VMEVSWHYK) as previously described (II.2.5.2 and III.1.3). The duplicate pattern of the positive clones is observed.


45

Positive clones were identified after tertiary screening in both unamplified libraries (Figure

III-4). Approximately 30,000 colonies from the subtracted cDNA library and 20,000 colonies

from the non-subtracted cDNA library were screened and 74 colonies were identified and

characterized. Although 23 of the clones exhibited strong hybridization signals, the sequence

analysis did not contain the identified Forisome peptides. Thus, the allocation of these DNA-

and/or DNA fragments to the Forisome genes was not possible.

III.1.4 Immunoscreening of cDNA expression library

In order to identify cDNAs encoding proteins involved in the constitution of Forisomes, pre-

absorbed sera from immunized chicken and mice (II.2.5.1) were used for immunoscreening of

a cDNA expression library of Vicia faba plant tips (II.2.5.1). Considering that the titer of this

amplified library was determined as 2.8x106 pfu/µl, 20,000 pfu per plate were subjected to

immunoscreening.

Figure III-5 Immunoscreening of Vicia faba cDNA expression library of plant tips. A cDNA expression library was constructed in λTriplEX2TM phagemid and purchased by Clontech (BD Biosciences Clontech, Palo Alto, USA). The induction of the fusion proteins expression was carried out presoaking prenumbered nitrocellulose filters in 10mM IPTG and when plaques were clearly visible, placing a damp filter onto each plate as described in the protocol suggested by the manufacturer (BD Biosciences Clontech). Proteins immobilized on the filters were detected using pre-absorbed serum from immunized chicken as primary antibody and RAC-FcHRP (Dianova) as secondary antibody (dil. 1:5000). Detection was carried out using ECL Advance Western blotting detection kit (II.1.2). (A) IgY pre-ab (phage lysate and Physalis protein extraction) dil. 1:30000. (B) positive control: human β2-microglobulin clone. Immunodetection was carried out with rabbit anti-human β2-microglobulin control antibody at dil. 1:1000 followed by GAR-FcHRP (1:5000). (C) negative control: preimmunized IgY pre-ab (phage lysate and Physalis protein extraction) (dil. 1:30000). (D) negative control: filter treated with RAC-FcHRP alone.

Due to a relative high background obtained during the procedure the pre-absorbed sera from

immunized chicken and mice were subjected to absorption of non-specific antibodies that

react with plant proteins. This was carried as described in established protocols (picoBlue

immunoscreening kit; Stratagene) using a total protein extraction from Physalis floridana.

Initial tests included a control with the secondary antibody alone to check whether it binds

A CB DA CB D


46

non-specifically and a control in absence of the inducer IPTG to determine the basal level of

bacterial protein expresion which could affect the background; hence, a precise identification

by immunoscreening (data not shown). Depending on the background levels and the signal

strength of the bound antibody only the pre-absorbed serum from immunized chicken was

used as primary antibody. Forty-five positive clones appeared from approximately 100,000

plaques after a tertiary screening (Figure III-5), and the positive λTriplEx2 phagemids were

converted into the pTriplEx2. Subsequently, the nucleotide sequences of inserts displaying

potential open reading frames (ORFs) were analyzed, however, none of the identified

fragments turned out to be unrelated sequences.

III.1.5 PCR screening of cDNA expression library

Since the initial attempts to clone cDNA and/or cDNAs for Vicia faba Forisomes by

immunoscreening with polyclonal antibodies were not successful PCR screening of the cDNA

expression library was carried out. Degenerate primers encoding the peptides sequences

EVTSV and VMEVSWHYK from Vicia faba Forisomes (Table III-1) were used to amplify

and clone sequences that might correspond to genes encoding these proteins in Vicia faba.

Although many attempts using different PCR conditions were performed the identified PCR

products do not show any distinct Forisome-related genes.

III.1.6 Cloning full-length Forisome cDNA

Due to the fact that all previous attempts in isolating full-length Forisome cDNA clones failed

a RACE PCR technique was considered as an alternative cloning strategy. Hence, the rapid

amplification of cDNA ends (RACE) (II.2.6.1) was used to obtain the full-length cDNA

sequence of Forisome, resolve the start of the 5’ untranslated region (5’-UTR), and locate the

poly(A)+ addition site of the gene.

A 5’- RACE was attempted with degenerated oligonucleotides primers designed after the

isolated Forisome peptides sequences (Table III-1). This initial trial was unsuccessful. To

circumvent this problem, a recently published database for Medicago truncatula – the model

plant for Fabaceae – (EST-Library; http://www.medicago.org/genome) was used for further

studies. After aligning the isolated Forisome peptides sequences from Vicia faba (II.2.2) with

this Medicago library patches of amino acids conserved among the two species were outlined

belonging to the same DNA sequence. Nested primers, based on these conserved peptides

(EGFDIAFK and EVTSVN), were used to perform a PCR amplification of genomic Vicia

faba DNA resulting in a 200bp fragment. RACE PCRs, using gene specific primers (GSP)

derived from the hypothetical Forisome sequence obtained, extended the identified 200bp

fragment by additional ~1.2kb in the upstream and downstream direction. The 5’- and 3’-

RACE methods yielded cDNA bands of 1.3 and 0.8 kb, respectively (Figure III-6).


47

Figure III-6 Agarose gel electrophoresis of 5’- and 3’- RACE PCR amplification products of Vicia faba cDNA. Lanes show the PCR products (II.2.6.1) amplified using different GSP in the RACE PCRs (II.2.6.1). 5µl of each sample were subjected to electrophoresis through a 1.2% (w/v) agarose gel (II.2.7.4). (A) 5’- and 3’- RACE PCRs. (B) reamplification of the 5’-RACE PCR products obtained in the first amplification. M: 1Kb DNA ladder (Invitrogen).

The nucleotide sequences of these bands overlapped with the 200bp initial fragment and

included the 3’ untranslated region of the gene. Genomic Vicia faba DNA, diluted 1:50 to

approximately 100 ng/µl, was used as a control in order to confirm that the amplification

products are derived from cDNA (data not shown). Further 5’-RACE PCRs were carried out

(II.2.6.1) extending the cDNA sequence resulting in retrieval of the 5’ untranslated region

sequence. A high-fidelity enzyme system (II.1.2) was used to reduce potential errors during

5’- and 3’- RACE PCRs. However, to detect possible mutations during PCR amplification,

this reaction was done in triplicate in independent reactions, and the products were sequenced.

All the three RACE sequences matched exactly with each other. The sequences were then

assembled into full length cDNAs. After conceptual translation of the ORF, the start codon

was defined. Among the cDNA sequences obtained, two ORFs were determined (ORF1 and

ORF2) differing from each other in patches of several nucleotides in the amino terminal

amino acids sequences (Figure III-7), representing a putative second Forisome gene.

The full-length Forisome cDNA (Figure III-8) was obtained by reverse transcriptase

polymerase chain reaction (RT-PCR) using primers designed based on the cDNA sequence

flanking the start and stop codons. The amplified sequence was cloned into pCR®2.1-TOPO

(Invitrogen) and sequenced from both directions with 10-12-fold redundancy. A cDNA

sequence of 2053bp was determined revealing the presence of 10 different peptides sequences

belonging to the Vicia faba Forisomes, therefore a putative Forisome gene (vff1, 2056 bp)

encoding a Vicia faba Forisome protein of 79 kDa (VFF1).

1.3 Kb

3‘-RACE 5 ‘-RACE

M 1 2 3 4 M 3 4

1.3 Kb

5‘-RACE BA

0.8 Kb


M 1 2 3 4 M 3 4

1.3 Kb

5‘-RACE

1.3 Kb


M 1 2 3 4 M 3 4

1.3 Kb

5‘-RACE BA

0.8 Kb


M 1 2 3 4 M 3 4

1.3 Kb

5‘-RACE


48

+1

Reverse transcription RT-PCR conducted using total RNA, which was obtained from Vicia

faba young leaves and stems (III-1.7), confirmed at the same time that the putative vff1 gene

was expressed in this plant tissue.

+1 C12 GA ATGTCCTT TTCTAACTCA ACTGCTGCTG CT...ACTGG CACTTTGGTT F04 GA ATGTCCTT TTCTAACTCA ACTGCTGCTG CT...ACTGG CACTTTGGTT E06 GA ATGTCCTT TTCTAACTCA CCTGCTGCTG CT...ACTGG CACTTTGGTT C07 GA ATGTCCTT TTCTAACTCA CCTGCTGCTG CTGCAACTGG CACTTTGGTT C09 GA ATGTCCTT TTCTAACTCA CCTGCTGCTG CTGCAACTGG CACTTTGGTT D06 GA ATGTCCTT TTCTAACTCA CCTGCTGCTG CTGCAACTGG CACTTTGGTT C12 CAAC...... ...ATGGTGG CAACGGCACT AATAAT...A GT TTGATCCA F04 CAAC...... ...ATGGTGG CAACGGCACT AATAAT...A GT TTGATCCA E06 CAAC...... ...ATGGTGG CAACGGCACT AATAAT...A GT TTGATCCA C07 CAACTTCAAC ATGGTGGTGG CACTGCCACT AATAATAACA GTTTGATCCA C09 CAACTTCAAC ATGGTGGTGG CACTGCCACT AATAATAACA GTTTGATCCA D06 CAACTTCAAC ATGGTGGTGG CACTGCCACT AATAATAACA GTTTGATCCA

Figure III-7 Sequence alignment of 5’- RACE PCR products of Vicia faba cDNA. The arrows at +1 position in the cDNAs sequences represent the first nucleotide of the coding region. Letters in bold indicate alternatives initiation codons. Sequences from the clones C12, F04 and E06 belong to ORF1 while the others represent sequences from ORF2. Figure III-8 RT-PCR amplification product of full- length Forisome Vicia faba cDNA. Total RNA was isolated from Vicia faba young leaves and stems (III-1.7). 10µl of sample were subjected to electrophoresis onto a 1.2% (w/v) agarose gel. Primers were designed based on the cDNA sequence flanking the translational start and stop codons. M: 1Kb DNA ladder (Invitrogen).

2050 bp

M

2050 bp

M


49

1 MSFSNSPAAA TGTLVQHGGN GTNNSLIQKT ATSSHPHHKA NNYLPNPFEL

51 HDSHILDKVY LTHVTDDEFC DTDIIFDLVS TLILQSNT QI PVTGFKPDFP

101 TLKLISCQ MI TTRSVAHCVH QTTLWILQNL RSYSWDAKAL ITLAAFTLEY

151 GNYLQLNRVT ATDPI GNSLR QLNQIQTRKI STDIPELVNF IVHKLLHLKE

201 WAAWSAEGYD PEDVPALTEA LQEIPVFVYW TIASIVAS TG NLVGVSDYNL

251 SEYRERLSGI VQKLVVHLNN CKLQISYIDD LFNRRKIF DK PKDIVDCLKA

301 LIHHNGADSP QIYEGAIHVK TGLEVFR HKH VLMFISSLDS IEDEISLLNS

351 IYERLQENSK ESIKGFKKED FKILWIPIVN NWDDIRKE RF RALKSGIKWY

401 AVEYFYELPG HRIITDPERI GYIGNPIIPV FNPHGYIT NI DAMDLIFQWG

451 IDAFPFRKSD GIDLTFK WKW LWDVIKKATP GLQVKGDRYI FIYGGTNNKW

501 IQDFTL ELEK IKRHETLKRA DVIIDNYQLG K DDPNRVPSF WIGVERKKQN

551 KKHQEAVDCE IQDIVKSLF C LKRDPQGWVI LSKGQNIKLL GHGEPAYQTL

601 AEFQN WKDRV LEKEGFDIAF KEYYEMKAKE LSGREPCEVV NVDTYSSNVI

651 ATIA CPNPMC GRVMEVSSVH YKCCHRDEPN NFGV

Figure III-9 Vicia faba Forisome-1 (VFF1) predicted amino acid sequence. Comparative analysis of the resulting data enabled direct identification of 10 peptides sequences from Vicia faba Forisomes proteins. Letters in bold indicate alternatives initiation codons for translation. Underlined sequences match to peptides sequenced from purified Vicia faba Forisomes. Red letters indicate a carboxyterminal succession of several cysteines. A coiled-coil motif is represented by reverse shaded letters. The standard single-letter code is used.

Vff1 cDNA obtained by RT-PCR was aligned against the reconstructed full-length cDNA

sequences from the 3’- and 5’-RACE products verifying the ORF1. However, after several

attempts, the second open reading frame (ORF2) could not be confirmed. The full-length vff1

(2352 bp) cDNA had 57 bp of 5’- untranslated region (5’-UTR), an open reading frame of

2056 bp, and a 3’-untranslated region (3’-UTR) of 239 bp. The open reading frame had two

ATGs within the first 330 bp (Figure III-7 and III-9). The sequence context near the first start

codon had matched well with the sequence context conserved around the initiation codon for

plant genes (Lütcke et al., 1987; Joshi, 1987; Cavener and Ray, 1991). A putative

polyadenylation signal, AAATAA (Heidecker and Messing, 1986), preceded poly(A)+ by 21

bp. The deduced amino acid sequence had 684 amino acid residues (Figure III-9) comprising

10 of the peptides that were sequenced (II.2.2) from purified Vicia faba Forisomes (Figure III-

9). There is no recognizable signal sequence (Emanuelsson et al., 2000) based upon sequence

analyses.


50

A Coiled-coil motif

F I S S L D S I E D E I S L L N S I Y E R L Q E N S K E S I K

B Amphipatic α-helix

Figure III-10 Representation of coiled-coil motif and amphipatic αααα-helix comprised in the VFF1 protein sequence. (A) heptad repeat (abcdefg) representative of coiled-coil structural motifs depicted in shaded letters. Nonpolar amino acids are indicated in blue letters whereas polar amino acids are represented by red letters. (B) amino acid sequence of the coiled-coil motif (A) depicted as an amphipatic α-helix. Hydrophobic amino acids residues are characterized by blue small boxes, hydrophilic amino acid by red letters

Considering the importance of Ca2+ in the regulation of the comformational change in vitro,

Ca2+-binding motifs where searched within the Forisome cDNA sequence by comparison with

the European Bioinformatics Institute database (www.ebi.ac.uk/InterProScan/). However, no

evidence of the presence of a conserved motif was retrieved. Motif searches against the

PROSITE, Pfam, and Smart databases, after exclusion of patterns with a high probability of

occurrence, did not detect any known motifs. Nevertheless, further attemps to identify well-

a b c d e f g a b c d e f g a b c d e f g


51

known motifs were performed using computer analysis (http://www.ch.embnet.org/software/

COILS_form.html; Lupas, A., 1996). COILS is a program that compares a sequence to a

database of known parallel two-stranded coiled-coils and derives a similarity score. By

comparing this score to the distribution of scores in globular and coiled-coil proteins, the

program then calculates the probability that the sequence will adopt a coiled-coil

conformation. This analysis revealed another structural motif, an amphipathic α-helix within

the coding region of VFF1 comprising a coiled-coil domain (Figures III-9 and III-10).

The α-helical coiled coil is one of the principal subunit oligomerization motifs in proteins. Its

most characteristic feature is a heptad repeat pattern of primarily apolar residues that

constitute the oligomer interface. The pattern of repeating hydrophobic residues at positions a

and d of the heptad repeat (denoted abcdefg) are responsible for coiled-coil formation. The

presence of a continuous interface of hydrophobic amino acids along the length of the helices

provides a major source of stability to the fold as the hydrophobes pack in a knobs-into-holes

fashion shielded from the bulk solvent (Crick, 1953).

In addition, motif searches against the Smart database, after inclusion of sequences (outlier

homologues) that are often difficult to detect using HMM methodology, retrieved a 100%

identity within the VFF1 amino acid sequence (167-395) to an unknown domain

(d1gw5a_domain; http://smart.embl-heidelberg.de/) which belongs to the ARM superfamily.

Previous studies reported by Huber et al. (1997) indicated that each ARM repeat forms a

trihelical structure that folds into a superhelix, and six ARM repeats are proposed to constitute

a protein interaction domain.

A so-called low-complexity region – ISSLDSIEDEISLL – for which no structure can be

predicted with the algorithms available (Schultz et al., 1998) was also identify within the

VFF1 amino acid sequence (335-348). Wright and Dyson (1999) reported that these low-

complexity regions only acquire a rigid structure (e.g., an α-helix) upon interaction with

another protein partner or oligomerization into a protein complex.

III.1.7 Isolation of total RNA from Vicia faba

Total RNA was isolated from young leaves and stems as described in the material and

methods section (II.2.4). RNA concentration and purity of isolated total RNA was determined

by spectrophotometry. The yield of total RNA isolated ranged between 1-1.5 mg per gram of

biomass. The integrity of the RNA was checked on a 1.2% (w/v) agarose gel (Figure III-11).

The 28S and 18S ribosomal RNA were visible as distinct bands whereas the mRNA was

present as background smear indicating the quality and integrity of the isolated total RNA.


52

28S

18S

1

Figure III-11 Analysis of total RNA isolated from Vicia faba. Total RNA (II.2.4) was isolated from Vicia faba young leaves and stems and separated on a 1.2% (w/v) agarose gel (II.2.7.4) containing 2.4 M formaldehyde. The major ribosomal RNA species (28S and 18S rRNA) are indicated. 1: 2µl of total RNA.

III.1.8 Identification of the transcription start sites for vff1

To identify the transcription start sites for vff1 gene, a SMART RACE analysis was

performed by using three reverse oligonucleotides derived from the coding region (821, 735

and 637 bp downstream of the start codon) and two adapter primers provided with the kit for

the primary and nested PCR. A weak smear on the agarose gel was observed in the first PCR

with outer primer AP1 and reverse primers GSP1 or GSP2 by using the total RNA from Vicia

faba young leaves and stems (data not shown).

Figure III-12 RACE analysis of the transcription start site of the vff1 gene. Analysis of the nested PCR (II.2.6) products on a 1.2% (w/v) agarose gel (II.2.7.4). Three RACE assays were conducted by using two adapter primers (AP1and AP2) and three vff1 GSPs (GSP1, GSP2, and GSP3, corresponding to nucleotide residues 821–846, 735–756, and 637–662, respectively). In the first RACE analysis, AP1-GSP1 and AP1-GSP2 primer pairs were used in the primary and secondary PCRs, respectively. Total RNA was extracted from Vicia faba young leaves and stems (III.1.7). Nested PCR product was cloned into the pCR®2.1-TOPO vector (Invitrogen), and subsequently verified by sequence analysis (II.2.7.6).

1018

M 1 2

Nested PCR

506

bp

1018

M 1 2

Nested PCR

506

bp


53

The primary PCR products were used as template for two different nested PCRs by using AP2

and GSP2, or GSP3. Only one single product was obtained from both nested PCRs (Figure

III-12). This result indicates that vff1 transcript may have one single translational site,

although it does not rule out the possibility that another transcription site is located closely to

the first one that PCR products were inseparable on the agarose gel electrophoresis. The 5’-

RACE product was cloned into pCR®2.1-TOPO (Invitrogen). The sequencing of 10 different

clones, randomly selected, revealed that they share the same sequence (data not shown). The

first base of this product was therefore assigned position -57, and it is located 57 bp upstream

of VFF1 start codon.

III.1.9 Molecular characterisation of the vff1 genomic clone

Application of LD PCR (II.2.6.3) on Vicia faba genomic DNA using sense and antisense

primers derived from the cDNA resulted in isolation of two genomic fragments of ~3 and 4.5

kb (Figure III-13).

Figure III-13 LD PCR on Vicia faba genomic DNA using primers derived from the cDNA. Genomic fragments of ~3 and 4,5 kb were amplified from 250-500 ng of Vicia faba genomic DNA (II.2.3) with sense and antisense primers derived from the Forisome cDNA. 5µl of each sample were analyzed on a 1.2% (w/v) agarose gel (II.2.7.4). Numbers indicates the PCR products samples amplified using different PCR conditions (Expand Long Template PCR System, Roche). 1: optimized buffers for amplification of fragments larger than 15 kb, 2: from 12 – 15 kb, and, 0.5 – 12 kb, respectively. M: 1Kb DNA ladder (Invitrogen).

The ~3 kb band was selected for sequence analysis and compared to the cDNA sequences

obtained from analysis of the RACE products. The entire genomic sequence of the Forisome

gene (vff1) was obtained by PCR displaying a 2710-bp fragment. Sequencing of the resulting

clones followed by the alignment of the cDNA and the genomic sequences of the vff1gene

revealed the presence of six introns flanked by GT and AG canonical intron border sequences.

These intervening sequences are located in the coding region and their lengths are 201, 92, 82,

89, 113, and 83 bp, respectively (sequences not shown). Sequences of the exons are identical

M 1 2 3bp

40723054

M 1 2 3bp

40723054


54

to sequences obtained with cDNA. The ORFs of the Forisome cDNA and genomic sequences

were resolved. The translated amino acid sequence predicted a protein of 684 residues with a

molecular mass of 79-kDa and an isoelectric point (pI) of 6.79. Three N-glycosylation sites

and several protein kinase phosphorylation sites were predicted by protein sequence analysis

using the PROSITE algorithm.

III.2 Molecular cloning and characterization of the vff1- promoter

III.2.1 Construction of genome walking libraries

Genomic DNA extracted from Vicia faba young leaves was digested with DraI, HpaI, MscI

and SspI restriction enzymes. Short adaptor DNA sequences provided in the Genome Walker

kit (II.1.2) were ligated to the blunt-end DraI-, HpaI-, MscI- and SspI-digested genomic DNA

fragments and generating four Genome Walking Libraries (Figure III-14)

Figure III-14 Analysis of Vicia faba genomic DNA digestion. A very high average molecular weight indicates the high quality of the isolated Vicia faba genomic DNA necessary in the construction of the GenomeWalker Libraries. Separate aliquots of genomic DNA were thoroughly digested with five different restriction enzymes that recognize a 6-base site, leaving blunt ends (in this case, DraI, HpaI, MscI, SspI and EcoRV). Three of these restrictions enzymes generated adequate Genome Walking Libraries. 5µl of each sample were analyzed on a 1.2% (w/v) agarose gel. DraI: DraI library, HpaI: HpaI library, MscI: MscI library, SspI: SspI library, EcoRV: digestion with EcoRV, control: HDL-EcoR V library provided with the BD GenomeWalker Human Kit, M: 1Kb DNA ladder (Invitrogen).

III.2.2 Identification and cloning of vff1 gene 5’-flanking region

While attempting to isolate and clone the genomic 5’-flanking sequence of vff1 using

Genome-Walking PCR (Clontech Laboratories, Palo Alto, CA) (II.2.6.4) coupled with a

combination of adapter and gene specific primers (GSP; Figure III-15A), a portion of a

putative vff1 promoter was cloned as follows. Primers (GSP1 and GSP2) were designed based

DraI HpaI MscI SspI EcoRV M controlDraI HpaI MscI SspI EcoRV M control


55

GSP2

GSP2

GSP1

on the 5’ end of the Forisome cDNA. The first PCR amplification of genomic DNA, using

GSP1 and an adaptor specific primer, produced two DNA fragments from four genomic DNA

libraries, with lengths ranging from 0.7 to 2.7 kbp (Figure III-16). A second PCR

amplification of the first-round PCR product with nested GSP2 and adaptor primers yielded

relatively shorter DNA fragments that were cloned and sequenced. The GSP2 primer

sequence at the 3’ end of this fragment flanked DNA sequence identical to the 5’ region of

vff1 cDNA. A putative TATA box (Figure III-15B, square) and a transcription initiation site

(Figure III-15B, asterisk) were predicted in the 5’-upstream region of this DNA fragment by

the Neural Network Promoter Prediction (http://www.fruitfly.org/seq tools/promoter. html;

Reese and Eeckman, 1995). These results initially suggested that the isolated fragment

contained the promoter regions of vff1.

