Clostridium perfringens - Hindawi Publishing …downloads.hindawi.com/journals/isrn/2013/865702.pdfClostridium perfringens + + Positive control Necrotic enteritis - Clostridium bifermentans

Hindawi Publishing CorporationISRN Veterinary ScienceVolume 2013 Article ID 865702 4 pageshttpdxdoiorg1011552013865702

Research ArticleUse of a Multiplex PCR for the Detection of Toxin-EncodingGenes netB and tpeL in Strains of Clostridium perfringens

Matthew A Bailey Kenneth S Macklin and James T Krehling

Department of Poultry Science Auburn University 201 Poultry Science Building Auburn AL 36849-5416 USA

Correspondence should be addressed to Kenneth S Macklin macklksauburnedu

Received 8 October 2013 Accepted 13 November 2013

Academic Editors A Balkema-Buschmann and A Fernandez

Copyright copy 2013 Matthew A Bailey et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Some studies have shown that the NetB toxin may be an important virulence factor of Clostridium perfringens associated necroticenteritis in poultry Additionally research has shown that strains of C perfringens positive for both the netB gene and a secondtoxin-encoding gene tpeL appear to be more virulent than strains with only netB In the past detection of these genes has beenperformed relatively inefficiently using two single locus PCRs This report describes a novel multiplex PCR developed to detectnetB and tpeL simultaneously in C perfringens strains isolated from cases of necrotic enteritis in broilers providing a more efficientdiagnostic tool in the screening of strains for these genes

1 Introduction

The disease necrotic enteritis (NE) is a major issue affect-ing the poultry industry causing extensive economic lossthrough mortality reduced bird performance and carcasscondemnation at slaughter [1 2] Caused by the bacteriumClostridium perfringens (CP) NE is characterized by necroticlesions primarily in the jejunum and ileum which can varyin severity from thickened mucosa and multifocal ulcerationin less severe cases to the formation of a greenish or yellowishpseudomembrane in the case of extensive mucosa inflamma-tion and necrosis [3] In the past alpha-toxin produced by CPtype A has been implicated as the primary virulence factor inNE pathogenesis [2 4 5] however the NetB toxin encodedby the netB gene was shown to be important for the virulenceof certain strains [6 7] Another toxin TpeL (encoded bythe tpeL gene) [8] is a potential virulence factor as well Ina recent study inoculation of broilers with strains positivefor both tpeL and netB was associated with greater severityof gross lesions over strains with only netB [9]

Existing studies ascertaining the prevalence of netB andtpeL have been limited to certain geographic populations ofCP mainly in Australia Belgium Denmark Sweden andCanada [1 7] In the United States studies on the prevalenceof these genes have analyzed CP populations from New

England New York and Pennsylvania [10] The relativelysmall number of sampled CP populations underlines a needfor more analysis to determine the importance of these geneson a worldwide scale Additionally detection of these geneshas been performed relatively inefficiently using two singlelocus PCRsThis report describes amultiplex PCR developedto detect netB and tpeL simultaneously providing a moreefficient tool in screening CP strains for these genes

2 Materials and Methods

Strains used as positive controls were provided by JG Songerof Iowa State University (JGS-1870 and JGS-4140) and theMitchem-Sparks Regional Diagnostic Laboratory located inBoaz Alabama (C103-99) All strains (Table 1) were preparedfor DNA extraction by enriching in cooked meat medium(HiMedia Laboratories Pvt Ltd Mumbai India) for 24 hrand then streaking the enriched samples for isolation ontotrypticase soy agar with 5 sheeprsquos blood (BD DiagnosticsFranklin Lakes NJ) After 24ndash48 hr a single colony exhibitingtypical hemolysis was placed into brain-heart infusion (BHI)broth (BD Diagnostics) and incubated for 24 hr All incuba-tion was carried out at 37∘C within a Bactron IV AnaerobicEnvironmental Chamber (Shel Lab Cornelius OR) with thefollowing atmospheric conditions 90 N

2 5 CO

2 and 5

2 ISRN Veterinary Science

Table 1 Bacterial strains used as positive and negative controls in amultiplex polymerase chain reaction designed for detection ofClostridiumperfringens genes netB and tpeL

