Compiled Practicals

National training on “Allele Mining”

12 – 25 September 2011

LABORATORY MANUAL

INDIAN INSTITUTE OF SPICES RESEARCH (INDIAN COUNCIL OF AGRICULTURAL RESEARCH)

CALICUT – 673 012, KERALA

Published by Dr. M. Anandaraj Director

Organized by Dr. Johnson K. George (Course Director) Dr. Santosh J. Eapen Dr. Prasath (Course Coordinator)

Compiled & Edited by

Dr. Johnson K. George P. R. Rahul

A. Chandrasekar The manual is an in-house publication intended for training purposes only and is not for public circulation. Copyright © 2011 IISR. All rights reserved. Reproduction and redistribution prohibited without approval.

CONTENTS

Sl.No Title Page No

1 RNA/DNA isolation 1

2 Reverse Transcription-PCR (RT-PCR) 4

3 Gel Elution Techniques 7

4 Cloning of PCR Amplified DNA (T/A cloning) & Bacterial Transformation 11

5 Plasmid isolation and restriction digestion 14

6 Sequence analysis 17

7 Agarose Gel Electrophoresis 19

8 Denaturing Polyacrylamide Gel Electrophoresis (PAGE) for nucleic acids 21

9 Silver staining of DNA Polyacrylamide gels 24

10 NBS Profiling 28

11 EcoTILLING 32

12 Promoter Mining 35

13 Tools for Genetic Diversity Analysis 38

14 RAPD and ISSR Analysis 48

15 Microsatellite (simple sequence Repeats) profiling 51

16 Multilocus Sequence Typing of bacteria 56

17 Rolling circle amplification-RACE (RCA-RACE) 64

18 Protocols in development and analysis of mutants for functional genomics 67

19 Quantitative RT-PCR 73

20 Loop mediated isothermal amplification (LAMP) 75

21 Two Dimensional Gel Electrophoresis 78

22 Bioinformatics -data mining tools, Identification of microsatellite sites, EST analysis

and annotation

83

23 Sequence - Based Marker Designing 87

Annexures

I General Conversion Tables and Formulae 88

II Gene tagging steps 89

III Bioanalyzer and Off Gel Fractionator 101

National training on “Allele Mining” 12th - 25th Sept, 2011, IISR, Calicut

Laboratory Manual 1

DNA/ RNA Isolation

Introduction Any molecular biology work is basically done using the genetic material of an organism, either DNA or RNA. Thus the isolation of a good quality DNA/RNA is essential to the success/failure of any experiment. The main role of DNA molecules is the long-term storage of information in the form of triplet codons containing the instructions needed to construct other components of cells, such as proteins and RNA molecules. The DNA segments that carry this genetic information are called genes, but other DNA sequences have structural purposes, or are involved in regulating the use of this genetic information. Ribonucleic acids (RNA) are crucial molecules in the “central dogma of life” and perform vital functions in both structural and functional roles. RNA molecules form the bridge between the stable genetic information contained within DNA and enzymes and proteins that carry out much of the metabolism within the cell. Many of the sites of protein synthesis, the ribosomes within the cell, are composed of these ribonucleic acids as tRNA molecules that deliver the amino acid building blocks to the ribosomes. Of all the RNA species, the nucleic acid intermediate, messenger RNA, is a desirable source of material to biologists, since this reflects much of, what ultimately, is translated into enzymes and proteins. High quality RNA is the starting material to study the qualitative and quantitative changes in mRNA expression, in- vitro translation, RNase protection assay, reverse transcriptase - polymerase chain reaction (RT-PCR) and cloning. The gene specific primers can be designed based on sequence information available at the NCBI database and can be used for the isolation of genes using RT-PCR. 1.1. DNA Isolation by modified CTAB method (Ausubel et al., 1995) The protocol used for extraction of DNA from Piper leaf tissues is as follows,

1. Grind 5 g of young leaves in liquid nitrogen with a mortar and pestle and add 25 ml of preheated (65ºC) CTAB buffer. Add 0.2% β-Mercaptoethanol prior to use.

2. Incubate at 60ºC for 30 minutes. 3. Extract with equal volume of chloroform: isoamyl alcohol (24:1) at 10,000 rpm for 10

minutes at room temperature. 4. Take the aqueous phase and add 2/3 rd volume of ice-cold isopropanol. 5. Incubate at -20ºC for 2 hours and centrifuge (10,000 rpm, 15 minutes at 4ºC). 6. Discard the supernatant and invert the tube on paper towel for few minutes. 7. Dissolve the pellet and add 1.5 ml of TE buffer at room temperature over night. 8. Add 10 µg/ml of RNase A and incubate at 37ºC for 30 minutes. 9. Add equal volume of Tris saturated phenol, mix it well and centrifuge at 10,000 rpm for ten

minutes. 10. To the aqueous phase add equal volume of phenol: chloroform: isoamyl alcohol,

(25:24:1), shake and centrifuge at 10,000 rpm for ten minutes. 11. Take the aqueous phase and add equal volume of chloroform: isoamyl alcohol (24:1), shake

and centrifuge at 10,000 rpm for ten minutes. 12. To the aqueous phase add one-tenth volume of 3M sodium acetate (pH 5.2) and 2.5 volumes

of ethanol and incubate at -20 for one hour or at -700C for 30 minutes. 13. Centrifuge at 10,000 rpm for 10 minutes and wash the pellet in 70% ethanol (10,000 rpm for

5 minutes). 14. Air dry the pellet and dissolve in 200 µl TE and estimate the yield.

1.1.2. Quantification of DNA The amount of DNA present in the sample is estimated using UV spectrophotometer/biophotometer/nanodrop etc which are all basically measuring the OD at 260nm. DNA shows a clear absorbance peak at 260 nm and the value of 1.0 OD260 is calculated equivalent to


Laboratory Manual 2

50 µg/ml. DNA solution was considered pure if the value of OD260 : OD280 is 1.8. Visualize the DNA on (0.8%) agarose gel for its quality. Store the DNA at -200C until further experiment. 1.2. RNA isolation using TRI-Reagent TRI Reagent is a mixture of guanidine thiocyanate and phenol in a mono-phase solution, which effectively dissolves RNA, DNA and protein on homogenization or lysis of tissue sample. After adding chloroform and centrifuging, the mixture separates into 3 phases: an aqueous phase containing the RNA, the interphase containing DNA and an organic phase containing proteins. Each component can be isolated after separating the phases. One ml of TRI Reagent is sufficient to isolate RNA, DNA and protein from 50-100 mg of leaf tissue. This is one of the most effective methods for isolating total RNA and can be completed in one hour starting with fresh tissue. The procedure is very effective for isolating RNA molecules of all types from 0.1 to 15 kb in length. The resulting RNA is intact with little or no contaminating DNA and protein. This RNA can be used for northern blots, mRNA isolation, in- vitro translation, RNase protection assay, cloning and reverse transcriptase - polymerase chain reaction (RT-PCR). Materials required Sterile powder free nitrile gloves, refrigerated centrifuge, vortex, autoclavable polythene covers, DEPC treated and autoclaved microfuge tubes, microtips, pestle and mortar. Reagents required TRI Reagent (Sigma), chloroform, iso-propanol, 75% ethanol prepared using DEPC treated and autoclaved water, DEPC treated and autoclaved water or RNA re-suspension solution (Ambion®) to dissolve the RNA pellet, RNaseZAP®. Steps in RNA isolation 1. Grind 100mg leaf sample to fine powder using liquid nitrogen, transfer it to 1.5 ml DEPC treated,

sterile microfuge tube and add 1ml of TRI Reagent. 2. Shake vigorously for homogenous mixing of TRI reagent with the sample and keep the sample at

4°C until all the samples are homogenized. 3. Incubate the samples at room temperature for 5 min, so as to ensure complete dissociation of

nucleoprotein complexes and release of RNA, mediated by guanidine thiocyanate and phenol present in the TRI Reagent.

4. Centrifuge the samples at 12,000 rpm for 10 min at 4°C. In this step, all the insoluble materials such as cellular debris, extra cellular membranes and high molecular weight DNA (>20kb) and most of polysaccharides are sediment at bottom of the microfuge tubes. The RNA, low molecular weight DNA and protein are in supernatant.

5. Carefully transfer the supernatant to a fresh microfuge tube and add 200µl of chloroform for every 1 ml of TRI Reagent used in the sample preparation.

6. Shake vigorously for 15 s and incubate at room temperature for 5-10 min. 7. Centrifuge at 12,000 rpm for 15 min at 4°C. The centrifugation separates the mixture into 3 phases:

a red organic phenol phase containing protein, an inter-phase containing DNA and a colorless upper aqueous phase containing RNA.

8. Transfer the supernatant containing RNA to a fresh microfuge tube and precipitate the RNA by adding 500 µl of iso-propanol. Incubate the samples at room temperature for 5 min.

9. Centrifuge at 12000 rpm for 15 min at 4°C to pellet the RNA. 10. Decant the supernatant and wash the pellet with 75 % ethanol prepared with DEPC treated sterile

water. 11. Centrifuge at 12000 rpm for 10 min at 4°C to pellet the RNA. 12. Air dry the pellet for 10 min and dissolve the RNA with 50 µl of DEPC treated water. 13. Check the quality of RNA in 1 % agarose gel. 14. Quantify the RNA in a spectrophotometer (260/280 nm), the 260/280 ratio should be 1.9 to 2.2,

which indicate the good quality of RNA. Quantify the RNA using the following formula:


Laboratory Manual 3

RNA in µg/µl = (40 x Dilution factor x Absorbance at 260)/1000 *A260/280 ratio should equal to 2, indicating little or no contamination of protein and

polysaccharides however, because of variation in starting materials and individual practices, the expected ratio ranges from 1.7-2.2.

*A260/280 ratio lower than 1.7, the RNA should be purified again. In most cases this is due to protein contamination and occurs when the aqueous phase is collected and some organic phase comes with it.

Quality of RNA The quality and integrity of RNA is judged by the intactness of the 25S and 18S ribosomal RNA bands in an agarose gel (1.5%). Notes and Precautions 1. Treat the plastic wares (micro-tips, micro-centrifuge tubes, pestle, mortar and other necessary items

with 0.1% Diethyl pyrocarbonate for overnight and autoclave it for 2 hours. 2. Use separate pipettes for RNA work. 3. Plastic gloves or powder free nitrile gloves should be worn at all times during isolation and

handling of RNA to avoid contamination of samples with RNases. 4. Perform RNA isolation in dust free environment. 5. The use of RNAzap® to wipe the surfaces as well as pipettes is recommended to inactivate RNases. 6. Keep all the kit components tightly sealed when not in use. Tubes with RNA

should be tightly closed during enzymatic reactions. 7. Use certified reagents, including high quality water (DEPC-treated water etc.). 8. Guanidine isothiocyanate (in Trizol), a strong protein denaturant capable of dissolving most cell

constituents, dissociate nucleoprotein and release RNA. 9. Polysaccharides form a whitish gel-like pellet. If the tissue used contains a high level of

polysaccharides. 10. RNA pellet should be white. The presence of an off-white, gel like pellet indicates contamination

by polysaccharides. 11. Because of the naturally occurring polysaccharides and polyphenols that are released during cell

disruption, they form a complex with nucleic acids during tissue extraction and co-precipitate during subsequent alcohol/isopropanol precipitation steps. Depending on the nature and the quantity of these contaminants the resulting alcohol precipitate can be gelatinous and difficult to dissolve.

12. Organic solvents such as phenol can dissociate RNA from the protein and exploiting the difference in hydrophobicity between RNA and protein can separate them by generating two phases.

The isolated RNA can be used for RT- PCR amplification using gene specific primers either for isolating ESTs or for diagnostics.


Laboratory Manual 4

1.2. Reverse Transcription-PCR (RT-PCR)

Polymerase Chain Reaction

The polymerase chain reaction (PCR) is a primer-mediated enzymatic amplification of specifically cloned or genomic DNA sequences. It was invented two decades ago and has revolutionized molecular biology research worldwide. The template DNA contains the target sequence, which may be tens of thousands of nucleotides in length. A thermostable DNA polymerase such as Taq DNA polymerase catalyzes the buffered reaction in which an excess of an oligonucleotide primer pair and four deoxynucleoside triphosphates (dNTPs) are used to make millions of copies of the target sequence. PCR Process Three fundamental steps defines one PCR cycle. 1. Double-stranded DNA template denaturation. 2. Annealing of two oligonucleotide primers to the single-stranded template and 3. Enzymatic extension of the primers produces copies that can serve as templates in subsequent

cycles. RT-PCR (Reverse Transcription-Polymerase Chain Reaction)

In biochemistry, a reverse transcriptase, also known as RNA-dependent DNA polymerase, is a DNA polymerase enzyme that transcribes single-stranded RNA into single-stranded DNA. Normal transcription involves the synthesis of RNA from DNA, hence reverse transcription is the reverse of this. It was discovered by Howard Temin at the University of Wisconsin-Madison, and independently by David Baltimore in 1970. The two shared the 1975 Nobel Prize in Physiology or Medicine with Renato Dulbecco for their discovery. Commonly used reverse transcriptase enzymes include:

1. M-MLV reverse transcriptase from the moloney murine leukemia virus 2. AMV reverse transcriptase from the avian myeloblastosis virus

Reverse transcription Process Reverse Transcription (RT reaction) is a process in which single-stranded RNA is reverse

transcribed into complementary DNA (cDNA) by using total cellular RNA or mRNA, a reverse transcriptase enzyme, a primer, dNTPs and an RNase inhibitor. The resulting cDNA can be used as template in PCR. RT reaction is also called as first strand cDNA synthesis. Traditionally RT-PCR involves two steps: the RT reaction and PCR amplification. RT-PCR can also be carried out as one-step RT-PCR in which all reaction components are mixed in one tube prior to starting the reactions. Although one-step RT-PCR offers simplicity, convenience and minimizes the possibility for contamination, the resulting cDNA cannot be repeatedly used as in two step RT-PCR. Three types of primers can be used for RT reaction: oligo (dT) primers complimentary to the poly A tail of mRNA, random (hexamer) primers and gene specific primers with each having its pros and cons. Protocol: Reverse Transcription (20 µl reaction)

1. In a 0.2 ml thin walled PCR tube, prepare the following reaction mix on ice. Total RNA (10ng-5µg) : variable oligo(dT)18 primer (0.5µg/µl) : 1 µl DEPC treated water : upto 12 µl Mix gently and spin in a microfuge briefly. 2. Incubate the mixture at 70° C for 5 min to denature the RNA secondary structure and

immediately chill on ice to maintain it in the same condition. Spin in a microfuge briefly. 3. Place the tube on ice and add the following components: 5X RT reaction buffer : 4 µl


Laboratory Manual 5

Ribonuclease inhibitor (40U/µl) : 0.5µl 10mM dNTP mix : 2 µl M-MuLV RT enzyme (200U/µl) : 0.25 µl RNase free water : up to 20 µl Mix gently and spin in a microfuge briefly 4. Incubate the mixture at 42° C for 60-90 min to anneal and extend the primers. 5. Incubate at 70° C for 10min to inactivate the enzyme and chill on ice. 6. Store the cDNA synthesis reactions at -20° C.

PCR amplification with Taq DNA polymerase (25 µl reaction) 1. Use only 10% of the cDNA synthesis reaction (2µl) for PCR and proceed the reaction using

Taq polymerase enzyme. 2. Add the following components to the PCR tube Sterile water : 16.67 µl 10X Taq PCR buffer : 2.5 µl 10mM dNTP mix : 2.5 µl 10µM Primers (forward) : 0.5 µl

10µM Primers (reverse) : 0.5 µl Taq polymerase enzyme (3U/µl) : 0.33 µl Template DNA (here cDNA) : 2 µl 3. Mix gently, centrifuge briefly and perform 40 cycles of PCR with optimized conditions for

the sample. 4. Carry out the reaction in a thermal cycler for 40 cycles with following specifications. Step 1 : Denaturation (95° C) : 10 min Step 2 : Denaturation (94° C) : 1 min Primer Annealing (XX ° C) : 1 min Primer Extension (72° C) : 1 min Step 2 repeat for 40 cycles Step3 : Final primer extension (72° C) : 15 min

At the end set the thermal cycler to hold at 4° C Run the PCR products on 1.5 % agarose gel stained with ethidium bromide and visualize the

samples under the UV light. The specific product is further used for elution and cloning for other downstream applications. Notes and Precautions RNase contamination is always a concern when working with RNA. Both the laboratory environment and all solutions have to be free of RNase. General recommendations to avoid RNase contamination are as follows:

1. Follow the recommendations for preventing RNase contamination, as in section 1.1 (notes and precautions).

2. Use an RNase inhibitor to stabilize RNA. 3. Always assess the integrity of RNA prior to cDNA synthesis. If sharp bands of both the plant

18S rRNA and the 25S rRNA are formed during denaturing agarose gel electrophoresis of total eukaryotic RNA, the mRNA in the sample is considered to be intact.

Troubleshooting No product 1. Make sure all the components have been thawed completely/mixed and added to reaction mix. 2. Check the integrity of RNA template. 3. Check the annealing and incubation temperatures in the RT step. 4. Check the quality of oligo(dT)18 primer against other lots or sources. 5. Increase the number of cycles (by increments of 5) 6. Increase the amount of template RNA.


Laboratory Manual 6

7. Repeat the experiment with freshly isolated RNA and new consumables, which have not been opened and used before.

No specific product/High background 1. Reduce the number of cycles 2. Reduce the volume of the RT reaction mix added to the PCR reaction in the two step protocol. 3. Increase the incubation time of the RT step. 4. Increase the time of the elongation cycle of the PCR step, but do not increase the time of

extension per cycle in the long range PCR program. Low yield 1. Increase the amount of RT enzyme. 2. Increase the amount of template RNA. 3. Increase the volume of cDNA added in the PCR (Max. 4µl ;two step protocol) 4. Increase the number of cycles (max. 40) 5. Increase the final dNTP concentration in the one step RT-PCR reaction mix upto a maximum of

500 µM.


Laboratory Manual 7

1.3. Gel Elution Techniques

DNA electrophoresed through agarose or polyacrylamide gels has got various downstream

applications. It is used as a primary or re-amplification template for the PCR, hybridization, sequencing, ligation and other molecular techniques. Commercially available agarose is not completely pure. It contains various impurities which affect the migration of DNA and the ability of DNA recovered from the gel to serve as substrate in enzymatic reactions. Hence it is essential to use special molecular biology grade agarose for gel elution, which is free of nucleases and inhibitors. Different methods in gel extraction

Different methods are available for extracting DNA from an agarose gel. The method, we employ depend on the consumables available in lab and the yield/purity of the DNA after extraction.

S.No Technique Method Remarks 1 Electroelution a) The gel fragments are placed inside a

dialysis bag along with electrophoresis buffer and electroeluted, the trapped DNA can be recovered by precipitation. b) A small trough is cut ahead of the migrating DNA band and electrophoretically eluted onto diethylaminoethyl (DEAE)-cellulose paper, dialysis tubing, affinity membrane or into a space in the gel containing 0.3 M sodium acetate pH 6.0, 10 % sucrose.

Gel must be visualized with UV and constantly monitored to ensure collection of the sample.