A

TCTCTGAAATTTGAGTCATCATGTCCTTTTCTAACTCACCTGCTGCTGCTACTGGCACTTT

GGTTCAACATGGTGGCAACGGCACTAATAATAGTTTGATCCAAAAGACTGCCACTTCCTCA

CATCCACACCACAAAGCTAATAATTACTTGCCAAATCCATTTGAACTTCATGATTCTCACA

TTTTGGACAAAGTCTATCTCACTCATGTCACGGATGATGAATTTTGTGATACTGATATCAT

TTTCGACCTTGTCTCCACTCTTATACTTCAGAGTAATACACAGATTCCTGTCACCGGTTTC

AAACCAGATTTTCCTACATTGAAGCTGATTTCTTGTCAGATGATAACTACACGTAGTGTTG

CACACTGCGTTCACCAAACAACACTATGGATTCTCCAAAACCTGAGATCCTACTCTTGGGA

TGCAAAAGCACTTATAACTCTAGCTGCATTCACTTTGGAGTATGGAAACTATTTGCAACTT

AATAGGGTCACAGC…

B

…gttttgataagaataaaataataactttagtttcattacacacttccatt ccttgacaca

tggtatcaaatcaaacgtctcttaaactctcatgcattcttccacactata aataagttat

gcaacttcaccaaccaatcc*ACCATTCTTAAACCAAACCTAAGAAGTGTT ACTACTTCTC

TGAAATTTGAGTCATCATGTCCTTTTCTAACTCACCTGCTGCTGCTACTGGCACTTTGGTT

CAACATGGTGGCAACGGCACTAATAATAGTTTGATCCAAAAGACTGCCACTTCCTCACATC

CACACCACAAA…

Figure III-15 Nucleotide sequence of the 5’-flanking region of the vff1 gene. A. Sequence of the 5’ region of vff1 cDNA. The first ATG in the coding region is highlighted by reverse shading. The 5’-untranslated region is underlined. The sequences used to design GSP1 and GSP2 for genome-walking PCR are shown in bold letters, and their positions are indicated by arrows. B. DNA sequence of a portion of the 2.7kb product obtained by genome-walking PCR. The predicted TATA-box and transcription initiation site are highlighted by a square and an asterisk, respectively. The promoter sequence is shown in small letters and the untranslated region in the putative cDNA is underlined. The entire 5’-upstream sequence of the promoter region is not shown.


56

Figure III-16 Primary and secondary BD GenomeWalker™ PCR. Primary and secondary (nested) PCR was performed using BD Advantage 2 Polymerase Mix (II.1.2) and the cycling parameters as described in the manufacture’s protocol. The GSP1 and GSP2 primers used were designed based on the 5’ end of the Forisome cDNA and are described in Figure III-15. DraI: DraI Library, HpaI: HpaI Library, MscI: MscI Library, SspI: SspI Library, M: 1 kb DNA ladder (Invitrogen), 1: positive control HDL-EcoRV amplified using positive control primers PCP1 and PCP2 provided with the BD GenomeWalker Human Kit (II.1.2), 2: negative control: not adding DNA library.

III.2.3 Potential regulatory sequences in the vff1 promoter

A search for cis-acting elements in the 5’-upstream region of vff1 (-2070 to +1) using plant

cis-acting regulatory DNA elements (http://www.dna.affrc.go.jp/PLACE/signalscan.html;

Higo et al., 1999) indicated that the putative promoter contained several characteristic

elements of eukaryote promoters, including motifs associated with tissue specific expression

like CAAT-BOX1 ( Shirsat et al., 1989) and GATA box (Lam, E. et al., 1989) (Figure III-17)

but no elements that appeared to contribute to expression in phloem were retrieved.

Nevertheless, a sequence comparison of the vff1 promoter and other phloem-specific

promoters revealed another motif in the vff1 promoter that was homologous to sequences

conserved among several other phloem-specific promoters. The first element identified was a

GATA motif known to be important for phloem-specific gene expression from the rice tungro

bacilliform virus RTBV promoter (Yin et al., 1997a). The same motif was found in the

promoters of GS3A (Brears et al., 1991), the Arabidopsis plasma membrane H+-ATPase gene

(AHA3; DeWitt et al., 1991), a potato invertase gene (Hedley et al., 2000) and the Rplec2

(Yoshida et al., 2002). Sequences matching the consensus sequence of the GATA motif,

A(N)3GATA, were found at –1788 (ATATGATA), –497 (AATGGATA) and –154 (ATATG

ATA) in the vff1 promoter (Table III-2).

DraI HpaI MscI SspI M 1 2 M DraI HpaI MscI SspI 1 2

Primary PCR Secondary PCR

3054

506

bp


57

Table III-2 Sequence comparison of GATA motifs present in the vff1 promoter and other phloem-specifc promoters

Promoter Sequence Position Origin vff1 ATATGATA –1788 Vicia faba AATGGATA –553 ATATGATA –210 Rplec2 ACATGATA –561 Robinia pseudoacacia AATTGATA –224 ATTTGATA –186 RTBV AGAAGATA –143 RTBV GS3A ATTAGATA –589, –557, –366 Pisum sativum AAGTGATA –201 AGTAGATA –115 AHA3 ACATGATA –294 Arabidopsis thaliana AGACGATA –166 AGATGATA –126 Nucleotides conserved between the promoters are underlined. Positions of sequences are indicated relative to the transcription start sites.

Another phloem specific motif of 13 bp in length was identified which has been described to

be highly conserved among four phloem-specific promoters (Hehn and Rohde, 1998),

originating from a pea glutamine synthase gene (GS3A), coconut foliar decay virus (CFDV),

rice tungro bacilliform virus (RTBV), and an Agrobacterium rhizogenes rolC gene as well as

the a Robinia pseudoacacia inner-bark lectin gene (Rplec2; Yoshida et al., 2002). In the vff1

promoter, a sequence that showed 69% homology with the 13 bp motif of the CFDV, GS3A

and RTBV promoters was located 524 bp upstream of a TATA box (Table III-3). Taken all

together, the occurrence of several elements specific for expression in the phloem is

noteworthy.

Table III-3 Sequence comparison of the 13 bp motifs present in the vff1 promoter and other phloem-specific promoters

Promoter Sequence Distance from Origin TATA box (bp) vff1 ATAAGGAGGAACA 524 Vicia faba CFDV ATAAGAACGAATC 169 CFDV GS3A ATAAGACAGAATC 255 Pisum sativum RTBV TTAAGTACGAATC 129 RTBV Rplec2 ATTAGAAAGAAAA 238 Robinia pseudoacacia rolC TTAAGTACAGACA 123 Agrobacterium rhizogenes

Nucleotides conserved in at least four promoters are underlined.


58

CAAT BOX1

GATA BOX

Asc I

Nco I

TATA BOX

GGCGCGCCTTACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGTAACTATAAAACTTTTTTCTTCATCAAAAA

CCCTAAAAACAATTTCTCCTTCATTTTTATATTTTATGCATAATTATTATTGTAATTCATATTCAATGGTTTGTA ATAATAATTAGTACTTTATTGCTTTCTTCCCCCTATTCACAAAATTGTACCCCTCATTCCTAAAGCGTTGTAATA ACATATGATATTTAAATTCTGCAATTTATCGCTTTCGAGTAATTAGGATTTGCATGACAAGACTAAAACCAAACC ATAGAAAACCATAATTCAAAGATAACATATATGAAAATAAAACACTTTGCACACTTGCACCTCTAGGGTAACTCA CACTTATTGCCTCGGATATAAACAGTCATGTCTCTCGAATGTGAGATGTTTTAGCAAAGACCCTCGATGAAAGAT CGTAGTTCCTCGATGACCCTTCAATGTTGTCTTCGGTAAACGATCTTAGTCCCTTATGACAATTTCTAAAACATC TTACAAGTTGTCTTCTATGACTGATGATATGGTTCTCTATCAATCAATGGTAATATAGTACTATCTAAAGGAGGA TGAAAATAACAAAGACTTTTTGAGTAGGTAGATTGCTCGTAATTGCTTGCTCACAAACAAAATCATTCCACACCT CACTTTCAAAATACTTTCCAAAACAAACATTTTGTATACATTCTCAACGATAAGAGAACCATTACAAAATTGCTT ACATTGACATTTTCAAAGCATCTTTCCAAAACACTCTTTTTAACAAATATTTTCAAAACTAACACTTTGTATACA TTCTCAACGATGCGAGAATCATTGCAAAGTTTTCTAAACTTAGGCGTTTTCAAAATATTTTCAAACTTACACAAA CACAAAGTATTTCAAAGTGAGCTAGCAATTAAGTGTACTACATTCTCAACGATGCGAGAATCATTGCAAAGTTTT CTAAACTTAGGCGTTTTCAAAATATTTTCAAACTTACACAAAAACAAAGTATTTCAAAGTGAGCTAGCAATTAAG TGTACTACGGATGAAAATGGTACTAACACATTCATTTTTCATAACCTACCCCGAACTCAAGAAAATTCTCAAAAG GGGGTATTTCGTATTCTTTTTACCCTTTTCTTTATTAGATAAAAGAAAAGTCAGTGGTGACTCTTGCTATCCGCA ATATTTGCGATAAAACACAAAACAATCAAGTCAATTCTCCCACTATATTATGCTATTATATTTAGTTTNTAAGA CATCATTTTTCACAACAATAGAAATGAAACAACTCAAACTTATATAACCAAACCATGCAACAAATTGATGGCTAT AATGTAAACACAAAATCTCTCTTTCATAAGTTCACCAAAAAATACTCACGTATTTTCAATTCCATTTTCTATAAA CGTTAATGTTTGTCCTTTTGTCTCTCTCCACATAAGGAGGAACATTTATGTGGACCAAATATTTAAAGGGTATGA TTCCTTATATAATATTTAATAATGGATAGTATGATTCTTGACTTGTAGATATGTTGATTCAATCTATAAGACAAA ATCTAAAATAAGACAAAATTTGAAGAACTAATTAATAAATAAAATAAAATTTGATTCGATTAAAACCATCGGTAC TTTCCTTCAATAATATAGTTATATAAAAAAATGAAATAGTAGTAATAGTATATGTCTATCTCTTTACTCTTCCCA AAAGCTGAGGGTTGGCATTATTCTCTTGATAGAGTTGCTTCAATTAATTAACGTAAAGGAATGGGGTATGTTAGA ACAACAAATCATTGCAGCGAGTTTCACGTTTTGAGACCATATGCATTAGATTCAGATGCTACTATATGATAACAT TGTCTTTTGTTTTGATAAGAATAAAATAATAACTTTAGTTTCATTACACACTTCCATTCCTTGACACATGGTATC AAATCAAACGTCTCTTAAACTCTCATGCATTCTTCCACACTATAAATAAGTTATGCAACTTCACCAACCAATCC* accattcttaaaccaaacctaagaagtgttactac ttctctgaaatttgagtcaccATGGTGACTCAAATTTCAGAGAA Figure III-17 Nucleotide sequence of vff1 promoter and the 5’-flanking region of the vff1 gene. Two genomic DNA fragments, corresponding to the vff1 gene 5’-flanking region, were amplified by a PCR-mediated genome-walking technique (II.2.6.4) using DraI, HpaI, MscI and SspI digested Vicia faba genomic libraries, respectively. Both DNA fragments were cloned into pCR®2.1-TOPO (Invitrogen) vector and sequenced (II.2.7.6). The DNA sequence of the 2.7kb product is shown. The ATG start codon is highlighted by reverse shading and the 5’UTR, obtained by RACE analysis, is indicated in small letters. The predicted TATA-box and transcription initiation site are highlighted by a square and an asterisk, respectively. Putative cis-elements, CAAT Box1 and GATA motif-like elements are boxed and the GATA and 13 bp phloem-specific-element-like motifs are indicated in red letters. Nucleotides conserved between phloem specific GATA (Table III-2) and 13bp motifs are indicated in bold letters (Table III-3). The sequences used to design specific primers for cloning the putative promoter sequence (II.2.6.4) are highlighted in bold, and their positions are indicated by arrows.

III.2.4 Characterization of vff1 promoter in transgenic tobacco

III.2.4.1 Cloning of vff1 promoter into the pTRAk-GUS vector

To characterize tissue specificity of vff1 promoter expression, the 5’-upstream region of this

gene (-2070 to +1) was cloned into a promoter-less vector encoding a GUS gene to create a

reporter vector designated pTRAk-vff1P:GUS (Figure III-18). The vff1 promoter sequence in

the 5’-upstream region of vff1 gene (-2070 to +1) was amplified using forward (5’-


59

TTGGCGCGCCTTGACTTGTAGATATGTTG-3’) and reverse (5’-TTGGCGCGCCTCTAT

AAACGTTAATGTTTG-3’) primers, which contained AscI and NcoI restriction enzyme sites

at their 5’ ends. The obtained PCR products were digested with AscI and NcoI and cloned into

the shuttle vector pTRAk-GUS containing the uidA (GUS) gene. The pTRAk-GUS vector

was constructed as follows: the GUS-terminator cassette (~2,1 kb) was excised from pUC103-

GUS with NcoI and XbaI and subsequently subcloned into NcoI and XbaI sites in pTRAktrfP

binary vector (Thomas Rademacher, Institut für Biologie VII, RWTH Aachen, Germany)

replacing the DSRed gene. The CaMV 35SS promoter was removed from the pTRAktrfP

vector by excision with AscI and NcoI restriction enzymes and replaced with the putative vff1

promoter in order to drive the expression of the GUS gene.

Figure III-18 Strategy for cloning the vff1 promoter-Gus expression cassette into pTRAk. Promoter fragment was ligated upstream of the Gus coding sequence as transcriptional fusion. P35S: 35S promoter from CaMV with duplicated enhancer; pA35S: 3' UTR of CaMV; GUS: uidA coding region.

The correct sequence of the construct was confirmed by sequence analysis (II.2.7.6) and the

plasmid DNA was introduced into Agrobacterium tumefaciens strain GV3101 by

electroporation (II.2.9.2). A. tumefaciens harbouring this reporter-gene cassette were used for

transformation of N. tabacum cv. Petite Havana SR1 plants (II.2.10). A plant expression

vector pTRAk containing the uidA gene driven by a doubled enhanced constitutive 35S

promoter from the Cauliflower mosaic virus (CaMV; Kay et al., 1987) was used as positive

control. The obtained recombinant clones were analyzed for the presence of the cDNA insert

AscI

3’

3’ pTRAk-35SS:DSRed NcoI XbaI AscI

5’ Dsred pA35S 35SS

3’ pUC 103:GUS NcoI XbaI

5’ GUS pA35S 35SS

vff1P

pTRAk-35SS:GUS NcoI XbaI 5’

GUS pA35S 35SS

AscI

3’ pTRAk-vff1P:GUS NcoI XbaI

5’ GUS pA35S vff1P

AscI

NcoI/XbaI digestion

AscI/NcoI digestion PCR amplification followed by AscI/NcoI digestion

AscI NcoI


60

by colony PCR with vector- and vff1 promoter- specific primers and glycerol stocks (II.2.9.4)

were prepared for both recombinant A. tumefaciens strains.

III.2.4.2 Expression of vff1 Promoter-GUS fusions in tobacco plants

Vectors encoding the uidA gene driven by the vff1 promoter were transferred via

Agrobacterium transformation into N. tabacum as a model species. The promoter activity of

the GUS fusions was evaluated in stably transformed kanamycin-resistant plants by

histochemical staining. GUS activity was assayed on sections of leaves and thin cross-

sections of tobacco leaves, stem, roots and flowers (II.2.10.6), and confirmed at different

stages of development, either on plantlets grown in vitro or on greenhouse-grown mature

plants. The primary transformants showed detectable levels of GUS activity. The same pattern

of cell-specific expression for vff1P-GUS in transgenic tobacco plants was observed for three

independently transformed plants. In addition to regenerated T0 plants, the selfed T1 progeny

(five plants for each transformant) were similarly tested for their GUS expression patterns and

the same results were obtained. Hence, it was demonstrated that GUS expression dictated by

the vff1 promoter in transgenic tobacco plants was transmitted to the next generation. The

integration of the transgenes in the plant genome was further confirmed by PCR on individual

T1 progeny plants using primers directed against the vff1 promoter (data not shown).

III.2.4.2.1 Tissue specificity of vff1 promoter in transgenic plants

Histochemical staining for GUS activity showed that the developmental expression of vff1

promoter-GUS fusions was concentrated in the vascular tissues of all transgenic tobacco

organs, including leaves, stems, roots and reproductive organs. A similar vascular pattern was

observed both on plants grown in vitro and in the greenhouse, at different stages of

development (data not shown).

The expression of GUS activity was observed in stems of vff1P-GUS transformed tobacco

plants (Fig. III-19A, B and C). A special feature of tobacco stem is that it contains two groups

of phloem tissues – the internal and external phloem – which are located along the two sides

of the xylem. Most other dicotyledonous plants only have external phloem. Stems sections

from first internodes of 6-week-old vff1P-GUS tobacco plants showed GUS activity restricted

to both types of phloem cells but not in any other cell types of the stem, including epidermis,

xylem, and ground tissue cells of pith and cortex (Fig. III-19A). At a higher magnification

(Fig. III-19B), the cellular localization of GUS activity was found to be highly specific. A

group of three to four cells residing at the center of phloem tissue clusters were highly stained

whereas the adjacent phloem parenchyma cells and vascular cambium cells show little or no

stain. The remaining cell types of the vascular cylinder, including xylem fiber, xylem

parenchyma cells, pith parenchyma cells, pericyle, and endodermis cells were not stained.


61

It was observed that two to three pairs of sieve elements and companion cells were localized

at the center of each phloem tissue bundle, and GUS activity was only visible in the

companion cells (Fig. III-19C). In addition, a faint GUS activity was also observed in some

sieve elements of young phloem tissue (data not shown).

Figure III-19 Expression of vff1 promoter-GUS fusions in transgenic tobacco. Histochemical analysis of GUS activity in transgenic tobacco plants harbouring the 2070-bp vff1 promoter::GUS construct revealed a vascular-specific acivity of the vff1 promoter. A, thin-cross-section of stem indicating the GUS activity in the adaxial (adp) and abaxial (abp) layer of cortex (internal and external phloem, respectively); B, higher magnification of a cryocross-section of stem with a similar pattern of staining in vascular cylinder; C, companion cell (CC)-specific activity of the vff1 promoter. The GUS activity is absent from all other cells including sieve element (SE) and phloem parenchyma (PP). D, leaf sections showing a phloem specific expression of the reporter gene in the midrib (mr) and lateral veins (lv); E, higher magnification (x4) view of the leaf. F, cryocross-section (50µm) of petiole showing the GUS activity in the adaxial (adp) and abaxial (abp) layer of cortex. For cytological observations, after GUS staining with X-gluc and clearing in 70% ethanol (II.2.10.6), stained sections were visualized with a Leica microscope Typ:DMLFS (Leica, Wetzlar, Germany) with a JVC camera Typ: TK-C1360 (Tokio, Japan). Pi, pith; C, cortex; vc, vascular cambium; e, epidermis.

Phloem cell-specific expression of vff1::GUS activity was also observed in flowers in the

inflorescence meristem and young floral buds (Fig. III-20A). In young flowers and at the

distal tip of floral organs the reporter gene expression was also evident (data not shown). In

later stages, expression was localized to developing ovules (Fig. III-20B).

X

ad P

ab P

mr

lv

lv

mr

PP

SE

CC

X

B C

D E F

ad P

ab P

X

A

X

ad P

ab P

PiC

vc

e

lv

X

ad P

ab P

mr

lv

lv

mr

PP

SE

CC

X

B C

D E F

ad P

ab P

X

A

X

ad P

ab P

PiC

vc

e

X

ad P

ab P

mr

lv

lv

mr

PP

SE

CC

X

B C

D E F

ad P

ab P

X

A

X

ad P

ab P

PiC

vc

e

lv


62

Figure III-20 Expression patterns of vff1 promoter-GUS fusions in transgenic tobacco flowers. Histochemical analysis of GUS activity (II.2.10.6) in transgenic tobacco flowers (II.2.10.4) revealed a phloem cell-specific expression of the vff1 promoter. A and B, thin-cross sections (II.2.10.6) of flower organs. The GUS activity is localized in the inflorescence meristem (A) and in the developing ovules (B). Stained sections were visualized with a Leica microscope Typ:DMLFS (Leica, Wetzlar, Germany) with a JVC camera Typ: TK-C1360 (Tokio, Japan).

To analyse the expression pattern in more detail, promoter-GUS studies were performed on T1

vff1P-GUS tobacco seedlings. After kanamycin selection of primary transformants (T0) the

plants were cultivated in the greenhouse. Self-fertilized seeds were collected from T0 plants

and were germinated on MS medium with kanamycin and the seedlings (T1 progeny) were

grown in vitro. GUS enzyme activity could be detected in different tissues of the seedlings but

not in cotyledon tissue, (Fig III-21A). Vff1::GUS roots showed the strongest staining for GUS

activity in dividing meristematic tissues (Fig. III-21D). As root development proceeded

through the zones of elongation and maturation, GUS activity become progressively restricted

to the stele. GUS activity was significantly reduced but still restricted to vascular tissues in

older roots (data not shown). In contrast, strong GUS activity was clearly detected in

vff1::GUS tobacco during the early stages of lateral root development. In lateral roots of those

plants, GUS activity was detected in the meristematic and elongation zones of vascular tissue

(Fig. III-21C, E and F).

Strong GUS activity was also detected in the first leaves and shoot apical meristem of

vff1::GUS seedling suggesting a preferential expression of vff1 promoter in developing

vascular tissue and especially in young phloem tissue of tobacco plants. Examination of the

root-shoot transition zone of vff1::GUS plants showed that GUS activity in the stele continue

as vascular bundles emerged in the stem (Fig. III-21B).

These results indicate (Fig. III-19-21) that the vff1 promoter directs a phloem-specific

expression of the GUS gene in transgenic tobacco plants. However, it is important to show

that the results are not due to differential staining anomalies. For comparison, transgenic

tobacco plants transformed with the same GUS gene but with a different plant gene promoter

were tested under identical conditions for the GUS assay. As expected, control transgenic

plants obtained with the p35SS::GUS construct exhibited GUS activity in all organs and

A B


63

tissues (data not shown), including cortex, phloem, xylem, pith tissue, trichomes and

mesophyll cells in aerial and root organs as previously reported (Odell et al., 1985). The

experiments confirm that the phloem cell expression pattern observed for vff1P-GUS

transgenic plants is highly specific and is not due to some unknown factors that may

differentially affect activity staining in our GUS assay.

Figure III-21 Vff1 promoter expression pattern in vff1P::GUS transgenic plants. Histochemical localisation of GUS activity in vff1P::GUS N. tabacum seedlings. GUS activity is indicated in transgenic tissue by an indigo dye precipitate after staining with X-Gluc. (A). twelve-day-old tobacco seedling grown on MS medium with staining in the leaves and at the base of cotyledons. (B) shoot apex of a 12-day-old seedling at higher magnification. (C) GUS staining throughout root apical meristem and lateral root. (D) Root apical meristem GUS activity in the meristematic and elongation zones. (E) GUS activity in lateral roots from seedlings. (F) GUS activity in growing lateral root. am, root apical meristem; c, cotyledon; e, elongation zone; l, leaf; lr, lateral root; m, meristematic zone; s, shoot.

III.2.4.2.2 Developmental regulation of vff1 promoter in transgenic plants

To determine if the vff1 promoter activity is developmentally regulated, T1 vff1P-GUS tobacco

seedlings were used to determine the expression pattern at different maturation stages.

In developing leaves there is a basipetal gradient in maturity, the distal end being more mature

than the base. The first evidence of GUS staining was visible near the leaf base, where the

tissue was more immature (Figure III-22). In young leaves, minor vein staining began at the

lamina base and progressed towards the tip as the leaves aged, in an opposite pattern as the

sink-source transition of photoassimilate transport (Turgeon, 1989). With increasing maturity,

staining becomes progressively restricted to regions of class-I, then to class-II veins, and to

A

B F D E

l

c

e

m

e

s

C

am

lr

A

B F D E

l

c

e

m

e

s

C

am

lr


64

isolated regions of class-III veins. Staining became progressively less intense in the more

distal (mature) regions of the leaf. The onset of the sink/source transition in expanding leaves

seemed to delimit the staining towards the apical portion of the leaf (Figure III-22).