Strain ID number Species netB tpeL Relevance SourceC103-99 Clostridium perfringens + + Positive control Necrotic enteritisJGS-1870 Clostridium perfringens + + Positive control Necrotic enteritisJGS-4140 Clostridium perfringens + + Positive control Necrotic enteritis232-2 Clostridium bifermentans minus minus Negative control Poultry litter259-14 Bacteroides caccae minus minus Negative control Poultry litter250-4 Wolinella sp minus minus Negative control Poultry litter

Table 2 Specifications of primers used in a multiplex PCR for the detection of netB and tpeL

Primer ID Sequence Target gene Product lengthnetB5F CGCTTCACATAAAGGTTGGAAGGC netB 316netB5R TCCAGCACCAGCAGTTTTTCCTAKP80lowast ATATAGAGTCAAGCAGTGGAG tpeL 466AKP81lowast GGAATACCACTTGATATACCTGlowastPrimers previously published by Keyburn et al 2010 [7]

H2 After incubation BHI broth cultures were centrifuged at

16000 g for 5min and the broth supernatant was aspiratedanddiscardedUtilizing aWizardGenomicDNAPurificationKit (Promega Corp MadisonWI) DNAwas extracted fromthe resulting bacterial pellet ExtractedDNAwas analyzed forquantity and purity with a Nanodrop 1000 Spectrophotome-ter (Thermo Scientific Inc Bremen Germany) according tothemanufacturerrsquos instructionsThe standard forDNApuritywas a 260280 nm absorbance ratio of 18ndash20

A previously published primer set [7] was used forthe detection of tpeL and a primer set detecting netB wasdesigned using the primer Basic Local Alignment SearchTool(BLAST) function on the National Center for Biotechnologywebsite Primer specifications are listed in Table 2 ThenetB primers were confirmed to target mostly conservedsequences by performing a sequence alignment with 47 netBsequences in GenBank using genetic analysis software

EconoTaq PLUS GREEN Master Mix (Lucigen CorpMiddleton WI) was used at 1x concentration providing Taqpolymerase MgCl

2 dNTPs and reaction buffer (pH 90)

Reagent concentrations of the optimized multiplex were asfollows 12 units25 uL of Taq DNA polymerase 144mMof MgCl

2 192 uM of each dNTP 02 uM of each primer

and 100 ng25 uL of template DNA The following cyclingconditions were used an initial denaturing step at 95∘C for5min 40 cycles of denaturing at 95∘C for 30 sec annealing at55∘C for 30 sec and extension at 72∘C for 30 sec with a finalextension step at 72∘C for 7min

Products were separated by electrophoresis in a 2agarose gel Gels and running buffer were made using 1xconcentrations of AccuGENE TBE buffer (Lonza GroupBasel Switzerland) For visualization of bands 1 uL of anethidium bromide solution (10mgmL) was added to themolten gel before solidifying Electrophoresis took place at100 v for about one hr or until sufficient separation betweenproducts occurred A 100 bp DNA Ladder (Promega) wasutilized as a DNA size standard Bands corresponding tothe expected amplicons were excised and DNA was purified

using a GFX PCR DNA and Gel Band Purification Kit (GEHealthcare Buckinghamshire UK)

Forward and reverse strands of the purified DNA weresequenced by Lucigen and a consensus sequence was deter-mined for each amplicon These consensus sequences werethen subjected to a nucleotide BLAST search using theNCBI database Nucleotide collection (nrnt) to calculate thelikelihood that each PCR product was produced from thetarget gene

3 Results

After the analysis of 47 netB gene sequences published inGenBank the target sequences for both forward (netB5F) andreverse (netB5R) primers proved to be mostly conserved Asingle polymorphism was present at site number 756 of thealignment with 21 (447) of the sequences having G at thissite and 26 (553) having AThis site was complementary tothe sixth base from the 51015840 end of primer netB5R and resultedin a single AC mismatch between the primer and 553of the gene sequences This same mutation affects primerspreviously described by Keyburn et al [6] resulting in a GTmismatch between the seventh base from the 51015840 end ofAKP78(the forward primer) and 24 (511) of the analyzed genesequences