2 Freeze and squeeze method

Freeze the gel piece in liquid nitrogen within a micropipette tip or centrifuge tube and spin out the liquid by centrifugation.

DNA quality is not assured.

3 Crush and soak method

Add buffer to the agarose slice and squash with a glass rod. The slurry is placed at 37°C and centrifuged through siliconized glass wool or non-toxic polyallomer fibers.

Co-elution of impurities.

4 Resin binding Bind the DNA to silica particles by using commercially available binding resins, diatomaceous earth or glass fibers.

Low yield.

5 Spin techniques Place the gel slice within a microfuge tube containing a membrane with a small pore size and spin.

Co-elution of contaminants.

6 Enzyme method Heat the gel slice to 65°C, lower the temperature to 40°C, and add GELase. Agarose is degraded into multimeric

DNA fragments purified in this way could not be


Laboratory Manual 8

subunits. enzymatically labeled by nick translation.

7 Syringe squeeze Place the gel piece in the syringe containing glass wool at its mouth and squeeze with the piston.

DNA may not be sufficiently purified from contaminating agarose or buffer components for further manipulations.

8 Resin binding coupled with spin techniques

Bind the DNA to silica particles by using resins and spin in a microfuge tube containing a membrane with a small pore size and spin.

Commercially exploited and widely being in use.

Typically, methods involving organic solvents, electroelution, or binding of the DNA to silica

particles or ion-exchange resins give quite pure DNA, but yields are relatively low. On the other hand, high-yield techniques tend to be problematic in enzyme reactions. Purification of PCR products using spin column

Agarose gel electrophoresis is ideal for the separation of 200bp to 10kb PCR fragments and for fragments smaller than 200bp, polyacrylamide gel is preferred. Resin binding coupled with spin columns are ideal for downstream cloning applications as they save time and comparatively give higher recovery (80%). Reuse of agarose may affect the quality of the eluted DNA, hence use of fresh agarose gel is recommended for DNA extraction. Agarose melts at a temperature greater than the melting temperature of DNA. Now a days low melting point (LMP) agarose is available in which the introduction of hydroxyl ethyl groups into the polysaccharide chain causes the agarose to gel at approximately 30°C and to melt at approximately 65°C which is well below the melting temperature of dsDNA. LMP agarose prevents double strand denaturation and gives higher yield than the use of normal agarose.

DNA fragments of interest are extracted from slices of an agarose gel by solubilizing the gel. The gel solubilisation solution contains chaotropic agent like guanidine thiocyanate which lowers the melting point of the gel thereby preventing the sample from reaching the melting temperature. The molten gel is added to a silica column. The adsorption of DNA to the membrane is efficient only at pH ≤7.5. Other impurities flow through the spin column. The resin is washed with 70% ethanol to remove unwanted materials bound to the column. At neutral pH, with addition of water or TE, DNA gets eluted from the silica column. Protocol 1. Excise band Excise the band of interest with a sterile scalpel blade.

Note: If possible, set the trans-illuminator to long-wavelegth UV (or low-power) and minimize the time of exposure. This is because the UV mutagenises the DNA at a measurable rate. It is good to trim off as much empty agarose as possible.

Place the excised band in a fresh microcentrifuge tube. 2. Weigh gel Weigh the gel slice, using an empty tube to tare the balance. Add 3 volumes of binding buffer or solubilization buffer. The binding buffer has the

chaotropic salt. 3. Solubilize gel

Incubate at 50°C for 10 min (or until the gel slice has completely dissolved). To dissolve the gel, vortex the tube for every 2–3 min during the incubation.


Laboratory Manual 9

Note: Solubilize agarose completely. For >2% gels, increase incubation time and the volume of solubilization buffer.

4. Add isopropanol After the gel slice has dissolved completely, add one gel volume of isopropanol to the sample

and mix by inverting the tube several times. 5. Prepare column Place the column in a 2 ml collection tube Add 500 µl of Column Buffer to the spin column and centrifuge for 1 min

Note: The column preparation solution maximizes the binding of DNA to the membrane resulting in more consistent yields

Discard the flow-through and place the column back in the same collection tube. 6. Bind DNA Load the solubilized gel solution to the column, and centrifuge at 13,000 rpm for 1 min. Discard the flow-through and place the column back in the same collection tube. For maximum recovery, transfer all traces of sample to the column. The maximum volume of

the column reservoir is 700 µl. If the sample volumes is more than 700 µl, repeat step 6 using 700μl fractions.

7. Wash column Wash the column with 600 µl of wash buffer and centrifuge at 13,000 rpm for 1 min. Discard the flow-through, place the column back in collection tube and centrifuge the column

at 13,000 rpm for 1 min to remove any trace of wash buffer. Note: Residual ethanol from buffer will not be completely removed unless the flow-through is

discarded before this additional centrifugation. 8. Elute DNA Place the column into a fresh 1.5 ml microcentrifuge tube. Elute the DNA with 20 µl of Elution Buffer (10 mM Tris·Cl, pH 8.5) or sterile MilliQ water.

Add to the center of the membrane, let the column stand for 1 min, and then centrifuge at 13,000 rpm for 1 min.

Note: Ensure that the elution buffer is dispensed directly onto the center of the membrane for complete elution of bound DNA. The average eluate volume is 9 µl from 10 µl elution buffer volume. Elution efficiency is dependent on pH. The maximum elution efficiency is achieved between pH 7.0 and 8.5. When using water, make sure that the pH value is within this range, and store DNA at –20°C as DNA may degrade in the absence of a buffering agent.

9. Quality checking Check both the quality and quantity of the eluted samples by electrophoresing them in an

agarose gel (0.8-2% depending on the samples). A single sharp band of required base pair without any streaks ensures good quality DNA. The sample can be quantified by comparing intensity of the sample with that of Mass ruler bands.

Alternatively, the quality and quantity of the sample can also be checked by using UV spectrophotometer. Read the absorbance at 260nm and 280nm

Purity of the DNA = A260/A280

The higher the ratio, the more pure the DNA sample. It is acceptable to have a ratio between 1.8 and 2.0 for A260/A280 .

Concentration of DNA (µg/ml) = Absorbance at 260nm x 50 x dilution factor 10. Downstream application The eluted fragments are now ready for various downstream applications like cloning, radio/non-radioactive labeling, hybridization and sequencing. Troubleshooting: Problem Reason Solution Poor or low Ratio of gel solubilization Use a ratio of 3:1, for agarose gels >2%,


Laboratory Manual 10

recovery solution to gel is incorrect. use 6:1. Agarose gel is incompletely solubilised.

Check that the incubation temperature is 50-60°C.

The pH of the electrophoresis buffer is too high, resulting in inefficient binding.

Use fresh electrophoresis buffer. Check the colour of the gel solubilization solution. If it is purple to brown, add 10µl 3M sodium acetate buffer.

Wash solution did not contain ethanol.

Check that ethanol was added to wash solution and the container sealed tightly.

The wrong volume of elution solution was used.

Use 30-50 µl elution buffer or water. Check that it completely covers the membrane.

A gelatinous precipitate formed after the addition of isopropanol.

Agarose was not dissolved prior to adding isopropanol. Incubate until the precipitate is completely dissolved.

Poor performance in downstream applications

The eluate contains too much salt.

Incubate the column for 5 min after adding wash solution, then spin.

Residual ethanol eluted with the DNA.

Re-centrifuge the column for 2 min after the wash step.

Eluate is contaminated with agarose gel.

The gel slice was incompletely solubilized. Add 500µl of gel solubilization solution to the binding column, incubate for 1 min and centrifuge. Continue washing and elution.



1.4. Cloning of PCR Amplified DNA (T/A cloning)

Successful cloning of polymerase chain reaction (PCR)-derived DNA fragment is a key step

for further analysis of the amplified DNAs. It most often relies on ligation of prepared insert with plasmid followed by transformation in competent E. coli cells. Traditionally, DNA ligation reaction conditions for cloning inserts in plasmid vectors vary according to the type of DNA termini that are being ligated. The vast majority of vector-insert cloning reactions involve ligation of the following types of DNA termini:

• 2–4 bp “sticky” end overhangs • Blunt termini • T/A single base overhang

In our experiment third strategy will be followed to clone the PCR amplified product. Principle

This cloning strategy is based on the principle that the polymerase enzymes like Taq, Tth, Tfl and other DNA polymerases adds adenine to PCR product termini. These enzymes which lack in the 3'-5' exonuclease activity has been exploited in T/A cloning. The plasmid vector that has been used for cloning has been pre-cleaved with an appropriate restriction enzyme and treated with terminal deoxynucleotidyl transferase to create 3'-ddT overhangs at both ends. The 3'-ddT overhangs prevent recircularization of the vector during ligation, resulting in high cloning yields. Thus we have a PCR fragment with 3'-dA overhangs which gets ligated into the vector (having 3'-ddT overhangs), creating a circular molecule with two nicks. The circular product can be used directly to transform E.coli cells with high efficiency. The DNA insert can be readily excised from the versatile polylinker of pTZ57R/T and subcloned into other vectors, as well as sequenced using standard M13/pUC primers. Protocol Major steps involved are:

I. Ligation II. Transformation III. Analysis of recombinant clones

InsTAclone™ PCR Cloning Kit (Fermentas, USA) will be used for direct one-step cloning of our PCR-amplified DNA fragments. We will be using only one fourth of the recommended reaction volume mentioned in the kit. I. Ligation (Day 1) Reagents provided with “InsTAclone” cloning kit. TransformAidTM T-Solution A and B TransformAidTM C-Medium Vector pTZ57R/T 5X Ligation buffer T4 DNA Ligase(5U/μl) Nuclease free water 1. Calculate volume of PCR fragment required for ligation reaction with 0.0375g (0.045 pmol ends) using the following formula

Size of the PCR fragment X 0.000045

Concentration of PCR product (g/l) = l(X) of PCR fragment (0.135 pmol ends (i.e.) 1:3 vector insert ratio) required for ligation reaction



(Where 0.000045 is g DNA required for 0.135 pmol ends from a 1bp size fragment) 2. Set up the ligation reaction in 0.2 ml PCR tube on ice as follows

Vector PTZ57R/T (0.0375g, 0.045 pmol ends) : 0.75 l 5x Ligation Buffer : 1.5 l DNA ligase enzyme (5U/l) : 0.30 l PCR fragment (0.135 pmol ends) : X l Nuclease free water : up to 7.5 l 3. Incubate at 22ºC for 2 hr (For maximum yield of useful recombinants, the reaction time can

be extended to overnight). Store at 4º C after incubation. Note: Inoculate LB agar plate (without ampicillin) using a loop full of glycerol stock culture of E.coli strain DH5α by streak plate method for transformation work.* II. Transformation (Day 2) Pre-Preparations: Luria bertani (LB) agar medium Weigh 4 g of ready made LB-Agar powder and dissolve in 100ml of d.H2O in a 250 ml conical

flask, plug with cotton and autoclave for 20 min. After autoclaving allow the solution to cool down to ~55ºC, then add 100µl of ampicillin stock

solution (50mg/ml) for a final concentration of 50µg/ml. Mix without producing air bubbles and pour 20-25ml of the medium to each plate. Let the medium to solidify completely (it will take ~30min) Spread 40µl each of IPTG and X-gal from stock solutions on the surface of the medium evenly. Warm the plates at 37ºC for at least 20 min before use. LB broth Dissolve 2.5g of ready made LB-Broth powder in 100 ml of d.H2O transfer 3ml aliquots in to

25ml screw cap culture tubes and autoclave for 20 min. Before use add 3µl of ampicillin stock solution to each tube.* Stock solutions Ampicillin (50 mg/ml): Dissolve 50 mg of ampicillin in 1 ml of sterile MilliQ H2O and store at - 20ºC

after use. X-Gal (20 mg/ml): Dissolve 20 mg of X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galacto pyranoside, Fermentas) in 1

ml of N, N-Dimethyl formamide and the tube containing the solution should be wrapped in aluminium foil to prevent damage by light and should be stored at -20ºC.

IPTG (24 mg/ml): Dissolve 24 mg of IPTG (Isopropyl-β-D-thiogalacto pyranoside)in 1 ml of sterile MilliQ H2O and

store at (-) 20ºC after use. Competent cell preparation and Transformation

1. Aliquot 1.5ml of TransformAid C-medium in sterile 2ml culture tubes (one tube is sufficient for 3 transformations) and pre-warm at 37º C.*

2. Move three to four well grown, individual colonies (~ 4 x 4mm size) from the overnight LB plate into the pre-warmed C-medium using an inoculating loop.*

3. Incubate tubes at 37º C for 2 hrs with vigorous shaking (~180rpm). 4. Prepare TransformAid T-solution by mixing equal volumes of T-solution A and T-Solution B

(420 µl of T-solution for each of 3 transformations). Mix well and keep on ice. 5. Transfer 1.5 ml of 2 hr culture into a 1.5ml micro centrifuge tube and keep on ice for 5 min. 6. Spin at 12,000 rpm for 1 min at 4º C to pellet cells. 7. Discard the medium and resuspend cells in 300µl of T-solution. 8. Incubate the tubes on ice for 5 min.



9. Spin at 12,000 rpm for 1min at 4º C and resuspend the cells in 120µl of T-solution. Keep the tubes on ice for 5 min.

10. Meanwhile transfer 2.5µl of the ligation mixture to a fresh labeled PCR tube and keep on ice for 5 min.

11. Add 40μl of the resuspended cells (from step 9) to each tube containing ligation mixture, mix gently and incubate on ice for 5 min.

12. Plate the cells on pre-warmed LB-Ampicillin-X-Gal-IPTG agar plates using sterile spreader.* 13. Incubate the plates at 37º C overnight.

III. Analysis of recombinant clones Back streaking (Day 3)

1. From each plate select 4-5 well isolated ,white colonies and back streak in a fresh pre-warmed LB-Ampicillin-X gal-IPTG agar plate.*

2. Incubate at 37ºC for overnight. Note: Colonies that contain active ß-galactosidase (i.e., non recombinants) are pale blue in the center and dense blue at their periphery. White colonies (having recombinant plasmid) occasionally show a faint blue spot in the center, but these are colorless at the periphery. Colony PCR confirmation (Day 4)

1. Observe the back streaked colonies, omit colonies looking bluish and mark 1 or 2 white colonies for colony PCR.

2. Dispense 10 µl of sterile MilliQ water and 2.5 µl of 10x PCR buffer into fresh, labeled 0.2 ml PCR tubes.

3. Transfer a small portion of the selected colony to the PCR tube (of step 2) using sterile micropipette tip and mix thoroughly by pipetting up and down several times. Keep the tubes on ice.*

4. Prepare PCR mix as follows(on ice) : dNTP mix (2.5mM) : 2.0µl Forward Primer : 0.5µl Reverse Primer : 0.5µl MilliQ H2O : 9.2µl Taq DNA polymerase (3U/µl) : 0.3µl

5. Add 12.5µl of PCR mix into each tube (of step 3), mix gently, spin briefly in a microfuge and transfer tubes to PCR machine.

6. After PCR, run amplified products along with molecular weight marker in 1.8 % agarose gel and verify its size.

7. Select colonies which give PCR product of desired size (same size as that of the insert). Note: Inoculate 3 ml of pre-warmed LB broth-ampicillin medium (in 25ml screw cap culture tube) with a small portion of a selected colony and incubate at 37º C with shaking (180 rpm) overnight for plasmid preparation.



1.5. Plasmid isolation and restriction digestion

1.5.1. Plasmid mini preparation

This protocol is designed for plasmid mini preparation using “GenElute™ Plasmid Miniprep Kit” (Sigma). Here the bacterial cells are harvested by centrifugation, subjected to a modified alkaline-SDS lysis procedure and the DNA adsorbed onto silica in the presence of high salts. Contaminants are then removed by a simple wash step. Bound DNA is eluted in water or Tris-EDTA buffer. Reagents provided with “GenElute™ Plasmid Miniprep Kit” Spin column assembly Resuspension solution Lysis solution Neutralization solution Column preparation. Wash buffer concentrate. RNase A

Pre-Preparation 1- Resuspension solution: Add 78 µl of Rnase A solution to the given resuspension solution

prior to initial use, and store at 4° C. 2- Wash solution: Dilute the wash solution concentrate with 100 ml of 100% ethanol prior to

initial use. Plasmid Purification

1. Transfer overnight grown bacterial cells into 1.5 ml micro centrifuge tube and pellet cells by centrifugation at 13,000 rpm for 1 min at RT.

2. Decant media, add remaining culture and spin again at 13,000 rpm for 1min at RT. 3. Decant media completely by inverting tubes on a tissue paper. 4. Resuspend the bacterial pellet with 200 µl of resuspension solution by vortex. 5. Add 200 µl of lysis solution, invert gently to mix and allow to clear for 5 min. 6. Add 350 µl of neutralization solution and mix by inverting 4-6 times. 7. Spin at 13,000 rpm for 10 min at RT to pellet the debris. Column Preparation 1. Add 500 µl of column preparation solution to binding column in a collection tube. 2. Spin at 13,000 rpm for 1 min at RT and discard the flow-through. 3. Now the column is ready for DNA binding (from step 7 of plasmid purification) 8. Transfer the clear lysate to the binding column. 9. Spin at 13,000 rpm for 1min at RT and discard the flow-through. 10. Add 750 µl of wash solution, spin for 12,000 rpm for 1 min and discard the flow-through. 11. Again spin at 13,000 rpm for 1 min at RT to dry the column and now transfer the column to a

fresh collection tube. 12. Add 30 µl of sterile MilliQ water to the centre of the column and allow it to stand for 1 min at

RT. 13. Spin at 13,000 rpm for 1min at RT and collect the eluted plasmid DNA. 14. Check the concentration of plasmid DNA by running 2 µl aliquot in 1.5 % agarose gel.

1.5.2. Restriction Digestion of plasmid DNA Restriction enzyme selection is made based on the restriction map (Fig.1) of the vector pTZ57R/T

and the presumption that the selected sites for restriction does not occur within our DNA insert.

Labo

Fig.1

1

23Ado

Trou

S.No

1.

2.

Natio

ratory Manu

.Restriction m

. Set up the 10 X RestrSterile MilHind III (1Xba I (10UPlasmid D

. Mix gently

. Run the diAfter confirma

ownstream apuble shootin

P

Few or no High backg

onal training o

ual

map of vector

restriction reriction enzymlliQ H2O (up 10U/µl) U/µl) NA (~200ng/

y and incubategest in 1.8 %ation by restrpplications. g:

Problem

transformant

ground of non

on “Allele Mi

pTZ57R/T.

action as follome buffer (Tan

to 25µl)

/µl) e at 37º C for agarose gel a

riction digesti

s

n

(i) Poocells (ii) Un (iii) Uswith “p (i) Lowconcen

ining” 12th - 2

ows: ngo) : 2.5 : 11.

: 0.5 : 0.5 : 5.0

r 2 h and heat and check forion, the rema

Possible cau

r quality of co

successful lig

se of DNA poproof-reading

w antibiotic ntration

25th Sept, 201

5 µl .5 µl

5 µl 5 µl 0 µl t inactivate ther the release oaining plasmi

use

ompetent

gation

olymerase g activity.