Figure III-22 Expression pattern of vff1 promoter in immature veins of leaves. A progressive and opposite, basipetal (tip-to-base) staining pattern in midrib and minor veins is evident in the three developing leaves, the most mature of which is stained in only the base while the following in maturity is stained to approximately the midway point. Basipetal maturation is a characteristic of features associated with the sink-to-source transition in leaves. Leaf tissue near the tip of a growing leaf that has completed the sink-source transition shows no staining. am: apical meristem of root; c: cotyledon; l1: first pair of leaves; l2: staining pattern in sink leaf; l3: staining pattern of immature veins in the proximal region of a leaf undergoing the sink-source transition.; l4: leaf in a late stage of the sink-source transition. Figure III-23 Expression pattern of vff1 promoter in veins of mature tobacco leaves. A, mature leaf tissue indicating a most apparent staining in class-I and class-II veins. The dye can also be seen in some patches of class-III veins. B, in class-III veins the staining is mainly localized in the junctions with class-IV veins (arrow). Class-V veins are not stained. Stained sections were visualized with a Leica microscope Typ:DMLFS (Leica, Wetzlar, Germany) with a JVC camera Typ: TK-C1360 (Tokio, Japan).

c

l4

l2

l3

l1

amc

l4

l2

l3

l1

am

I II

III

II

III

IV

V

A B

I II

III

II

I II

III

II

III

IV

V

III

IV

V

A B


65

1 2 3 4 5 6 7 8 9 10 11 12 13 M

3054

506

bp

In mature leaves GUS activity was only detected in class-I (midrib) veins, and class-II veins

(branching from the midrib) (Figure III-23A). Class-III veins, which define large segments of

the vein network, were often stained. Staining was first evident in isolated patches of class-III

veins, often at branch points where class-IV veins merged with them (Figure III-23B). Class-

V veins being the most extensive in the leaf did not stain (Figure III-23B). Staining decreased

in intensity toward the finest veins. No staining was detected in mesophyll cells.

It was also noted that damaged tissue demonstrated intense staining in the wounded area,

presumably because GUS enzyme was released from the minor veins into the apoplast (data

not shown).

III.2.4.3 Deletion analysis of vff1 promoter in transiently transformed tobacco leaves

The resulting GUS activity in transgenic tobacco plants revealed that the DNA fragment

display phloem-specific promoter activity (III.2.4.2.1; Fig. III-19-21). This result suggests

that the cell-specific elements may be present in this sequence. To localize the responsible

elements/motifs for phloem-specific promoter activity, a series of thirteen truncated promoter

fragments (P-pTRAk-1 to P-pTRAk-13), starting from nucleotide -2070 to nucleotide -543 of

the upstream sequence, and ending in the first ATG of the coding region, were prepared by

PCR (Fig. III-24). The correct sequences of the promoter fragments were confirmed by

sequence analysis (II.2.7.6) and cloned unidirectional into a promoter-less GUS reporter

vector, pTRAk-GUS, and the fusion promoter-GUS constructs were transiently expressed in

Nicotiana tabacum SR1 plants (II.2.10.1) with the phloem-specific Coconut Foliar Decay

Virus (CFDV) promoter (Hehn und Rohde, 1998) as the positive control. Three to five

independent transient expressions were performed. Nevertheless, among all the PCR-

generated fragments there was no substantial difference in GUS activities.

Figure III-24 PCR amplification of truncated vff1 promoter-GUS fusions fragments. Different lengths of the vff1 promoter, starting from nucleotide -2070 to nucleotide -543 of the upstream sequence, and ending in a 5’ position relative to the ATG start codon of the vff1 coding region, were ligated with the uidA gene. Lanes 1-13: PCR amplification products (II.2.7.3) of the promoter fragments using P-pTRAk-1 to P-pTRAk-13 specific primers (Table II-2), separated on a 1.2% (w/v) agarose gel (II.2.7.4). Lane M: 1Kb DNA ladder (Invitrogen).


66

III.3 Bacterial expression and characterization of VFF1

III.3.1 Cloning of vff1 into the bacterial expression vector pGEX-5X-3

For the production of recombinant VFF1 protein in bacteria the entire vff1 cDNA (III-1.6) as

well as partial fragments (amino/carboxy terminus, center part) were amplified by PCR from

a Vicia faba RACE-Ready cDNA population (II.2.6.1). Oligonucleotides specific to the 5' and

3' end of vff1 (II.2.6.2) were used to obtain its full-length cDNA. Oligonucleotides used in the

PCR amplification of the N-terminal (+1 to 1317bp), center- (649 to 1707bp) and C-terminal

(1317 to 2056bp) domains as well as of the entire vff1 cDNA are shown in Table II-4 (II.1.8).

Restriction sites NcoI and NotI were introduced into the forward and reverse oligonucleotides

for cloning into pGEX-5X-3 bacterial expression vector (II.1.7.1 and II.2.6.2). The PCR

products were subsequently ligated into the NcoI/NotI sites of pGEX-5X-3 vector and verified

by sequence analysis (II 2.7.6).

III.3.2 Bacterial expression and purification of VFF1

In order to obtain VFF1 protein for immunization, the amplified sequences were fused to the

C-terminus of GST and expressed in E. coli BL21λDE3 (II.2.11.1) (Fig. III-25).

Figure III-25 SDS-PAGE and immunoblot analysis of affinity purified GST fusion proteins. Vff1 cDNA as well as its amino/carboxy terminus and center domains were subcloned into the pGEX-5X-3 vector (II.1.7.1 and II.2.6.2) and expressed in the E. coli strain BL21(λDE3) upon induction with IPTG. The cytoplasmic overexpressed fusion proteins were purified by glutathione affinity chromatography. Protein were separated on a 12 % (w/v) SDS-PAA gel and stained with Coomassie brilliant blue (A) (II.2.12.2) or blotted onto nitrocellulose membrane (B) (II.2.12.4). Immunodetection was carried out using 1:5000 diluted anti GST monoclonal antibody and GAMAP polyclonal antibody (1:5000). Detection was performed with NBT/BCIP for 1 min at RT. M: 5 µl of Prestained Protein Marker. 1: 10 µl of GST-VFF1-C-domain elution fraction; 2: 10 µl of GST-VFF1-M-domain elution fraction; 3: 10 µl of GST-VFF1-N-domain elution fraction and 4: 10 µl of full-length VFF1 elution fraction. N-domain: N-terminal protein domain, C-domain: C-terminal protein domain, M-domain: central potein domain.

VFF1

M 1 2 3 4 1 2 3 4Kda

13010072

55

40

33

24

VFF1

C-domain

A B

N-domainM-domain

VFF1

M 1 2 3 4 1 2 3 4Kda

13010072

55

40

33

24

VFF1

C-domain

A B

N-domainM-domain


67

The GST fusion proteins contained a Factor Xa cleavage site for removal of the GST fusion

part. When protein expression was induced with 1 mM IPTG at 30°C most of the fusion

proteins were produced as insoluble inclusion bodies (data not shown). To improve the

solubility of recombinant VFF1 protein (and subdomains) the following conditions were

employed: i. increase of culture volume to 4l, ii. decrease of IPTG concentration to 0.1 mM,

iii. decrease in the growth and induction temperatures from 30°C to 16°C after induction and

iv. increase of induction time to 12 hs. Another attempt to improve the yield of overexpressed

VFF1 was a step-wise inactivation of the proteases by increasing the temperature to 42°C for

1h, performed to minimize the degradation of the fusion proteins. Nevertheless, there was no

significant increase in the yield of the overexpressed fusion proteins even seeming to induce

the formation of inclusion bodies (data not shown).

The analysis of the elution fractions by SDS-PAGE (Figure III-25A) revealed the presence of

bands which sizes corresponded with the expected molecular weights of 104, 70, 67 and 60,3

kDa of the GST fusion full-length, N-terminal, C-terminal and center protein domains,

respectively.

Following the elution steps, a significant amount of the overexpressed fusion protein

remained bound to the matrix (Figure III-26, line 2). However, affinity purified fusion

proteins showed high purity in Coomassie-stained SDS-polyacrylamide gels (Figure III-26).

After purification, the elution fractions were dialyzed overnight in 1XPBS buffer and the final

protein concentration was determined by SDS-PAGE (II.2.12.2) using BSA of known

concentration as a standard (data not shown). The amount of purified GST-VFF1 ranged

between 0.7-100 µg per L culture volumes. Cleavage of the Forisome fusion protein from the

GST domain with Factor Xa was not successful probably due to an almost complete

degradation of the overexpressed protein (data not shown).

Figure III-26 SDS-PAGE analysis of affinity purified GST fusion VFF1. Affinity purified VFF1-GST fusion protein obtained from the GST expression system was resolved on 12% (w/v) SDS-PAA gel followed by staining with Coomassie brilliant blue (II.2.12.2). 1: 5 µl of sonified E. coli BL21(λDE3) cells containing the pGEX-5x-3 plasmid harboring VFF1-GST; 2: 5 µl of Glutathione sepharose 4B from AmershamPharmacia Biotech used for purification of GST fusion proteins; 3: 10 µl of the first elution fraction of VFF1-GST fusion protein; 4: 10 µl of the second elution fraction of VFF1-GST fusion protein; M: Prestained Protein Marker.

M 1 2 3 4

175

8362

47,5

32,5

25

Kda

GST-VFF1

16,5

M 1 2 3 4

175

8362

47,5

32,5

25

Kda

GST-VFF1

16,5


68

Figure III-27 SDS-PAGE and immunoblot analysis of affinity purified recombinant VFF1. VFF1 cDNA was subcloned into the pGEX-5x-3 vector and overexpressed at a 4-liter fermentation scale (II.2.11.2) in the E. coli strain BL21(λDE3) upon induction with IPTG. The expressed fusion protein was purified using a Glutathione sepharose matrix. Proteins were separated on a 12 % (w/v) SDS-PAA gel and either stained with Coomassie brilliant blue (A) (II.2.12.2) or blotted onto nitrocellulose membrane (B) (II.2.12.4). Immunodetection was carried out using 1:5000 diluted anti GST monoclonal antibody and GAMAP polyclonal antibody (1:5000). Detection was done with NBT/BCIP for 1 min at RT. P: 5 µl of pellet; SN: 5 µl of cytoplasmic extract; FT: 5 µl of flow trough; W: 10 µl of wash fractions; C: 5 µl of matrix; E1, E2, E3, E4: 10 µl of elution fractions; M,c: 5 µl of Prestained Protein Marker together with 100 ng of GST protein as control.

With the aim to increase the yield of recombinant VFF1 protein fermentation at 4-liter scale

was carried out (II.2.11.2). The result of SDS-PAGE and immunoblot analysis of the elution

fractions of the affinity purified VFF1 are shown in Figure III-27 (A) and (B), respectively,

and revealed the presence of a band of approximately 100 kDa corresponding to the

calculated molecular weight of 104 kDa. A significant amount of other co-eluted bands were

also present on the Coomassie stained SDS-PAA gel. The most prominent co-eluted bands

run in a range between the molecular sizes of 24 and 33 kDa. These co-eluted proteins were

detected by immunoblot analysis demonstrating that these proteins probably representing

degradation forms of the recombinant VFF1 protein. As GST is known to induce dimerization

of proteins (Lim et al., 1994), upper bands were also immuno detected.

Attempts to purify soluble GST-tagged VFF1 (MW 104 kDa) at a fermentation scale with the

above mentioned parameters gave no improvements (Figure III-27). Therefore, gel slices from

the corresponding single band of recombinant GST-VFF1 fusion protein band were excised

from the SDS-PAA gel and send for polyclonal antibodies production in rabbits to

EUROGENTEC (Seraing, Belgium).

III.3.3 Characterization of GST-VFF1 fusion protein by immunoreativity toward

Forisome-specific mouse and chicken antisera

To assess whether the recombinant VFF1 proteins were recognized by the Forisome-specific

mouse and chicken antisera an immunoblot analysis was performed. Hence, the different

bacterial expressed VFF1 fragments together with 5 µg of isolated Vicia faba Forisomes as

P SN FT W C M,c E1 E2 E3 E4 P SN FT W C M,c E1 E2 E3 E4

130

Kda

10072

55

40

33

24

130

Kda

10072

55

40

33

24

A B

P SN FT W C M,c E1 E2 E3 E4 P SN FT W C M,c E1 E2 E3 E4

130

Kda

10072

55

40

33

24

130

Kda

10072

55

40

33

24

130

Kda

10072

55

40

33

24

130

Kda

10072

55

40

33

24

A B


69

positive control were used to assay their immunoreactivity. None of both preimmune sera

recognized either the recombinant fusion proteins or the isolated Forisome proteins from

Vicia faba (data not shown).

As shown in Figure III-28A, only co-eluted proteins were detected by immunoblot analysis

with the mouse antiserum. These proteins turned out to be not degraded forms of the GST-

VFF1 but unrelated bacterial contaminants as confirmed by the presence of the same pattern

of bands in a cytoplasmic extract of E. coli (data not shown). However, the immunoblot

analysis with Forisome-specific chicken antiserum indeed revealed the presence of bands at

the expected sizes of 104, 70, 67 and 60,3 kDa for the GST fusion VFF1 and N-terminal, C-

terminal and center- protein domains, respectively. It was also observed a strong reaction

against low molecular weight fusion proteins (Figure II-28 B, lanes 1 and 2). Nevertheless, no

cross hybridization of the Forisome-specific chicken antiserum to GST proteins could be

detected (data not shown) demonstrating that these proteins were degraded or perhaps

truncated forms of VFF1 recombinant protein. This result indicates that the Forisome-specific

chicken antibodies are recognizing epitopes present on the recombinant protein suggesting

that the isolated vff1 gene may encode one of the proteins involved in the constitution of Vicia

faba Forisomes.

Figure III-28 Characterization of GST-VFF1 fusion protein by immunoreactivity against Forisome-specific mouse and chicken antisera. GST fusion VFF1 together with the N-terminal, C-terminal and center- protein fragments of vff1 cDNA were subcloned into the pGEX-5x-3 vector and overexpressed at a 4-liter fermentation scale (II.2.11.2) in the E. coli strain BL21(λDE3). Proteins were separated on a 12 % (w/v) SDS-PAA gel (II.2.12.2) and electroblotted onto a nitrocellulose membrane (II.2.12.4). (A) Immunoreactivity of recombinant proteins toward Forisome-specific mouse antisera (dil. 1:2000). Immunodetection was performed with GAMAP(H+L) polyclonal antibodies (dil. 1:5000). (B) Immunoreactivity of the recombinant proteins toward Forisome-specific chicken antisera. Immunodetection was performed with RACAP(Fc) polyclonal antibodies. Detection was done with NBT/BCIP for 2 min at RT. 1: 10 µl of full-length VFF1 elution fraction; 2: 10 µl of GST-VFF1-N-domain elution fraction; 3: 10 µl of GST-VFF1-M-domain elution fraction; 4: 10 µl of GST-VFF1-C-domain elution fraction; F: 5µg of isolated Forisomes from Vicia faba; M: 5 µl of Prestained Protein Marker.

13010072

55

40

33

24

Kda1 2 3 4 M F

A

13010072

55

40

33

24

Kda

B

1 2 3 4 M F

13010072

55

40

33

24

Kda

13010072

55

40

33

24

Kda

13010072

55

40

33

24

Kda1 2 3 4 M F

A

13010072

55

40

33

24

Kda

13010072

55

40

33

24

Kda

B

1 2 3 4 M F


70

III.4 Immunological characterization of native and recombinant Forisomes

III.4.1 Reactivity of polyclonal anti-GST-VFF1 antibodies to isolated Forisomes

Preliminary immunoblot analysis (III.3.3) confirmed that polyclonal Forisome-specific

antibodies recognized epitopes located on both, isolated Vicia faba Forisomes and

recombinant VFF1 protein. As an attempt to demonstrate that the protein encoded in the vff1

gene is present in the Forisome protein-complex, rabbit polyclonal antibodies raised against

the recombinant protein were subjected to immunoblot analysis against native Vicia faba

Forisomes. Since the attempts to purify soluble GST-VFF1 gave no improvements and the

cleavage of the Forisome fusion protein from the GST domain with Factor Xa resulted in a

significant loss of protein, gel slices from the corresponding single band were excised from

SDS-PAA gel. These denatured antigens were send for polyclonal antibodies production in

rabbits to EUROGENTEC (Seraing, Belgium).

Figure III-29 Immunoblot analysis of Vicia faba isolated Forisomes and recombinant VFF1 fusion protein using VFF1 specific rabbit antiserum. Specific binding of VFF1 rabbit anitserum (II.2.13.3) to isolated Vicia faba Forisomes (II.2.1) and overexpressed VFF1 (II.2.11.1) was characterized by immunoblot analysis. Proteins and either stained with Coomassie brilliant blue (II.2.12.2) (A) or blotted onto nitrocellulose membrane (II.2.12.4) followed by immunoblot analysis (II.2.12.4) (B). Immunodetection was carried out using 1:500 diluted anti GST-VFF1 rabbit antiserum and GAR(Fc)AP polyclonal antibody (1:5000). Detection was done with NBT/BCIP. 1: 10µl of cytoplasmic extract without IPTG induction; 2: 5µl of cytoplasmic extract after IPTG induction; E: 10µl of overexpressed VFF1elution fraction; F: 5µg of isolated Forisomes from Vicia faba; M: 5µl of Prestained Protein Marker; GST: 100 ng of GST protein as negative control.

To assess whether the recombinant VFF1 indeed expressed in the E. coli strain BL21(λDE3)

only upon IPTG induction, an SDS-PAGE analysis was performed. A sample of cytoplasmic

bacterial extract before and after IPTG induction was subjected to gel electrophoresis

confirming that there was no basal expression of the recombinant protein.

130

100

72

55

40

33

24

Kda1 2 E F M GST

A

130

100

72

55

40

33

24

Kda1 2 E F M GST

B

130

100

72

55

40

33

24

Kda

130

100

72

55

40

33

24

Kda1 2 E F M GST

A

130

100

72

55

40

33

24

Kda

130

100

72

55

40

33

24

Kda1 2 E F M GST

B


71

The result shown in Figure III-29 confirmed that the VFF1 rabbit antiserum binds highly

specific to the isolated Vicia faba Forisome protein confirming that the vff1 gene encodes a

protein involved in the constitution of Forisomes. A striking observation was the absence of a

positive signal against the recombinant fusion protein used as the antigen for immunization.

This fact raised compelling questions whether the epitopes recognized on the isolated

Forisomes are exposed in the bacterial expressed protein when running through the gel.

Presumably, the VFF1-specific antibody was unable to interact with the adopted conformation

of the fusion protein under reducing conditions.

Cross-reactivity to GST could not be excluded since a low binding activity to the GST antigen

was observed. This result shows that the fusion partner elicited a response during the

immunization. Nevertheless, the presence of specific polyclonal antibodies against VFF1

dominated the immunoresponse. The pre immune serum recognized neither the recombinant

fusion proteins nor the isolated Forisome proteins from Vicia faba (data not shown).

It is interesting to note that antibodies raised against the recombinant protein detected the

>100-kDa bands revealed by Coomassie staining (Figure III-1) as well as the additional bands

in the range 50-70 kDa. Since the vff1 sequence predict a protein of 79 kDa, all higher

molecular weight bands are likely to be multimers representing partially assembled Forisomes

that are stable in the presence of SDS and under reducing conditions. Such stability has been

reported for several other multimeric proteins (Grigorian et. al, 2005 and Peaper et. al, 2005).

However, it might sound paradoxical that considering that a major protein band at ~70 kDa

was used to generate the original peptide sequences, this antibodies recognized a strong band

with a molecular weight lower than 70kDa. This might indicate that most of the epitopes

within the 70-kDa protein are masked (e.g. by post-translational modifications) and only

become accessible for the antibodies recognition in the multimeric protein derivates or protein

bands of lower molecular weight (which might represent degradation products of the 70-kDa

band).

III.4.2 Characterization of native Forisomes by immunofluorescence

III.4.2.1 Reactivity of Forisome-specific polyclonal antibodies to native Forisomes

Since preliminary immunoblot analysis (III.1.2) confirmed that polyclonal mouse and chicken

Forisome-specific antibodies recognized epitopes located on denatured Vicia faba Forisomes,

confocal immunofluorescence microscopy (II.2.15) was performed to evaluate their antigen

specificity toward native Vicia faba Forisomes. As shown in Figure III-30A and E, epitopes

located over the entire surface of Forisomes could be recognized by both polyclonal

antibodies.

As previously reported (Knoblauch et al., 2001), Vicia faba Forisomes undergo a reversible

condense-disperse conformational change in response to variations in free Ca+2 concentration.


72

Figure III-30 Confocal immunofluorescence analysis of Vicia faba native Forisomes using polyclonal Forisome-specific mouse and chicken antibodies. Specific binding of mouse and chicken polyclonal antibodies (II.2.13.1; II.2.13.2) to native Vicia faba Forisomes was characterized by immunofluorescence. Both Forisome-specific antisera in a dilution 1:250 in 1xPBS buffer (pH 7.4) were incubated for 2h at RT for epitopes recognition. Immunodetection was carried out using goat anti-mouse (dil 1:500) or goat anti-chicken (dil 1:500) Alexa Fluor® 488 (Molecular Probes) according to the first antibody. A confocal fluorescence microscope (Leica TCS SP) was used to obtain immunofluorescence. A, immunodetection of native Forisomes in absence of Ca+2 (condense conformation) with Forisome-specific chicken antiserum; B, immunodetection of Forisomes in presence of 20mM Ca+2 (disperse conformation) with Forisome-specific chicken antiserum; C, immunodetection with chicken preimmune serum used as negative control; D, immunodetection with GAC Alexa Fluor® 488 as primary antibody; E, immunodetection of native Forisomes in absence of Ca+2 (condense conformation) with Forisome-specific mouse antiserum; F, immunodetection of Forisomes in presence of 20 mM Ca+2 (disperse conformation) with Forisome-specific mouse antiserum; G, immunodetection with mouse preimmune serum used as negative control; D, immunodetection with GAM Alexa Fluor® 488 as primary antibody.

E F

G H

C D

BA

EE FF

GG HH

CC DD

BBAA


73

To examine whether these polyclonal antibodies could recognize epitopes exposed in the

dispersed structure of the Forisomes, immunofluorescence microscopy in presence in 20 mM

Ca+2 was carried out. Isolated Forisomes from Vicia faba (II.2.1) were used as antigens.

Taking the advantage of a high adherence of Forisomes after centrifugation at 4000 rpm, the

use of microtiter plates enables washing and incubation steps and therefore avoiding a

considerable loss of the antigen.

The dispersed conformation of the Forisomes was not completely achieved in all protein

bodies due to the incubation with a suitable media for the antibodies. However, a transitional

state toward the dispersed conformation could be observed. It is interesting to note a fibrilar

pattern evidenced on the dispersed conformation of Forisomes after incubation with

Forisome-specific-chicken antibodies (Figure III-30B). The same experiment was performed

using Forisome-specific mouse antibodies; though a difference in the recognition pattern in

presence and absence of Ca+2 using this antiserum could not be confirmed. No cross-reactivity

with pre-immune sera and secondary antibodies used as negative controls was observed

(Figure III-30C, D, G and H).

III.4.2.2 Reactivity of VFF1-specific polyclonal antibodies to native Forisomes

Immunoblot analysis confirmed the antigen specificity of VFF1-specific rabbit antiserum to

denatured Forisomes (III.4.1). A further insight in the characterization of Vicia faba

Forisomes is the determination of whether the native protein can be recognized by polyclonal

antibodies raised against the recombinant VFF1. Thus, immunofluorescence microscopy

(II.2.15) was performed as previously described (III.4.2.1).

Figure III-31 Confocal immunofluorescence analysis of Vicia faba native Forisomes using polyclonal VFF1-specific antibodies. Specific binding of polyclonal antibodies raised against recombinant VFF1 proteins to native Vicia faba Forisomes was characterized by immunofluorescence. VFF1-specific antisera in a dilution 1:250 in 1xPBS buffer (pH 7.4) were incubated for 2h at RT for epitopes recognition. Immunodetection was carried out using goat anti-rabbit (dil 1:500) Alexa Fluor® 488 (Molecular Probes). A confocal fluorescence microscope (Leica TCS SP) was used to obtain immunofluorescence. A, immunodetection of native Forisomes in absence of Ca+2 (condense conformation) with VFF1-specific antiserum; B, immunodetection of Forisomes in presence of 20 mM Ca+2 (disperse conformation ) with VFF1-specific chicken antiserum.