Gel electrophoresis of PCR products confirmed theamplification of the target sequences for all three positivecontrols Bands of the expected size corresponding to thenetB (316 bp) and tpeL (466 bp) fragments were observed forthe positive controls and no bands were observed for thenegative controls Sequences obtained from PCR productsmatched the target sequence (at least 99max identity) withsignificantly low 119864-values after performing a BLAST search(Table 3)

4 Discussion

The multiplex PCR described in this report successfullydetected the netB and tpeL genes in three control organisms

ISRN Veterinary Science 3

Table 3 BLAST output for sequenced PCR productslowast

Targetgene

Sequencesourcedagger Description of top result GenBank accession Max identity () 119864-value

netB C103-99 Clostridium perfringens strain CP4 plasmid pCP4netBpathogenicity locus 1 genomic sequence JF8378121 100 5 times 10

minus158

netB JGS-1870 Clostridium perfringens strain CP4 plasmid pCP4netBpathogenicity locus 1 genomic sequence JF8378121 100 3 times 10

minus152


minus144

tpeL C103-99 Clostridium perfringens A strain CP4 TpeL (tpeL) genecomplete cds EU8484931 99 0

tpeL JGS-1870 Clostridium perfringens A strain CP4 TpeL (tpeL) genecomplete cds EU8484931 99 0


lowastEach row corresponds to a single sequenced banddaggerlists the strain that the sequenced band was amplified from

and did not produce false positives in the negative controlsThe chance of a false negative was minimized by choosingprimers that targeted mostly conserved sites within the Cperfringens genome After analysis of 47 sequences one poly-morphism was observed in the target sequence indicating aninternal ACmismatch between the netB5R primer and 553of the 47 aligned sequences Althoughmismatches between atemplate and the 31015840 end of a primer are known to interferewith the active site of DNA polymerase and can result inreduced reaction efficiency [11 12] internal mismatches orthose closer to the 51015840 end have a much smaller impact [12]In addition out of the possible mismatches AC (purine-pyrimidine) mismatches generally produce only minor inter-ferences [12] Previously published primer AKP787 containeda GT mismatch between 511 of the sequences As GT isanother purine-pyrimidine mismatch and the mismatch alsooccurred near the 51015840 end of the primer it is comparable tonetB5R In consequence it is unlikely that this mismatchbetween the template and netB5R would have a significantimpact on product formation Although evidence suggeststhe netB and tpeL toxin genes may be important virulencefactors for certain strains of C perfringens relatively fewbacterial populations have been screened for these two genesMore populations must be screened to determine the overallimpact of these genes in NE By pairing the detection of bothnetB and tpeL into one PCR reaction this multiplex PCR hasthe potential to increase the efficiency with which strains arescreened for these two genes of interest The effectiveness ofthis assay has been shown in three control organisms andmust now be confirmed using a larger number of strains

Acknowledgments

The authors recognize and appreciate the advice of Dr MarkLiles regarding sequencing and primer analysis Dr JosephGiambrone for the use of his laboratory equipment andDr J G Songer and Janice Seibel for providing positivecontrol strains The authors declare that there is no conflictof interests regarding the publication of this paper

References

[1] A Johansson A Aspan M Kaldhusdal and B E EngstromldquoGenetic diversity and prevalence of netB in Clostridium per-fringens isolated from a broiler flock affected by mild necroticenteritisrdquo Veterinary Microbiology vol 144 no 1-2 pp 87ndash922010

[2] F Van Immerseel J I Rood R J Moore and R W TitballldquoRethinking our understanding of the pathogenesis of necroticenteritis in chickensrdquo Trends in Microbiology vol 17 no 1 pp32ndash36 2009

[3] M D Ficken andD PWages ldquoNecrotic enteritisrdquo inDiseases ofPoultry B W Calnek H J Barnes C W Beard L R McDoug-ald and Y M Saif Eds pp 261ndash264 Iowa State UniversityPress Ames Iowa USA 10th edition 1997

[4] F Al-Sheikhly and R B Truscott ldquoThe pathology of necroticenteritis of chickens following infusion of crude toxins ofClostridium perfringens into the duodenumrdquo Avian Diseasesvol 21 no 2 pp 241ndash255 1977