PuPcPp

U&u

11, IISR, Cali

e enzymes at of desired sized DNA can b

Re

Perform test trusing control pPerform test liontrol PCR D

Perform PCR polymerase

Use freshly pr& store it at - 2use.

icut

65º C for 10 e of the insertbe used for fu

emedy

ransformationplasmid DNAigation using DNA fragmenwith Taq DN

repared antibi20ºC after ea

15

min. t. further

n A

nt. NA

iotic ch



3.

4.

recombinants Low quality plasmid DNA Low plasmid DNA yield

(ii) Ratio of vector to PCR fragment is too high. (i) The bacterial pellet may not have been fully resuspended. (i) The plasmid did not propagate (ii) The cell resuspension was incomplete. (iii) The lysate was not incubated long enough.

Adjust ratio to optimal. Proper resuspension of the bacterial pellet is critical for the removal of cellular contaminants. Vortex bacterial pellet for at least 30 seconds. Make sure that the appropriate antibiotic was included during all stages of growth. Vortex bacterial pellet for at least 30 seconds. Check for homogeneous solution with no apparent cell clumps. Make sure that the lysate is incubated for at least 5 min (not to exceed 5 min).

Note: Steps marked with “*” should be carried out in the laminar air flow chamber only.



1.6. Sequence analysis

The plasmids isolated from positive clones will be subjected to sequencing at commercial sequencing facility (1st base, Selangor Darul Ehsan, Malaysia). The plasmids will be sequenced by performing single pass sequencing using ABI PRISM 377 DNA sequencer, using BigDye Terminator Cycle Sequencing Kit v3.0 / v3.1 (Perkin Elmer). The primer M13F (-20) will be used for sequencing for single pass reaction while, M13R will be used in case of bidirectional sequencing, where the target sequence are >600bp. Sequence editing

The sequences received from sequencing firm will be in two formats viz., chromatogram and notepad. The sequences will be searched for primer binding, using the find option present in the chromatogram itself or after importing in to a word/text document and search will be performed using control+F option. In both these methods, we will be unable to find out the primer binding positions unless the chromatograms containing sequences perfectly matched with the primer sequences. In that situation the raw sequences will be aligned using clustalW multiple sequence alignment tool along with forward primer used in the PCR amplification. In some instances, primer binding site was not found using all the three methods, such sequences are converted to reverse antisense strand and then the primer binding site was matched using any of the above said methods. Similarly, the reverse primer binding site will be identified. After identifying the primer binding sites, sequences flanking the forward and reverse primer binding sites will be trimmed. Thus complete sequences for our target insert will be obtained in this manner and their deduced amino acid sequences will obtained by performing protein translation. Online tool like VecScreen has been used in some cases, where in it was difficult to locate the exact location of our primer binding sites in any of the sequences. NCBI Blast search for sequence similarity

After editing, NCBI nucleotide sequence blast search will be performed with the edited sequences. In blast search, results will be displayed in three forms viz., graphical view, hit table followed by pairwise alignment. Selected sequences were imported in FASTA format to a notepad. The query sequences were also copied into the same file for further comparative studies. List of URLs for the database searches and analysis Database URL Nucleotide sequences GenBank EMBL DDBJ Genome sequences Entrez genomes GeneCensus COGs Integrated databases InterPro Sequence retrieval system (SRS) Entrez Protein sequence (primary) SWISS-PROT PIR-International Protein sequence (composite)

www.ncbi.nlm.nih.gov/Genbank www.ebi.ac.uk/embl www.ddbj.nig.ac.jp www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Genome bioinfo.mbb.yale.edu/genome www.ncbi.nlm.nih.gov/COG www.ebi.ac.uk/interpro www.expasy.ch/srs5 www.ncbi.nlm.nih.gov/Entrez www.expasy.ch/sprot/sprot-top.html www.mips.biochem.mpg.de/proj/protseqdb



OWL NRDB Protein sequence (secondary) PROSITE PRINTS Pfam Macromolecular structures Protein Data Bank (PDB) Nucleic Acids Database (NDB) HIV Protease Database ReLiBase PDBsum CATH SCOP FSSP

www.bioinf.man.ac.uk/dbbrowser/OWL www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Protein www.expasy.ch/prosite www.bioinf.man.ac.uk/dbbrowser/PRINTS/PRINTS.html www.sanger.ac.uk/Pfam/ www.rcsb.org/pdb ndbserver.rutgers.edu/ www.ncifcrf.gov/CRYS/HIVdb/NEW_DATABASE www2.ebi.ac.uk:8081/home.html www.biochem.ucl.ac.uk/bsm/pdbsum www.biochem.ucl.ac.uk/bsm/cath scop.mrc-lmb.cam.ac.uk/scop www2.embl-ebi.ac.uk/dali/fssp

References: Birnboim, H.C. and Doly, J. 1979. A rapid alkaline extraction procedure for screening recombinant

plasmid DNA. Nucleic Acids Research. 7, 1513-1522. Brown, T. A.1998. Gene Cloning: An Introduction, third edition, Stanley Thornes (Publishers) Ltd. Chen, B.Y and Janes, H.W. 2002. PCR Cloning Protocols. In: Methods in Molecular Biology,

Second Edition (ed.) Walker, J.M. Humana press Inc. New Jersey. 439p. Chomczynski, P. A. 1993. Reagent for the single-step simultaneous isolation of RNA, DNA and

proteins from cell and tissue samples. BioTechniques. 15: 532-537. Chomczynski, P. and Mackey, K. 1995. Modification of the Tri Reagent procedure for isolation of

RNA from polysaccharide- and proteoglycan-rich sources. BioTechniques. 19: 924-945. Chomczynski, P. and Sacchi, N. 1987. Single-step method of RNA isolation by acid guanidinium

thiocyanate-phenol-chloroform extraction. Annals of Biochemistry. 162: 156. Clark, J. M. 1988. Novel non-templates nucleotide addition reactions catalyzed by prokaryotic and

eukaryotic DNA polymerases. Nucleic Acids Research. 16(20): 9677-9686. Hall, T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program

for Windows 95/98/NT. Nucl Acids Symp Ser 41: 95-98 Hanahan D. 1983. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular

Biology. 166:557-580. Hanahan, D. 1985. Techniques for transformation of E.coli. In: DNA cloning. Vol. 1 (ed.)

D.M.Glover. Oxford, Washington DC, IRL Press.109-136pp. Joe O’Connell. 2002. RT-PCR Protocols In: Methods in Molecular biology, Vol. 193 (ed.) Walker,

J.M. Humana press Inc. New Jersey. 378p Lo, Y. M. D.1998. Introduction to the polymerase chain reaction. Methods in Molecular Biology. 16:

3-10. Pascali, V. L., Pescarmona,M., Dobosz, M. and d'Aloja, E. 1990. Efficient, small scale electroelution

of high molecular weight DNA from agarose gels by a miniature vertical electrophoresis cell. Electrophoresis. 12: 317-320.

Rapley, R. and Manning, R.L. 1998. RNA isolation and characterization protocols. In: Methods in Molecular Biology, Vol. 86 (ed.) Walker, J.M., Humana Press, New Jersey, USA. 264 p.

Sambrook, J., Fritsch, E.F. and Maniatis, T. 1989. Molecular Cloning: A laboratory manual, Second Edition. Cold Spring Harbor Laboratory Press, New York, USA.

Vogelstein,B., and Gillespie,D. 1979. Proceedings of National Academy of Science, USA.76: 615.



Agarose Gel Electrophoresis

This is one of the routinely used techniques in molecular biology. This is used to separate DNA fragments and to assess the quality and quantity of DNA. Principle The gel is made from agarose, a highly purified form of the polysaccharide that is used to make agar plates on which bacteria is grown. The gel is immersed in buffer and the DNA fragments are loaded onto a well at one end of the gel and made to move through the gel by the application of electric current. DNA is negatively charged and so will move towards the positive anode. However, the polysaccharide mix of the gel retards the DNA by a process of sieving, so that small fragments move through faster and these fragments separate according to size. The DNA is visualised by adding ethidium bromide (EtBr), a fluorescent molecule which intercalate with the DNA bases, extending the length of linear and nicked circular DNA molecules and making them more rigid. When EtBr is added, UV radiation at 254 nm is absorbed by the DNA and transmitted to the bound dye. The energy is re-emitted at 590 nm in the red-orange region of the spectrum. Ethidium bromide is a powerful mutagen and hence the gel should be handled carefully with the gloves. The DNA bands can be visualised under UV and gel documentation appliances can record the data. Characteristic features of gel electrophoresis are: 1. The molecular weight of the DNA: The migration rate is inversely proportional to the molecular weight 2. Agarose concentration: The migration rate is inversely proportional to the agarose concentration 3. Conformation of the DNA: Linear form travels slowest and the supercoiled form travels fastest 4. Applied voltage: Typical value - 5 volts per cm. The heat generated during electrophoresis is dissipated by the buffer. 5. DNA being polyanionic at neutral pH, it migrates towards the anode. 6. The loading dye for DNA contains glycerol, which gives density to help the sample sink to the bottom of the well and marker dyes Xylene Cyanol and bromophenol blue. Bromophenol blue moves on par with 300-400 bp DNA and Xylene cyanol with 2-3 kb DNA. 7. The DNA is visualised by adding EtBr a fluorescent molecule that intercalates with the DNA bases. To 0.8% agarose gel add EtBr to give 0.5 pg/ml concentration. UV radiation at 254 nm is absorbed by the DNA and transmitted to the bound dye. The energy is re-emitted at 590 nm in the red-orange region of the spectrum. 8. EtBr is a powerful mutagen. The dye is usually incorporated into the gel or conversely the gel is stained after running by soaking in a solution of Et. Br. 9. The usual sensitivity of detection is 0.1 pg of DNA 10. The gel will be run along with a molecular weight marker, a wide range of which is commercially available. Protocol 1. Prepare 1% agarose gel in Tris-acetate EDTA buffer (IX TAE) containing EtBr 2. To 1 gm of agarose, add 100 ml of IX TAE. Heat until dissolved. Cool the gel to 50°C and add EtBr (0.5 pg/ml) before pouring into the gel apparatus. 3. Wash the gel casting tray and comb with water to remove dirt. 4. Place the apparatus on a level surface and check with the spirit level and adjust the level.



5. Choose appropriate comb (commonly 12 slots) and fix into position. 6. Pour the gel onto the apparatus and allow it to cool and set. 7. After the gel has set firmly, pour little amount of buffer and remove the comb gently. Take care not to drag the comb and break the gel. 8. Immerse the gel slowly into the gel tank. Add sufficient amount of IX TAE buffer. Connect the electrode and check the current. 9. Note: Always check the electrical connections before loading the sample. 10. Load the samples into wells carefully. 11. Always load an aliquot of standard molecular weight marker along with the samples. It will help in assessing the size of the DNA fragment by comparing with the electrophoretic mobility.



Denaturing Polyacrylamide Gel Electrophoresis (PAGE) for nucleic acids

Introduction

Polyacrylamide gels are chemically cross-linked gels formed by the polymerization of acrylamide with a cross-linking agent, usually N, N’-methylene bisacrylamide (Bis). The polymerization initiates by free radical formation usually carrying out with ammonium per sulfate as the initiator and N, N, N’, N’-tetramethylene diamine (TEMED) as a catalyst. The length of the chain may be determined by the concentration of acrylamide in the polymerization reaction. One molecule of crosslinker includes for every 29 monomers of acrylamide. Denaturing gels polymerized in the presence of an agent (urea or, less frequently, formamide) suppresses base pairing in nucleic acids. Denatured DNA migrates through these gels at a rate that is almost completely independent of its base composition and sequence. They are capable of resolving short single-stranded fragments of DNA or RNA that differ in length by as little as one nucleotide. Such gels are uniquely suited for nucleic acid sequence analysis, which is required, for instance, for all finger printing protocols. During early days the gels used for DNA sequencing were thick by today’s standards. The method described here was used to cast in the Biorad unit (Sequi-Gen GT Sequencing Cell) and may be used with appropriate modifications for other systems. Materials Required: Buffers and solutions Acrylamide solution (45% w/v) Acrylamide 434 g N,N-methylenebisacrylamide 16 g H2O to 600 ml Heat the solution to 37ºC to dissolve the chemicals. Adjust the volume to 1 liter with distilled H2O. Filter the solution through nitrocellulose filter and store in dark bottles at room temperature Ammonium per sulfate (1.6% w/v) in H2O KOH/Methanol solution: 5g KOH pellet in 100ml methanol. Store the solution at room temperature in tightly capped bottle. Repel Silane: contains dichlorodimethylsilane, eg.Sigmacote (from sigma), repelcote (from BDH) --(500 µl Dimethyldichlorosilane mixed in 10 ml chlororform) Bind Silane: 1 µl of ethacryloxypropltti-methoxy-silane mixed in 497.5 ml ethanol and 2.5 ml of 0.5 % acetic acid 10X TBE electrophoresis buffer (1000ml) 108 g of Tris base 55 g of boric acid 40 ml of 0.5 M EDTA (pH 8.0) EDTA (0.5 M, pH 8.0): Add 186.1g of disodium EDTA.2H2O to 800 ml of H2O. Stir vigorously on magnetic stirrer. Adjust pH to 8.0 with NaOH (~20g of NaOH pellets) dispense into aliquots and sterize by autoclaving (Note: The EDTA will not dissolve untill pH of solution is adjusted to 8.0 by adding NaOH) TEMED (N,N,N,’N’-tetramethylethylenediamine): commercially available must be stored in tightly sealed bottles in 4 C. Gel loading dye: 95 % formamide, 10 mM EDTA, pH 8, 0.09 % xylene cyanol FF and 0.09 % bromophenol blue. Urea (Solid) and water Other requirements: Gel casting assembly (including glassplates), gloves (talc free), syringes, water bath (at 55 C), petroleum jelly



Procedure: Gel casting (Sequi-Gen GT Sequencing Cell):

1. Wash the plates, spacers in warm dilute dishwashing liquid and rinse thoroughly in tap water, followed by distilled water. Rinse the plates with absolute ethanol and allow to dry. Plates must be cleaned meticulously.

2. Treat the inner core plate or smaller or notched plate with silanizing solution (repel silane) using tissue paper followed by even spreading (preferably in a fumehood), wipe the solution through the entire surface of glassplates using kimwipes and allow it to air dry for 1-2 min. Rinse the plates with deionized water then with ethanol and allow the plate to dry.

3. In the same way the outer glass plate was coated with bind silane, which help in fixing the gel firmly to the plates during staining process.

4. Place the spacers in position over the inner core plate and place the outer glass plates over it. 5. The plates are positioned in vertical position and the lever-operated clamps are placed on

both sides and slide the lever clamps over sandwich. 6. Insert sandwich assembly into the cam-operated precision caster base. Lay assembly flat on

lab bench. Now prepare the gel solution. Preparation of Acrilamide solution:

1. In a 250 ml conical flask prepare the acrilamide solution as per the table. 2. Combine all the reagents and then heat the solution in a waterbath 55 C waterbath for 3 min

to help dissolution of urea. 3. The solution was then filtered and was made up to 100 ml with water. 4. Remove the solution from the waterbath and allow it to cool to room temperature for 15 min,

swirl the mixture from time to time. Table: Acrylamide solutions for denaturing gels 4% Gel 6% Gel 8% Gel 10% Gel Acrylamide:bis solution (45%)

8.9 ml 13.3 ml 17.8 ml 22.2 ml

10x TBE buffer 10 ml 10 ml 10 ml 10 ml H2O 45.8 ml 41.4 ml 36.9 ml 32.5 ml Urea 42 g 42 g 42 g 42 g

5. Transfer the solution to a 250 ml glass beaker, add 3.3 ml of freshly prepared 1.6% ammonium per sulfate and swirl the gel solution gently to mix the reagents.

6. Add 50 µl of TEMED to the gel solution and swirl the solution gently to mix. 7. Proceed with speed from here, carefully drawn the solution using the syringe. 8. The solution was pumped slowly using a syringe into the plate assembly through the injection

port provided at the bottom of the casting assembly. 9. Place the flat side of shark comb in position ~0.5 cm into the gel solution. 10. Allow to polymerise, the gel is ready for running after 1 hour. 11. Remove the shark comb tooth and reinsert the shark teeth side of the comb just into the gel to

form the wells between the teeth. 12. The plate assembly was shifted to the gel running compartment where, the upper and lower

tank units were filled with 1x TBE buffer. 13. In order to maintain the DNA in denatured condition during the gel run, a temperature probe

was attached to the plate and connected to the powerpack unit (PowerPac 3000, Biorad, USA).

14. The gel was heated to 50ºC by pre-electrophoresis programmed at a constant temperature of 50ºC and variable parameters limits at 1000V/300mA for half an hour.

15. The samples were prepared by mixing 3.5 µl of sample with 2 µl of loading dye and heating at 95ºC for 5 min and immediately placed on ice.



16. The wells were flushed using a syringe and samples loaded from one end of the wells formed between the shark teeth of the comb.

17. Electrophoresis was conducted at a constant temperature of 50ºC and maximum limits of current at 1500 V and 300 mA in the power pack settings.

18. After the xylene cyanol dye reaches 2/3 of the gel length, the electrophoresis was terminated. The glass plates were separated and the gel bound glass plate was trasferred to the staining tray.



Silver staining of DNA Polyacrylamide gels

Introduction As a method, silver staining was originally developed to detect proteins separated by PAGE. It was further optimized and applied to visualize other biological molecules, for example, nucleic acids, lipopolysaccharides, glycoproteins and polysaccharides. These earlier protocols were, however, comparatively tedious and offered limited sensitivity. The development of DNA amplification fingerprinting (DAF) by Caetano-Anolle´s et al.,(1991) required a superior protocol to adequately resolve and visualize complex DNA profiles. These requirements led directly to the codevelopment of a successful combination of polyester-backed PAGE gels and DNA silver staining. The silver stain protocol developed for DAF was described separately by Bassam et al., (1991) and has since gained wide acceptance including commercialization (e.g., in the GenePrint STR systems and SILVER SEQUENCE products from Promega Corporation, USA). Silver staining of DNA (and other biological samples) has several advantages:

1. Image development and visualization is done under normal ambient light. Thus, the procedure can be performed entirely at the laboratory bench without the need for darkroom or UV illumination facilities.

2. The image is resolved with the best possible sensitivity and detail, because silver is deposited directly on the molecules within the transparent gel matrix. Thus visualization is from the primary source and does not suffer any degradation or blurring that can accompany secondary imaging devices which involve fluorescence, autoradiography, focusing lenses, film development or digital image processing.

3. Silver staining offers similar sensitivity to autoradiography, but avoids radioactive handling, delays from development times and waste disposal issues.

4. As a preferred option, gels can even be dried onto a semi-rigid plastic backing film such as GelBond PAG film, creating a permanent record of the original material. Air-dried gels are resilient, preserving a concentrated and contrast-intensified image. They can also be stored indefinitely without distortion, obviating the need and added expense of photography and printing. In addition, the preserved gel is a ‘molecular archive’, as stained DNA bands are ‘real’ DNA that can be extracted, amplified, cloned and DNA-sequenced.