A BAA BB


74

As shown in figure III-31, the same pattern of antibody specificity toward epitopes located

over the entire surface of Forisomes was observed. No cross-reactivity with pre-immune sera

and secondary antibodies used as negative controls was detected (data not shown).

Chapter IV Discussion ___________________________________________________________________________

75

IV Discussion

IV.1 Molecular characterization of Forisome genes

IV.1.1 Analysis of Vicia faba Forisomes subunits

Isolation of V. faba Forisomes (II.2.1) and subsequent SDS-PAGE analysis (Figure III-1)

revealed the presence of several protein bands of different molecular weight. A major band of

approximately 70 kDa was observed together with several minor bands of lower and higher

molecular weights. Within the range of 50-70 kDa, the detected bands might suggests the

presence of different subunits or degradation products of the main (~70 kDa) band, whereas

the higher molecular weights bands might denote dimerization and multimerization derivates.

The reduction of the acrylamide concentration from 12% to 7% enabled the separation of the

main ~70kDa protein into two different bands of slight lower molecular weights with the

larger subunit quantitatively stronger represented. Moreover, complete fractionation into three

individual subunits could be achieved after addition of Ca2+ (data not shown). Nevertheless,

the possibility cannot be excluded that one or several of these three bands in the SDS-PAA

gel might indicate the presence of proteins with the same running properties. This

interpretation seemed reasonable since some sequenced peptides generated from the ~70kDa

large subunit of V. faba Forisomes (II.2.2) could not be found within the VFF1 amino acid

sequence. Alternatively, these lower molecular weight bands may reflect the presence of

additional subunits which comprised the protein complex but where sequences are yet

unknown.

Further experiments were performed with the aim of identify proteins difficult to resolve on

Coomassie blue-stained one-dimensional PAGE. Isolated Forisomes from V. faba were

subjected to two-dimensional PAGE and different forms spanning the pI values from 6.0 to

7.5 (Figure III-3A) were observed, which is in agreement with the isoelectric point (pI) of

6.79 predicted for the vff1 translated amino acid sequence (III.1.9).

The major band of ~70kDa observed on one-dimensional PAGE is composed of possibly two

or three proteins running at the same molecular weight. After immunoblot analysis (III.1.2.2),

a defined pattern was revealed in which the Forisome subunits of higher molecular mass are

of less acidic pI, whereas those migrating as lower molecular mass forms are apparently more

acidic. This heterogenicity among the spots might indicate the result of post-translational

modifications such as glycosylation and/or phosphorylation. It is commonly assumed that a

variety of forms are predominantly accounted for by the differences in the amount of sugar

moieties imparting different charges in the attached N-glycans. Some heterogeneity of

molecular mass is also introduced by differences in the number and size of N-glycans

attached. This can be in part correlated with the observed N-glycosylation and protein kinase

phosphorylation sites predicted by protein sequence analysis (III.1.9). Studies using


76

antibodies against these post-translational modifications combined with antibodies raised

against the recombinant subunits, might be required to gain more insight into the Forisomes

structure.

IV.1.2 Cloning and characterization of vff1 gene

IV.1.2.1 Screening of cDNA libraries

Attempts to identify Forisome-encoding genes by screening either subtracted or non-

subtracted Vicia faba derived cDNA libraries (III.1.3) retrieved no successful results.

It has been previously reported that the percentage of clones in a subtracted library that

corresponds to differentially expressed mRNAs varies considerably: as high as 95%

(Diatchenko, L. et al., 1996), a midrange of 40–60% (Gurskaya, N. G. et al., 1996; von Stain,

O.D. et al., 1997), and as low as 5% (Diatchenko, L. et al., 1998). In most cases, the

subtraction method greatly enriches differentially expressed genes. Nevertheless, the

subtracted sample might still contain some cDNAs that correspond to mRNAs common to

both the tester and driver samples. Although this background may depend somewhat on the

quality of RNA purification and the performance of the particular subtraction, it mainly arises

when very few mRNA species are differentially expressed in tester and driver, as it might be

the case here.

In general, a limited set of differentially expressed mRNAs and low quantitative difference in

expression means higher background, even if a good enrichment of differentially expressed

cDNAs is obtained. Since the background was moderately high, the possibility of picking

random clones from the subtracted library for Northern blot analysis was considered.

However, this procedure would have been time-consuming and inefficient. Therefore, a

differential screening step was performed instead to minimize background before performing

a Northern blot analysis.

There are two approaches for differentially screening a subtracted library. The first is to

hybridize the subtracted library with 32P-labeled probes synthesized as first-strand cDNA

from tester and driver (Hedrick et al., 1984; Sakaguchi et al., 1986). Clones corresponding to

differentially expressed mRNAs will hybridize only with the tester probe, and not with the

driver probe. Although this approach is widely used, it has one major disadvantage since only

cDNA molecules corresponding to highly abundant mRNAs (i.e., mRNAs which constitute

more than about 0.2% of the total cDNA in the probe) will produce detectable hybridization

signals (Wang, Z. and Brown, D., 1991). Therefore, clones corresponding to low-abundance

differentially expressed mRNAs will not be detected by this screening procedure. Hence, an

alternative approach was considered.

The second alternative approach bypasses the problem of losing low-abundance sequences. In

this method, the subtracted library is hybridized with forward- and reverse-subtracted cDNA


77

probes (Lukyanov et al., 1996; Wang, Z and Brown, D., 1991). To construct reverse-

subtracted probes, subtractive hybridization was performed with the original tester cDNA as a

driver and the driver cDNA as a tester. Clones representing mRNAs that are truly

differentially expressed hybridize only with the forward-subtracted probe, whereas clones that

hybridize with the reverse-subtracted probe may be considered as background. Although a

good ratio of signal to background was ensured among the clones which exhibited strong

hybridization signals, the sequence analysis did not contain the identified Forisome peptides.

Assuming that Forisomes were expressed in young phloem tissue, a subtracted cDNA library

was constructed using samples prepared from Vicia faba plant leaves as tester in combination

with samples from the Vicia faba root tips as driver (II.2.5.2). Later, it has been observed that

although during root elongation, vff1 promoter expression pattern was restricted to the

meristematic and elongation zones at root tips, in the tips of fully developed roots vff1

expression was no longer detectable (IV.2.4.1). These results indicate that the Vicia faba

subtracted cDNA library might not be representative as among root tips used as drivers the

level of expression of these specific mRNAs was not determined. Thus, a very low

quantitative difference in expression of Forisome mRNAs might have been obtained between

driver and tester cDNAs.

An alternative explanation for these results, and which encompasses also the non-subtracted

library, may be the fact that during the hybridization screen of both libraries, the probes used

were designed according to sequenced peptides which afterwards could not be allocated

within the identified VFF1 sequence. This may imply the presence of proteins, in the

sequenced samples, with the same running properties as the main ~70kDa band. Hence, some

peptides might have been sequenced from proteins isolated along with Forisomes and which

may not be present in the cDNA libraries. Nevertheless, this interpretation does not exclude

the possibility that sequenced peptides absent from VFF1 might be present in still unidentified

Forisome proteins. Hence, the observed results might also suggest a low stability of the

Forisome specific mRNAs and therefore making the construction of representative libraries

impossible.

Furthermore, immunoscreening (III.1.4) and PCR screening (III.1.5) of cDNA expression

library of Vicia faba plant tips was performed. Nevertheless, neither the identification of

cDNAs encoding antigenic Forisome fusion proteins nor the allocation of DNA- and/or DNA

fragments to the Forisome genes was possible.

These results might suggest, as described above, the construction of a not representative

cDNA library due to a low stability of the Forisome specific mRNAs. This interpretation may

therefore also explain the unsuccessful attempts in screening of this cDNA expression library.

In addition, it is of interest to note that degenerate primers were used in the PCR screening of

this Vicia faba cDNA expression library (III.1.5). Degenerate primers provide a tool to search

for more than one gene isoform at a time in a reverse-genetic strategy raising the possibility of


78

amplifying and cloning sequences that might correspond to genes encoding Forisome proteins

in Vicia faba. However, the unsuccessful attempts presented here indicate that, in this case,

the use of degenerated primers was not a suitable method.

Other possible reasons could be considered to explain the inability to generate amplification

products. First, the overlay of the protein subunits in the SDS-PAA gel electrophoresis and, as

a consequence, the identification of peptide sequences of different subunits and/or proteins.

Second, the different length of amino acids residues of the generated peptide sequences with

the concomitant strong deviation among the annealing temperatures of the designed

degenerated oligonucleotides used. Third, it seemed likely that the failure to amplify these

genes might be attributed to the unawareness of the localization of the peptides to each other

within the polypeptide chain that resulted in the placement of primers in regions of the

predicted gene that are actually too close in the final transcript for an adequate PCR

amplification. Finally, the shortness and degeneration of the derived oligonucleotides could

not ensure the use of suitable high annealing temperatures as a condition which enables

touchdown PCR.

IV.1.2.2 Database search and cloning of vff1 gene

Peptide sequences obtained by sequencing the isolated ~70-kDa protein band from Vicia faba

Forisomes were used for screening public databases (II.2.2). Interestingly, two of the peptide

sequences were nearly 100% identical to parts of a M. truncatula 478-bp EST (expressed

sequence tag) from the MENS database (Medicago EST Navigation System) encoding a

partial sequence of 157 amino acids. Based on this sequence information specific primers

were designed and the cDNA sequence along with the full-length genomic sequence could be

cloned by 5´ and 3´ RACE (III.1.6) and LD PCR (III.1.9). Computer analysis of the genomic

and cDNA sequences revealed the presence of a 2710-bp open reading frame, interrupted by

six introns flanked by GT and AG canonical intron border sequences. The identified ORF

encodes a protein of ~ 79-kDa. The resulting cDNA clone was designated vff1 (protein VFF1)

and its deduced amino acid sequence revealed the presence of 10 different peptides sequences

belonging to the Vicia faba Forisome. Nevertheless, many of the sequenced peptides could

not be allocated within the identified cDNA clone, which might indicate the presence of yet

not yet identified additional Forisome subunits.

IV.1.2.3 Sequence analysis of vff1 gene

Given that neither the alignment of the vff1 gene against the completely sequenced genome of

Arabidopsis thaliana nor against the genome of Oryza sativa retrieved any information, a

sequence comparison with known protein databases was performed. The identification of

significantly homologous genes and/or proteins could not be achieved. The strongest


79

homology with approx. 29% identity to VFF1 showed the amino acid sequence of a protein

(At3g01680; www.ncbi.nlm.nih.gov/BLAST) from A. thaliana, which function is yet

unknown. While the entire sequence exhibited only very small homology with the vff1

Forisome gene, a carboxyterminal stretch of several cysteines could be identified encoded by

both clones (Figure III-9). These specific amino acid residues might be involved in the

stabilization of the protein complex by the formation of disulfide bridges of the side chains,

although formation of covalent S-S bridges is rarely found in intracellular proteins.

Experiments performed in parallel to the vff1 gene cloning, revealed homologous cDNA

clones for two further Fabaceae plants, Medicago truncatula (mtf1, 1944 bp; MTF1, 74 kDa)

(Noll, G., personal report) and Canavalia gladiata (cgf1, 2007 bp; CGF1, 77 kDa) (Ashoub,

A., personal report). These clones were of similar length and shared protein sequence identity

of ~61%.

Perhaps the most noticeable feature of Forisomes is their existence only within the Fabaceae.

Molecular analysis of the structure of this novel protein will lead to a better characterization

of this unique protein.

IV.1.2.4 The different motifs identified within the vff1 gene

Despite the importance given to Ca2+ in the Forisome regulation, no structural features such as

Ca2+-binding domains (e.g. EF-hands; Nakayama, S. and Kretsinger, H., 1994; Muranyi, A.

and Finn, B.E., 2001; Swairjo, M.A. and Seation, B.A., 1994; Nalefski, E.A. and Falke, J.J.,

1996; Rizo, J. and Südhof, T.C., 1998; Weis, W.I., 1996) could be predicted for VFF1.

Nevertheless, computer analysis (http://www.ch.embnet.org/software/COILS_form.html;

Lupas, A., 1996) revealed another structural motif, an amphipathic α-helix within the coding

region of VFF1 comprising a coiled-coil domain (Figure III-10). The coiled-coil domain is

responsible for oligomerization of protein subunits and concomitant folding of the proteins. It

has been described for the first time in the intermediate filament keratin protein (McArthur,

1943; Burkhard et al., 2001). Later, a dimerization domain of a family of transcription factors,

the leucine zipper (Landschulz et al., 1988), was also described comprising this structural

motif. Some amphipatic helices are arranged as interwined helices that are termed as coiled

coils or super-helices. Although structurally simple, coiled coils have the ability to form a

variety of different assemblies ranging from dimers to pentamers (Lupas, A. N. and Gruber,

M., 2005; Walshaw, J. and Woolfson, D. N., 2001).

Furthermore, coiled coils can form homomers or heteromers with their chains arranged in a

parallel or antiparallel fashion (Lupas, 1992). Sequences of parallel left-handed coiled coils

are characterized by a seven-residue periodicity (heptad repeat), with the occurrence of apolar

residues preferentially in the first (a) and fourth (d) positions of the ‘heptad’ (Lupas, A.,

1996). The interaction between these apolar amino acids denote the formation of the


80

hydrophobic core, which induces coiled coils (Crick, 1953; Lupas, 1996). Charged amino acid

residues, frequently at positions outside of the hydrophobic core, can affect upon changes of

the pH in the surrounding medium (Suzuki et al., 1997; Krylov et al., 1998), after

phosphorylation of the AA side chains (Szilak, L. et al., 1997; Liang, W. et al., 1999) and

after interaction with ions (Farah, C.S. and Reinach, F.C., 1999), the hydrophobic interaction

of the coiled-coil domains. It is also generally acknowledged that the detailed packing

geometry of hydrophobic core residues correlates with the oligomerization state (Harbury, P.

B. et al., 1993; Harbury, P. B. et al., 1994).

The 21 AA coiled-coil domain of the VFF1 is relatively short, however, this has been already

described for some other globular proteins with less than 20 AA (Lupas, 1996; Müller, K. et

al., 2000; Kohn, W. and Hodges, R., 1998; Rieker, J. and Hu, J., 2000; Cho, C. et al., 2004;

Eckert, D. and Kim, P., 2001; Ryadnov, M. et al., 2003; Petka, W. et al., 1998). Moreover

and in contrast to the characterized apolar amino acid residues found in the first (a) and

fourth (d) positions of the heptad pattern, in the VFF1 coiled-coil domain a polar amino acid

residue is present within one of the heptads. In this context, it has been shown that distinct

coiled-coil ‘trigger sites’ within heptad-repeat-containing amino acid sequences might be

necessary to mediate coiled coil formation (Steinmetz, M.O. et al., 1998; Kammerer, R.A. et

al., 1998; Frank, S. et al., 2000). As a hallmark, the coiled-coil trigger site of the actin-

bundling protein cortexillin I contains a distinct inter- and intrahelical salt-bridge pattern,

which includes charged residues even at core positions (Burkhard, P. et al., 2000a). Other

recent results suggest that ionic interactions are not only important for proper alignment,

orientation and selectivity of coiled coils, as shown previously (Kohn, W.D. et al., 1995;

O’Shea, E.K. et al., 1992), but can also contribute considerably to stability of coiled coils

(Burkhard, P. et al., 2000b; Moll, J.R. et al., 2000; Krylov, D. et al., 1998; Spek, E.J. et al.,

1998), thereby modulating assembly of coiled coils in a pH-dependent manner (Suzuki, K. et

al., 1997; Bullough, P.A. et al., 1994).

Taken together, this interpretation raises the possibility that the coiled-coil motive found in

VFF1 proteins might be involved in the Ca2+ dependent reaction of the Forisomes or that

additional and yet unidentified subunits are responsible for the conformational change.

Further analysis of the VFF1 amino acid sequence was performed, nevertheless, no well-

known motives that appeared to contribute to the secondary structure of the protein were

retrieved. Instead, a low-complexity region (III.1.6) was identified for which no structure can

be predicted with the algorithms available (Schultz et al., 1998). One general idea about the

functional relevance of these low-complexity regions is that they only acquire a rigid structure

(e.g., an α-helix) upon interaction with another protein partner or oligomerization into a

protein complex (Wright and Dyson, 1999). This has been reported for soluble N-

ethylmaleimide-sensitive factor attachment protein receptor, which play a role in vesicle


81

docking and fusion, and which only form an α-helix when they bind to their interaction

partner (Fasshauer et al., 1997; Jahn and Sudhof, 1999).

In addition, it is of interest to note that motif searches against the Smart database, after

inclusion of sequences (outlier homologues) that are often difficult to detect using HMM

methodology, retrieved a 100% identity within the VFF1 amino acid sequence (167-395) to

an unknown domain (d1gw5a_domain; http://smart.embl-heidelberg.de/) which belongs to the

ARM superfamily.

ARM repeats are short 42-amino acid motifs that were first identified in the fruitfly

(Drosophila melanogaster) segment polarity protein, armadillo (Riggleman et al., 1989).

ARM repeats have been subsequently identified in a wide range of eukaryotic proteins, and

these proteins interact with numerous other proteins via their ARM repeats, resulting in the

regulation of a variety of cellular processes (Hatzfeld, M., 1999). Based on the crystal

structure of the mammalian armadillo homolog, β-catenin, each ARM repeat forms a

trihelical structure that folds into a superhelix, and six ARM repeats are proposed to constitute

a protein interaction domain (Huber et al., 1997). Within the VFF1 sequence only one ARM

repeat was identified. Despite this, the highly divergence, not only between proteins but also

between repeats within the same protein in this family, suggest that there are likely other

ARM repeats in the VFF1 sequence that have not been detected. This is evident in the

arrangement of ARM repeats for closely related proteins where a featureless region is present

between ARM repeats in one protein but not in the other relative and the fact that ARM

repeats tend to be tandemly repeated (Mudgil, Y. et al., 2004).

Based on the three-dimensional structure of β-catenin, six ARM repeats have been predicted

to form the basic superhelical structure of the protein interaction domain (Huber et al., 1997).

If this is the typical requirement, then the predicted VFF1 protein with fewer ARM repeats

may has some undetected repeats or it may has gained new functions based on these fewer

ARM repeats (Andrade, M. A. et al., 2001; Meyers, B. C. et al., 1998).

As described above and apart from the data presented here, a succession of several cysteine

residues could also be identified at the carboxy-terminal domain (IV.1.2.3). The reversible

conformational change of Forisomes from the condensed into the dispersed state after

addition of Ca2+ leads not to a complete dissolution of the protein complexes. Forisomes still

remains as distinctive bodies (Knoblauch et al., 2003). A function of the cysteine residues

with the stabilization of the protein complex by the formation of disulfide bridges of the side

chains would be conceivable. Possibly these covalent bonds serve as the linkage of the

individual subunits holding them together and facilitating, after Ca2+ withdrawal, the back

folding of the Forisome into the arranged condensed conformation.

Taken together, from the characterization of the different motifs identified within the VFF1

sequence, it is becoming clear that this protein comprise several structural features related to

helices and coiled-coil motive formation. These structural characteristics might indicate a


82

possible Ca2+ dependent reaction of the Forisomes. However, future work focusing on the

identification of additional Forisome genes and their molecular characterization are needed

for the elucidation of mechanisms that influence their conformational change.

IV.1.3 Immunological evidence of vff1 gene encoding a Forisome protein

IV.1.3.1 Expression and purification of recombinant VFF1 protein

After cloning and sequence analysis of vff1 gene, bacterial expression of the recombinant

protein was performed with the aim to obtain antigens for immunization. Vff1 cDNA was

genetically fused to the carboxyl-terminal end of GST (III.3.1). Using GST as fusion protein

allowed one step affinity purification of the recombinant overexpressed proteins under native

conditions (Frangioni and Neel, 1993).

Overexpression of the GST-VFF1 fusion protein resulted in formation of inclusion bodies.

Thus, for altering amounts of soluble and correctly folded protein, the cultivation and

induction conditions had to be optimized. Slightly larger quantities of soluble GST-VFF1

fusion protein were obtained by increasing the culture volume, decreasing the IPTG

concentration, increasing the time and reducing the temperature to 16°C after induction. The

positive effect of low temperature to reduce inclusion bodies formation has been

demonstrated in many studies (Bishia et al., 1987; Schein, 1989; Burton et al., 1991). The

rationale behind was based on the assumption that the rate of protein folding is only slightly

affected at temperatures between 15 to 20°C, whereas the rates of transcription and

translation, being biochemical reactions, is substantially decreased. This, in turn provides

sufficient time for protein folding, yielding active proteins and avoiding the formation of

inactive protein aggregates, i.e., inclusion bodies, without reducing the final yield of the target

protein (Oppenheim et al., 1996). Nevertheless and contrary to this expectation, the

improvement in protein expression was not entirely sufficient.

On the other hand, the yield of purified VFF1 cleaved from GST domain with Factor Xa was

unfortunately very low due to an almost complete degradation of the overexpressed protein

even though affinity purified proteins showed high purity in SDS PAGE (data not shown).

Hence, production of recombinant fusion protein was carried out in a 4-liter scale

fermentation, but again, no soluble GST-VFF1 fusion protein could be obtained even using

the optimized conditions described above. This might indicate that formation of VFF1

inclusion bodies was not affected by the expression conditions used. The large size of the

GST-VFF1 fusion protein (104 kDa) could affect the proper refolding of the fusion protein as

reported in other studies (Hackenbeck et al., 1998). In consequence, GST-VFF1 fusion

proteins were isolated from the SDS-PAA gel in large quantities and used for the production

of specific polyclonal antibodies in rabbits.


83

IV.1.3.2 Immunoreactivity of Vicia faba Forisome-specific polyclonal antibodies to

recombinant VFF1 proteins and native Vicia faba Forisomes

Bacterial expressed VFF1 along with isolated Vicia faba Forisomes as a positive control were

used to assay their immunoreactivity toward Forisome-specific mouse and chicken antisera.

The results shown in Figure III-28B indicated that Forisome-specific chicken antiserum

recognized the overexpressed recombinant VFF1 protein confirming its presence in Vicia faba

Forisomes.

Immunoblot analysis with Forisome-specific mouse antiserum could not reveal the presence

of bands at the expected sizes whereby immunodetection of isolated Forisomes shows a

remarkably strong signal (Figure III-28A). This might indicate that mouse antiserum

recognize different epitopes not present in the recombinant protein, however, exposed on the

isolated Vicia faba Forisomes. In this respect, it would be also conceivable that

conformational epitopes absent from the bacterial expressed protein might have been

responsible for the immunoresponse in mouse and that these same epitopes could be stable in

the presence of SDS and under reducing conditions. Such stability has been reported for

several other multimeric proteins (Grigorian, A. L., et al., 2005; Salahpour, A. et al., 2003;

Peaper, D. et al., 2005). It could, nevertheless, either be discriminated whether the absence of

specific signal is caused by a weak interaction not detectable by immunoblot analysis.

Furthermore, confocal immunofluorescence analysis of Vicia faba native Forisomes using

polyclonal Forisome-specific mouse and chicken antibodies was performed (Figure III-30). It

could be observed that whereby epitopes located over the entire surface of the Forisomes

could be recognized by both polyclonal antibodies, a different pattern was observed in

presence of Ca2+. Knoblauch, M. et al. (2001) have reported that Vicia faba Forisomes

undergo a reversible condense-disperse conformational change in response to variations in

free Ca+2 concentration. Despite the immunoreaction of Forisome-specific polyclonal chicken

antibodies evidenced a fibrilar pattern on the dispersed conformation of Forisomes (Figure

III-30B), Forisome-specific mouse antibodies showed only reactivity against epitopes located

on the surface of the protein bodies. This observation might indicate that epitopes hidden

inside the Forisomes could be exposed as a result of the change in conformation due to a

variation in Ca+2 concentration thus enabling antibodies binding. These epitopes might be

recognized by Forisome-specific chicken antiserum but not by mouse polyclonal antibodies.