[5] A L Keyburn S A Sheedy M E Ford et al ldquoAlpha-toxin ofClostridium perfringens is not an essential virulence factor innecrotic enteritis in chickensrdquo Infection and Immunity vol 74no 11 pp 6496ndash6500 2006

[6] A L Keyburn J D Boyce P Vaz et al ldquonetB a new toxin thatis associated with avian necrotic enteritis caused by Clostridiumperfringensrdquo PLoS Pathogens vol 4 article e26 2008

[7] A L Keyburn X-X Yan T L Bannam F Van Immerseel JI Rood and R J Moore ldquoAssociation between avian necroticenteritis and Clostridium perfringens strains expressing netBtoxinrdquo Veterinary research vol 41 article 21 2010

[8] K Amimoto T Noro E Oishi and M Shimizu ldquoA novel toxinhomologous to large clostridial cytotoxins found in culturesupernatant of Clostridium perfringens type Crdquo Microbiologyvol 153 no 4 pp 1198ndash1206 2007

[9] C F Coursodon R D Glock K L Moore K K Cooper and JG Songer ldquoTpeL-producing strains of Clostridium perfringenstype A are highly virulent for broiler chicksrdquo Anaerobe vol 18no 1 pp 117ndash121 2012

[10] T G Martin and J A Smyth ldquoPrevalence of netB among someclinical isolates of Clostridium perfringens from animals in the


United Statesrdquo Veterinary Microbiology vol 136 no 1-2 pp202ndash205 2009

[11] S Kwok D E Kellogg N McKinney et al ldquoEffects of primer-template mismatches on the polymerase chain reaction humanimmunodeficiency virus type 1 model studiesrdquo Nucleic AcidsResearch vol 18 no 4 pp 999ndash1005 1990

[12] R Stadhouders S D Pas J Anber J Voermans T H M MesandM Schutten ldquoThe effect of primer-template mismatches onthe detection and quantification of nucleic acids using the 51015840nuclease assayrdquo Journal of Molecular Diagnostics vol 12 no 1pp 109ndash117 2010

Submit your manuscripts athttpwwwhindawicom

Veterinary MedicineJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Veterinary Medicine International



International Journal of

Microbiology


AnimalsJournal of

EcologyInternational Journal of


PsycheHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Evolutionary BiologyInternational Journal of


Hindawi Publishing Corporationhttpwwwhindawicom

Applied ampEnvironmentalSoil Science

Volume 2014

Biotechnology Research International


Agronomy




Journal of Parasitology Research

Hindawi Publishing Corporation httpwwwhindawicom


Volume 2014

Zoology

GenomicsInternational Journal of


InsectsJournal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


VirusesJournal of

ScientificaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Cell BiologyInternational Journal of



Case Reports in Veterinary Medicine


Table 1 Bacterial strains used as positive and negative controls in amultiplex polymerase chain reaction designed for detection ofClostridiumperfringens genes netB and tpeL

Strain ID number Species netB tpeL Relevance SourceC103-99 Clostridium perfringens + + Positive control Necrotic enteritisJGS-1870 Clostridium perfringens + + Positive control Necrotic enteritisJGS-4140 Clostridium perfringens + + Positive control Necrotic enteritis232-2 Clostridium bifermentans minus minus Negative control Poultry litter259-14 Bacteroides caccae minus minus Negative control Poultry litter250-4 Wolinella sp minus minus Negative control Poultry litter

Table 2 Specifications of primers used in a multiplex PCR for the detection of netB and tpeL

Primer ID Sequence Target gene Product lengthnetB5F CGCTTCACATAAAGGTTGGAAGGC netB 316netB5R TCCAGCACCAGCAGTTTTTCCTAKP80lowast ATATAGAGTCAAGCAGTGGAG tpeL 466AKP81lowast GGAATACCACTTGATATACCTGlowastPrimers previously published by Keyburn et al 2010 [7]

H2 After incubation BHI broth cultures were centrifuged at

16000 g for 5min and the broth supernatant was aspiratedanddiscardedUtilizing aWizardGenomicDNAPurificationKit (Promega Corp MadisonWI) DNAwas extracted fromthe resulting bacterial pellet ExtractedDNAwas analyzed forquantity and purity with a Nanodrop 1000 Spectrophotome-ter (Thermo Scientific Inc Bremen Germany) according tothemanufacturerrsquos instructionsThe standard forDNApuritywas a 260280 nm absorbance ratio of 18ndash20