The protocol herein described was developed by Bassam and Gresshoff et al., (2007). Chemicals required: Fixer solution: Dilute glacial CH3COOH to 7.5% (vol/vol) with deionized water. Store at room temperature (18–25º C). Fixer solution is stable and can be made up in bulk. CAUTION: Solution is slightly corrosive (household vinegar is commonly 5% CH3COOH). Avoid inhaling the vapor. Formaldehyde solution (HCHO): Add 15 ml formaldehyde to 85 ml deionized water. CRITICAL:This solution must be made up fresh as required. Ensure formaldehyde is stored at room temperature, since cold storage causes inactivation. Before preparing, estimate the volume needed for the number and size of gels that are to be stained. Silver solution: Dissolve 0.1 g AgNO3 in 100 ml deionized water. CRITICAL: This solution must be made up fresh as required. Sodium thiosulphate stock solution (Na2S2O3): Dissolve 0.2 g sodium thiosulphate in 50 ml water to make a stock solution. CRITICAL: The stock must be prepared fresh weekly, hence keep it as small as possible to avoid wastage. Developer solution: Dissolve 3 g Na2CO3 in 100 ml deionized water to make the developer solution. To speed dissolving and avoid clumping, swirl the water vigorously and add the Na2CO3 gradually. CRITICAL: This solution must be made up fresh as required and used at ~8º C. This is



most conveniently done by swirling the solution on an ice bath and monitoring the temperature just before use. To raise the temperature, should it get too cold, swirl the flask under a hot water tap. Developer stop solution: Dilute glacial CH3COOH to 7.5% (vol/vol) with deionized water. Store refrigerated at 4º C. Solution is stable and can be made up in bulk. CAUTION Solution is slightly corrosive. Avoid inhaling the vapor. Note: Before preparing stock solutions, estimate the volume needed for the number and size of gels that are to be stained. Equipment Setup: Platform rocker: A simple and gentle rocking motion (once every 2–3 s) gives the best results. Orbital motion is not recommended as it does not distribute reagent evenly across the gel surface, seemingly because reagent swirls around the perimeter of the gel leaving the center region relatively stagnant. Procedure Nucleic acid fixation

1. Choose a clean plastic staining tray that is larger than the gel by ~2 cm on all sides. Pour sufficient fixer solution into the tray to cover the gel to a depth of ~5 mm.

2. Disassemble the PAGE rig carefully, and place the gel into the staining tray. If you are using a polyester-backed gel, place it such that the gel side faces up in the tray.

3. Rock the staining tray continuously on a platform rocker. For typical mini-gels of ~1 mm thickness, a minimum of 5 min fixation is required, but 10 min provides optimum contrast. Longer times may be needed if thicker gels are used. This step may continue for up to ~30 min. CRITICAL STEP: Fixation is important for stain sensitivity. Its main function is to immobilize the DNA molecules in the acrylamide gel matrix to avoid diffusion and subsequent image blurring. It also removes and neutralizes unwanted chemicals such as urea and buffer, which can interfere with staining. Prepare fresh solutions

4. While the gel is fixing, prepare sufficient developer solution (as described in REAGENT SETUP) to cover the gel in the staining tray to a depth of ~5 mm. CRITICAL STEP: This and the solutions made up in the following steps are best prepared at this point in the protocol to ensure freshness and for optimal time management. (The sodium thiosulphate stock and developer stop solutions should already be pre-prepared and ready to use at this point.)

5. Add sodium thiosulphate stock solution (prepared as described in REAGENT SETUP) at the rate of 50 ml per 100 ml to the developer solution.

6. Cool the developer solution by putting it into a 4º C refrigerator. 7. Prepare sufficient formaldehyde solution (as described in REAGENT SETUP) to cover the

gel in the staining tray to a depth of ~5 mm. 8. Prepare sufficient silver solution (as described in REAGENT SETUP) to cover the gel in the

staining tray to a depth of ~5 mm. Gel washing

9. Following fixation, carefully decant the solution, taking care not to damage the gel or touch the gel surface.

10. To wash the gel, pour sufficient deionized water into the staining tray to cover the gel to a depth of ~5 mm.

11. Rock the staining tray continuously on a platform rocker for 2 min. Longer times may be needed if gels thicker than ~1 mm are used. If the gel is washed for too long (over ~20 min), then staining may be compromised, and fainter bands will result.

12. At the end of the wash, carefully decant the wash solution as described in Step 9.



13. Repeat the wash steps two times more for a total of three washes in deionized water. CRITICAL STEP: Washing the gel is important. It removes acid and other trace substances that interfere with staining, and provides a clear, blemish-free background to the final stain. Formaldehyde pre-treatment

14. Add sufficient formaldehyde solution to cover the gel in the staining tray to a depth of ~5 mm. Gently rock the staining tray continuously on a platform rocker. For typical mini-gels of ~1 mm thickness, a minimum of 5 min formaldehyde pre-treatment is required while ~10 min provides optimum contrast. Longer times may be needed if thicker gels are used. This step may continue for up to ~30 min. CRITICAL STEP: Formaldehyde pre-treatment is important for stain sensitivity and maximum image contrast.

15. Following the formaldehyde pre-treatment, carefully decant the solution, taking care not to damage the gel or touch the gel surface. Silver impregnation

16. Add sufficient silver solution to cover the gel in the staining tray to a depth of ~5 mm. 17. Gently rock the staining tray continuously on a platform rocker. For typical mini-gels of ~1

mm thickness, a 20 min impregnation time is usually optimal. CRITICAL STEP: The recommended silver concentration cannot be reduced without affecting sensitivity and contrast. A careful examination of silver impregnation times showed that optimal staining was achieved after ~20 min. However, as little as 10 min is sufficient for high-quality staining without significant loss of sensitivity. Impregnation times can be increased up to ~60 min, but greater than ~90 min can cause severe image loss.

18. Following silver impregnation, carefully decant the solution, taking care not to damage the gel or touch the gel surface. ! CAUTION: The silver solution is toxic and should be disposed of with care. Avoid spilling the solution, as it will permanently stain most surfaces.

19. Briefly rinse residual silver solution from the surface of the gel by rinsing with ~100 ml of deionized water for 5–10 s. Do not rinse the gel longer than ~15 s, as this step removes silver from the gel. Image development

20. Check whether the developer is cold (it should be between 4º and 10º C). Add sufficient developer solution to cover the gel in the staining tray to a depth of ~5 mm. Agitate the staining tray throughout image development so the developer solution is not stagnant. Image development begins as soon as the developer solution is added. The developer solution is kept cold to control the rate of image development, since development is usually too fast to control if done at temperatures above 10º C. Image development typically takes about 3 min depending on gel thickness, the reagents used and the temperature of the reagents. CRITICAL STEP: Decreasing Na2CO3 concentration below the recommended levels causes higher background staining and poor image contrast. Poor staining can also result from the use of low quality or old (stale) reagents. Stopping the reaction

21. Decant the developer solution carefully, avoiding damage to the gel or touching the gel surface.

22. Check whether the developer stop solution is cold (it should be stored refrigerated at 4º C). Add sufficient developer stop solution to cover the gel in the staining tray to a depth of ~5 mm. As an alternative, developer stop solution kept at room temperature can be used for thin gels (<1 mm in thickness). However, this alternative requires some practice as the image will continue to develop for several seconds after the developer stop solution is added.

23. Allow the gel to sit in developer stop solution for 5–10 min. CRITICAL STEP: The developer stop solution contains 7.5% CH3COOH. Higher CH3COOH concentrations can cause image fading, and should be avoided. Since development occurs quickly, it is best to



stop the reaction as abruptly as possible to avoid accidental overdevelopment. For this reason, the developer stop solution is chilled to 4 ºC so that it acts as quickly as possible-the low temperature slows the kinetics of development and allows time for the acid to take effect.

24. Decant the developer stop solution and rinse the gel with deionized water. 25. If desired, photograph the gel. Dried gels are robust and can be safely handled. If properly

stained, the image will not fade or darken and provides a permanent record of the experiment. References: Bassam, B.J. & Bentley, S. (1995) Electrophoresis of polyester-backed polyacrylamide gels.

Biotechniques 19, 568–573. Bassam, B.J. and Gresshoff, P.M. (2007) Silver staining DNA in polyacrylamide gels. Nature-

Protocols. 2(11), 2649-2654 Bassam, B.J., Caetano-Anolle´s, G. & Gresshoff, P.M. (1991) Fast and sensitive silver staining of

DNA in polyacrylamide gels. Anal. Biochem. 196, 80–83. Sambrook, J., Russell, D.W. Molecular Cloning: A Laboratory Manual 3rd Edition. Cold Spring

Harbor, NY: Cold Spring Harbor Laboratory Press, 2001



NBS Profiling Ben Vosman

Plant Research International, Wageningen, Netherlands

Introduction NBS profiling is a technique for DNA fingerprinting and expression profiling of R-genes based on conserved motifs in the nucleotide binding domain of resistance genes in plants. The technique involves three steps:

1. Restriction enzyme digest of (c)DNA and the ligation of adapters 2. Selective amplification of fragments using a (degenerated) primer for the conserved

domains. 3. Gel analysis of the amplified fragments

Depending on the motif and primer, 30-150 fragments can be amplified in a single PCR reaction of which up to 95 % contain the targeted motif. Polymorphisms are based on variations in the region of conserved domain (including absence presence of genes), mutations in the restriction sites used and indels in the sequence between the motif-specific primer annealing site and the restriction site. Any changes made to this protocol (including use of polymerase, minute changes in the primers, RL mixes, PCR cycling conditions, use of PCR machines) may affect the NBS profile produced and should be done with extreme caution and the appropriate controls. Starting Material 1.1 Quality check and estimation of DNA Yield. If one starts with similar amounts of plant material using the same procedure the yield will also be similar. Dissolve DNA to an expected concentration of 200 ng/ul in TE. Load approximately 50 ngr on a agarose gel. Using a dilution series of known quantity (add RNase to the loading buffer) estimate the DNA concentration and dilute the DNA to a final concentration of 50 ngr/ul. The quality of the DNA is one of the most important determinants of the quality of the NBS profile. The highest grade of DNA quality should be pursued. 2.1 Restriction Digestion and Adaptor Ligation In this step the DNA is digested with a restriction enzyme with a four base recognition site and blocked adapters are ligated to the ends. The blocked adapters consist of a long oligo with a sequence similar to the adapter primer and a short oligo that is blocked by an amino group at the 3’ end. The amino groups blocks elongation by Taq polymerase. At the start of the PCR the adapter primer can not anneal, only when a domain specific primer anneals and is elongated the annealing site for the adapter primer is generated. This prevents the amplification of adapter-adapter fragments. Adapter sequences: 5’ A C T C G A T T C T C A A C C C G A A A G T A T A G A T C C C A 3’ (long arm) 5’P T G G G A T C T A T A C T T 3’-NH2 (short arm) Prepare a mix of reagents shown in blue (always prepare approximately 10% more than needed). It is best to pipet reagents in the order listed and to mix the solution before the enzymes are added and after all components are added.

Components l per reaction 5 xRL+ (AFLP buffer) 12 adapter (adapted to Restriction enzyme 3 H2O 29 ATP 10 mM 6 Restriction enzyme (10 Units/ul) 1 Ligase (1 Unit/ul) (for blunt Enzymes: use high concentrate ligase

1

DNA 4 Incubate for 3 hours at 37 0C (preferable in PCR block) inactivate enzymes for 15 minutes at 65 0C and store at 4 oC or at –20 oC.



Add 60 ul H2O to the Restriction Ligation mixture! Note: experiments have shown that variation of the amount of DNA from 50 and 500 ng does not result in different patterns; we recommend using 200 ng of DNA. Other experiments have shown that dilution of the restriction ligation mixture is critical. 3. FIRST AMPLIFICATION ROUND 3.1. PCR methods In this step the domain specific primer is annealed and elongated by the Taq polymerase resulting in an annealing site for the adaptor primer not present previously. This in combination with the hot start Taq ensures high specificity. Although degenerate primers have a reputation of giving variable results, experiments show high reproducibility of this PCR (comparable to AFLP). Prepare a mix of reagents shown in blue (always prepare approximately 10% more than needed). It is best to pipet reagents in the order listed and to mix the solution before the enzymes are added and after all components are added. Adapter primer sequence: 5’ G T T T A C T C G A T T C T C A A C C C G A A A G 3’

Components l per reaction PCR buffer (with 15 mM MgCl2)

2.5

DNTP mix (5mM) 1 HotstarTaq polymerase (Qiagen)

0.08

NBS specific primer 10 pMol/ul 2 Adapter primer (10 pMol/ul 2 H2O 12.42 Template 5

PCR conditions: 15 min 95 C 30 sec 95 C, 1.40 min at 55-60C, depending on motif-specific primer (see below), 2 min 72 C 30-35 cycles 20 min 72 C Hold at 4 0C Note: HotstarTaq polymerase is only active after an incubation step of 15 minutes at 95 oC and therefore prevents non-specific amplification during pipetting. Annealing temperatures of the common primers: NBS2, NBS3: 60C NBS1, NBS5, NBS9: 55C 3.2 VERIFICATION OF PCR AMPLIFICATION Load 15 µl of the PCR product on 1% agarose which should result in a smear with several distinct fragments in the size range of 100-1000 bp. Patterns vary with the primer used and the DNA source. 3.3 DILUTION OF THE AMPLIFIED FRAGMENTS Add 90 ul of H2O to the remainder of the sample. 4. AMPLIFICATION WITH LABELLED PRIMER 4.1 PRIMER LABELLING Prepare a mix of reagents shown in blue (always prepare approximately 10% more than needed). It is best to pipet reagents in the order listed and to mix the solution before the enzymes are added and after all components are added.

Components l per reaction T4-forward buffer 5x 0.1 Distilled water 0.19



Domain specific primer ((10 pmol/l)

0.1

T4-polynucleotide kinase (10 U/l)

0.01

-33PATP 0.1 incubate mixture in 37 C waterbath for 1 to 16 hours. Optional: Inactivate kinase by heating reaction mixture to 70 C for 10 minutes 4.2 PCR METHODS Prepare a mix of reagents shown in blue (always prepare approximately 10% more than needed). It is best to pipet reagents in the order listed and to mix the solution before the enzymes are added and after all components are added.

Components l per reaction PCR buffer 2 DNTP mix (5mM) 0.8 Taq polymerase 0.08 Labelled motif-specific primer 0.5 Adaptor primer (10 pMol/ul) 0.2 H2O 11.42 Diluted mixture first PCR 5

PCR conditions: (Perkin Elmer GeneAmpTM PCR system 9600) 30 sec 95 C,1.40 min 55-60C (depending on motif-specific primer), 2 min 72 C 30-35 cycles 20 min 72 C Hold at 4 oC 5. POLYACRYLAMIDE GEL ELCTROPHORESIS 5.1. SAMPLE PREPARATION

1. Add an equal volume of loading buffer (98% formamide, 10mM EDTA pH8.0, Bromophenol blue and Xylene cyanol), incubate samples for 3 min to 95 C and cool samples on ice before loading on the PAA-gel.

2. DNA samples are analyzed on a 6% polyacrylamide gel (SequaGel-6, Ready-To-Use 6% Sequencing Gel Solution, National Diagnostics)

3. Electrophorese unit: Bio Rad sequi-Gen II(38x50 cm) 4. Gel loading using a fixed order and a tracking system for loading of samples in order to

prevent loading errors. Empty wells in the microtiter plate scheme, provide a check for correct loading.

5. Run the samples generally for at least 3 hours (depends on size of DNA fragments) at 110 W. 6. Fix gel on Whatman 3MM paper and dry. 7. Cover dry gel with film (Kodak X-OMAT AR, 35x43 cm) and store gel and film in light-tight

cassette. Length of exposure time depends on the amount of radioactivity of the image. 8. Develop film.

STOCKS AND SOLUTIONS: 5xRL+ buffer: 50 mM Tris.HAC pH 7.5 50 mM MgAc 250 mM KAc 25 mM DTT 250 ng/ul BSA TE buffer: 1 ml 1M Tris.HCl (pH 8.0) 20 l 0.5 M EDTA (pH 8.0) Add MilliQ H2O up to 100 ml. Adapter synthesis:

Labo

blunt 5’ A C AdaptAdd 1Incub

ReferVan d

Van d

Calen

Brugm

Wang

Jacob

Natio

ratory Manu

adapter: C T C G A T ter synthesis: 1.25 nmol eacbate mixture f

rences: der Linden CG

Vosman (Theor. App

der Linden Cmolecular process. Fvolume 14

nge F, van de(2005) Resmajor gene

mans B, WouVossen E (using NBS

g, M., RG Vafor plant sEvolution

bs, M.M.J., BBerg (2010genetic ma

onal training o

ual

T C T C A A 3’

ch of top- andfor 3 min at 90

G, D.C.A.E. W2004) Efficiepl. Genet. 109CG, Smulder

evolution. I.T. Bakker, L

43. Koeltz, Koer Linden CGsistance genees and QTL futers D, van (2008) Genet

S profiling. Than den Berg, Gsystematics: a Plant Syst Ev. Vosman, V0) A novel apap. Theor. Ap

on “Allele Mi

A C C C G A ANH2 T T C A

d bottom stran0 C and cool

Wouters, Viraent targeting9:384-393. rs MJM & VIn: Plant speL.W. Chatrouoenigstein/GeG, van de Wee analogues idfor disease res

Os H, Huttetic mapping aheor Appl GeGC Van der La first study ivol 276:137–

V.G.A.A. Vlepproach to locppl. Genet. 12

ining” 12th - 2

A A G T A TA T A T C T

nd and adjust l down slowly

ag Mihalka, E of plant dis

Vosman B. (2ecies-level sy, B. Gravend

ermany. Page eg E, Schoutedentified throsistance in appen R, van derand transcriptienet 117:1379Linden & B. Vin tuber-beari

–148 eeshouwers, Rcate Phytopht20:785-796.

25th Sept, 201

T A G A T C CA G G G T

volume to 75y to room tem

Elena .Z. Kocsease resistan

2005) Motif-ystematics: nedeel & P.B. Pe

291-303. en HJ, van A

ough the NBSple. Theor Apr Linden G, ion analyses o9–1388 Vosman (200ing Solanum

R.G.F. Vissethora infestan

11, IISR, Cali

C C A 3’ 5’-P

5 l. mperature.

From Bru

chieva, M. J. nce loci usin

-directed profew perspectielser (eds.) R

Arkel G, DenS-profiling meppl Genet. 11Visser R, vaof resistance

08) The utilityspecies. Plan

er, B. Henkenns resistance g

icut

ugmans et al.,

M. Smuldersng NBS prof

filing: a glanives on patte

Regnum Vege

nancé C, Durethod map clo0: 660-668.

an Eck H, vagene loci in p

y of NBS pront Systematic

n & R.G. Vagenes on the p

31

2008

s & B. filing.

nce at ern & etabile

el CE ose to

an der potato

ofiling cs and

an den potato



EcoTILLING K.Johnson George, and I.P. Vijesh Kumar

Indian Institute of Spices Research, Marikunnu P.O., Calicut- 673012.