On the other hand, conformational epitopes possibly present inside the condensed state of the

Forisomes are lost during the transition to the disperse state with the concomitant loss of

immunoreactivity towards the mouse polyclonal antibodies.

This interpretation may also explain the specific reaction of the mouse polyclonal antibodies

observed against the protein bands of higher molecular weight which were weakly detected by

the specific chicken antiserum (Figure III-28). It seems conceivable that not only the main

band of ~70kDa is recognized by the mouse polyclonal antibodies but also some interactions


84

between subunits of Forisomes which in turn, are not present in the dispersed conformation.

These interactions may build up the conformational epitopes explained above. This

interpretation might indicate the possibility of homo and heterodimers and/or multimers

forming the Forisome structure. In addition, this is supported by the observation that some

sequenced peptides from isolated V. faba Forisomes were not found within the VFF1 amino

acid sequence confirming that this is not the only subunit present in the Forisomes.

Taken together, it can be assumed that the Forisome-specific chicken polyclonal antibodies

recognize mainly the ~70kDa subunit whereas the Forisome-specific mouse polyclonal

antibodies were raised against not only this protein but also against conformational epitopes

determined by interactions between the ~70kDa protein and other protein subunits comprised

in the condensed Forisome structure stabilized even in presence of SDS and under reducing

conditions.

The fact that no immunodetection could be observed for Forisome-specific mouse antiserum

within the dispersed conformational state of the Forisomes, favours the idea of a

heteromultimer protein. Nevertheless, other, as yet unidentified Forisome protein sequences

might also be required to confirm this hypothesis.

IV.1.3.3 Immunoreactivity of VFF1-specific polyclonal antibodies to recombinant

VFF1 proteins and native Vicia faba Forisomes

From the results presented in Figure III-29 it becomes clear that the VFF1 rabbit antiserum

binds highly specific to the isolated Vicia faba Forisome proteins confirming that the vff1

gene encodes a Forisome protein.

Seemingly contradictory but nonetheless evident was the absence of a positive signal against

the recombinant fusion protein used as antigen for the immunization. An explanation for this

could be that the recognized epitopes are shielded from the VFF1-specific antibodies by the

adopted conformation of the fusion protein under the reducing conditions used in the SDS-

PAA gel electrophoresis.

It is, however, interesting to note that antibodies raised against the recombinant VFF1 protein

detected the >100kDa bands revealed by Coomassie staining (Figure III-1) as well as the

additional bands in the range 50-70kDa. Since the vff1 sequence predicted a protein of 79kDa,

all higher molecular weight bands are thus likely to be multimers representing partially

assembled Forisomes stable in the presence of SDS and under reducing conditions in

agreement with what was explained above. Nevertheless, it might sound paradoxical that

considering that the major protein band at ~70kDa was used to generate the original peptide

sequences and to identify vff1, this antibody recognized a strong band with a molecular weight

lower than 70kDa. This might indicate that most of the epitopes within the 70kDa protein are

masked (e.g. by post-translational modifications) and only become accessible for the


85

antibodies recognition in the multimeric protein derivates or protein bands of lower molecular

weight (which might represent degradation products of the 70-kDa band).

Confocal immunofluorescense revealed that native V. faba Forisomes are detected by the

specific anti-VFF1 polyclonal antibodies (Figure III-31). Adhesion of co-purified particles on

the Forisome surface, along with a non-specific reactivity of the antibodies to these, can be

not completely excluded. However, the preimmune serum did not show comparable

fluorescence intensity. Moreover, the immunodetection pattern towards the condensed and

dispersed conformation of native Forisomes resembled that one observed with Forisome-

specific chicken antiserum. In this respect, it is worthwhile to note that presumably, the VFF1

protein is highly represented inside the Forisome structure, which is supported by the strong

immunodetection in presence of Ca+2.

IV.2 Molecular characterization of vff1 promoter

The putative promoter of the vff1 gene was isolated from genomic DNA by genome walking

(III.2.2) and its activity as well as tissue specificity was confirmed in transgenic tobacco

plants using GUS as a reporter system (III.2.4). In addition, sequence analysis of the promoter

region of vff1 gene revealed the presence of two conserved motifs which have already been

reported for several phloem-specific promoters (III.2.3). Taken together, these results indicate

that the 5′-upstream region of vff1 functions as a promoter (designated vff1P) that directs

preferential expression of the uidA gene to the phloem of transgenic tobacco plants. Besides

the tissue-specificity (III.2.4.2.1) a spatial and temporal regulation of vff1P was observed

during development (III.2.4.2.2) which seems to be in consistent with the expression of

Forisomes mainly in the early stage of phloem development.

IV.2.1 Sequence analysis of vff1 promoter

Sequence comparison of the vff1 promoter and other phloem-specific promoters revealed the

presence of two shared motifs, the 13bp and GATA motifs. The involvement of these motifs

to phloem-specific gene expression was demonstrated by loss-of-function analysis that

introduced point mutations (Yin et al., 1997a) or deletions (Ohta et al., 1991; Hehn and

Rohde, 1998) into each promoter. The 13 bp and GATA motifs are conserved between virus

and plant promoters, implying an important role for these motifs for gene expression in the

phloem.

Hehn and Rohde (1998) identified a highly conserved motif ‘ATAAGAACGAATC’ (13-bp

motif) involved in activity and phloem-specificity when they compared the Coconut Foliar

Decay Virus (CFDV) promoter sequence with other phloem-specific promoters from Rice

Tungro Bacilliform Virus (RTBV), Commelia yellow mottle virus (CoYMV), rolC of

Agrobacterium rhizogenes and the pea gultamine synthase gene GS3A. Another vascular


86

tissue-specific promoter from a rice GRP gene (Osgrp-2) was also described to contain this

conserved sequence (Liu et al., 2003). In all these promoters, this motif is localized upstream

of the TATA box. A similar motif with high homology to the above-mentioned 13bp

conserved sequence was also found 524 bp upstream of the TATA box in the vff1 promoter

and 37 bp upstream of TATA box in the C. maxima PP2 promoter (Thompson and Larkins,

1996). These findings imply that the 13-bp motif might be in part responsible for the specific

activity of the vff1 promoter, although function of other sequences in phloem-specificity and

enhancement of the promoter activity could not be ruled out. Further dissection of the vff1

promoter is required to confirm whether these motifs and/or other elements are involved in

gene expression in the phloem.

Several other promoters from plants (Yang and Russell, 1990; Brears et al., 1991; DeWitt et

al., 1991; Ohta et al., 1991; Martin et al., 1993; Hérouart et al., 1994; Shi et al., 1994;

Truernit and Sauer, 1995; Tornero et al., 1996), Agrobacterium (Schmülling et al., 1989;

Sugaya et al., 1989; Guevara-García et al., 1993) and viruses (Medberry et al., 1992;

Bhattacharyya-Pakrasi et al., 1993; Rohde et al., 1995) have been reported to drive expression

of reporter genes in the phloem of transgenic plants. These promoters differ in the degree of

specificity of gene expression. Among them, there are promoters that direct gene expression

in phloem parenchyma cells in addition to sieve elements and companion cells. The

Arabidopsis plasma membrane H+-ATPase gene promoter (DeWitt et al., 1991) is an

example of this type. Other promoters direct gene expression in phloem and additional cells of

other tissues. For example, the Commelina yellow mottle virus promoter drives gene

expression in phloem along with weak expression in xylem parenchyma cells in transgenic

tobacco (Medberry et al., 1992). The sporamin A gSPO-A1 gene promoter directs gene

expression predominantly in internal phloem, but also, to a lesser extent, in pith parenchyma

cells of transgenic tobacco (Ohta et al., 1991). However, the most stringent promoters direct

gene expression only in sieve elements and companion cells of the phloem. Maize and rice

sucrose synthase promoters (Yang and Russell, 1990; Shi et al., 1994) are typical examples of

this type. The vff1 promoter was assigned to the last specificity group, since expression of

GUS was detected exclusively in companion cells and sieve elements of vff1P-GUS

transgenic tobacco plants.

IV.2.2 Phloem-specific expression pattern driven by vff1 promoter

In order to study tissue specificity the β-glucuronidase reporter gene was placed under the

control of the full-length vff1 promoter and examined for promoter activity in N. tabacum.

Transient assays in detached and vacuum-infiltrated tobacco leaves were performed for rapid

verification of the promoter activity (Kapila et al., 1997; Fischer et al., 1999). Although

transient gene expression may not be fully comparable to results obtained with transgenic

plants, it can provide a rapid and reliable method to evaluate promoter expression since there


87

is no transgene integration and expression levels might be influenced by position effects

(Kapila et al., 1997). Nevertheless, despite some GUS expression could be observed, these

results were not reproducible. As it was confirmed in further experiments, the synthesis of

Forisomes is taking place during the early stages of sieve element development. Moreover,

the subsequent differentiation of the sieve element from the companion cell would only imply

the delivery of subunits of the Forisome, which indicate a diminished level in protein

synthesis. Therefore, the low levels of GUS expression in mature vacuum-infiltrated leaves

denoted an inadequate method for promoter studies.

As an alternative approach to study the vff1 promoter activity, transient expression in isolated

protoplast was carried out; however, this method gave again low and non reproducible levels

of activity. Considering that vascular tissues are highly specialized tissue, activation of

phloem-specific promoters probably requires specific transcription factors. The activity of

such promoters would therefore be expected to be poor in cell cultures or in protoplasts, in

which, even though not devoid of phloem cells, only some few phloem derived protoplasts are

present. This could explain the low activity observed using the vff1 promoter when tested in

transient expression assays in protoplasts (Zhan et al., 1993; Dry et al., 2000). Hence, stable

transformation of N. tabacum plants was used for further analysis.

With the stable integration of T-DNA encoding the uidA gene driven by the vff1 promoter,

transgenic N. tabacum plants were generated. Histochemical assays of GUS activity

demonstrated that in stably transformed tobacco plants, the vff1 promoter conferred a phloem-

specific expression pattern in stems, leaves, flowers and roots. The expression of the uidA

gene was confined to internal and external phloem of stems and leaves (Figure III-19). GUS

activity was also detected in flowers (Figure III-20) and in the phloem of roots (Figure III-21).

In flowers, the staining was localized to the inflorescence meristem and young floral buds

(Fig. III-20A). Roots of these transgenic plants showed the strongest staining for GUS activity

restricted to dividing meristematic tissues (Fig. III-21D). As the histochemical assays were

performed under reducing conditions to prevent diffusion of the GUS product (Guivarc’h et

al., 1996), the accumulation accounted essentially for expression of vff1 promoter in these

tissues.

A chimeric promoter consisting of the double enhancer sequence from the Cauliflower

Mosaic Virus (CaMV) 35S promoter fused upstream to the uidA gene was used as positive

control. When compared with this enhanced CaMV 35S promoter (Kay et al., 1987), the level

of GUS activity driven by vff1 promoter was moderate. This may reflect the low proportion of

phloem tissues in plant organs. Indeed, the phloem is only a small fraction of organ tissues,

representing only 0.4% of leaf volume (Sjölund, 1997).

Taken together, the above data showed that the vff1 promoter drives highly specific

expression of the GUS gene in the phloem of transgenic tobacco plants. The phloem-specific

expression coincides with the occurrence of cis-acting elements detected within the vff1


88

promoter sequence (III.2.3) that are similar to phloem-specific elements found on several

promoters from plants, Agrobacterium and viruses (IV.2.1).

Furthermore, these results indicate that there may be similar transcription factors in tobacco

and V. faba that regulate expression of the promoter. It is known that some plant promoters

retain specific expression patterns in different plant species (Chen, G. et al., 1994; Klöti, A. et

al., 1999; Jefferson, R. A. et al., 1987; Katagiri, F. et al., 1992; Medberry, S. L. and

Olszewiki, N. E. 1993; John, M. and Petersen, M., 1994) while others do not (Gallusci, P. et

al., 1994; Medberry, S. L. et al., 1992).

IV.2.3 Differential expression pattern driven by vff1 promoter in the sieve element-

companion cell complex

Histochemical analysis of Vff1P-GUS plants showed that the expression pattern driven by the

vff1 promoter was confined to companion cells (Figure III-19) of mature transgenic N.

tabacum leaves. In addition, it was also observed a slight GUS activity in some sieve

elements of young phloem tissue (data not shown). Since Forisomes are found within sieve

elements and considering that enucleated sieve elements are thought to be incapable of protein

synthesis, the specific vff1 promoter expression in companion cell suggested that VFF1, a

subunit of the Forisomes, might be synthesized in companion cells and transported into sieve

elements through plasmodesmata and functional folded in the sieve elements.

Experiments performed in vitro, showed that reversible transitions between a condensed and a

dispersed state of Forisomes can be repeated several times by addition of Ca2+ and/or EDTA

(Knoblauch et al., 2001). However, it was likewise observed that after some reaction cycles

the conformation of the protein bodies in the condensed and/or dispersed condition is no

longer possible. This indicates that the Forisomes might undergo a loss in functionality due to

alterations in their structure. In addition, the fibrilar structure of the Forisomes together with

their reported function involved in the formation of slime plugs upon wounding of the sieve

elements (Knoblauch and van Bel, 1998; Knoblauch et al., 2001), leads to the assumption that

one or several subunits are involved in the structure of the Forisomes. Possibly, the

accumulation of structural P-protein fibres observed by electron microscopy of crystalline P-

proteins (Arsanto, 1982) could refer to an evolutive connection and the possibility that both

structures are assembled by the same subunits. The function of these two phloem proteins in

plugging the sieves elements upon wounding would explain the protein biosynthesis of

individual subunits in the companion cells and their subsequent transport to the sieve

elements for the repair of the proteins. Hence, the delivery of one or several subunits of the

Forisome after differentiation of the sieve element from the companion cell would be

conceivable reinforcing the hypothesis of the transport of VFF1 by the PPUs in the sieve

elements, as described for several proteins (Fisher et al., 1992).


89

Based on experiments using transgenic plants, snowdrop lectin and GFP have been reported

to traffic into sieve elements in N. tabacum (Shi et al. 1994, Imlau et al., 1999). Moreover,

Fukuda et al. (2005) reported that GUS, which has a larger molecular mass (68 kDa) than

snowdrop lectin (12 kDa) or GFP (27 kDa) enters sieve elements in rice. This is interesting

since the β-glucuronidase gene expression product has a similar molecular mass (68 kDa) to

the Vicia faba Forisome protein of ~70 kDa (VFF1) suggesting the possibility of being

transported to the sieve elements by an analogous process. Large proteins were suggested to

traffick selectively from CC to SE (Fisher and Cash-Clark, 2000; Oparka and Santa Cruz,

2000; Wu et al., 2002), with mechanisms of selectivity that are unknown. It was previously

reported that the selective traffic of a protein from CC to SE, is presumably mediated by

molecular recognition (Itaya, A. et al., 2002). Such selective protein traffic may account for

the presence of proteins of 60 to 200 kD in the phloem exudate of many plant species

(Balachandran et al., 1997; Hayashi et al., 2000). In some cases, a protein may be anchored to

membranes and cleavage of the protein may precede active traffic from CC to SE

(Xoconostle-Cázares et al., 2000).

In addition, previous microinjection experiments demonstrated that 10 kDa, but not 40 kDa,

fluorescent dextran could move through plasmodesmata between sieve elements and

companion cells of Vicia faba (Kempers and van Bel, 1997). In O. sativa, direct injection

experiments produced similar results: that 3 kDa dextran could move through the

plasmodesmata between sieve elements and companion cells, but 42 kDa dextran could not

(Fujimaki et al., 2000). Dextrans of 3, 10 and 40 kDa have Stokes’ radii of approximately 1.2,

2.0 and 4.3 nm, respectively (Fisher and Cash-Clark, 2000), suggesting that the size exclusion

limit of the sieve element-companion cell boundary is at least 1.2 nm in V. faba and 2.0 nm in

O. sativa. However, these results do not exclude the possibility of a different mechanism of

transport taking place in V. faba which might facilitate the movement of larger molecules

between companion cells and sieves elements. In this respect, it is worthwhile to cite the work

of Fukuda et al. (2005) who showed that GUS, with a Stokes’ radius of 3.3 nm (Fisher and

Cash-Clark, 2000), could enter the sieve elements. Some phloem proteins, like C. maxima

PP2 and CmPP16, R. communis glutaredoxin and cystatin, and O. sativa TRXh, were reported

to increase the size exclusion limit of mesophyll plasmodesmata and facilitate their own cell-

to-cell movement after microinjection (Balachandran et al., 1997; Ishiwatari et al., 1998;

Xoconostle-Cázares et al., 1999). To explain the cell-to-cell movement of proteins larger than

the size exclusion limit of plasmodesmata, protein unfolding was proposed. Large proteins

like GUS might be unfolded prior to moving through plasmodesmata and then refolded in the

sieve elements. Indeed, homologues of two chaperones, rubisco-subunit-binding protein and

cyclophilin, have been detected in sieve-tube exudates from T. aestivum, O. sativa, Yucca

filamentosa, C. maxima, Robinia pseudoacacia and Tilia platyphyllos (Schobert et al., 1998).

Moreover, a small heat-shock protein has been detected in phloem sap from O. sativa (Fukuda

et al., 2004). Microinjection experiments on N. tabacum mesophyll cells revealed that TRXh


90

increased the size exclusion limit of plasmodesmata and modified their own cell-to-cell

movement, and that certain structural motifs of TRXh are necessary for cell-to-cell movement

of this protein (Ishiwatari et al., 1998).

In summary, it is suggested that the efficient transport of the proteins comprising the

Forisomes from companion cells to sieve elements might need specific structural motifs,

which are recognized by plasmodesmata carriers, and modify cell-to-cell movements of these

proteins. Nevertheless, further analysis of VFF1 by microinjection experiments in V. faba

and/or immunolocalization will be required to clarify how this protein is delivered to the sieve

elements.

On the other hand, the expression of VFF1 in sieve elements of young phloem tissue might be

in part correlated with the presumption of the presence of promoter activity in the early stages

of sieve elements differentiation. Indeed, the presence of crystalline P-proteins (Forisomes) in

the early stages of sieve elements development has been reported (Esau, 1971). Besides,

several authors (Wergin and Newcomb, 1970; Wergin et al., 1975) observed condensed

crystalline P-proteins in differentiating sieve elements of the Fabaceae. This accumulation of

fibril material in the proximity of ribosomes in immature sieve elements represents therefore

the preliminary stages of the Forisomes. Thus, the observed GUS expression in the sieve

elements of young phloem tissue of transgenic N. tabacum might be reflective of the activity

of the identified vff1 promoter in the differentiating sieve elements still capable of protein

biosynthesis.

The expression of different fluorescent reporter enzymes (e.g. GFP, YFP, DSRed) under

control of the vff1 promoter will give the possibility to gain more insight into the promoter

activity in vivo.

IV.2.4 Developmental expression pattern of vff1 promoter in different maturation stages

In transgenic tobacco the vff1 promoter directed GUS expression in the phloem cells of the

vasculature in leaves, stems, flowers and roots indicating as highly tissue-specific regulation.

To determine if the promoter expression pattern is developmentally regulated, promoter-GUS

studies were performed on T1 vff1P-GUS tobacco seedlings.

IV.2.4.1 Vff1 promoter expression pattern in roots of N. tabacum

In transgenic vff1P-uidA tobacco plants, expression of β-glucuronidase in developing phloem

tissue and, especially, in the meristematic and elongation zones at root tips of germinating T1

seedlings was detected (Fig. III-21D). During root elongation, this expression pattern was

restricted to the meristematic and elongation zones at root tips. In the tips of fully developed


91

roots, vff1 expression was no longer detectable in accordance to the cession of developing

phloem synthesis.

The most apical 2mm of the root tip, which showed strong β-glucuronidase activity, is a

region of the root that includes the root meristem, the elongation zone, and the differentiation

zone where lateral root formation is initiated (Schiefelbein and Benfey, 1994; Dolan and

Davies, 2004). The primary root meristem has many cells undergoing rapid cell division

(Beeckman et al., 2001; Birnbaum et al., 2003). It has also been observed (van der Weele et

al., 2003) that the root tip contains two distinct zones with constant elongation rates, lower in

the meristematic zone (0 to 0.5 mm from the tip) and much higher in the elongation zone (0.5

to 1.2 mm from the tip). In the differentiation zone, the growth rate decreases to zero.

Some roots are genetically determined to have the capacity to undergo additional radial

growth, but other roots do not. Only dicotyledons have this capacity and it is more likely to

occur in thicker, lower-order lateral roots. This radial growth is called secondary growth to

distinguish it from primary growth at the root apex. Secondary growth occurs when new

meristematic tissue forms in a ring around the vascular cylinder of roots and produces new

xylem inwards and new phloem outwards (Dean, G. et al., 2004). This would explain the

GUS expression observed in growing lateral root (Fig. III-21C, E and F). Thus, during the

early stages of lateral root formation, vff1 promoter expression seemed to be restricted to the

developing phloem tissue (Fig. III-21F).

In summary, these results provide convincing evidence that indicate not only a spatial but also

a temporal regulation of the expression pattern driven by the vff1 promoter in roots of tobacco

plants.

IV.2.4.2 Vff1 promoter expression pattern in leaves of N. tabacum

Strong GUS activity was also detected in the first leaves and shoot apical meristem of

vff1P::GUS seedling suggesting a preferential expression of vff1 promoter in developing

vascular tissue and especially in young phloem tissue of tobacco plants. In addition, a

particular expression pattern of GUS expression was observed in the veins of tobacco leaves

(Fig. III-23).

The leaf vein classification of dicotyledonous plants is based largely on anatomical

observations (e.g., Avery, 1933). In anatomical terms, minor veins do not have rib tissue that

protrude beneath the surface of the lamina (Esau, 1965). However, from a physiological and

developmental perspective, minor veins are those that are immature in sink leaves and do not

participate in phloem unloading (Turgeon, 1987; Roberts et al., 1997) but mature during the

sink-source transition (Turgeon and Webb, 1976). The anatomical, developmental, and

functional roles of leaf venation have been well studied in tobacco. The veins of tobacco


92

leaves have been subdivided into classes, based on cell numbers rather than branching pattern,

which can be misleading (Ding et al., 1988).

GUS expression was detected in the phloem of developing leaves (Fig. III-22). In mature

leaves GUS activity was only detected in class-I (midrib) veins, and class-II veins (branching

from the midrib) (Figure III-23A). In class-III veins, staining was first evident in isolated

patches, often at branch points where class-IV veins merged with them (Figure III-23B). For

class-V veins no staining was observed (Figure III-23B). Staining decreased in intensity

toward the finest veins. This finding was interesting since in developing leaves there is a

basipetal gradient in maturity, the distal end being more mature than the base. As a leaf

develops, the class I and II veins undergo differentiation whereas class III veins have not yet

differentiated. In sink tissue, class IV and V veins are still immature. The phloem in these

veins is still undifferentiated (Turgeon and Webb, 1976), class IV and V veins mature

progressively toward the finest ramifications of the vein network (Turgeon and Webb, 1976),

beginning at the junction of the class III veins (Roberts et al., 1997). According to this, it

became obvious that these results confirmed a developmental expression pattern of vff1

promoter.

It seems likely that structural vein maturation is developmentally programmed (Wright et al.,

2003). The activation of the vff1 promoter within the veins of tobacco suggests that the

promoter responds to a regulatory system. Moreover, the reduced staining in late veins

development stages suggests that phloem differentiation may affect the vff1 promoter

regulation. Nevertheless, the nature of these signals, and whether the vff1 promoter responds

to the same conserved signals in different plant species, remains to be determined.

Taken together, the overall temporal and tissue-specific regulation of the vff1 promoter are

indicative of the expression of Forisomes mainly in the first stage of phloem development,

which is in turn related to the biological function of these proteins in the sieve elements of V.

faba as part of a defence mechanism against the loss of assimilates upon wounding

(Knoblauch, M. and Peters, W., 2004). Nevertheless, since the vff1 promoter was introduced

into tobacco, further studies are required to access whether the expression pattern of the vff1P-

GUS construct correlates with phloem development in V. faba.