A previously published primer set [7] was used forthe detection of tpeL and a primer set detecting netB wasdesigned using the primer Basic Local Alignment SearchTool(BLAST) function on the National Center for Biotechnologywebsite Primer specifications are listed in Table 2 ThenetB primers were confirmed to target mostly conservedsequences by performing a sequence alignment with 47 netBsequences in GenBank using genetic analysis software

EconoTaq PLUS GREEN Master Mix (Lucigen CorpMiddleton WI) was used at 1x concentration providing Taqpolymerase MgCl

2 dNTPs and reaction buffer (pH 90)

Reagent concentrations of the optimized multiplex were asfollows 12 units25 uL of Taq DNA polymerase 144mMof MgCl

2 192 uM of each dNTP 02 uM of each primer

and 100 ng25 uL of template DNA The following cyclingconditions were used an initial denaturing step at 95∘C for5min 40 cycles of denaturing at 95∘C for 30 sec annealing at55∘C for 30 sec and extension at 72∘C for 30 sec with a finalextension step at 72∘C for 7min

Products were separated by electrophoresis in a 2agarose gel Gels and running buffer were made using 1xconcentrations of AccuGENE TBE buffer (Lonza GroupBasel Switzerland) For visualization of bands 1 uL of anethidium bromide solution (10mgmL) was added to themolten gel before solidifying Electrophoresis took place at100 v for about one hr or until sufficient separation betweenproducts occurred A 100 bp DNA Ladder (Promega) wasutilized as a DNA size standard Bands corresponding tothe expected amplicons were excised and DNA was purified

using a GFX PCR DNA and Gel Band Purification Kit (GEHealthcare Buckinghamshire UK)

Forward and reverse strands of the purified DNA weresequenced by Lucigen and a consensus sequence was deter-mined for each amplicon These consensus sequences werethen subjected to a nucleotide BLAST search using theNCBI database Nucleotide collection (nrnt) to calculate thelikelihood that each PCR product was produced from thetarget gene

3 Results

After the analysis of 47 netB gene sequences published inGenBank the target sequences for both forward (netB5F) andreverse (netB5R) primers proved to be mostly conserved Asingle polymorphism was present at site number 756 of thealignment with 21 (447) of the sequences having G at thissite and 26 (553) having AThis site was complementary tothe sixth base from the 51015840 end of primer netB5R and resultedin a single AC mismatch between the primer and 553of the gene sequences This same mutation affects primerspreviously described by Keyburn et al [6] resulting in a GTmismatch between the seventh base from the 51015840 end ofAKP78(the forward primer) and 24 (511) of the analyzed genesequences

Gel electrophoresis of PCR products confirmed theamplification of the target sequences for all three positivecontrols Bands of the expected size corresponding to thenetB (316 bp) and tpeL (466 bp) fragments were observed forthe positive controls and no bands were observed for thenegative controls Sequences obtained from PCR productsmatched the target sequence (at least 99max identity) withsignificantly low 119864-values after performing a BLAST search(Table 3)

4 Discussion

The multiplex PCR described in this report successfullydetected the netB and tpeL genes in three control organisms



Targetgene



minus158


minus152


minus144






Acknowledgments


References






















Microbiology


AnimalsJournal of








Volume 2014



Agronomy







Volume 2014

Zoology



InsectsJournal of




VirusesJournal of








Targetgene



minus158


minus152


minus144






Acknowledgments


References






















Microbiology


AnimalsJournal of








Volume 2014



Agronomy







Volume 2014

Zoology



InsectsJournal of




VirusesJournal of

















Microbiology


AnimalsJournal of








Volume 2014



Agronomy







Volume 2014

Zoology



InsectsJournal of




VirusesJournal of













Microbiology


AnimalsJournal of








Volume 2014



Agronomy







Volume 2014

Zoology



InsectsJournal of




VirusesJournal of






Documents

Clostridium perfringens - Hindawi Publishing …downloads.hindawi.com/journals/isrn/2013/865702.pdfClostridium perfringens + + Positive control Necrotic enteritis - Clostridium bifermentans