TILLING and EcoTILLING applications were originally designed to be used on the LICOR DNA Analyzer, but have moved to numerous other platforms which do not require the use of dye labeled primers. The benefits are an inexpensive platform for reverse genetics and rapid SNP discovery, which still allows pooling of samples to increase throughput and reduce discovery bias. EcoTILLING studies are primarily concerned with identifying informative SNPs for population genetics, forensics, conservation and resource management work. Inclusion of too few individuals in the discovery panel can introduce ascertainment bias. EcoTILLING allows hundreds or thousands of individuals to be included in the discovery panel by pooling, which reduces ascertainment bias, and allows for the discovery of the most informative SNPs for the study at hand. During the training, we will be using Transgenomic SURVEYOR Mutation Detection Kits for TILLING. The kit includes a mismatch-specific DNA endonuclease to scan for known and unknown mutations and polymorphisms in heteroduplex DNA. SURVEYOR Nuclease, the key component of the kits, is an endonuclease that cleaves DNA with high specificity at sites of base-substitution mismatch and other distortions. The SURVEYOR Mutation Detection Kit for Standard Gel Electrophoresis has been designed to cleave unlabeled DNA fragments at mismatched sites for subsequent analysis by agarose gel electrophoresis or polyacrylamide gel electrophoresis (PAGE). DNA 200 to 4,000 bp long can be analyzed using manual agarose gel electrophoresis while smaller fragments (<1,000 bp) can be analyzed using manual polyacrylamide gel electrophoresis (PAGE). Kit Components 1). SURVEYOR Nuclease S 2). SURVEYOR Enhancer S 3).0.15 M MgCl2 Solution 0.25 mL 4).Stop Solution 0.25 mL (Store all components at –20 °C) DNA samples from black pepper (Piper nigrum) accessions will be used in the experiments. Step 1. PCR amplify your target fragment. This step is criticalto the success of the surveyor nuclease digestion. Ensure the following: • Your PCR yield is sufficiently high (>25 ng/μL). • Your PCR product has low background (preferably a single species of the correct size). • Your PCR product is essentially free of primer-dimer artifacts. It is imperative that a single PCR product be produced for efficient TILLING. Pooling several individuals in each PCR Pooling of samples is advantageous for several reasons: (1) More potential heteroduplexes may be seen (2) the number of individuals that can be surveyed at a time is increased (3) pooling can give an indication of the frequency of the SNP site in various populations prior to investing time and money in high-throughput genotyping. How many samples can be pooled? Up to 5 individual samples (~50ng/ul), 1ul each, can be pooled into a PCR reaction. For a single 25uL PCR reaction, add: DNA 50 ng



10X PCR Buffer 2.5 uL 50mM MgCl2 1.5 uL 10mM dNTPs 1.3 uL SharkaTAQ 1.0 uL H2O x uL Total: 25.0 uL Cycling: • 95°C for 3 minutes • 33 cycles of: • 95°C for 30 seconds • 57°C for 30 seconds * • 72°C for 2 minutes** • 15°C soak Depending on the primer* and expected PCR product** Step 2. Create heteroduplexes of the PCR products:

1. Mix equal amounts of PCR products in a 0.2-mL tube (If interested in creating pooled PCR product, individual products also may be used). For efficient annealing final volume should be at least 10 μL. The concentration of samples should be in the range of 25 to 80 ng/μL and ideally 50 ng/μL. About 200 - 400 ng of hybridized DNA is recommended for treatment with SURVEYOR Nuclease S, so that each tube should contain at least 200 ng total DNA.

2. Place the tube in a thermocycler and run the following program: 95 ºC 10 min 95 ºC to 85 ºC (-2.0 ºC/s) 85 ºC 1 min 85 ºC to 75 ºC (-0.3 ºC/s) 75 ºC 1 min 75 ºC to 65 ºC (-0.3 ºC/s) 65 ºC 1 min 65 ºC to 55 ºC (-0.3 ºC/s) 55 ºC 1 min 55 ºC to 45 ºC (-0.3 ºC/s) 45 ºC 1 min 45 ºC to 35 ºC (-0.3 ºC/s) 35 ºC 1 min 35 ºC to 25 ºC (-0.3 ºC/s) 25 ºC 1 min 4 ºC Hold.

The product is now ready to be treated with SURVEYOR Nuclease for heteroduplex analysis. Continue with Step 3 — Treatment with SURVEYOR Nuclease. Step 3. Cleave heteroduplexes:

1. For each digestion, add the following components in the order shown to a nuclease-free 0.2-mL tube (kept on ice): • 200 to 400 ng (V = 8 to 40 μL) hybridized DNA • 1/10th V μL 0.15 M MgCl2 Solution • 1 μL SURVEYOR Enhancer S • 1 μL SURVEYOR Nuclease S

2. Mix by vortexing gently, by agitation or by aspiration/expulsion in a pipette tip using a micro-pipetter.

3. Incubate at 42 °C for 60 min



4. Add 1/10th volume of Stop Solution and mix. Store the digestion products at –20 °C if not analyzed immediately.

Step 4. Separate cleavage products: Samples can be separated on various platforms. Amplified DNA fragments in the size range of 200 to 4,000 bp are most effectively resolved from potential digestion products on agarose gels (2%).

Labo

and dtranscstrikinTransorganregulaother regula

PCRThis pnestedrigoro Gene

Natio

ratory Manu

Ind

The DNA directs RNA pcription. Idenng interest fscription factnisms. The fatory sites, infactors to re

ate the transcr

R Based Genprotocol was d PCR with aously the requ

eral outline

onal training o

ual

dian Institute

region, usualpolymerase tontification of for biologiststors, which afactors can bn the promoteegulate the traription of gen

nome Walkinadapted from

a touch down uirements for

on “Allele Mi

PromD. Pras

of Spices Res

lly upstream o the correct f transcriptions since theseare proteins,

bind to specier region of panscription ones.

ng m Siebert et al

program. Thithe design of

ining” 12th - 2

moter Minsath and P.R.search, Marik

to the codingtranscriptionanal regulatore elements g play a majific sites, terparticular genf a gene. Tra

l. (1995) and is method is vf primers and

25th Sept, 201

ning . Rahul kunnu P.O., C

g sequence ofal start site a

ry elements wgovern the rjor role in rmed transcrnes and interanscription fa

www.clontecvery prone tothe touch-dow

11, IISR, Cali

Calicut- 6730

f a gene or opand thus permwithin promo

regulation of gene regulatription factorract with RNactors are sai

ch.com. The po artefacts so ywn PCR prog

icut

12.

peron, which mits the initati

oter regions f gene expretion of eukar binding sit

NA polymerasid to coopera

protocol invoyou need to fgram.

35

binds ion of is of

ession. aryotic tes or se and atively

lves a follow

Labo

Diges1. Cuto ma

2. Inc3. Ad

lay4. Ad

805. Spi

sup6. Res7. Run Adap1. To 25mM2’ and

2. Use

3. Inc4. Sto5. Adfor m

Natio

ratory Manu

stion of gent with a 6bp b

aximize gene c

2.5 μg of D5 μl of rest10μl 10 x r10 μl 1mgmdH2O to a

cubate for 5h add 100μl 25:24yer to fresh tudd 2.5 volume

oC for 1 hr. in in microfupernate. suspend pellen 1 μl on a 1%

pter Ligatiomake the ada

M final conced then let coo

ed a concentr5 μl of dig1 μl 10X li1 μl T4 lig2.4 μl adap0.6 μl dH2

cubate overnigop the ligase add 90 ul TE (1ore than a 20

onal training o

ual

nomic DNA blunt end cutcoverage. Set

DNA triction enzymrestriction buml-1 BSA (iffinal reactionat the appropr4:1 phenol:ch

ube. es ethanol and

uge for 10’ at

et in 20μl dH2

% gel, 30V fo

on aptor, mix the

entration [e.g.l to room tem

rated T4 DNAgested DNA igase buffer

gase ptor (25mM) 0 ght at 16oC activity by inc10mM Tris pH0 PCR reactio

on “Allele Mi

tter. Can eithet up reaction:

me uffer f not already in volume of 1riate tempera

hloroform: IA

d 0.1 volume

t full speed.

2O. or 5 hours. A

e long and sh 20μl long pr

mp.

A ligase (5x)

cubating the rH7.5, 1mM Eons.

ining” 12th - 2

er use one en

in 10 x buffer00μl. ture.

AA. Vortex an

3M NaOAc p

Wash pellet

good smear s

hort primers (srimer (50mM

, (Biolabs, M

reactions at 70EDTA). This g

25th Sept, 201

nzyme or set u

r)

nd spin for 5’

pH4.5. Precip

with 70% eth

should be seen

see below) inM) + 20μl sho

M0202T) and s

0oC for 5’ gives you 100

11, IISR, Cali

up 4 different

in microfuge

pitate at –20oC

hanol, spin a

n.

n the right conort (50mM)].

set up the foll

0μl of a librar

icut

t enzyme reac

e. Remove aq

C overnight o

again and dra

ncentration toPlace at 100o

lowing reactio

ry that can be

36

ctions

queous

or at –

ain off

o get a oC for

on:

e used



Touch down PCR Two nested reactions need to be carried out using the AP1 and AP2 primers illustrated on the previous page and two gene specific primers. The gene specific primers need to be designed (www.clontech.com) 1. Set up following reaction using an expand or other enhanced polymerase

1 μl adapter ligated library 5 μl 10 X PCR buffer 4 μl 25 mM MgCl2 1 μl 10 mM dNTP’s 1 μl AP1 Primer (10μM) 1 μl Gene specific primer 1 (10μM) 0.5 μl DNA Polymerase 35.5 μl dH2O 50 μl TOTAL

2. Cycle as follows: 94oC (25s), 72oC (3’) X 7 94oC (25s), 67oC (3’) X 32 67oC (7’) X 1 cool to 4oC.

3. Analyze 8μl of the reaction on a 1.5% agarose gel. You should observe banding patterns however there may be some smearing. 4. Dilute 1μl of each primary PCR into 49 μl dH2O. 5. Set up nested reaction mix:

1 μl diluted primary PCR reaction 5 μl 10 X PCR buffer 4 μl 25 mM MgCl2 1 μl 10 mM dNTP’s 1 μl AP2 Primer (10μM) 1 μl Gene specific primer 2 (10μM) 0.5 μl DNA polymerase 35.5 μl dH2O 50 μl TOTAL

6. Cycle as follows: 94oC (25s), 72oC (3’) X 5 94oC (25s), 67oC (3’) X 20 67oC (7’) X 1; cool to 4oC. 7. Analyze 5μl of the reaction on a 1.5% agarose gel. You should observe distinct banding patterns.

The remainder of the PCR reaction can then be used to clone and sequence the band of interest. Selected references: Siebert et al. 1995. An improved PCR method for walking in uncloned genomic DNA , Nucleic acid research, 23(6):1087-1088. www.clontech.com



TOOLS FOR GENETIC DIVERSITY ANALYSIS Rajesh M.K.*, 1 and Jayasekhar S.2

1Division of Crop Improvement, 2Division of Social Sciences Central Plantation Crops Research Institute, Kasaragod 671124, Kerala

(*E-mail: [email protected])

Introduction Plant genetic resources constitute the chief component of agro-biodiversity and comprise of

land races, modern cultivars and obsolete varieties, breeding lines and genetic stocks and wild species. They provide the basic materials to the plant breeders to utilize genetic variability for the development of high yielding cultivars with a broad genetic base. The utilization of these genetic resources, however, depends upon their efficient and adequate characterization and evaluation, which in turn entails efficient characterization standards and appropriate strategies.

Analysis of trait data generated from characterization and evaluation of the genetic resources is used to understand and use diversity. Currently, a large number of distance measures are available for analyzing similarity/dissimilarity among accessions based on different traits representing different types of variables. The selection of the most appropriate distance measure for each trait is the prerequisite for diversity analysis studies. One of the approaches is to form clusters where accessions between clusters would be more diverse than the accessions within a cluster. The clustering algorithms require a distance/similarity matrix between the accessions which can be calculated depending upon the nature or type of traits such as morphological and agronomic traits and/or molecular markers.

The availability of cost-efficient, large scale genotyping techniques has greatly facilitated the assessment of genetic diversity within populations. Various computational tools have also been developed concurrently to analyze the genetic data derived from the genotyping experiments. In this review, the basics of population genetics, important parameters in genetic diversity analysis and the most widely used computer programmes in population genetic studies have been described. Basics of population genetics

Variation in alleles allows organisms to adapt to ever-changing environments. Alleles are different forms of the same gene that are expressed as different phenotypes. All of the alleles shared by all of the individuals in a population make up the population's gene pool. In diploid organisms, every gene is represented by two alleles, one inherited from each parent. The pair of alleles may differ from one another, in which case it is said that the individual is "heterozygous" for that gene. If the two alleles are identical, it is said that the individual is "homozygous" for that gene.

Population genetics is the study of allele frequency distribution and change under the influence of the four main evolutionary processes: natural selection, genetic drift, mutation and gene flow. It also takes into account the factors of population subdivision and population structure and attempts to explain such phenomena as adaptation and speciation.

Based on Mendelian genetics, it is possible to predict the probability of the appearance of a particular allele in an offspring when the alleles of each parent are known. Similar predictions can be made about the frequencies of alleles in the next generation of an entire population. By comparing the predicted or "expected" frequencies with the actual or "observed" frequencies in a real population, one can infer a number of possible external factors that may be influencing the genetic structure of the population (such as inbreeding or selection). A population is defined as a group of interbreeding individuals that exist together at the same time. A population may either be considered as a single unit or it can be subdivided into smaller units. Subdivisions of a population may be the result of ecological factors or behavioural factors. If a population is subdivided, the genetic links among its parts may differ, depending on the real degree of gene flow taking place.



A population is considered structured if: (i) Genetic drift is occurring in some of its subpopulations, (ii) Migration does not happen uniformly throughout the population, or (iii) Mating is not random throughout the population. A population’s structure affects the extent of genetic variation and its patterns of distribution.

Genetic drift

‘Genetic drift’ refers to fluctuations in allele frequencies that occur by chance (particularly in small populations) as a result of random sampling among gametes, i.e. random changes in gene frequency which are not due to selection, gene mutation or migration. Genetic drift decreases diversity within a population because it tends to cause the loss of rare alleles, reducing the overall number of alleles. Because of genetic drift, small, isolated populations often have unusual frequencies of a few alleles. Gene flow

‘Gene flow’ is the passage and establishment of genes typical of one population in the gene pool of another by natural or artificial hybridization and backcrossing. ‘Non-random mating’ occurs when individuals those are more closely (inbreeding) or less closely related mate more often than would be expected by chance for the population. Self-pollination or inbreeding is similar to mating between relatives. It increases the homozygosity of a population and its effect is generalized for all alleles. Inbreeding per se does not change the allelic frequencies but, over time, it leads to homozygosity by slowly increasing the two homozygous classes.

Mutations could lead to occurrence of new alleles, which may be favourable or deleterious to the individual’s ability to survive. If changes are advantageous, then the new alleles will tend to prevail by being selected in the population. The effect of selection on diversity may be: (i) ‘Directional’, where it decreases diversity; (ii) ‘Balancing’, where it increases diversity. Heterozygotes have the highest fitness, so selection

favours the maintenance of multiple alleles; and (iii) ‘Frequency dependent’, where it increases diversity. Fitness is a function of allele or

genotype frequency and changes over time. Migration

‘Migration’ implies not only the movement of individuals into new populations but that this movement introduces new alleles into the population (gene flow). Changes in gene frequencies will occur through migration either because more copies of an allele already present will be brought in or because a new allele arrives. Various factors which affect migration in crop species include breeding system, sympatry with wild and/or weedy relatives, pollinators, and seed dispersal. The immediate effect of migration is to increase a population’s genetic variability and, as such, helps increase the possibilities of that population to withstand environmental changes. Migration also helps blend populations and prevent their divergence. Hardy-Weinberg Principle

The foundation for population genetics was laid in 1908, when Godfrey Hardy and Wilhelm Weinberg independently published which is known as the ‘Hardy-Weinberg Equilibrium’ or ‘Hardy-Weinberg Principle’, which states: "In a large, randomly breeding (diploid) population, allelic frequencies will remain the same from generation to generation; assuming no unbalanced mutation, gene migration, selection or genetic drift." When a population meets all of the Hardy-Weinberg conditions, it is said to be in Hardy-Weinberg equilibrium. The "equilibrium" is a simple prediction of genotype frequencies in any given generation, and the observation that the genotype frequencies are expected to remain constant from generation to generation as long as several simple assumptions are



met. This description of stasis provides a counterpoint to studies of how populations change over time. Testing for Hardy-Weinberg Equilibrium The deviation of a population from Hardy-Weinberg equilibrium is an indication of the intensity of external factors and can be determined by a statistical formula called a chi-square, which is used to compare observed versus expected outcomes. The statistical test follows this formula:

HWT = ∑ (Oi-Ei)2/Ei

Where HWT = Statistical test for Hardy-Weinberg Equilibrium; Oi = Observed frequencies and Ei = Expected frequencies If X2

cal ≤ X2tab, then H0 hypothesis is accepted and it follows that allele frequencies for loci in a given

population are HWT equilibrium. If X2cal ≥ X2

cal, then H0 hypothesis is rejected. Important parameters in genetic diversity analysis (A) Polymorphism or rate of polymorphism: A polymorphic gene is usually defined as one for

which the most common alleles has a frequency of less than 0.95. Pj = q ≤ 0.95

Where, Pj = rate of polymorphism and q = allele frequency

For a correct estimation of genetic distance, the genetic loci use in genetic distance analysis should be informative, i.e., they should display sufficient polymorphism. The limit of allele frequency, which is set at 0.95, is arbitrary, its objective being to help identify those genes in which allelic variation is common. Rare alleles are defined as those with frequencies of less than 0.005.

This index is best applied with codominant markers. It can also be used with dominant markers too, but restrictively, as the estimate based on dominant markers would be biased below the real number. (B) Average number of alleles per locus: It is the sum of all the detected alleles in all loci,

divided by the total number of loci. This parameter, which provides complementary information to that polymorphism, is given by:

N= k/1

k

i 1

ni

Where: k = Number of loci and ni = Number of alleles detected by locus This parameter is best applied in the case of codominant markers as dominant markers do not permit the detection of all alleles. (C) Effective number of alleles: This measure, which explains about the number of alleles that

would be expected in a locus in each population, is given by: Ae = 1/(1 – h) = 1/Σpi

2

Where, pi = frequency of the ith allele in a locus and h = 1 – Σpi2 = heterozygosity in a locus.It

ranges from 0 to 1. It can be calculated for both dominant and co-dominant markers. By taking allele frequencies into account, this descriptor of allelic richness is less sensitive to rare alleles. This parameter plays a fundamental role in verification of sampling strategies. However, its calculation is affected by the sample size. (D) Observed Heterozygosity: A population's heterozygosity is measured by first determining the proportion of genes that are heterozygous and the number of individuals that are heterozygous for each particular gene. For a single gene locus with two alleles, the Observed Heterozygosity (Ho) is calculated as follows:



Ho = Number of heterozygotes at a locus Total number of individuals surveyed

Derivations of the above formula are used to calculate the HO when there are more than two alleles for a particular locus, which is particularly common when microsatellite or simple sequence repeat (SSR) markers are applied for analysis of populations. (E) Expected Heterozygosity: The Expected Heterozygosity (He) is defined as the estimated fraction of all individuals that would be heterozygous for any randomly chosen locus. It is the probability that, at a single locus, any two alleles, chosen at random from the population, are different to each other. For a locus j with I alleles, It is calculated as:

hj = 1 – Σpi2

Where, hj = heterozygosity per locus and p = allele frequencies He differs from the Ho because it is a prediction based on the known allele frequency from a sample of individuals. Deviation of the observed from the expected can be used as an indicator of important population dynamics. (F) Effective Population Size: One of the many variables of population dynamics that can influence the rate and size of fluctuation in allele frequencies is population size. Genetic drift, the random increase or decrease of an allele's frequency, affects small populations more severely than large ones, since alleles are drawn from a smaller parental gene pool. The rate of change in allele frequencies in a population is determined by the population's effective population size. The effective population size is the number of individuals that evenly contribute to the gene pool. The actual number of individuals in a population is rarely the effective population size. This is because some individuals reproduce at a higher rate than others (have a higher fitness), the distribution of males and females may result in some individuals being unable to secure a mate, or inbreeding reduces the unique contribution of an individual. The effective population size is a theoretical measure that compares a population's genetic behavior to the behavior of an "ideal" population. As the effective population size becomes smaller, the chance that allele frequencies will shift due to chance (drift) alone becomes greater. (G) Shannon index: Estimates Shannon’s Information Index as a measure of gene diversity. It is based on information theory and is a measure of the average degree of "uncertainty" in predicting to what species an individual chosen at random from a collection of S species and N individuals will belong. This average uncertainty increases as the number of species increases and as the distribution of individuals among the species becomes even. The proportion of species i relative to the total number of species (pi) is calculated, and then multiplied by the natural logarithm of this proportion (lnpi) in order to obtain the Shannon’s Index (H’).