Moreover, experiments combining GUS expression and in situ RNA hybridization would be

of interest to gain insight in the development profile of the expression pattern driven by the

vff1 promoter.

IV.2.5 Vff1 promoter activation during the sink-source transition

In cotyledons, which act solely as sources, and in the first formed leaves, a functional minor

vein network has not formed by the time the tissue becomes a source (Turgeon and Webb,


93

1976; Turgeon, 1989; Wright et al., 2003). In sink tobacco leaves, it has been suggested that

the earliest differentiation takes place in the external phloem at the tip of the midrib and that

maturation progresses basipetally (Avery, 1933). However, other reports claim that

maturation of the midrib and major veins occurs acropetally (Esau, 1960; Turgeon and Webb,

1973). Although the present work does not provide any information regarding the structural

maturation of the major veins, it does demonstrate an acropetal progression in the vff1

promoter expression pattern.

Taken together, this can be correlated with the observed absence of staining in cotyledons and

first pair of leaves in vff1P::GUS N. tabacum seedlings whereas it was evident an acropetal

vff1 promoter expression pattern in leaves undergoing the sink-source transition (Fig. III-22).

This might be a consequence of a down-regulation of vff1 promoter expression as the sink-

source transition progresses. The cessation of GUS expression in source tissue of vff1P::GUS

plants undergoing the sink-source transition, suggests that activation of the vff1 promoter is an

accurate marker for the sink-source transition in tobacco leaves.

During the sink-source transition, the minor veins became structurally mature (Turgeon and

Webb, 1973; Turgeon, 1989). Because subunits of Forisomes are thought to be expressed

within the companion cells of mature veins, it could be argued that its expression is linked to

structural maturation of the minor veins, reflecting once again the temporal regulation of the

expression of vff1 promoter.

However, further experiments aiming to identify the factors controlling vff1 promoter

activation and vein maturation, will be required to clarify how putative control points in the

sink-source transition could regulate the vff1 promoter expression pattern in developing

leaves.

IV.2.6 Vff1 promoter expression induced upon wounding

Analyses of vff1 promoter-GUS plants reproducibly gave very strong GUS staining at all sites

where leaves or stem sections were cut before the incubation with the staining solution. This

result suggested that the activity of the vff1 promoter driving this GUS expression might be

enhanced upon wounding however, up to date, convincing evidence is lacking that this is

indeed the case. Therefore, to exclude the possibility that this increased GUS activity at the

sites of wounding may simply result from a better diffusion of substrate into the plant tissue,

cell-free extracts (Roberts et al., 1989; Bauer et al., 1993) should be prepared from untreated

control tissues and from tissues that had been wounded. GUS activities could be determined

in these extracts using the GUS substrate 4-methylumbelliferyl-β-d-glucuronide (MUG),

which yields a fluorescent product after hydrolysis by GUS. Whether GUS-derived

fluorescence indicates an induced expression upon wounding in vff1P::GUS N. tabacum,

would be determined by a comparison to wild-type plants. The absence of GUS-derived


94

fluorescence in the extracts from wild-type plants, from unwounded or wounded tissues, in

contrast to significant GUS activities in transgenic plants might reflect a wounding

enhancement in the promoter expression.

In addition, to confirm these data analysis of potential changes in GUS mRNA levels in tissue

of tobacco transgenic plants at different times after wounding would be required.

IV.2.7 Deletion analysis

Experiments using 5'-upstream deletion mutants cloned unidirectional into a promoter-less

GUS reporter vector, were conducted to define the region of the vff1 promoter involved in its

organ-, cell-specific and developmentally regulated expression pattern. Even after several

attempts, it was not possible to obtain conclusive evidence. As mentioned above, a striking

feature of the vff1 promoter is its tissue-specific expression together with its developmental

regulation. This interpretation may explain the absence of substantial differences in GUS

activities in the analysis of vff1 promoter in transiently transformed tobacco leaves. Assuming

that the synthesis of Forisomes is taking place during the early stages of sieve element

development and that the subsequent differentiation of the sieve element from the companion

cell imply only the delivery of subunits of the Forisome, thus evoking the possibility of a

diminished protein synthesis, the low levels of GUS expression in mature vacuum-infiltrated

leaves denote an inadequate method for promoter studies. In addition, experiments performed

in protoplasts showed a low GUS activity driven by vff1 promoter which excludes the

possibility of using it as a suitable method.

An alternative approach will be the investigation of the regulation of the vff1 promoter

through the characterization of stable transformed tobacco plants.

It is interesting to note that, though many phloem-specific promoters have been characterized

from vascular plants, plant viruses and phytopathogenic bacteria, the unique advantages of

using phloem-specific promoters derived from plant genes, are attractive in plant

biotechnology (e.g. for the targeted expression of molecules in the phloem against vascular

pests or pathogens). Therefore, the vff1 promoter could be of practical value in

biotechnological applications, especially for genetic engineering of tobacco and possibly other

dicotyledonous plants when the expression of a foreign gene is required mainly in the phloem.


95

IV.3 Conclusion and future prospects

Previous studies indicated that Forisomes perform mechanical work by deforming

anisotropically without direct interaction with a chemical energy supply such as ATP. It has

also been reported that they are extremely sensitive to their regulative agent, Ca2+, but are

structurally stable if kept under appropriate conditions (Knoblauch et al., 2003). It has been

proposed that, as the response can be evoked alternatively by changes of pH, it is possible to

drive Forisome contraction and curvature electrically by electrotitration. Because Forisomes

consist of protein, they lend themselves to biomolecular engineering, opening the possibility

to create variants of format and functionality. Owing to this combination of desirable

properties, Forisome proteins appear to provide a useful paradigm of peptide actuators in the

rapidly evolving fields of biomimetic robotics, microfluidics and microscale engineering.

Data presented in this study demonstrated the identification and characterization of a cDNA

clone encoding a Vicia faba Forisome protein (VFF1). From the characterization of the

different motifs identified within the aminoacid VFF1 sequence, it was evident that this

protein comprises several structural features related to helices and coiled-coil motive

formation. These structural characteristics, correlated with the observed Ca2+ response in vitro

(Knoblauch et al., 2003), indicated a possible Ca2+ dependent reaction of the Forisomes in

which the VFF1 protein could be involved. Nevertheless, another possibility to explain the

comformational change undergone as a response to this divalent cation is that as yet

unidentified proteins, with known Ca2+-binding domains or pH-responsive domains, might

contribute to the structure of Forisomes. Therefore, further experiments to look at protein

interactions within Forisomes, e.g. cross linking of Forisomes followed by tryptic digest and

mass spectrometry, will provide additional information on Forisome structure.

Considering technical applicability, it would appear desirable if Forisome action could be

controlled. Accordingly, it will be crucial to provide complete and precise data for their

protein composition. The question arises whether there are additional proteins which are

involved in the structure of the Forisomes, however a probable interaction of such proteins

with the VFF1 might lead to their identification. Therefore, a yeast-2-hybrid-system (Fields,

S. and Song, O., 1989) could be used.

Additionally, cloning and recombinant expression of the isolated vff1 gene permitted the

generation of VFF1-specific polyclonal antibodies. Furthermore, Forisome-specific

polyclonal antibodies were obtained. By means of western blot analysis together with

confocal immunofluorescence analysis, immunological evidence of vff1 gene encoding a

Forisome protein is reported here.

Future work will focus on the identification of additional Forisome genes and their molecular

characterization. Expression of potential yet unidentified Forisomes genes will also permit the


96

production of specific antibodies to provide new insights into the structure of the Forisome

and to uncover some unifying principal underlying their conformational change and related

biological function. Furthermore, an accurate analysis of the antibody specificity would be

conceivable by means of electron micrographs, after embedding of the Forisome and

immunogold detection. As a complete analysis of the potentially further Forisomes genes was

not possible within the time frame of this PhD thesis, the forthcoming cloning and

characterization of these proteins will provide information on their involvement in the

structure of the Forisomes. Cloning and characterization of the vff1 gene described here has

opened up this important opportunity.

Within this thesis, the isolation and characterization of vff1 promoter is also reported. Its

activity as well as tissue specificity was confirmed in transgenic N. tabacum plants using

GUS as a reporter system. In addition, sequence analysis of the promoter region of vff1 gene

revealed the presence of two conserved motifs which have already been reported for several

phloem-specific promoters. Significantly, these findings indicate that the 5′-upstream region

of vff1 functions as a promoter that drives preferential expression of the uidA gene to the

phloem of transgenic tobacco plants. Besides the tissue-specificity a spatial and temporal

regulation of vff1 promoter observed during development provide evidence of the expression

of Forisomes mainly in the first stage of phloem development, which is in turn related to the

biological function of these proteins in the sieve elements of V. faba as part of a defence

mechanism against the loss of assimilates upon wounding (Knoblauch and Peters, 2004).

Nevertheless, since the vff1 promoter was introduced into tobacco, Vicia faba in planta

transformation will be interesting to carry out to access whether the expression pattern of the

vff1P-GUS construct correlates with phloem development in this Fabaceae.

These results also indicated that there may be similar transcription factors in tobacco and V.

faba that regulate expression of the promoter. Central to both basic and applied molecular

biology is the identification of cis elements that contributes to the expression of promoters.

Accordingly, experiments using 5'-upstream deletion mutants were conducted to define the

region of the vff1 promoter involved in its organ-, cell-specific and developmentally regulated

expression pattern. Nevertheless, it was not possible to obtain conclusive evidence. An

alternative approach will be the investigation of the regulation of the vff1 promoter through

the characterization of stable transformed tobacco plants. Moreover, experiments combining

GUS expression and in situ RNA hybridization will be crucial to gain insight in the

development profile of the expression pattern driven by the vff1 promoter.

In addition, the expression of different fluorescent reporter enzymes (e.g. GFP, YFP, DSRed)

under control of the vff1 promoter will give the possibility to gain further insight into the

promoter activity in vivo.

Chapter V Summary ___________________________________________________________________________

97

V Summary

Forisomes are phloem-specific proteins of the family of the Fabaceae which undergo a rapid,

reversible and ATP-independent comformational change when stimulated by variations in

Ca2+ levels or pH. These proteins, present in the sieve elements, switch instantaneously

between a dispersed and a condensed conformation, allowing them to control the stream of

photo-assimilates in the phloem after wounding by sealing the conducting tubes.

Isolation of Forisomes from Vicia faba permitted the sequencing of peptides from which

specific oligonucleotides were designed for library screening. In addition, polyclonal

Forisome-specific antibodies were obtained. First attempts to identify Forisome-encoding

genes were performed by hybridization screening of subtracted and non-subtracted Vicia faba

derived cDNA libraries, however, no successful results could be retrieved. In an alternative

approach, immunoscreening along with PCR screening of cDNA expression library of Vicia

faba plant tips was carried out. Neither the identification of cDNAs encoding antigenic

Forisome fusion proteins nor the allocation of DNA- and/or DNA fragments to the Forisome

genes was possible.

Aligning the isolated Forisome peptide sequences from Vicia faba with a recently published

EST-library for Medicago truncatula – the model plant for Fabaceae – enabled the

identification of patches of amino acids conserved among the two species belonging to the

same DNA sequence. This important finding provided the basis for the isolation of genes

encoding Forisome proteins. Hence, the rapid amplification of cDNA ends (RACE) together

with genome walking was used to obtain the full-length cDNA as well as the genomic

sequence of the Forisome gene vff1.

Sequence analysis of the amplified vff1 was performed and even thought no well-known Ca2+-

binding motif could be identified, different domains which might be involved in Ca2+

dependent reaction of the Forisomes were recognized within the vff1 gene.

Cloning and recombinant expression of the isolated vff1 gene in E. coli permitted the

generation of VFF1-specific polyclonal antibodies. Immunological evidence of the isolated

vff1 gene encoding a Forisome protein was obtained by means of western blot analysis and

confocal immunofluorescence techniques.

Further experiments were performed with the aim of identifying and cloning the vff1 gene 5’-

flanking region. The putative promoter of the vff1 gene was isolated from genomic DNA by

genome walking and its activity as well as tissue specificity was confirmed in transgenic

tobacco plants using GUS as a reporter system. Sequence analysis revealed two conserved

motifs shared with several previously reported phloem-specific promoters. Taken together,

these results indicate that the 5′-upstream region of vff1 functions as a promoter (designated

vff1P) that directs preferential expression of the uidA gene to the phloem of transgenic

Chapter V Summary ___________________________________________________________________________

98

tobacco plants. Besides the tissue-specificity a spatial and temporal regulation of vff1P was

observed during development of transgenic tobacco seedlings.

Chapter VI References ___________________________________________________________________________

99

VI References Andrade, M.A., Perez-Iratxeta, C., Ponting, C.P. (2001) Protein repeats: structures, functions, and evolution. J. Struct Biol. 134: 117-131. Arsanto, J.P. (1982) Observations on P-protein in dicotyledons. Substructural and developmental features. Am. J. Bot. 69: 1200-1212. Ausubel, F.M., Brent, R., Kingston, R.F., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K. (eds) (1995) Current protocols in molecular biology. John Wiley & Sons, Inc., New York. Avery, G.S.J. (1933) Structure and germination of tobacco seed and the developmental anatomy of the seedling plant. American Journal of Botany 20: 309-327. Balachandran, S., Xiang, Y., Schobert, C., Thompson, G.A., Lucas, W.J. (1997) Phloem sap proteins from Cucurbita maxima and Ricinus communis have the capacity to traffic cell to cell through plasmodesmata. Proc. Natl Acad. Sci. USA 94: 14150-14155. Bauer, R., Paltauf, F., Kohlwein, S.D. (1993) Functional expression of bacterial β-glucuronidase and its use as a reporter system in the yeast Yarrowia lipolytica. Yeast 9: 71-75. Beeckman, T., Burssens, S., Inze, D. (2001). The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52: 403-411. Behnke, H.D. (1981) Sieve-element characters. Nord. J. Bot. 1: 381-400. Behnke, H.D. (1989) Structure of the phloem. In transport of Photoassimilates. Baker, D.A., Milburn, J.A. (eds), pp. 79-137, Longman, Harlow, UK. Behnke H.D, Sjölund, R.D. (1990) Sieve elements, pp. 305, Springer, Berlin, Heidelberg, New York. Behnke, H.D. (1991a) Distribution and evolution of forms and types of sieve-element plastids in the dicotyledons. Aliso 3: 167-182. Behnke, H.D. (1991b) Nondispersive protein bodies in sieve elements: A survey and review of their origin, distribution and taxonomic significance. IAWA Bull 12: 143-175. Benfey, P.N., Chua, N.-H. (1989) Regulated genes in transgenic plants. Science 244: 174-181. Berg, H.C. (1974) Dynamic properties of bacterial flagellar motors. Nature 249: 77-79. Bhattacharyya-Pakrasi, M., Peng, J., Elmer, J.S., Laco, G., Shen, P., Kaniewska, M.B., Kononowicz, H., Wen, F., Hodges, T.K., Beachy, R.N. (1993) Specificity of a promoter from the rice tungro bacilliform virus for expression in phloem tissues. Plant J. 4: 71-79. Birnbaum, K., Shasha, D.E., Wang, J.Y., Jung, J.W., Lambert, G.M., Galbraith, D.W., Benfey, P.N. (2003) A gene expression map of the Arabidopsis root. Science 302: 1956-1960.


100

Bishia, W.R., Rappuoli, R., Murphy, J.R. (1987) High level expression of a proteolytically sensitive diphtheria toxin fragment in Escherichi coli. J. Bacteriol. 169: 5140-5151. Blackwood, E.M., Kadonaga, J.T. (1998) Going the distance: Acurrent view of enhancer action. Science 281: 60-63. Bottino, D., Mogilner, A., Roberts, T., Stewart, M., Oster, G. (2001) How nematode sperm crawl. J. Cell Sci. 115: 367-384. Brauer, M., Zhong, W.-J., Jelitto, T., Schobert, C., Sanders, D., Komor, E. (1998) Free calcium ion concentration in the sieve-tube sap of Ricinus communis L. seedlings. Planta 206: 103-107. Brears, T., Walker, E.L., Coruzzi, G.M. (1991) A promoter sequence involved in cell-specific expression of the pea glutamine synthetase GS3A gene in organs of transgenic tobacco and alfalfa. Plant J. 1: 235-244. Bullough, F.M., Hughson, F.M., Skehel, J.J., Don C.W. (1994) Structure of influenza haemagglutinin at the pH of membrane fusion. Nature 371: 37-43. Burkhard, P., Kammerer, R.A., Steinmetz, M.O., Bourenkov, G.P., Aebi, U. (2000a) The coiled-coil trigger site of the rod domain of cortexillin I unveils a distinct network of interhelical and intrahelical salt bridges. Structure 8: 223-230. Burkhard, P., Meier, M., Lustig, A. (2000b) Design of a minimal protein oligomerization domain by a structural approach. Protein Sci. 9: 2294-2301. Burkhard, P., Stetefeld, J., Strelkov, S.V. (2001) Coiled coils: a highly versatile protein folding motif. Trends Cell Biol. 11: 82-88. Burton, D.R. (1991) Human and mouse monoclonal antibodies by repertoire cloning. Trends Biotechnol. 9: 169-175. Caissard, J.C., Guivarc’h, A., Rembur, J., Abdelkrim, A., Chriqui, D. (1994) Spurious localizations of diX-indigo microcrystals generated by the histochemical GUS assay. Transgenic Res. 3: 176-181. Cavener, D.R., Ray, S.C. (1991) Eukaryotic start and stop translation sites. Nucleic Acids Res. 19: 3185-3192. Chazin, W. J. (1995) Releasing the calcium trigger. Nature Struct. Biol. 2: 707–710. Chen, G., Müller, M., Potrykus, I., Hohn, T., Fütterer, J. (1994) Rice tungro bacilliform virus: transcription and translation in protoplasts. Virology 204: 91-100. Cho, C.H., Kammerer, R.A., Lee, H.J., Steinmetz, M.O., Ryu, Y.S., Lee, S.H., Yasunaga, K., Kim, K.T., Kim, I., Choi, H.H., Kim, W., Kim, S.H., Park, S.K., Lee, G.M., Koh, G.Y. (2004) COMP-Ang1: A designed angiopoietin-1 variant with nonleaky angiogenic activity. Proc. Natl. Acad. Sci. USA 101: 5547-5552.


101

Coligan, J.E., Dunn, B.M., Ploegh, H.L., Speicher, D.W., Wingfield, P.T. (eds.) (1995) Current protocols in protein science. John Wiley & Sons, New York. Crick, F.C.H. (1953) The packing of α-helices: simple coiled coils. Acta Crystallographica 6: 689-697. Cronshaw, J., Esau, K. (1967) Tubular and fibrillar components of mature and differentiating sieve elements. J. Cell Biol. 34: 801-815. Cronshaw, J. (1981) Phloem structure and function. Annu. Rev. Plant Physiol. 32: 465-484. da Silva, A. C. R., Reinach, F.C. (1991) Calcium binding induces conformational changes in muscle regulatory proteins. Trends Biochem. Sci. 16:53–57. Dean, G., Casson, S., Lindsey, K. (2004) KNAT6 gene of Arabidopsis is expressed in roots and is required for correct lateral root formation. Plant Mol. Biol. 54: 71-84. DeWitt, N.D., Harper, J.F., Sussman, M.R. (1991) Evidence for a plasma membrane proton pump in phloem cells of higher plants. Plant J. 1: 121-128. Diatchenko, L., Lau, Y.-F.C., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov, E.D., Siebert, P.D. (1996) Suppression subtractive hybridization: A method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. Sci. USA 93: 6025-6030. Diatchenko, L., Chenchik, A., Siebert, P. (1998) Suppression subtractive hybridization: A method for generating subtracted cDNA libraries starting from poly (A+) or total RNA. In RT-PCR Methods for Gene Cloning and Analysis. Siebert, P. & Larrick, J. (eds), pp. 213-239, BioTechniques Books, MA. Ding, B., Parthasarathy, M.V., Niklas, K., Turgeon, R. (1988) A morphometric analysis of the phloem-unloading pathway in developing tobacco leaves. Planta 176: 307-318. Dolan, L., Davies, J. (2004). Cell expansion in roots. Curr. Opin. Plant Biol. 7: 33-39. Dower, W.J., Miller, J.F., Ragsdale, C.W. (1988) High efficiency transformation of E.coli by high voltage electroporation. Nucleic Acids Res. 16: 6127-6145. Dry, I., Krake, L., Mullineaux, P., Rezaian, A. (2000) Regulation of Tomato leaf curl viral gene expression in host tissues. Mol. Plant Microbe Interact. 13: 529-537. Dubey, A., Mavroidis, C., Thornton, A., Nikitczuk, K.P., Yarmush, M.L. (2003) Viral Protein Linear (VPL) Nano-Actuators. Proceedings of the 2003 IEEE - NANO Conference, San Francisco, CA, Vol. 2, pp. 140-143. Eckert, D. M., Kim, P. S. (2001) Design of potent inhibitors of HIV-1 entry from the gp41 N-peptide region. Proc. Natl. Acad. Sci. USA 98: 11187-11192. Ehlers, K., Knoblauch, M., van Bel, A.J.E. (2000) Ultrastructural features of well-preserved and injured sieve elements: minute clamps keep the phloem transport conduits free for mass flow. Protoplasma 214: 80-92.


102

Eleftheriou, E.P. (1990) Monocotyledons. In Sieve Elements. Behnke, H.D., Sjölund, R.D. (eds), pp. 139-159, Springer, Berlin. Ellerstrom, M., Stalberg, K., Ezcurra, I., Rask, L. (1996) Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription. Plant Mol. Biol. 32: 1019-1027. Emanuelsson, O., Nielsen, H., Brunak, S., Heijne, G. (2000) Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol. 300: 1005–1016. Esau, K. (1960) Anatomy of Seed Plants, Ed 2., pp. 321-349, John Wiley & Sons, New York. Esau, K. (1965) Plant Anatomy. John Wiley & Sons, New York. Esau, K. (1969). The Phloem. In Handbuch der Pflanzenanatomie. Zimmermann, W., Ozenda, P., Wulff, H.D. (eds), Vol. 5, no. 2. Gebruder Borntraeger, Berlin. Esau, K. (1971) Development of P-protein in sieve elements of Mimosa pudica. Protoplasma 73: 225-238. Esau, K., Thorsch, J. (1985) Sieve plate pores and plasmodesmata, the communication channels of the symplast: ultrastructural aspects and developmental relations. Am. J. Bot. 72: 1641-1653. Eschrich, W., Heyser, W. (1975) Biochemistry of phloem constituents. In Transport in Plants I. Phloem Transport. Zimmermann, M.H., Milburn, J.A. (eds), pp. 101-136, Springer-Verlag, Berlin, Heidelberg, New York. Evert, R.J. (1990) Dicotyledons. In Sieve Elements. Behnke, H.D., Sjölund, R.D. (eds), pp. 103-137, Springer, Berlin. Faktor, O., Kooter, J. M., Dixon, R. A., Lamb, C. J. (1996) Functional dissection of a bean chalcone synthase gene promoter in transgenic tobacco plants reveals sequence motifs essential for floral expression. Plant Mol. Biol 32: 849-859. Falke, J. J., Drake, S. K. Hazard, A. L., Peersen, O. B. (1994) Molecular tuning of ion binding to calcium signaling proteins. Quart. Rev. Biophys. 27: 219–290. Farah, C.S., Reinach, F.C. (1999) Regulatory properties of recombinant tropomyosins containing 5- hydroxytryptophan: Ca2+-binding to troponin results in a conformational change in a region of tropomyosin outside the troponin binding bite. Biochemistry 38: 10543-10551. Fasshauer, D., Otto, H., Eliason, W.K., Jahn, R., Brunger, A.T. (1997). Structural changes are associated with soluble N-ethylmaleimide-sensitive fusion protein attachment protein receptor complex formation. J. Biol. Chem. 272: 28036-28041. Fields, S., Song,O.-K. (1989) A novel genetic system to detect protein-protein interactions. Nature 340: 245-246.


103

Fischer, R., Liao, Y. C., Hoffmann, K., Schillberg, S., Emans, N. (1999) Molecular farming of recombinant antibodies in plants. Biol. Chem. 380: 825-839. Fisher, D.B. (1975) Structure of functional soybean sieve elements. Plant Physiol. 56: 555-569. Fisher, D.B., Wu, Y., Ku, M.S.B. (1992) Turnover of soluble proteins in the wheat sieve tube. Plant Physiol. 100: 1433-1441. Fisher, D.B., Cash-Clark, C.E. (2000) Sieve tube unloading and post-phloem transport of fluorescent tracers and proteins injected into sieve tubes via severed aphid stylets. Plant Physiol. 123: 125-137. Fraley, R.T., Rogers, S.G., Horsch, R.B., Sanders, P.R., Flick, J.S., Adams, S.P., Bittner, M.L., Brand, L.A., Flink, C.L., Fry, J.S., Galluppi, G.R., Goldberg, S.B., Hoffmann, N.L., Woo, S.C. (1983) Expression of bacterial genes in plant cells. Proc. Natl. Acad. USA 80: 4803-4807. Frangioni, J.V., Neel, B.G. (1993) Solubilization and purification of enzymatically active glutathione S-transferase (pGEX) fusion proteins. Anal. Biochem. 210: 179-187. Frank, S., Lustig, A., Schulthess, T., Engel, J., Kammerer, R.A. (2000) A distinct seven-residue trigger sequence is indispensable for proper coiled-coil formation of the human macrophage scavenger receptor oligomerization domain. J. Biol. Chem. 275: 11672-11677. Fujimaki, S., Fujiwara, T., Hayashi, H. (2000) A new method for direct introduction of chemicals into a single sieve tube of intact rice plants. Plant Cell Physiol. 41: 124-128. Fujiwara, T., Beachy, R.N. (1994) Tissue-specific and temporal regulation of a beta-conglycinin gene: roles of the RY repeat and other cis-acting elements. Plant Mol. Biol. 24: 261-272. Fukuda, A., Okada, Y., Suzui, N., Fujiwara, T., Yoneyama, T., Hayashi, H. (2004) Cloning of the phloem-specific small heat-shock protein from leaves of rice plants. Soil Sci. Plant Nutr. 50: 1255-1262. Fukuda, A., Fujimaki, S., Mori, T., Suzui, N., Ishiyama, K., Hayakawa, T., Yamaya, T., Fujiwara, T., Yoneyama, T., Hayashi, H. (2005) Differential distribution of proteins expressed in companion cells in the sieve element-companion cell complex of rice plants. Plant Cell Physiol. 46: 1779-86. Gallusci, P., Salamini, F., Thompson, R.D. (1994) Differences in cell type-specific expression of the gene Opaque 2 in maize and transgenic tobacco. Mol. Gen. Genet. 244: 391-400. Grigorian, A.L., Bustamante, J.J., Hernandez, P., Martinez, A.O., Haro, L.S. (2005) Extraordinarily stable disulfide-linked homodimer of human growth hormone. Protein Sci. 1: 902-13. Guevara-García, A., Mosqueda-Cano, G., Argüello-Astorga, G., Simpson, J., Herrera-Estrella, L. (1993) Tissue-specific and wound-inducible pattern of expression of the mannopine


104

synthase promoter is determined by the interaction between positive and negative cis-regulatory elements. Plant J. 4: 495-505. Guivarc’h, A., Spena, A., Noin, M., Besnard, C., Chriqui, D. (1996) The pleiotropic effects induced by the rolC gene in transgenic plants are caused by expression restricted to protophloem and companion cells. Transgenic Res. 5: 3-11. Gurskaya, N.G., Diatchenko, L., Chenchik, A., Siebert, P.D., Khaspekov, G.L., Lukyanov, K. A., Vagner, L.L., Ermolaeva, O.D., Lukyanov, S.A., Sverdlov, E.D. (1996) Equalizing cDNA subtraction based on selective suppression of polymerase chain reaction: Cloning of Jurkat cell transcripts induced by phytohemaglutinin and phorbol 12-myristate 13-acetate. Anal. Biochem. 240: 90-97. Hackenbeck, R., Konig, A., Kern, I., van der Linden, M., Keck, W., Billot-Klein, D., Legrand, R., Schoot, B., Gutmann, L. (1998) Acquisition of five high-Mr penicillin-binding protein variants during transfer of high-level β-lactam resistance from Streptoccoccus pneumoniae. J. Bacteriol. 180: 1831-1840. Harbury, P.B., Zhang, T., Kim, P.S., Alber, T. (1993) A switch between two-, three-, and four-stranded coiled coils in GCN4 leucine zipper mutants. Science 262: 1401-7. Harbury, P.B., Kim, P.S., Alber, T. (1994). Crystal structure of an isoleucine-zipper trimer. Nature 371: 80-83. Harrison, B., Zimmerman, S.B. (1986) T4 Polynucleotide Kinase: Macromolecular Crowding Increases the Efficiency of Reaction at DNA Termini. Anal Biochem. 158: 307-315. Hartig, T. (1837) Vergleichende Untersuchungen über die Organisation des Stammes der einheimischen Waldbäume. Jahresber. Fortschr. Forstwiss. Forstl. Naturkd. 1: 125-168. Hatzfeld, M. (1999) The armadillo family of structural proteins. Int. Rev. Cytol. 186: 179-224. Hauffe, K.D., Lee, S.P., Subramaniam, R., Douglas, C.J. (1993) Combinatorial interactions between positive and negative cis-acting elements control spatial patterns of 4CL-1 expression in transgenic tobacco. Plant J. 4: 235–253. Hay, J.M., Jones, M.C., Blakebrough, M.L., Dasgupta, I., Davies, J.W., Hull, R. (1991) An analysis of the sequence of an infectious clone of rice tungro bacilliform virus, a plant pararetrovirus. Nucleic Acids Res. 19: 2615-2621. Hayashi, H., Fukuda, A., Suzui, N., Fujimaki, S. (2000) Proteins in the sieve element-companion cell complexes: their detection, localization and possible functions. Aust. J. Plant Physiol. 27: 489-496. He, X., Hohn, T., Futterer, J. (2000) Transcriptional Activation of the Rice Tungro Bacilliform Virus Gene Is Critically Dependent on an Activator Element Located Immediately Upstream of the TATA Box. J. Biol. Chem. 275: 11799-11808. Hedley, P.E., Maddison, A.L., Davidson, D., Machray, G.C. (2000) Differential expression of invertase genes in internal and external phloem tissues of potato (Solanum tuberosum L.). J. Exp Bot. 51: 817-821.


105

Hedrick, S.M., Cohen, D.I., Neilson, E.A., Davis, M.M. (1984) Isolation of cDNA clones encoding T cell-specific membrane-associated proteins. Nature 308:149-153. Hehn, A., Rohde, W. (1998) Characterization of cis-acting elements affecting strength and phloem specificity of the coconut foliar decay virus promoter. J. Gen. Virol. 79 : 1495-1499. Heidecker, G., Messing, J. (1986) Structural analysis of plant genes. Ann. Rev. Plant Physiol. 37: 439-66. Hérouart, D., Van Montagu, M., Inzé, D. (1994) Developmental and environmental regulation of the Nicotiana plumbaginifolia cytosolic Cu/Zn-superoxide dismutase promoter in transgenic tobacco. Plant Physiol. 104: 873-880. Higo, K., Ugawa, Y., Iwamoto, M., Korenaga, T. (1999) Plant cis-acting regulatory DNA elements (PLACE) database: 1999. Nucleic Acids Res. 27: 297-300. Hodges, R.S., Sodek, J., Smillie, L.B., Jurasek, L. (1972) Tropomyosin: Amino acid sequence and coiled-coil structure. Cold Spring Harbor Symp. Quant. Biol. 37: 299-310. Horsch, R., Fry, J.E., Hoffman, N., Eicholtz, D., Rogers, S., Fraley, R. (1985) A simple and general method for transferring genes into plants. Science 227: 1229-1231. Huber, A.H., Nelson, W.J., Weis, W.I. (1997) Three-dimensional structure of the armadillo repeat region of beta-catenin. Cell 90: 871-882. Ikura, M. (1996) Calcium binding and conformational response in EF-hand proteins. Trends Biochem. Sci. 21: 14–17. Imlau, A., Truernit, E., Sauer, N. (1999) Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell 11: 309-322. Ishiwatari, Y., Fujiwara, T., McFarland, K.C., Nemoto, K., Hayashi, H., Chino, M., Lucas, W.J. (1998). Rice phloem thioredoxin h has the capacity to mediate its own cell-to-cell transport through plasmodesmata. Planta 205: 12–22. Itaya, A., Ma, F., Matsuda, Y., Zhu, Y., Liang, G., Ding, B. (2002) Plasmodesma-mediated selective protein traffic between ‘symplasmically isolated’ cells probed by a viral movement protein. Plant Cell 14: 2071-2083. Jahn, R., Sudhof, T.C. (1999). Membrane fusion and exocytosis. Annu. Rev. Biochem. 68: 863-911. Jefferson, R.A. (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol. Biol. Rep. 5: 387-405. Jefferson, R.A., Kavanagh, T.A., Bevan, M.W. (1987) GUS fusions : β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6: 3901-3907.


106

Jesnowski, R., Nähring, J., Wolf, K. (1995) A rapid and reliable method for PCR-based amplification of chromosomal and mitochondrial DNA from intact yeast cells. Current Genetics. 27: 318-319. John, M., Petersen, M. (1994) Cotton (Gossypium hirsutum L.) pollen-specific polygalacturonase mRNA: tissue and temporal specificity of its promoter in transgenic tobacco. Plant Mol. Biol. 26: 1989-1993. Joshi, C.P. (1987) An inspection of the domain between putative TATA box and translation start site in 79 plant genes. Nucleic Acids Res. 15: 6643-6653. Kammerer, R.A., Schulthess, T., Landwehr, R., Lustig, A., Aebi, U., Steinmetz, M.O. (1998) An autonomous folding unit mediates the assembly of two-stranded coiled coils. Proc. Natl. Acad. Sci. USA 95: 13419-13424. Kapila J., De Rycke R., Van Montagu M., Angenon G. (1997). An Agrobacterium mediated transient gene expression system for intact leaves. Plant Sci. 122: 101-108. Katagiri, F., Seipel, K., Chua, N.H. (1992). Identification of a novel dimer stabilization region in a plant bzip transcription activator. Mol. Cell Biol. 12: 4809-4816. Kawasaki, H., Kretsinger, R. (1994) Calcium-binding proteins 1: EFhands. Protein Profile 1: 343-391. Kawasaki, H., Kretsinger, R. (1995) Calcium-binding proteins 1: EF-hands. Prot. Profile 2: 297-490. Kay, R., Chan, A., Daly, M., McPherson, J. (1987) Duplication of CaMV-35S promoter sequences creates a strong enhancer for plant genes. Science 236: 1299-1301. Kempers, R., Van Bel, A.J.E. (1997). Symplasmic connections between sieve element and companion cell in the stem phloem of Vicia faba L. have a molecular exclusion limit of at least 10 kDa. Planta 201: 195-201. Klöti, A., Henrich, C., Bieri, S., He, X., Chen, G., Burkhardt, P.K., Wunn, J., Lucca, P., Hohn, T., Potrykus, I., Fütterer, J. (1999) Upstream and downstream sequence elements determine the specifity of the rice tungro bacilliform virus promoter and influence RNA production after transcription. Plant Mol. Biol. 40: 249-266. Knoblauch, M., van Bel AJE. (1998) Sieve tubes in action. Plant Cell 10: 35-50. Knoblauch, M., Peters, W.S., Ehlers, K., van Bel, A.J.E. (2001) Reversible calcium-regulated stopcocks in legume sieve tubes. Plant Cell 13: 1221-1230. Knoblauch, M., Noll, G.A., Muller, T., Prüfer, D., Schneider-Hüther, I., Scharner, D., van Bel A.J.E., Peters, W.S. (2003) ATP-independent contractile proteins from plants. Nature Mater. 2: 600-603. Knoblauch, M., Peters, W.S. (2004) Forisomes, a novel type of Ca2+-dependent contractile protein motor. Cell Mot. Cyt. 58: 137-142.


107

Kohn, W.D., Kay, C.M., Hodges, R.S. (1995) Protein destabilization by electrostatic repulsions in the two-stranded alpha-helical coiled-coil/leucine zipper. Protein Sci. 4: 237-250. Kohn, W.D., Mant, C.T., Hodges, R.S. (1997) α-helical protein assembly motifs. J. Biol. Chem. 272: 2583-2586. Kohn, W.D., Hodges, R.S. (1998). De novo design of α-helical coiled-coils and bundles: models for the development of proteindesign principles. Trends Biotechnol. 16: 379-389. Konz, C., Schell, J. (1986) The promoter of TL-DNA gene 5 controls the tissue-specific expression of chimaeric genes carried by a novel type of Agrobacterium binary vector. Mol. Gen. Genet. 204: 382-396. Krylov, D., Barchi, J., Vinson, C. (1998) Inter-helical interactions in the leucine zipper coiled coil dimer: ph and salt dependence of coupling energy between charged amino acids. J. Mol. Biol. 279: 959-972 Lam, E., Benfey, P.N., Gilmartin, P.M., Fang, R.X., Chua, N.H. (1989) Site-Specific Mutations Alter in vitro Factor Binding and Change Promoter Expression Pattern in Transgenic Plants. Proc. Natl. Acad. Sci. U S A 86: 7890-7894. Landschulz, W.H., Johnson, P.F., McKnight, S.L. (1988) The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins. Science 240: 1759-1764. Lawton, D.M. (1978a). Ultrastructural comparison of the tailed and tailless P-protein crystals respectively of runner bean (Phaseolus multiflorus) and garden pea (Pisum sativum) with tilting stage electron microscopy. Protoplasma 97: 1-11. Lawton, D.M. (1978b) P-protein crystals do not disperse in uninjured sieve elements of roots in runner bean (Phaseolus multiflorus) fixed with glutaraldehyde. Ann Bot 42: 353-361. Lee, T.I., Young, R.A. (2000) Transcription of eukaryotic protein-coding genes. Annu. Rev. Genet. 34: 77-137. Lemon, B., Tjian, R. (2000) Orchestrated response: Asymphony of transcription factors for gene control. Genes & Dev. 14: 2551-2569. Leyva, A., Liang, X., Pintor-Toro, J.A., Dixon, R.A., Lamb, C.J. (1992) cis-Element Combinations Determine Phenylalanine Ammonia-Lyase Gene Tissue-Specific Expression Patterns. Plant Cell 4: 263-271. Liang, W. , Warrick, H.M., Spudich, J.A. (1999) A structural model for phosphorylation control of Dictyostelium myosin II thick filament assembly. J. Cell Biol. 147: 1039-1048. Lim, K., Ho, J.X., Keeling, K., Gilliland, G.L., Ji, X., Ruker, F., Carter, D.C. (1994) Three-dimensional structure of Schistosoma japonicum glutathione S-transferase fused with a six-amino acid conserved neutralizing epitope of gp41 from HIV. Prot Sci 3: 2233-2244.


108

Liu, Z.Z., Wang, J.L., Huang, X., Xu, W.H., Liu, Z.M., Fang, R.X. (2003) The promoter of a rice glycine-rich protein gene, Osgrp-2, confers vascular-specific expression in transgenic plants. Planta 216: 824-833. Lukyanov, K.A., Matz, M.V., Bogdanova, E.A., Gurskaya, N.G., Lukyanov, S.A. (1996) Molecule by molecule PCR amplification of complex DNA mixtures for direct sequencing: An approach to in vitro cloning. Nucleic Acids Res. 24: 2194-2195. Lupas, A.N., Lupas, J.M., Stock, J.B. (1992) Do G protein subunits associate via a three-stranded coiled coil? FEBS Lett. 314: 105-108. Lupas, A. (1996) Prediction and analysis of coiled-coil structures. Methods Enzymol. 266: 513-525. Lupas, A.N., Gruber, M. (2005) The structure of alpha-helical coiled coils. Adv. Protein Chem. 70: 37-38. Lütcke, H.A., Chow, K.C., Mickel, F.S., Moss, K.A., Kern, H.F., Scheele, G.A. (1987) Selection of AUG initiation codons differs in plants and animals. EMBO J. 6: 43-8. Malik, S., Roeder, R.G. (2000) Transcriptional regulation through Mediator- like coactivators in yeast and metazoan cells. Trends Biochem. Sci. 25: 277-283. Martin, T., Frommer, W.B., Salanoubat, M., Willmitzer, L. (1993) Expression of an Arabidopsis sucrose synthase gene indicates a role in metabolization of sucrose both during phloem loading and in sink organs. Plant J 4: 367-377. McArthur, I. (1943) Structure of alpha-keratin. Nature 152: 38. McEuen, A.R., Hart, J.W., Sabnis, D.D. (1981) Calcium-binding protein in sieve tube exudate. Planta 151: 531-534. Medberry, S.L., Lockhart, B.E., Olszewski, N.E. (1992) The Commelina yellow mottle virus promoter is a strong promoter in vascular and reproductive tissues. Plant Cell 4: 185-192. Medberry, S.L, Olszewski, N.E. (1993). Identification of cis elements involved in Commelina yellow mottle virus promoter activity. Plant J. 3: 619-626.

Meisel, L., Lam, E. (1997) Switching on gene expression: Analysis of the factors that spatially and temporally regulate plant gene expression. Genet Eng. 19: 183-199.

Meyers, B.C., Shen, K.A., Rohani, P., Gaut, B.S., Michelmore, R.W. (1998) Receptor-like genes in the major resistance locus of lettuce are subject to divergent selection. Plant Cell 10: 1833-1846. Mogilner, A., Oster, G. (2003) Polymer motors: pushing out the front and pulling up the back. Curr. Biol. 13: R721-R733. Moll, J.R. , Olive, M., Vinson, C. (2000) Attractive interhelical electrostatic interactions in the PAR leucine zipper subfamily (VBP/TEF, HLF, and DBP) preclude heterodimerization with other B-ZIP subfamilies. J. Biol. Chem. 275: 34826-34832.


109

Moser, C., Gatto, P., Moser, M., Pindo, M., Velasco, R. (2004) Isolation of functional RNA from small amounts of different grape and apple tissues. Mol Biotechnol 26: 95-99. Mudgil, Y., Shiu, S.H., Stone, S.L., Salt, J.N., Goring, D.R. (2004) A large complement of the predicted Arabidopsis ARM repeat proteins are members of the U-box E3 ubiquitin ligase family. Plant Physiol. 134: 59-66. Muranyi, A., Finn, B.E. (2001) Calcium and its enzymes. In Handbook on Metalloproteins. Bertini, I., Sigel, A., Sigel H. (eds), pp. 100-115, Mercel Dekker, Inc., New York, Basel. Murashige T., Skoog F. (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15: 473-497. Müller, K.M., Arndt, K.M., Alber, T. (2000) Protein fusions to coiled-coil domains. Methods Enzymol. 328: 261-282. Münch, E. (1930) Die Stoffbewegung in der Pflanze. Fischer, G., Jena. Nakamura, S., Hayashi, H., Mori, S., Chino, M. (1993) Protein phosphorylation in the sieve tubes of rice plants. Plant Cell Physiol. 34: 927-933. Nakashima, K., Ishida, H., Ohki, S. Y., Hikichi, K., Yazawa, M. (1999) Calcium binding induces interaction between the N- and C-terminal domains of yeast calmodulin and modulates its overall conformation. Biochemistry 38: 98-104. Nakayama, S., Kretsinger, H. (1994) Evolution of the EF-hand family of proteins. Annu. Rev. Biophys. Biomol. Struct. 23: 473-507. Nalefski, E.A., Falke, J.J. (1996) The C2 domain calcium-binding motif: structural and functional diversity. Prot. Sci. 5: 2375-2390. Niggeweg, R., Thurow, C., Weigel, R., Pfitzner, U., Gatz, C. (2000) Tobacco TGA factors differ with respect to interaction with NPR1, activation potential and DNA-binding properties. Plant Mol.Biol. 42: 775-788. Odell, J.T., Nagy, F., Chua, N.H. (1985) Identification of DNA sequences for activity of the Cauliflower mosaic virus 35S promoter. Nature 313: 810-812. Ohta, S., Hattori, T., Morikami, A., Nakamura, K. (1991) High-level expression of a sweet potato sporamin gene promoter: β-glucuronidase (GUS) fusion gene in the stems of transgenic tobacco plants is conferred by multiple cell type-specific regulatory elements. Mol. Gen. Genet. 225: 369-378. Oparka, K.J., Turgeon, R. (1999) Sieve elements and companion cells: traffic control centers of the phloem. Plant Cell 11: 739-750. Oparka, K.J., Santa Cruz, S. (2000) The great escape: phloem transport and unloading of macromolecules Annu. Rev. Plant Physiol. Plant Mol. Biol. 51: 323-347.


110

Oppenheim, A.B., Giladi, H., Goldenberg, D., Kobi, S., Azar, I. (1996) Vectors and transformed host cells for recombinant protein production at reduced temperatures. International patent application. WO 96/03521. Orphanides, G., Lagrange, T., Reinberg, D. (1996) The general transcription factors of RNApolymerase II. Genes & Dev. 10: 2657-2683. O'shea, E.K., Rutkowski, R., Kim, P.S. (1992) Mechanism of specificity in the Fos–Jun oncoprotein heterodimer. Cell 68: 699-708. Pal, G. P., Elce, J. S., Jia, Z. (2001) Dissociation and aggregation of calpain in the presence of calcium. J. Biol. Chem. 276: 47233–47238. Palevitz, B.A., Newcomb, E.H. (1971) The ultrastructure and development of tubular and crystalline P-protein in the sieve elements of certain papilionaceous legumes. Protoplasma 72: 399-425. Parthasarathy, M.V., Pesacreta, T.C. (1980) Microfilaments in plant vascular cells. Can. J. Bot. 58: 807-815. Peaper, D.R., Wearsch, P.A., Cresswell, P. (2005) Tapasin and ERp57 form a stable disulfide-linked dimer within the MHC class I peptide-loading complex. EMBO J. 24, 3613-3623. Petka, W.A., Harden, J.L., McGrath, K.P., Wirtz, D., Tirrell, D.A. (1998) Reversible hydrogels from self-assembling artificial proteins. Science 281: 389-392. Polson, A., Coetzer, T., Kruger, J., von Maltzahn, E., van der Merwe, K.J. (1985) Improvements in the isolation of IgY from the yolks of eggs laid by immunized hens. Immunol Invest. 14: 323-327. Qu, R.D., Bhattacharyya, M., Laco, G.S., De Kochko, A., Rao, B.L., Kaniewska, M.B., Elmer, J.S., Rochester, D.E., Smith, C.E., Beachy, R.N. (1991) Characterization of the genome of rice tungro bacilliform virus: comparison with Commelina yellow mottle virus and caulimoviruses. Virology 185: 354-364. Rashidi, H.H., Bauer, M., Patterson, J., Smith, D.W. (1999) Sequence motifs determine structure and Ca++-binding by EF-hand proteins. J. Mol. Microbiol. Biotechnol. 1: 175-182. Read, S.M., Northcote, D.H. (1983) Chemical and immunological similarities between the phloem proteins of three genera of the Cucurbitaceae. Planta 158: 119-127. Reese, M.G., Eeckman, F.H. (1995) Novel Neural Network Algorithms for Improved Eukaryotic Promoter Site Recognition. Presented at the Seventh International Genome Sequencing and Analysis Conference, September 16-20, Hilton Head Island, South Carolina. Rieker, J.D., Hu, J.C. (2000) Molecular applications of fusions to leucine zippers. Methods Enzymol. 328: 282-296.