H’=-

S

i 1

(pi In pi)

It can be shown that for any given number of species, there is a maximum possible H’, Hmax = lnS which occurs when all species are present in equal numbers. When Shannon index is near 1, it can be concluded that the population is highly heterozygous. (H) Inbreeding and Relatedness: Small effective population size can result in a high occurrence of inbreeding, or mating between close relatives. One of the effects of inbreeding is a decrease in the heterozygosity (increase in homozygosity) of the population as a whole, which means a decrease in the number of heterozygous genes in the individuals. This effect places individuals and the population at a greater risk from homozygous recessive diseases that result from inheriting a copy of the same recessive allele from both parents. The impact of accumulating deleterious homozygous traits is called ‘inbreeding depression’ - the loss in population vigor due to loss in genetic variability. Wright (1951) developed a set of parameters called F-statistics. The inbreeding coefficient (FIS) defined as the probability that two homologous (same) alleles present in the same individual are



identical by descent. FIS is calculated by comparing the expected heterozygosity (He) with observed heterozygosity (Ho), and ranges from -1 (no inbreeding) to +1 (complete identity). If the values for both observed and expected heterozygosity are the same, FIS will be zero. A positive value indicates that there is an increased number of homozygotes, and population may be inbred - the larger the number, the greater the extent of inbreeding. A negative value indicates that there are more heterozygous individuals than would be expected; this might happen for the first few generations after two previously isolated populations become one.

The relationships among the F statistics can be deduced through the following: (1 - FIT) = (1 – FIS)(1 – FST) FIT = 1 – (HI/HT) FIS = 1 – (HI/HS) FST = 1 – (HS/HT)

Where, HT = total gene diversity or expected heterozygosity in the total population as estimated from the pooled allele frequencies, HI = intrapopulation gene diversity or average observed heterozygosity in a group of populations, and HS = average expected heterozygosity estimated from each subpopulation. These statistical indices measure: FIS = the deficiency or excess of average heterozygotes in each population FST = the degree of gene differentiation among populations in terms of allele frequencies FIT = the deficiency or excess of average heterozygotes in a group of populations The chi-square test can be used to statistically analyze whether the difference between the observed and expected is not likely due to chance. If there is a significant increase in the expected number of heterozygotes, inbreeding can be ruled out as a possible population dynamic that is influencing the genotype frequencies. Corrections for Sampling Error:

There are two sources of allele frequency difference among subpopulations in a sample: (i) Real differences in the allele frequencies among our sampled subpopulations (ii) Differences that arise because allele frequencies in our samples differ from those in the subpopulations from which they were taken. Nei and Chesser (1983) described the GST approach to account for the sampling error. GST is an interpopulation differentiation measure when multiple loci are used for analysis. It measures the proportion of gene diversity that is measured among populations, when a large number of loci are sampled. GST = DST / HT,

where, DST = interpopulation diversity, HT = total diversity (HS + DST), Hs = intrapopulation genic diversity, and DST = HT – HS.

Because of the complexity of its components, calculation of GST requires specialized computer software. It can be used with codominant markers and restrictedly with dominant markers, since it is a measure of heterozygosity. Weir and Cockerham (1984) described another statistic, , which incorporates an important source of sampling error ignored by GST. Measurement of genetic distance

Various genetic distance measures have been proposed for analysis of molecular marker data, depending on whether the markers are dominant or co-dominant. For dominate markers, the total number of bands is conventionally set as the number of analyzed loci. For co-dominant markers, genetic similarity between two individuals number of alleles per locus determined for total collection,



is in general higher than two, Opposite to the 1- and 0- allele for dominant markers. Generally, genetic distance in codominant markers are based on allele frequencies.

If we assume that a = 3, b = 1, c = 3 and d = 2 then: (i) Dice and Nei and Li: a/[a + (b + c)/2] =0.6 (ii) Jaccard: a/(a + b + c) = 0.49 (iii) Sokal and Sneath: a/[a +2(b + c)] = 0.273 (iv) Roger and Tanimoto : (a + d)/[a + d + 2(b + c)]= 0.385

The Jaccard coefficient only count bands present for either individual and treats double

absences as missing data. If false-positive or false negative data occur, the index estimate tends to be biased. It can be applied with co-dominant marker data. Nei and Li coefficient counts the percentage of shard bands among two individuals and gives more weight to those bands they are present in both. It considers that absence has less biological significance, and so this coefficient has complete meaning in terms of DNA similarity. It can be applied with codominant marker data (RFLP, SSR). Multivariate analysis

One of the main concerns of plant breeders is to quantify the degree of dissimilarity in genetic resources, since knowledge concerning genetic distances is necessary for optimum organization of gene banks and for identifying parental combinations that produce progenies with maximum genetic variability, thereby increasing the chances of obtaining superior individuals (Mohammadi and Prasanna, 2003). Use of multivariate statistical algorithms is considered an important strategy to quantify genetic similarity. Multivariate analysis is based on the statistical principle of multivariate statistics, which involves observation and analysis of more than one statistical variable at a time. Multivariate techniques permit standardization of multiple types of in-formation of a set of characteristics. The most widely used algorithms are principal component and canonical variable analysis, as well as clustering methods

The principle of clustering methods is to join genotypes into groups, so that there is uniformity within and heterogeneity among groups. These methods depend on previous estimates of dissimilarity measures derived from discrete and continuous (or categorical) variables. These categorical variables can be defined as binary, nominal or ordinal. Among grouping methods, hierarchical clustering has been used most frequently, particularly the single linkage (SL) and unweighted pair group method using arithmetic averages (UPGMA) methods. The reliability of clustering methods depends on the magnitude of the cophenetic correlation, which is the association between the genetic distance matrix and the matrix based on genotype grouping. SL consider absence corresponds to homozygous loci, it can be used with dominate marker (RAPD, AFLP) because absence could corresponds to homozygous recessives. UPGMA is most commonly method for cluster analysis, UPGMA can only be used when the evolutionary rate is nearly same for all groups included in the study, when studying the genetic diversity of germplasm collection, SL method should be preferred above the UPGMA clustering method, because genetic difference among accessions in germplasm are dominantly determined by selection and breeding rather than by evolutionary forces.

Resampling is a term used in statistics for bootstrapping and permutation these procedures can be used in genetic diversity studies to assign confidence to the presence of clusters in a dendrogram. Bootstrapping is a statistical method for estimating the sampling distribution of an estimator by sampling with replacement from the original sample, major purpose of bootstrapping is deriving robust estimates of standard errors and confidence intervals of population parameters. A permutation test is type of statistical significant test in which a reference distribution is obtained by calculating all possible values of the test statistic under rearrangements the tables on the observed data points. Steps involved in analysis of molecular marker data Three main steps are involved in the statistical analysis of molecular data in diversity studies: A. Data collection: The data on molecular markers is recorded in the following two forms:



(a) Binary data: presence or absence of molecular marker bands (b) Allelic data (based on allele size) B. Data analysis using univariate and multivariate statistical approaches C. Interpretation of the data.

Each step in the process should follow a standardized format if the output of one diversity study is to be compared to other studies and inferences drawn in this manner. Software programs for analyzing genetic diversity

Many software programs for molecular population genetics studies have been developed; the important ones are given below: (i) CONVERT (http://www.agriculture.purdue.edu/fnr/html/faculty/rhodes/

students%20and%20staff/glaubitz/software.htm) CONVERT is a user-friendly, 32-bit Windows program that aids conversion of diploid

genotypic data files into formats that can be directly read by a number of commonly used population genetic computer programs: GDA, GENEPOP, ARLEQUIN, POPGENE, MICROSAT, PHYLIP and STRUCTURE (Glaubitz, 2004). In addition, CONVERT can be used to produce a table of allele frequencies in a convenient format, allowing the visual comparison of allele frequencies across populations. The input file for CONVERT follows a 'standard' format that can be easily obtained via an EXCEL file containing the genotypic data. CONVERT can also read in input data files in GENEPOP format. CONVERT works on Windows 95/98/NT/2000/XP platforms. (ii) ARLEQUIN (http://cmpg.unibe.ch/software/arlequin/)

Released first in 1997, Arlequin is a freely available integrated population genetics software environment (Schneider et al., 1997). It is able to handle both large samples of molecular data (RFLPs, DNA sequences, microsatellites) and also conventional genetic data (standard multi-locus data or allele frequency data). Molecular data can be entered as DNA sequences, RFLP haplotypes, microsatellite profiles, or multilocus haplotypes. The graphical interface is designed to allow users to rapidly select the different analyses they want to perform on their data.

The data format is specified in an input file. The user can create a data file from scratch, using a text editor and appropriate keywords, or use the ‘Project Outline Wizard’. Data can be imported from files created for other programs, including MEGA, BIOSYS, GENEPOP, and PHYLIP. Missing or ambiguous data can be included. A very detailed user manual is available, which includes a large amount of theoretical information, formulae, and references. A large number of data can be analysed, and a Batch Files option is also available (iii) POWERMARKER (http://statgen.ncsu.edu/powermarker/)

PowerMarker was designed specifically for the use of SSR/SNP data in population genetics analyses (Liu, 2003). Data can be imported from Excel or other formats, making data set-up very easy. Data can also be exported to NEXUS and Arlequin formats. It includes a ‘2D viewer’ for linkage disequilibrium visualization. The user can edit graphics within PowerMarker or export them for publication. The program has been tested extensively for accuracy and efficiency. Full documentation is included. Several new modules for association study are included in the package. Several demonstration datasets are available to get started. The program is free, but requires having PHYLIP, TreeView and the Microsoft.net framework system (all freely available) and Excel 2000 (not free). Another disadvantage is that it is available only for Windows 98 and above (not for Macintosh or other systems). (iv) PAUP (http://paup.csit.fsu.edu/)

PAUP is widely used for inferring and interpreting evolutionary trees (Swofford, 2002). It originally meant Phylogenetic Analysis Using Parsimony, but now has many other options. Although not free, it is relatively inexpensive and available from Sinauer Associates, Sunderland, MA. A new version, 4.0 beta, has been released as a provisional version. Macintosh, PowerMac, Windows and Unix/OpenVMS versions are available; the Mac version has some extra features. The Windows version runs as a GUI application, however, unlike the Macintosh version, most options are



command-line-driven. The advantage to running PAUP under Windows is that a scrollback display buffer is built into the program, an editor is provided, and commands are remembered between sessions (they can be recalled, edited, etc.). It is closely compatible with MacClade (another program available from Sinauer), since they use a common data format (NEXUS). (v) MEGA (http://www.megasoftware.net/)

MEGA (Molecular Evolutionary Genetics Analysis) software has been widely used since its creation in 1993. It uses DNA sequence, protein sequence, evolutionary distance or phylogenetic tree data. It is an integrated tool for conducting automatic and manual sequence alignment, inferring phylogenetic trees, mining web-based databases, estimating rates of molecular evolution, and testing evolutionary hypotheses (Kumar et al., 2008). Although it was designed for the Windows platform, it runs well on Macintosh with a Windows emulator, Sun workstation (with SoftWindows95) or Linux (with Windows by VMWare). Online, a thorough manual is available, together with a bulletin board to interact with other users. (vi) GENEPOP (http://genepop.curtin.edu.au/)

Genepop is a population genetics software package, which has options for the following analysis: Hardy-Weinberg equilibrium, linkage disequilibrium, population differentiation, effective number of migrants, Fst or other correlations (Raymond and Rousset, 1995). Genepop can be used either as a DOS-version or a Web-version. The web-version is easy to use: after choosing an option for the analysis, the data is typed or pasted into the text window provided and the results are obtained either by email or by viewing the output via the Web. (vii) POPGENE (http://www.ualberta.ca/~fyeh/popgene_download.html)

POPGENE is a user-friendly window-based computer package for the analysis of genetic variation among and within natural populations using co-dominant and dominant markers and quantitative traits (Yeh and Boyle, 1997). This package provides the Windows graphical user interface that makes population genetics analysis more accessible for the casual computer user and more convenient for the experienced computer user. The current version is designed specifically for the analysis of co-dominant and dominant markers using haploid and diploid data. It performs most types of data analysis encountered in population genetics and related fields. It can be used to compute summary statistics (e.g., allele frequency, gene diversity, genetic distance, F-statistics, multilocus structure, etc.) for (a) single-locus, single populations; (b) single-locus, multiple populations; (c) multilocus, single populations and (d) multilocus, multiple populations. The latest version also includes the module for quantitative traits. (viii) GDA (http://hydrodictyon.eeb.uconn.edu/people/plewis/software.php)

GDA (Genetic Data Analysis) is a programme written by Lewis and Zaykin (1999). It computes linkage and Hardy-Weinberg disequilibrium, some genetic distances, and provides method-of-moments estimators for hierarchical F-statistics. (ix) GenAlEx (http://www.anu.edu.au/BoZo/GenAlEx/)

GenAlEx (' Genetic Analysis in Excel') is a user-friendly cross-platform package for population genetic analysis that runs within Microsoft Excel (Peakall and Smouse, 2006). GenAlEx enables population genetic data analysis of codominant, haploid and binary genetic data providing analysis tools applicable to plants, animals and microorganisms. It has tools for importing, editing and manipulating raw genotype and sequence data from automated sequencing or genotyping software. New 2D spatial autocorrelation procedures have been incorporated in addition to the existing wide range of spatial analysis options. Pairwise relatedness among individuals can be estimated. There are tools for genetic tagging applications, including location of matching genotypes and calculation of probabilities of identity. Data export options to a host of other population genetic software packages are also available. (x) TFGPA (http://www.marksgeneticsoftware.net/tfpga.htm) TFGPA (Tools for Population Genetic Analyses) is a Windows program for the analysis of allozyme and molecular population genetic data (Miller, 1997). This program calculates descriptive statistics,



genetic distances, and F-statistics. It also performs tests for Hardy-Weinberg equilibrium, exact tests for genetic differentiation, Mantel tests, and UPGMA cluster analyses. Additional features include the ability to analyze hierarchical data sets as well as data from either codominant markers such as allozymes or dominant markers such as AFLPs or RAPDs. (xi) STRUCTURE (http://pritch.bsd.uchicago.edu/structure.html)

The program structure is a free software package for using multi-locus genotype data to investigate population structure. Its uses include inferring the presence of distinct populations, assigning individuals to populations, studying hybrid zones, identifying migrants and admixed individuals, and estimating population allele frequencies in situations where many individuals are migrants or admixed. It can be applied to most of the commonly-used genetic markers, including SNPs, microsatellites, RFLPs and AFLPs. The basic algorithm was described by Pritchard et al. (2000). Useful internet resources

The following are a list of Internet resources containing links to useful information pertaining to genetic diversity analysis, population genetics and other software available: (i) ‘An alphabetical list of genetic analysis software’ from the North Shore LIJ Research

Institute (http://linkage.rockefeller.edu/soft/list1.html) contains a list of 520 programmes. Computer software on genetic linkage analysis for human pedigree data, QTL analysis for animal/plant breeding data, genetic marker ordering, genetic association analysis, haplotype construction, pedigree drawing, and population genetics are included here.

(ii) ‘Phylogeny Programs’ (http://evolution.genetics.washington.edu/ phylip/software.html) contains links to 365 phylogeny packages and 51 free web servers. Updates to these pages are made monthly. Many of the programs in these pages are available on the web, and some of the older ones are also available from ftp server machines. The programs listed below include both free and non-free ones. The packages are sorted in various ways (e.g. by methods, system used, analyzing particular kind of data, most recent etc.).

(iii) Maize Genetics site (http://www.maizegenetics.net/bioinformatics) from Cornell’s Institute of Genomic Diversity contains freely available software programme to evaluate linkage disequilibrium, nucleotide diversity, and trait associations

(iv) The European Molecular Biology Laboratory–European Bioinformatics Institute (EBI) site (http://www.ebi.ac.uk/) contains links to many useful programs and other sites.

(v) Mathematical Genetics and Bioinformatics Site, University of Chicago (http://mathgen.stats.ox.ac.uk/software.html)

(vi) Statistical genetics and Bioinformatics Site, North Carolina State University (http://statgen.ncsu.edu/brcwebsite/software_BRC.php) contains software’s for genetic data analysis developed and made available by researchers at or affiliated with the Bioinformatics Research Center’s.

Conclusion The analysis of genetic diversity within a species is imperative for gaining an insight into the

process of evolution of the species at the population level. Many statistical packages and computer programmes are currently available for analyzing molecular data for assessment of genetic diversity. Most programs perform similar tasks and many of them are freely downloadable from the internet. The programmes, however, differ from each other in the type of marker they can handle, the manner in which the raw data is formatted and also in how the users select the details of the computations to be performed. Many of these programmes use a specific data-file format, but several of these programmes offer the possibility to read or write data from, or to, other file formats. Many of these programmes possess user-friendly and sophisticated graphical interfaces which helps the users to easily select the type of analyses to be performed and to set up computational parameters. Currently, researchers are directing their efforts on development of newer programmes using more specialized methodologies.