111

Riggleman, B., Wieschaus, E., Schedl, P. (1989) Molecular analysis of the armadillo locus: uniformly distributed transcripts and a protein with novel internal repeats are associated with a Drosophila segment polarity gene. Genes & Dev. 3: 96-113. Ringli, C., Keller, B. (1998) Specific interaction of the tomato bZIP transcription factor VSF-1 with a non-palindromic DNA sequence that controls vascular gene expression. Plant Mol. Biol. 37: 977-988. Rizo, J., Südhof, T.C. (1998) C2-domains, structure and function of a universal Ca2+-binding domain. J. Biol. Chem. 273: 15879-15882. Roberts, I.N., Oliver, R.P., Punt, P.J., van der Hondel, C.A.M. (1989). Expression of the Escherichia coli -glucuronidase gene in industrial and phytopathogenic filamentous fungi. Current Genetics 15: 177-180. Roberts, A.G., Santa-Cruz, S., Roberts, I.M., Prior, D.A.M., Turgeon, R., Oparka, K.J. (1997) Phloem unloading in sink leaves of Nicotiana benthamiana: comparison of a fluorescent solute with a fluorescent virus. Plant Cell 9: 1381-1396. Roeder, R.G. (1991) The complexities of eukaryotic transcription initiation: regulation of preinitiation complex assembly. Trends Biochem. Sci. 16, 402-408. Rohde, W., Becker, D., Randles, J.W. (1995) The promoter of coconut foliar decay-associated circular single-stranded DNA directs phloem-specific reporter gene expression in transgenic tobacco. Plant Mol. Biol. 27: 623-628. Ryadnov, M.G., Ceyhan, B., Niemeyer, C.M., Woolfson, D.N. (2003) "Belt and braces": a peptide-based linker system of de novo design. J. Am.Chem. Soc. 125: 9388-9394. Sakaguchi, N., Berger, C.N., Melchers, F. (1986) Isolation of cDNA copy of an RNA species expressed in murine pre-B cells. EMBO J. 5: 2139-2147. Sakuth, T., Schobert, C., Pecsvaradi, A., Eichholz, A., Komor, E., Orlich, G. (1993) Specific proteins in the sieve-tube exudate of Ricinus communis L. seedlings: separation, characterization and in-vivo labelling. Planta 191: 207-213. Salahpour, A., Bonin, H., Bhalla, S., Petaja-Repo, U., Bouvier, M. (2003). Biochemical characterization of beta2-adrenergic receptor dimers and oligomers. Biol Chem. 384: 117-23. Sambrook, J., Fritsch, E.F., Maniatis, T. (1989) Molecular cloning-A laboratory Manual. Cold Spring Harbor Laboratory, New York. Sambrook, J., Russell, D.W. (2000). Molecular cloning a laboratory manual. Cold Spring Harbor Laboratory, New York. Sanger, F., Nicklen, S., Coulsen, A.R. (1977) DNA sequencing chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467. Schafer, B.W., Heizmann, C.W. (1996) The S100 family of EF-hand Ca2+-binding proteins: functions and pathology. Trends Biochem. Sci. 21: 134–140.


112

Schein, C.H. (1989) Production of soluble recombinant proteins in bacteria. Bio Technol. 7: 1141-1149. Schiefelbein, J.W., Benfey, P.N. (1994). Root development in Arabidopsis. In Arabidopsis. Meyerowitz, E.M., Somerville, C.R. (eds), pp. 335-353, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schmülling, T., Schell, J., Spena, A. (1989) Promoters of the rolA, B, and C genes of Agrobacterium rhizogenes are differentially regulated in transgenic plants. Plant Cell 1: 665-670. Schobert, C., Baker, L., Szederkényi, J., Großmann, P., Komor, E., Hayashi, H., Chino, M., Lucas, W.J. (1998) Identification of immunologically related proteins in sieve-tube exudates collected from monocotyledonous and dicotyledonous plants. Planta 206: 245-252. Schulz, A. (1990) Conifers. In Sieve Elements. Behnke, H.D., Sjölund, R.D. (eds), pp. 63-88, Springer, Berlin. Schultz, J., Milpetz, F., Bork, P., Ponting, C.P. (1998). SMART, a simple modular architecture research tool: identification of signaling domains. Proc. Natl. Acad. Sci. USA 95: 5857-5864. Shi, Y., Wang, M.B., Powell, K.S., Van Damme, E., Hilder, V.A., Gatehouse, A.M.R., Boulter, D., Gatehouse, J.A. (1994) Use of the rice sucrose synthase-1 promoter to direct phloem-specific expression of β-glucuronidase and snowdrop lectin genes in transgenic tobacco plants. J. Exp. Bot. 45: 623-631. Shirsat, A., Wilford, N., Croy, R., Boulter, D. (1989) Sequences responsible for the tissue specific promoter activity of a pea legumin gene in tobacco. Mol. Gen. Genet. 215: 326-331 Sjölund, R.D., Shih, C.Y. (1983) Freeze-fracture analysis of phloem structure in plant tissue cultures I: the sieve element reticulum. J. Ultrastruct. Res. 82: 111-121. Sjölund, R.D. (1997) The phloem sieve element: a river runs through it. Plant Cell 9:1137-1146. Smale, S.T. (1997) Transcription initiation from TATA-less promoters within eukaryotic protein-coding genes. Biochim. Biophys. Acta 1351: 73-88. Smith, D.B. (1993) Purification of glutathione S-transferase fusion proteins. Meth. Mol. Cell Biol. 4: 220-229. Spek, E.J., Bui, A.H., Lu, M., Kallenbach, N.R. (1998) Surface salt bridges stabilize the GCN4 leucine zipper. Protein Sci. 7: 2431-2437. Steinmetz, M.O., Stock, A., Schulthess, T., Landwehr, R., Lustig, A., Faix, J., Gerisch, G., Engel, J., Aebi, U., Kammerer, R.A (1998) A distinct 14 residue site triggers coiled-coil formation in cortexillin I. EMBO J. 17: 1883-1891.


113

Sugaya, S., Hayakawa, K., Handa, T., Uchimiya, H. (1989) Cell-specific expression of the rolC gene of the TL-DNA of Ri plasmid in transgenic tobacco plants. Plant Cell Physiol. 30: 649-653. Suzuki, K., Doi, T., Imanishi, T., Kodama, T., Tanaka, T. (1997) The conformation of the alpha-helical coiled coil domain of macrophage scavenger receptor is pH dependent. Biochemistry 36: 15140-15146. Suzuki, M., Koide, Y., Hattori, T., Nakamura, K., Asahi, T. (1995) Different sets of cis-elements contribute to the expression of a catalase gene from castor bean during seed formation and postembryonic development in transgenic tobacco. Plant Cell Physiol. 36: 1067-1074. Swairjo, M.A., Seation, B.A. (1994) Annexin structure and membrane interaction: a molecular perspective. Annu. Rev. Biophys. Biomol. Struct. 23: 193-213. Szilak, L. Moitra, J., Vinson, C. (1997) Design of a leucine zipper coiled coil stabilized 1,4 kcal mol-1 by phosphorylation of a serine in the e position. Protein Sci. 6: 1273-1283. Thompson, G.A., Larkins, B.A. (1996) Phloem-specific promoter. US patent US005495007A. Thompson, G.A., Schulz, A. (1999) Long-distance transport of macromolecules. Trends Plant Sci. 4: 354-360. Tornero, P., Conejero, V., Vera, P. (1996) Phloem-specific expression of a plant homeobox gene during secondary phases of vascular development. Plant J. 9: 639-648. Truernit, E., Sauer, N. (1995) The promoter of the Arabidopsis thaliana SUC2 sucrose-H+ symporter gene directs expression of β-glucuronidase to the phloem: Evidence for phloem loading and unloading by SUC2. Planta 196: 564-570. Turgeon, R., Webb, J.A. (1973) Leaf development and phloem transport in Cucurbita pepo: transition from import to export. Planta 113: 179-191. Turgeon, R., Webb, J.A. (1976) Leaf development and phloem transport in Cucurbita pepo: maturation of the minor veins. Planta 129: 265-269. Turgeon, R. (1987) Phloem unloading in tobacco sink leaves: insensitivity to anoxia indicates a symplastic pathway. Planta 171: 73-81. Turgeon, R. (1989) The sink-source transition in leaves. Annu. Rev. Plant Physio.l Plant. Mol. Biol. 40: 119-138. van Bel, A.J.E., Kempers, R. (1996) The pore/plasmodesm unit: key element in the interplay between sieve element and companion cell. Prog. Bot. 58: 278-291 van Bel, A.J.E., Ehlers, K., Knoblauch, M. (2002) Sieve elements caught in the act. Trends Plant Sci. 7: 126-132. van der Weele, C.M., Jiang, H.S., Palaniappan, K.K., Ivanov, V., Palaniappan, K., Baskin, T. (2003) A new algorithm for computational image analysis of deformable motion at high


114

spatial and temporal resolution applied to root growth: Roughly uniform elongation in the meristem and also, after an abrupt acceleration, in the elongation zone. Plant Physiol. 132: 1138-1148. Verdaguer, B., de Kochko, A., Fux, C.I., Beachy, R.N., Fauquet, C. (1998) Isolation and expression in transgenic tobacco and rice plants, of the Cassava vein mosaic virus (CVMV) promoter. Plant Mol. Biol. 37: 1055-1067. Volk, G.M., Franceschi, V.R. (2000) Localization of a calcium channel–like protein in the sieve element plasma membrane. Aust. J. Plant Physiol. 27: 779-786. von Stein, O.D., Thies, W.-G., Hofmann, M. (1997) A high throughput screening for rarely transcribed differentially expressed genes. Nucleic Acids Res. 25: 2598-2602. Walshaw, J., Woolfson, D.N. (2001) Socket: a program for identifying and analysing coiled-coil motifs. J. Mol. Biol. 307: 1427-1450. Wang, Z., Brown, D.D. (1991) A gene expression screen. Proc. Natl. Acad. Sci. USA 88: 11505-11509. Weis, W.I. (1996) Structural basis of lectin-carbohydrate recognition. Annu. Rev. Biochem. 65: 441-473. Wergin, W.P., Newcomb, E.H. (1970) Formation and dispersal of crystalline P-protein in sieve elements of soybean (Glycine max L.). Protoplasma 71: 365-388. Wergin, W.P., Palevitz, B.A., Newcomb, E.H. (1975) Structure and development of P-protein in phloem parenchyma and companion cells of legumes. Tissue and Cell 7: 227. Werr, W., Frommer, W.-B., Maas, C., Starlinger, P. (1985) Structure of the sucrose synthase gene on chromosome 9 of Zea mays L. EMBO J., 4: 1373-1380. White, R.J. (2001) Gene transcription: Mechanisms and control. Blackwell Science, Ltd., Oxford, UK. Wright, P.E., Dyson, H.J. (1999). Intrinsically unstructured proteins: reassessing the protein structure-function paradigm. J. Mol. Biol. 293: 321-331. Wright, K.M., Roberts, A.G., Martens, H.J., Sauer, N., Oparka, K.J. (2003) Structural and Functional Vein Maturation in Developing Tobacco Leaves in Relation to AtSUC2 Promoter Activity. Plant Physiology 131: 1555-1565. Wu, D.Y., Ugozzoli, L., Pal, B.K., Wallace, R.B. (1991) The effect of temperature and oligonucleotide primer length on the specificity and efficiency of amplification by polymerase chain reaction. DNA Cell Biol. 10: 233-238. Wu, X.L., Weigel, D., Wigge, P.A. (2002) Signaling in plants by intercellular RNA and protein movement. Genes Dev. 16: 151-158.


115

Xoconostle-Cázares, B., Xiang, Y., Ruiz-Medrano, R., Wang, H.L., Monzer, J., Yoo, B.C., McFarland, K.C., Franceschi, V.R., Lucas, W.J. (1999) Plant paralog to viral movement protein that potentiates transport of mRNA into the phloem. Science 283: 94-98. Xoconostle-Cázares, B., Ruiz-Medrano, R., Lucas, W.J. (2000) Proteolytic processing of CmPP36, a protein from the cytochrome b(5) reductase family, is required for entry into the phloem translocation pathway. Plant J. 24: 735-747. Yang, N-S., Russell, D. (1990) Maize sucrose synthase-1 promoter directs phloem cell-specific expression of Gus gene in transgenic tobacco plants. Proc Natl Acad Sci USA 87: 4144-4148. Yankulov, K., Blau, J., Purton, T., Roberts, S., Bentley, D. L. (1994) Transcriptional elongation by RNA polymerase II is stimulated by transactivators. Cell 77: 749-759. Yin, Y., Beachy, R.N. (1995) The regulatory regions of the rice tungro bacilliform virus promoter and interacting nuclear factors in rice (Oryza sativa L.). Plant J. 7: 969-980. Yin, Y., Chen, L., Beachy, R. (1997a) Promoter elements required for phloem-specific gene expression from the RTBV promoter in rice. Plant J. 12: 1179-1188. Yin, Y., Zhu, Q., Da, S., Lamb, C., Beachy, R. (1997b) RF2a, a bZIP transcriptional activator of the phloem-specific rice tungro bacilliform virus promoter, function in vascular development. EMBO J. 16: 5247-5259. Yoshida, K., Mohri, T., Nishiguchi, M., Tazaki, K. (2002) Robinia pseudoacacia inner-bark lectin promoter expresses GUS also predominantly in phloem of transgenic tobacco. J. Plant Physiol. 159: 757-764. Yurke, B., Turberfield, A. J.,Mills, A. P., Simmel, F. C., Neumann, J. L. (2000) A DNA-fuelled molecular machine made of DNA. Nature 415: 62-65. Zhan, X., Richardson, K.A., Haley, A., Morris, B.A. (1993) The activity of the coat protein promoter of Chloris striate mosaic virus is enhanced by its own and C1-C2 gene products. Virology 193: 498-502.

Chapter VII Appendices ____________________________________________________________________________________________________

116

VII Appendices

VII.1 List of abbreviations

ABTS 2,2’-Azino-di-(3-ethylbenzthiazoline sulphonate)

Ab Antibody

Ag Antigen

Amp Ampicillin

AP Alkaline phosphatase

ATP Adenosine triphosphate

BCIP/NBT 5-bromo-4-chloro-3-indolyl phosphate/p-nitrobluetetrazolium chloride

bp Base pair

BSA Bovine serum albumin

CaMV 35S 35S promoter from the Cauliflower mosaic virus

carb Carbenicillin

CC Companion cell

CDMFDA 5[6]-carboxy-4,5’-dimethylfluorescein diacetate

cDNA Complementary DNA

CFDV Coconut Foliar Decay Virus

CI Chloroform/isoamyl alcohol (24:1)

CLSM Confocal Laser Scanning Microscopy

cv. Cultivar

Cys Cysteine

dil. Dilution

DMSO Dimethyl sulphoxide

DNA Deoxyribonucleic acid

dNTP Deoxyribonucleoside triphosphate

DSRed Discosoma-Red

DTT 1,4-dithiothreitol

E. coli Escherichia coli

EDTA Ethylene diaminether tetra-acetic acid

e.g. exempli gratia

ELISA Enzyme-linked immunosorbent assay

ER Endoplasmatic reticulum


117

EtOH Ethanol

g Relative centrifugal force (RCF)

GFP Green fluorescent protein

GSM Agrobacteria glycerol stock media

GSP Gene specific primers

GST Glutathione S-transferase

GUS ß-Glucuronidase

h Hour(s)

HCl Hydrochloride

HRP Horse radish peroxidase

i.e. id est

IPTG Isopropyl β-D-thiogalactopyranoside

kb Kilobase pair

kDa Kilodalton

Km Kanamycin

L Litre

LB Luria-Bertani medium

M Molarity

MALDI-TOF Matrix-assisted laser desorption ionization-time of flight

MES 2-(N-morpholino)-ethanesulphonic acid

min Minute(s)

MgSO4 Magnesium sulfate

Mr Molecular mass

mRNA Messenger RNA

MS Murashige and Skoog medium

MW Molecular weight

NaCl Sodium chloride

nos Gene of the nopaline synthase

Nt Nucleotide

OD Optical density

o/n Overnight

ORF Open reading frame

Ori Origin of replication

PBS Phosphate buffered saline


118

PBST Phosphate buffered saline, 0,1% (v/v) tween-20

PCR Polymerase chain reaction

PEG Polyethylenglycol

pH A logarithmic measure of hydrogen ion concentration

pNPP p-nitrophenyl phosphate

poly A Polyadenylation signal

PPUs Pore plasmodesmata units

Rif Rifampicilin

RNA Ribonucleic acid

RNase Ribonuclease

rpm Rounds per minute

RT Room temperature

S Segment; small

SDS-PAGE Sodium dodecyl sulphate-polyacrylamide gel electrophoresis

SE Sieve element

sec seconds

SER Sieve element endoplasmic reticulum

Taq Thermus aquaticus

TB Terrific broth

TBE Tri- buffered saline electrophoresis buffer

TCA Trichloroacetic acid

TEMED N,N,N′, N′-tetramethylene-ethylenediamine

TMV Tobacco mosaic virus

Tris Tris(hydroxymethyl)aminomethane

UTR untranslated region

Ω Omega leader region of TMV

V Volt; variable region

v/v Volume per volume

w/v Weight per volume

w/w Weight per weight

YFP yellow fluorescent protein


119

VII.2 Schematic presentation of vectors maps

A

B


120

C

D Figure VII-1 Schematic presentation of the vector maps. A: pCR® 2.1-TOPO® (Invitrogen), the nucleotide sequence of the multiple cloning site is indicated, B: pGEX-5x-3, C,D: pTRA.


121

VII.3 Figures

Figure I-1 In vivo structure of sieve elements in Vicia faba 3

Figure I-2 Comformational change of crystalline P-protein bodies in Vicia faba

as a response to injury 4

Figure I-3 Structures of parallel coiled coils 8

Figure I-4 Schematic outline of the thesis 13

Figure III-1 SDS-PAGE analysis of isolated Vicia faba Forisomes 41

Figure III-2 Immunoblot analysis of isolated Vicia faba Forisomes with mouse and

chicken antisera 42

Figure III-3 2D-gel electrophoresis and immunoblot analysis of isolated Vicia faba

Forisomes 43

Figure III-4 Hybridization screening on arrayed Vicia faba cDNA libraries 44

Figure III-5 Immunoscreening of Vicia faba cDNA expression library of plant tips 45

Figure III-6 Agarose Gel Electrophoresis of 5’- and 3’- RACE PCR amplification

products of Vicia faba cDNA 47

Figure III-7 Sequence alignment of 5’- RACE PCR products of Vicia faba cDNA 48

Figure III-8 RT-PCR amplification product of full-length Forisome Vicia faba cDNA 48

Figure III-9 Vicia faba Forisome-1 (VFF1) predicted amino acid sequence 49

Figure III-10 Representation of coiled-coil motif and amphipatic α-helix comprised

in the VFF1 protein sequence 50

Figure III-11 Analysis of total RNA isolated from Vicia faba 52

Figure III-12 RACE analysis of the transcription start site of the vff1 gene 52

Figure III-13 LD PCR on Vicia faba genomic DNA using primers derived from the

cDNA 53

Figure III-14 Analysis of Vicia faba genomic DNA digestion 54

Figure III-15 Nucleotide sequence of the 5’-flanking region of the vff1 gene 55

Figure III-16 Primary and secondary BD GenomeWalker™ PCR 56

Figure III-17 Nucleotide sequence of vff1- promoter and the 5’-flanking region of

the vff1 gene 58

Figure III-18 Strategy for cloning the vff1 promoter-Gus expression cassette into

pTRAk 59

Figure III-19 Expression of vff1 promoter-GUS fusions in transgenic tobacco 61


122

Figure III-20 Expression patterns of vff1 promoter-GUS fusions in transgenic tobacco

flowers 62

Figure III-21 Vff1 promoter expression pattern in vff1P::GUS transgenic plants 63

Figure III-22 Expression pattern of vff1 promoter in immature veins of leaves 64

Figure III-23 Expression pattern of vff1 promoter in veins of mature tobacco leaves 64

Figure III-24 PCR amplification of truncated vff1 promoter-GUS fusions fragments 65

Figure III-25 SDS-PAGE and immunoblot analysis of affinity purified GST fusion

proteins 66

Figure III-26 SDS-PAGE analysis of affinity purified GST fusion VFF1 67

Figure III-27 SDS-PAGE and immunoblot analysis of affinity purified recombinant

VFF1 68

Figure III-28 Characterization of GST-VFF1 fusion protein by immunoreativity

against Forisome-specific mouse and chicken antisera 69

Figure III-29 Immunoblot analysis of Vicia faba isolated Forisomes and recombinant

VFF1 fusion protein using VFF1 specific rabbit antiserum 70

Figure III-30 Confocal immunofluorescence analysis of Vicia faba native Forisomes

using polyclonal Forisome-specific mouse and chicken antibodies 72

Figure III-31 Confocal immunofluorescence analysis of Vicia faba native Forisomes

using polyclonal VFF1-specific 73

Figure VII-1 Schematic representation of vector maps 120

VII.4 Tables

Table II-1 Name, suppliers and genotypes of bacterial strains used throughout

this thesis 16

Table II-2 Primers used for PCR amplification in deletion analysis of vff1 Promoter

in Vicia faba 17

Table II-3 Primers used for cDNA amplification in RACE-PCR 18

Table II-4 Primers used for PCR amplification and subclone Vicia faba forisome

cDNA, N-terminal, C-terminal and central domains 18

Table II-5 PCR reactions 28

Table III-1 Oligonucleotides used for hybridization screening 44

Table III-2 Sequence comparison of GATA motifs present in the vff1promoter and

other phloem-specifc promoters 57


123

Table III-3 Sequence comparison of the 13 bp motifs present in the vff1 promoter

and other phloem-specific promoters 57

Acknowledgements

First of all, I want to express my gratitude to Prof. Dr. Rainer Fischer for giving me the

opportunity to work in the Fraunhofer Institut für Molekularbiologie und Angewandte

Oekologie IME in Aachen and reviewing my thesis.

Prof. Dr. Dirk Prüfer for entrusting me with this project, for all the valuable suggestions and

support during my work, his critical reading of my thesis, and for agreening to be co-

examiner.

Dr. Hannah Jaag, my gratitude to her for her guidance throughout my doctoral work, and very

much for being of great help on my arrival in Aachen.

It is my pleasure to acknowledge the constructive discussions, motivating enthusiasm and

encouragement of Dr. Michael Knoblauch during the course of this project.

Furthermore, I would like to thank Dr. Winfried Peters for his scientific acumen and critical

thinking.

Sincere thanks are due to my colleagues not only in Aachen but also in Giessen and

Schmallenberg, for their cooperation and kindness.

I thank Dr. Jost Muth for the sequencing and interesting discussions.

Special thanks go to Eva Aguado for her precious help in tissue culture and plant

maintenance.

Most of all, I thank my family for their support, patience and understanding. This work would

certainly not have been possible without them.

I thank the friendship of all those who became an important part of my life during these years

and their seemingly unlimited belief in me.

And last but not least, my very special thanks go to those who having most closely

experienced and shared all the ups and downs that came along during this time, managed to

make my life easier and funnier.

____________________________________________________________________________________________________

Lebenslauf

Persönliche Daten

Name: María Eugenia Fontanellaz

Geburtsdatum: 25.09.1973

Geburstort: Rosario, Argentinien

Familienstand: Ledig

Staatsangehörigkeit: argentinisch

Ausbildung

1986-1990 Instituto Politécnico Superior Gral. San Martín Gymnasium,

Rosario, Argentinien

1991-2001 Fakultät für Biochemische und Phamazeutische

Wissenschaften, Rosario, Argentinien

Abschluß: Master of Sciences

Thema der Arbeit: “Functional properties of whey protein

concentrate“

4/2002-2/2006 Promotion am IME Fraunhofer Institut für Molekularbiologie

und Angewandte Oekologie Aachen unter Anleitung von Prof.

Dr. Rainer Fischer

Berufserfahrung

4/2002-12/2005 Wissenschaftlicher Angestellter am IME Fraunhofer Institut für

Molekularbiologie und Angewandte Oekologie Aachen

1/2006-6/2006 Wissenschaftliche Angestellter am Institut für Biologie VII der

RWTH Aachen

Seit 7/2006 Wissenschaftlicher Angestellter (Post-Doc) am Institut für

Biochemie und Biotechnologie der Pflanzen Westfälische

Wilhelms-Universität Münster

Documents

Cloning and molecular characterization of vff1 gene