References Glaubitz, J.C. (2004) convert: A user-friendly program to reformat diploid genotypic data for

commonly used population genetic software packages. Molecular Ecology Notes, 4: 309-310. Liu, J. (2003) PowerMarker: New Genetic Data Analysis Software, Version 3.0. Free program

distributed by author over Internet. Kumar, S., J. Dudley, M. Nei and K. Tamura (2008) MEGA: A biologist-centric software for

evolutionary analysis of DNA and protein sequences. Briefings in Bioinformatics, 9: 299-306. Miller, M.P. (1997) Tools for population genetic analysis (TFPGA) 1.3:AWindows program for the

analysis of allozyme and molecular population genetic data. Distributed by the author. Mohammadi, S.A. and B. M. Prasanna (2003) Analysis of Genetic Diversity in Crop Plants- Salient

Statistical Tools and Considerations. Crop Science, 43:1235–1248. Nei, M. and R.K. Chesser (1983) Estimation of fixation indices and gene diversities. Annals of

Human Genetics, 47:253–259. Nei, M. and W. Li (1979) Mathematical model for studying genetic variation in terms of restriction

endonucleases. Proceedings of National Academy of Sciences (USA), 76:5269–5273. Nei, M., and R.K. Chesser (1983) Estimation of fixation indices and gene diversities. Annals of

Human Genetics, 47:253–259. Peakall, R. and P. E. Smouse (2006) GENALEX 6: genetic analysis in Excel. Population genetic

software for teaching and research. Molecular Ecology Notes, 6: 288-295. Pritchard, J.K., M. Stephens, and P. Donnelly (2000) Inference of population structure using

multilocus genotype data. Genetics, 155:945–959. Raymond, M., and F. Rousset (1995) GENEPOP (version 1.2): Population genetics software for exact

tests and ecumenicism. Journal of Heredity, 86:248–249. Schneider, S., D. Roessli and L. Excoffier (2000) ARLEQUIN, version 2.00-software for population

genetics data analysis. Genetics and Biometry Laboratory, University of Geneva, Switzerland.

Swofford, D.L. (2002) PAUP*: Phylogenetic Analysis Using Parsimony (*and Other Methods), Version 4. Sinauer Associates, Sunderland, MA.

Weir, B.S. and C.C. Cockerham (1984) Estimating F-statistics for the analysis of population

structure. Evolution, 38:1358–1370. Wright, S. (1951) The genetical structure of populations. Annals of Eugenics, 15: 323-354. Yeh, F.C. and T.J.B. Boyle (1997) Population genetic analysis of codominant and dominant markers

and quantitative traits. Belgian Journal of Botany, 129:157.



RAPD and ISSR Analysis Ritto Paul, Sayuj K.P and K. Nirmal Babu


Principle Many different methods and technologies are available for the isolation of genomic DNA. In general, all methods involve disruption and lysis of the starting material followed by the removal of proteins and other contaminants and finally recovery of the DNA. Removal of proteins is typically achieved by digestion with proteinase K, followed by salting-out, organic extraction, or binding of the DNA to a solid-phase support (either anion-exchange or silica technology). DNA is usually recovered by precipitation using ethanol or isopropanol. The choice of a method depends on many factors: the required quantity and molecular weight of the DNA, the purity required for downstream applications, and the time and expense. Several of the most commonly used methods are detailed below, although many different methods and variations on these methods exist. However, they usually lack standardization and therefore yields and quality are not always reproducible. Reproducibility is also affected when the method is used by different researchers, or with different sample types. The separation of DNA from cellular components can be divided into four stages: 1. Disruption 2. Lysis 3. Removal of proteins and contaminants 4. Recovery of DNA Standardized Protocol for DNA isolation for Spices.

Lyophilize 200-300 mg of fresh leaf material. Grind 20 mg of lyophilized leaf material to a fine powder using quartz sand using pestle and

mortar. Transfer the powdered material to 700 µl of pre-warmed Extraction buffer and 700 µl of 2X

CTAB buffer and incubate for 60 min at 60˚ C with occasional stirring. Extract with equal volume of Phenol: Chloroform: Isoamyl alcohol (25:24:1). Centrifuge at 10,000 rpm for 15 min at room temperature (20˚ C). Separate the aqueous phase and transfer to a fresh tube. Add 2 µl 0f RNase A (10 mg/ml) to final concentration of 50 mg/ml and incubate for 30 min

at 37˚ C. Extract with an equal volume of chloroform: isoamyl alcohol (24:1) at 10,000 rpm for 10

min. To the aqueous phase add 0.6 volumes of ice-cold isopropanol and incubate at -20˚C for 30-

60 min. Centrifuge at 10,000 rpm for 10 min at 4˚ C. Wash the DNA pellet obtained with 70%

ethanol and 10 mM ammonium acetate. Dry the DNA pellet and dissolve in 100 ml of water or low concentration TE buffer.

Quantification of DNA i. Agarose gel electrophoresis Attach tape to the ends of the gel tray. Position the well-forming comb and ensure that the gel

tray is horizontal. Prepare 0.8% Agarose gel by adding 0.8 gm agarose in 100 ml of 1x TAE and gently boil the

solution in microwave oven with occasional mixing until all agarose particles are completely dissolved. Allow it to cool to 60C and add 0.1g/ml to 0.5g/ml ethidium bromide. Pour agarose onto the gel tray and allow the gel to set.



Remove the comb and tape. Place the gel into the electrophoresis tank and pour 1x TAE until the gel is fully immersed.

Load the DNA sample wit 6 x loading dye in to the wells. In one well load a standard marker. Carry out the electrophoresis at 5-6 V/cm gel until the dye is 4-5 cm from the wells. Visualize the DNA bands on a UV transilluminator or in Gel Documentation System. ii. DNA quantification by UV spectroscopy Take 5l of the DNA samples in a quartz cuvette. Make up the volume to 1 ml with distilled

water. Measure absorbance of the solution at wavelengths 260 and 280 nm. Calculate the ratio A280/A260. A good DNA preparation exhibits this ratio < 0.55 O.D units. Calculate DNA concentration using the relationships for soluble standard DNA, 1 O.D at 260 nm

=50g/ml. This estimate is influenced by the contaminating substances like RNA and very low molecular weight DNA in the solution.

Randomly Amplified polymorphic DNA (RAPD) analysis Randomly amplified polymorphic DNA’s (RAPD’s) are well suited to high through put system, required for plant genetic analysis because of its simplicity, speed, low cost requirement of smaller quantities of genomic DNA and relative abundance of the marker in the genome. This is a PCR based technique in which single PCR primer of ten nucleotides in length will find homologous sequences in the genome, by chance and will amplify several regions of the genome, if the primer is annealed within the reasonable distance that can be amplified by Taq DNA polymerase and also in correct orientation. RAPD’s are dominant marker, which cannot differentiate the homozygotes from the heterozygotes. The primer used in the RAPD reaction possesses the base sequences, which is arbitrarily defined. In this marker system the investigator have no idea to which, if any gene or repeated sequence in the plant genome, the primer may have homology. Any band after the RAPD reaction resolved in an ethidium bromide stained agarose gel or silver stained polyacrylamide gel can be used as the raw data for comparison of plant genome. Inter Simple Sequence Repeat (ISSR) analysis The Inter-Simple Sequence Repeat marker (ISSR, anchored microsatellite) use simple sequence repeats anchored at the 5' or 3' end by a short arbitrary sequence as PCR primers (Zietkiewicz et al, 1994). This generates multilocus markers. It is a simple and quick method that combines most of the advantages of microsatellites (SSRs) and amplified fragment length polymorphism (AFLP) to the universality of random amplified polymorphic DNA (RAPD). ISSR markers are highly polymorphic and are useful in studies on genetic diversity, phylogeny, gene tagging, genome mapping and evolutionary biology. ISSRs are ideal markers for genetic mapping and population studies due to their abundance and the high degree of polymorphism between individuals with a population of closely related genotypes. Optimization of reaction conditions should precede the actual RAPD and ISSR analysis to get repeatable results. Following optimizations are essential:

Template DNA concentration. Taq DNA polymerase concentration. Mg 2+ ion concentration. Primer concentration. Primer annealing temperature.

Labo

Mate polymand 1initialdenatuat 72° TAE b Data coeffiSystemdendr

Refer Rohlf

Samb

Zietki

Natio

ratory Manu

Primers su

rial and reagAmplificat

merase buffer U Taq DNAl step of 94°uration, 45 s ° C for elonga

Amplificatbuffer (pH 8.

Amplwere analy

icients for bim program rograms can b

rences

f, F.J. (1999)2.02i. Exet

brook, J., FritsI. 2ndeditio

iewicz, E., Rrepeats (S176–83.

Figure showing

onal training o

ual

uitable for det

gents: tion was perf, 50 ng of tot

A Polymerase.° C for 5 mat (37°C for Ration. A 10 mtion products0) stained witlified productsed based onary data viaPackage for

be constructed

). NTSYS-pcter Software, sch, E.F. and

on. Cold SprinRafalski, A. aSR)-anchored

g the ISSR profili

on “Allele Mi

tection of poly

formed in a total cellular D. PCR amplif

mins, followedRAPD analys

mins step at 72s were separath Ethidium Bts were scoreon the Jaccaa SIMQUALr PC (NTSYd based on the

c Numerical Setauket, Ne

d Maniatis, T.ng Harbor Laband Labuda. d polymerase

ing of Black pepp

ining” 12th - 2

ymorphic loci

otal volume oDNA, 150µM fication were d by 35 cycsis and 50° C 2° C is prograated by electrBromide as deed as presentard’s Sorens of the Num

YS-pc ver. 2e analysis of t

Taxonamy aewyork. . (1989). Moleboratory PresD. (1994). G

e chain react

pper

25th Sept, 201

i in the taxa t

of 25 ml incldNTP mix, performed in

cles, each onfor ISSR Ana

ammed as a fintrophoresis onescribed by St (1) or absensen-Dice and

merical taxono2.021i Packathe data.

and Multivari

lecular Cloninss. Genome fingtion amplific

11, IISR, Cali

to be analysed

luding 2.5µl o1.5 mM MgCn a thermocy

ne including alysis) for annnal extensionn 1.5% agaro

Sambrook et ant (0) to formd Simple momy and Muage) (Rohlf,

iate Analysis

ng: A Labora

gerprinting bycation, Genom

icut

d.

of 10 X Taq Cl2, 0.4 µM pycler as follow

45s at 94° nealing and 2

n. ose gel and ial (1989). m a binary m

matching simiultivariant An

1993). UP

s System. Ve

atory Manual

y simple seqmics, Vol. 20

50

DNA primer ws: an C for

2 mins

in 1X

matrix. ilarity

nalysis GMA

ersion

l, Vol.

quence 0, pp.



Microsatellite (simple sequence Repeats) Profiling Anucyriac, Anupama K. Rittopaul, Rahul P.R


Simple sequence repeats (SSRs) also called microsatellites are stretches of DNA consisting of tandemly repeating mono, di, tri, tetra or penta nucleotide units that are arranged throughout the genomes of all prokaryotic and eukaryotic genomes analysed to date (Powell et al., 1996; Zane et al., 2001). SSR loci harbor considerable length variation and are extremely abundant. The origin of such polymorphism is appears most likely to be due to slippage events during DNA replication (Schlotterer & Tautz 1992).They are individually amplified by polymerase chain reaction from total genomic DNA, using a pair of oligonucleotide primers specific to the DNA flanking the SSR sequence and hence define the microsatellite locus. Amplification products obtained from different individuals can be resolved on gels to reveal polymorphism. The amplified products usually exhibit high levels of length polymorphisms, which result from variation between alleles in the number of tandemly repeating units of the locus (Tautz, 1989; Weber and May, 1989). Microsatellites have proven to be an extremely valuable tool for genome mapping in many organisms (Schuler et al.1996; Knapik et al. 1998), but their applications span over different areas ranging from ancient and forensic DNA studies, to population genetics and conservation/management of biological resources ( Jarne & Lagoda 1996).The advantages of microsatellites are that they are relatively abundant with uniform genome coverage, high variable codominant, robust and reproducible, easy to detection by PCR, represent sequence tagged sites and require only small amount of starting DNA. Their high information content, which is directly related to the effective number of alleles at each locus and the ease of automating the PCR assays for identifying the Simple Sequence Repeat polymorphisms make SSRs ideal genetic markers. But there is considerable difficulty in generating SSR markers compared to others as cloning and sequence information is necessary. The traditional method for isolation of SSRs involve - Creation of small insert genomic library, Screening of library for presence of microsatellites, sequencing of the positive clones, primer design and locus specific analysis and identification of polymorphisms (Rafalski et al., 1996). A further class of isolation methods is based on selective Hybridization which appears to be extremely popular for isolation of microsatellites (Zane et al 2001). The basic protocol involves restriction digestion of the DNA into small fragments, Selective hybridization using biotinylated oligonucleotides, capture the microsatellite containing regions using magnetic beads , cloning of the DNA fragments, Sequencing of positive clones and primer designing (Armour et al., 1994; Kijas et al., 1994;Glenn et al 2005). ATTTGTATTT TACAACACCT CACATGCTCA GTTATTTGGT TCATATGCAA Forward Primer GTCTCGGTTT TGGTCTCTGC TCAGAAAAAG AGAGAGAGAG AGAGAGAGAG Reverse Primer AGAGAGAGAG AGAGAGAGAA GAAATTTGCA GTTAATTGTC AAGTAGAAGT

Fig. 2. Soyabean library derived microsatelllite (AG) 20

Because of their sensitivity to minor genetic differences, PCR-based markers such as AFLPs and microsatellites are likely to remain key molecular tools for some time to come. Protocol for developing microsatellite profiles Microsatellites can be amplified with specifically designed primers, if available for crop in question, using PCR and can be resolved on either acrylamide or high quality Agarose gels both radioactive as well as non-radioactive methods can be used. A simple method using non-radioactive PCR and polyacrylamide gel electrophoresis is given below;



PCR Amplification: Select the DNA of the population that is to be studied. Prepare PCR for each of the genotypes in the following method: Per reaction x 10 10x PCR buffer (without Mgcl2): 2.5 μl 25 μl Mgcl2 (25mM) 2μl 20μl dNTPs 2.5 mM each 1μl 10μl Forward Primer (5μM ) 2.5μl 25μl Reverse Primer (5μM) 2.5μl 25μl Sterile H2O 13.4μl 134μl Taq Polymerase 0.5 Unit (5U/ μl) 0.1μl 10μl Mix thoroughly, distribute 24μl into each PCR tube and add DNA: 15-25ng, 1 μl (20ng /μl) to each of the tube. Total reaction volume 25μl Follow standarad PCR with Initial denaturation: 940C for 2 min 1 cycle Denaturation, annealing and primer extension: 940C for 30 seconds 35 cycles 50-600C for 30seconds 720C for 1 min Final Extension 720C for 5 min 1 cycle Electrophoresis Resolve the amplification product in 3% Metaphor Agarose gel in 1x TBE or using 6-8% polyacrylamide gel in 1X TBE. Use the profile for analysis. SSR Advantages:

Co-dominant (more informative when dealing with heterozygotes) Highly variable (important for species with narrow gene pools) Widely used Excellent for use in marker assisted selection, fingerprinting and marker assisted

backcrossing Neutral Polyacrylamide Gel Electrophoresis These gels are used for the separation and purification of fragments of double- stranded DNA. They will migrate through non-denaturing polyacrylamide gels at rates that are inversely proportional to the log10 of their size. The mobility is also affected by their base composition and sequence, so that duplex DNAs of exactly the same size can differ in mobility up to 10%. Monomers of acrylamide are polymerized into long chains in a reaction initiated by free radicals. In the presence of N, N’ – methylenebisacrylamide, these chains become cross – linked to form a gel. The porosity of the resulting gel is determined by the length of chains and degree of cross – linking that occurs during the polymerization reaction. Materials 1. TBE – 10X (500ml) Trizma base – 54g Boric acid - 27.5g 0.5M EDTA, pH 8.0 – 20.0ml 2. 40% Acrylamide/ bisacrylamide (29:1) solution Acrylamide – 38.62g Bisacrylamide – 1.38g Add water to obtain a final volume of 100ml;store at 4°C 3. 10% Ammonium per sulfate (APS)

Dissolve 0.1g of APS in 1ml distilled water., Store at 4°C 4. KOH/Methanol solution (10%w/v)



This solution is for cleaning the glass plates used to cast sequencing gels. It is prepared by dissolving 5g of KOH pellets in100 ml of methanol. Store the solution at room temperature in atightly capped glass bottle. 5. TEMED Electrophoresis grade TEMED available from commercial suppliers. 6. Ethidium Bromide. (10mg/ml) – 1%stock. Add 1g of ethidium bromide to 100 ml of water. Stir on a magnetic stirrer for several hours to ensure that the dye has dissolved. Wrap the container in aluminum foil or transfer the solution to a dark bottle and store at room temperature. 7. Loading Dye(6X) Sucrose (40%) or Glycerol(30%) = 4gm or 3gm Bromophenol blue (0.25%) = 0.025gm Xylene cyanol (0.025%) =0.025gm Make upto 10ml with distilled water. Methods Assembling the apparatus and preparing the Gel solution

1. If necessary, clean the glass plates and spacers with KOH/methanol. 2. Wash the glass plates and spacers in warm detergent solution and rinse them well, first in tap

water and then in deionized water. Hold the plates by the edges or wear glows, so that oils from the hand do not become deposited on the working surface of the plates. Rinse the plates with ethanol and set them aside to dry.

3. Assemble the glass plates with spacers: a, Lay the larger (or un notched) plate flat on the bench and arrange the spacers at each side

parallel to the two edges. b, Lay the inner (notched) plates in position, resting on the spacer bars. c, Clamp the plates together with binder or “bulldog” paper clips and bind the entire length of

the two sides and the bottom of the plates with gel-sealing tape to make a water tight seal 4. Taking into account the size of the glass plates and the thickness of the spacers, calculate the

volume of gel required. Prepare the gel solution with the desired polyacrylamide percentage . Add the following into a beaker to prepare 60 ml of 8% polyacrylamide gel and swirl it for mixing. 40%Acrylamide solution - 12.0 ml 10XTBE - 6.0 ml 10%APS - 300.0µl TEMED - 125.0µl Distilled water - 41.58ml

5. Expel the gel solution to the assembled plates, avoiding air bubbles and filling almost to the top.

6. Once the solution is filled up insert the comb at the top of gel without creating air bubbles. Allow 60 min for the gel to polymerize.

7. After polymerization is complete, surround the comb and the top of the gel with paper towels that have been soaked in 1 X TBE. Then seal the entire gel in Saran Wrap and store it at 4°c until needed (may be stored for 1-2 days in this state before used).

8. When ready to proceed with electrophoresis, carefully pull the comb from the polymerized gel and remove the gel sealing tape from the bottom of the gel .

9. Remove any excess polyacrylamide from around the comb and top of the glass plates with razor blade. Clean the plates with paper towels.

10. Add 1X TBE in the bottom chamber or as per the capacity of the chamber. 11. Fit the gel assembly into the apparatus and fill the upper tank with required quantity of 1X

TBE buffer. Remove any air bubble from the top of the gel.



12. Add tracking dye; 2µl of 6X dye for 10µl of PCR product and mix it well. 13. Flush the wells with IX TBE buffer. Load the samples into the wells as per the type of comb

used. Generally 1-2 µl of the sample is loaded. If the concentration of PCR product is high, smaller quantity should be loaded for better resolution of DNA fragments.

14. Each gel must be loaded with DNA size markers (50bp or 100bp as per requirement). 15. Start electrophoresis with constant voltage of 80V for 5h (Low voltage with longer duration

helps in the finer separation of closely sized markers). 16. Run the gel until the marker dyes have migrated the desired distance. Turn off the power,

disconnect the leads, and discard the electrophoresis buffer from the reservoirs. 17. Detach the glas plates. Use a spacer or plastic wedge to lift a corner of the upper glass plate.

Check the gel remains attached to the lower plate. Pull the upper plate smoothly away. Remove spacers.

18. The gel is taken out and stained in the tray containing 20µl of ethidium bromide (1.0% stock solution) in 1 litter of distilled water for 5 minutes.

19. The tray is constantly shaken in the horizontal shaker to maintain the uniformity of the solution.

20. The gel is taken out and destained in double distilled water for 20 minutes. 21. After destaining the gel is analysed using a Gel Doc imaging system .

References Armour, J. A.L., Newmann, R., Gobert, S., Jefferys, A. J., 1940. Isolation of human simple repeat

loci by hybridization selection .Human Mol.Gen.3, 599-605 Creste,S.,Tulmann,N.A.,Figueira,A., 2001 Detection of Single Sequence repeat polymorphisms in

denaturing Polyacrylamide SequencingGels by Silver Staining. Plant Molecular Biology Reporter 19,299 - 306

Glenn, T. C., Schable, N.A., 2005.Isolating microsatellite DNA loci. In: Methods in Enzymology 395, Molecular Evolution : producing the biochemical data , part b( ends Zimmer EA, Roalson EH).Academic pres, San Diego

Jarne ,P., Lagoda, P.J.L., 1996 Microsatellites, from molecules to populations and back. Trends in Ecology and Evolution, 11,424 - 429.

Jones CJ, Edwards KJ, Castaglione S, Winfield MO, Sale F, Van de Wiel C, BredemeijerG, Buiatti M, Maestri E, Malcevshi A, Marmiroli N, Aert R, Volckaert G, Rueda J, Linacero R, Vazquez A and Karp A 1997 Reproducibility testing of RAPD, AFLPand SSR markers in plants by a network of European laboratories. Mol Breed 3:381-390.

Karp, A., Seberg, O. and Buiatti, M. (1996) Molecular techniquesin the assessment of botanical diversity, Ann. Bot. 78,143–149

Kijas, J.M., Fowler, J.C., Garbett, C.A., Thomas, M.R., 1994 Enrichment of microsatellites from the citrus genome using biotinylated oligonucleotide sequences bound to streptavidin-coated magnetic particles. Biotechniques, 16, 656 - 662.

Lu, Z.X., 1998 Construction of a genetic linkage map and identification of AFLP markers for resistance to root-knot nematodes in peach rootstocks, Genome 41, 199–207

Lynch, M. and Walsh, B. 1998 Genetic Analysis of Quantitative Traits, Sinauer Patterson,A.H., Tanksley, S.D., Sorrels, M.E.,. 1991. DNA markers in plant improvement. Advances

in Agronomy. Vol. 46. Academic Press. pp 40-90. Powell W, Gordon CM and Provan J. 1996. Polymorphism revelaed by simple sequence repeats.

Elsevier Publishers 1 (7) : 215. Powell, W., 1996 The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for

germplasm analysis, Mol. Breed. 2,225–238. Rafalski, J.A.,1996. Generating and using DNA markers implants, In, Analysis of Non mammelian

Genomes – A Practical Guide (Birren E and Lai E eds.) Academic Press.



Rosendahl, S. and Taylor, J.W. (1997) Development of multiplegenetic markers for studies of genetic variation in arbuscular mycorrhizal fungi using AFLP, Mol. Ecol. 6, 821–829

Sambrook,J and Russel,D.W .2001. Molecular Cloning: A Laboratory Manual, third ed. CSH Laboratory Press, ColdSpring Harbor, New York.

Semblat, J.P., 1998 High-resolution DNA fingerprinting of parthenogenetic root-knot nematodes using AFLP analysis, Mol. Ecol. 7, 119–125

Schlotterer C, Tautz D 1992 Slippage synthesis of simple sequence DNA. Nucleic Acids Research, 20, 211 - 215.

Swapna ,M.,Sivaraju,K.,Sharma,R,K.,Singh,N.K.,Mohapatra,T.,2010. Single-Strand conformational Polymorphism of EST- SSRs:A potential Tool for Diversity Analysis and varietal Identification in Sugarcane

Tautz,D., 1989 Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Res 17(16): 6463-6471.

Vos P, Hogers R, Bleeker M, Reijans M, Van der Lee T, Hornes M, Frijters A, Pot J, Peleman J, Kuiper M and Zabeau M 1995 AFLP: a new technique for DNA fingerprinting.Nucleic Acids Res 23: 4407-4414.

Labo

BackRalstois the plant long pplant plantsanalywhichdetermamonThougacrossagreemrevealdevisegeogrrespecIndon

Natio

ratory Manu

kground onia solanacecausative agpathogens owpersistence inspecies, inclu

s, shrubs, andsed by severah is based omination (Hayg the global cgh popular, ths the geograpment with eal the “actual ed Phylotypinraphical origictively, wher

nesia, Japan an

onal training o

ual

Multi

earum Yabuuent of bacteriwing to its agn soil & wateuding many ed trees (Wickal phenotypic on substrate yward 1964, collection of Rhese techniquphical locationch other. Perhdiversity” ex

ng which clasn of the straireas phylotypnd Australia.

on “Allele Mi

ilocus Sequ

uchi (Smith) pial wilt of croggressivenesser associated eeconomically ker et al, 200and genotyputilization a

BuddenhagenRalstonia sola

ues are not enons. Besides, thaps these an

xist in populassifies Ralstonins: phylotyppe III memb

ining” 12th - 2

uence TypA. Kuma

IARI, New D

previously knop plants that s, broad host environmentsimportant cro

07). The geneic. The phenoability of thn 1962). Fiveanacearum (Tough for decithese two indnomalies promation of Ralstonia solanaceae I and II arebers are Afri

25th Sept, 201

ping of bacar Delhi

nown as Pseuis regarded arange & wid

s. The pathogops includingetic diversityotypic assay ihe bacteriume biovars and Table 1 & 2). iphering the p

dependent systmpted the resonia solanac

arum in to foue composed oican, and ph

11, IISR, Cali

cteria

udomonas soas one of the ide geographicgen is known g vegetables, y of Ralstoniaincludes biov

m, and host as many race

population biotems of classearchers to d

cearum. Feganur phylotypesof Asian andhylotype IV

icut

lanacearum important bac

cal distributioto infect ovespices, herbaa solanacear

var characterizrange based

es have been

ology of the ssification are devise finer ton and Prior (s which reflecd American st

isolates are

56

Smith cterial

on and er 450 aceous rum is zation

d race found

strains not in

ools to 2005)

cts the trains,

from



Molecular tools for genetic diversity analysis: Many techniques based on the electrophoretic mobility of the genomic fragments are in use for the analysis of population structure of R. solanacearum isolates worldwide. The genotypic tool based on electrophoretic patter comparison of PCR/restriction digestion generated fragments (to name few, ISSR, RAPD, Rep-PCR) among the strains is the most popular choice in the late 1990’s. These techniques which exploits, the random amplified fragments are turned out to be NonPortable Tools due to their inherent non-reproducible nature. Sequence based discrimination of strains such as Multilocus sequence typing (MLST) and Comparative Genome Hybridization (CGH) which uncovers allelic variants in conserved housekeeping and virulence genes is portable across the laboratories. Sequence data can be compared readily between laboratories, such that a typing method based on the sequences of gene fragments from a number of different housekeeping loci. Multilocus sequence typing approach uses sequences of internal gene fragments and assigns different allele numbers to the sequence at each locus, so it will provide unique allelic profile for each isolate called Sequence Types (STs). Based on this approach Castillo and Greenberg (2007) had analyzed the evolutionary forces operating on R. solanacearum populations using Multilocus Sequence Typing (MLST) including five housekeeping and three virulence-related genes. R. solanacearum to be a diverse pathogen, showing high levels of nucleotide polymorphism and a number of unique alleles in the Chromosome and in the Megaplasmid. So far about 27 to 33 STs were identified for the eight genes by MLST based analysis. Methodology Isolation of the R. solanacearum isolates Bacterial wilt affected plant samples were collected from field and processed for isolation of bacterium. The thoroughly washed stem cutting of wilted plants were allowed to ooze in a clean glass of water for few minutes and were plated on to CPG agar amended with 2, 3, 5 triphenyl tetrazolium chloride and incubated at 28oC for two to three days. The typical colonies of R. solanacearum as indicated by their fluidal appearance with spiral pink centre were purified by repeated streaking on fresh plates. Preparation of bacterial cells for DNA isolation A single colony of R. solanacearum was inoculated in a broth and incubated for about 24-36 h for isolation of total genomic DNA. Isolation of genomic DNA from R. solanacearum DNA isolation 1. Density of the bacterial suspension is adjusted to OD1.0 @ 600nm 2. Spin down at 14000 rpm at room temperature for 2 min. 3. The supernatant is discarded and pellet is washed three times with sterile distilled water. 4. To the pellet 550µl of TE buffer+lysozyme is added, mixed well and incubated for 30 min at 37C. 5. After incubation 76µl of 10% SDS+Proteinase K is added. 6. The contents are mixed by flipping the tube and incubated for 15 min at 65C. 7. After incubation 100µl of 5M NaCl is added and mixed the contents by flipping the tube. 8. Then 80µl of CTAB/NaCl is added, mixed and incubated for 10 min at 65C. 9. After incubation 660µl of Chloroform+isoamyl alcohol is added. 10. The contents are mixed by flipping the tube about 30sec. 11. Then centrifuge for 5 min at 14000 rpm at room temperature. 12. After centrifugation the aqueous fraction is carefully transferred to a new 1.5ml tube without touching the white middle layer (interface). This step is repeated twice. 13. Equal volume of isopropanol is added and inverted to mix. 14. Then centrifuge for 15 min at 14000 rpm at room temperature. 15. The supernatant is gently drained and mixed with 0.5ml of 70% ice cold ethanol. 16. Centrifuge for 15min at 14000rpm at room temperature.



17. After this the supernatant is carefully removed and evaporated the remaining ethanol in the laminar flow for about one hour. 18. 25µl of 10:1 TE is added to each tube to dissolve the DNA and the tubes are kept at 4oC for overnight. 19. The DNA from the two tubes is pooled in one tube, so the total is 50µl and added RNase to remove the contaminating RNA at a concentration of200µg/ml 20. The tubes are incubated for 30min at 30C. Then stored the DNA at -20oC. Quality analysis and quantitation of genomic DNA 1. 5µl of stock DNA is diluted 10 times by adding 45µl of MQ water. 2. The quantity of DNA is measured using a Biophotometer 3. Quality assessed by gel electrophoresis 4. DNA concentration is adjusted to 200ng per ul of water 5. Proceed with PCR amplification of genes Multilocus Sequence Typing Various steps involved in the sequence typing are given in the fig 1. Briefly the selected genes are amplified, purified and sequenced. The sequence reads are assembled and compared with the database for assigning the alleles. The combination of the allele numbers is unique for each strain of the bacterium in question. The allele numbers are further compared among the strains in order to decipher the strain migration in the field of molecular epidemiology. Choice of loci: For the diversity analysis five housekeeping genes, which resides in the chromosome (ppsA, phosphoenol pyruvate synthase; gyrB, DNA gyrase, subunit B; adk, adenylate kinase; gdhA, glutamate dehydrogenase oxidoreductase; and gapA, glyceraldehyde 3-phosphate dehydrogenase oxidoreductase) and three plasmid borne virulence related genes (hrpB, regulatory transcription regulator; fliC, encoding flagellin protein; and egl, endoglucanase precursor) are considered. The details of the genes, its protein and the conserved length are furnished in the Table 3.

Fig. 1. MLST workflow



PCR Amplification: For PCR amplification, the reaction mixture (50µl) contained 50-100ng of template genomic DNA, 1× PCR buffer, MgCl2 3mM, DMSO 6%, each dNTPs 50µM, 10pmol of each primer(Table 1), and 1 U of Taq DNA polymerase DNA was amplified using an initial denaturation at 96ºC for9 min, followed by 35 cycles of 95ºC for 30s, appropriate annealing for 1 min and extension 72ºC for 2 min. Reactions were completed with a final extension step of 10 min at 72ºC. All PCR products were electrophoresed through a 1.0 % agarose gel and visualized with UV light after ethidium bromide staining. Elution, Purification and Sequencing: The amplicon was eluted and purified using Gel Elution kit according to the instructions given. The eluted product was sequenced in both directions and the sequences were assembled using DNA baser software. Sequencing is carried out on each DNA strand with BigDye Terminator Ready Reaction Mix under the following conditions, an initial denaturation at 96ºC for 9 min, followed by 35 cycles of 95ºC for 30s, appropriate annealing for 1 min and extension 72ºC for 2 min. Reactions were completed with a final extension step of 10 min at 72ºC. Unincorporated dye terminators were removed by precipitation with 95% alcohol. Sequence analysis: Sequences are carefully analysed and sequence type assigned for each of the strain by comparing the data sets with www.pamdb.org. The strain relation with the existing collection of strain can be determined by eBurst programme ( http://eburst.mlst.net). Handling sequence data: The sequencing machines would give us the chromatogram indicating the quality of the sequence reads (Fig 2). The sequence reads are carefully observed for any errors in the base using any one of the chromatogram viewers (eg. DNA baser, BioEdit, Chromos etc). Thus obtained sequence is called as raw sequence (Fig.3). For each gene, two such sequences are obtained which are known as forward sequence and reverse sequence respectively. The forward and reverse

Labo

sequeDNA seque >A01CTGGACAAAGCTAGCTCACGGGCAACCG >A01GCAGGAAGCCATAGTTTCCAGTTGTTGCFig. 3seque>FliCGGCCGCAGGACCAGCCTGCCGTTGCGAGFig. 4 The aconse19 of >CaRGCCGGCTGAAGG

Natio

ratory Manu

ences are assebaser). The

ences (Contigs

_CaRS_MepGGCCAGGTACGGCGGTTGGCAACGTGTTCGACGGACGTGAACGAGCGTGACCTGAC1_CaRS_MeGGGCTGCGGGTCGACATATTGGAATGGCGTTGAGGTTGGTGGCGCATACAGGTACG3. Fasta fileencing mach

C-CaRs-Mep CTTCAGGGGCGCTGGTCGTGGTCACGTCGAACCAGCTGTTGGGATTCCAGTCGGCCG4. Assemble

assembled seqensus sequenc

Ralstonia solRs-Mep (318)GACTCGTAGTGGAATCGAATACCA

onal training o

ual

embled usingassemble seqs) are used to

pFLIC_FLICTTGAAACAATCTGTCGGCGGCTAACAA

GGCTCGGTACCACGGTCTGACCAGCGCCTCCCTGA

pFLIC_FLICGGTCGCGTTATGTTGACGAGGTCGTCGGGTTTCGAT

CTGGTCGGACGTTGCAGGAGTTCGCA

format of fhine (393)-Contig

GAGGTCAGGTCACGCTCGACGTCCGTGCAGCTTGTTGGTATTCCCAGCCAGT

GTTTGCAGGed sequence

quences are coce where the alanacearum i)

ACCTGGGCCCCAACAACGAACAGCTGG

on “Allele Mi

g any one of tquences are c determine th

CF_copy.ab1ACCTGCAACAGCCGACAGAACATCTGGCTTCGACACCAACGGCTGCCAA

AAGGCCGCCCR_copy.abTGGCAGCGGTTGGTGAGAAGCCACTGTTCTTGTGCTGCCGACGGTTGTTTTACCGTTGGCforward and

gs GTCGGTATGTGCCGGTCGGCTGCGTTTGCCGTTGT

CTTGTCCAGTTGGCGCATGTACGAGTT for an allel

ompared withallelic differens furnished be

CAGGTTGAAGGCGGTCTGCAACGGC

ining” 12th - 2

the programmalled Contigs

he allelic varia

1- Forward SACGTATGCGCCAGACCAACGAAACCAAACGACCTT

GTCAACATGACGCGACCGCCA 1- Reverse S

GCTGGTCACCCGTGGTCCGAGCCGT

TTAGCCGTTCAGACCGCTCAACCTGGCGTT d reverse se

CGATCGCGCAGCGTGCTCTGGCCATAGTTGGC

GGTTGGTCTTACGTTGCTCGCAC CGle, fliC

h the databasences can be reelow for illus

AAACAACCGTCGGCAG

CTAACAAG

25th Sept, 201

mes that are as (large contiations (Fig. 4

Sequence GCCAACTGGACCTGGACACGCCAACCCAATATG

GTCGACCTTGCAGCCCA

Sequence CGCTCGTGCCACGTCCGTTCGAACAGTGCCAGCTGCCGTTGTTGGCCCAGGT

equence read

GGCCTGGGCCCGAAGGTCATATTGGAA

GTTGGTTTTGGTCGGCT

CAGGTTGTTGTTGGC

e (www.pamdesolved. The stration (Fig.5

CTGCAACGGCCGACCA

GAACATCGA

11, IISR, Cali

available in piguous sequen).

GCTGTGGACAAGGAATACTACAACGGGCCAGAATCGGCACG

AGGCCGCGA

CCGGTCAGTGGCTGCG

GCTTGTTGCGTTGGTATT

GGATTCCACTACGAGTCG

ds obtained

CTGCGGTCCGACATGT

AGGTCGTCGTCGATGTTCTGCCGACA

TTTCAACCT

db.org) for deconsensus se

5).

GTATGCGCCAGACCAACCAAACCAAC

icut

public domainnces). Such a

AATCCA ACCAAC

GGCAACA ACGCAGC GCTGACC ATCGAT

GCGTGCC GTTCTGG CCGTTGT TCCTTG CAGCCA GGCCGT

d from

CGCGTTG TTGACGTTGGAAGCCAC

CTTGTTAGCAGACCGCCGTGGCCCAG

termination oequence of all

CAACTG CTGGAC

CGCCAAC

60

n (eg. a long

GGTCCGCCGTGTTGTA

of lele



TACAACGGCAACAAGCTGTTCGACGGCTCGGTGGCTTCGACGACCTTCCAATATG GCCAGAACGCAGCCACGGACGTGACCACGGTCACCAACGTCAACATGTCGACCT TCGGCACGCTGACCGGCACGAGCGTGACCAGCGCTGCCAACGCGACC Fig.5. Allele 19 of gene fliC belong to Ralstonia solanacearum infecting Zingiberaceae members The string of allele numbers (integers) for the housekeeping and virulence genes obtained for a strain is called as sequence type which is specific for a strain of bacterium. For example, the allele numbers obtained for a cardamom strain of Ralstonia solanacearum is ppsA-10, fliC19, hrpB-27, gdhA- 24, adk-1, gyrB-26, egl-25. The combination of integers (10, 19, 27, 24, 1, 26, and 25) serves the input data for establishing the strain relationship by eBurst programme which is based on eBurst algorithm, a dedicated programme for analysis of microbial MLST data. Phylogenetic analysis using MLST data The allelic sequences, thus, obtained from the strains are pooled to construct concatenated sequences which serve input data for establishing phylogeny. The concatenated sequence is nothing but the string of all the loci are assembled in an order (ppsA + fliC + hrpB + gdhA + adk + gyrB + egl ) to get large sequence length. An example of concatenated sequence constructed for a strain of Ralstonia solanacearum obtained from cardamom is furnished below (Table 3, Fig.6). This large sequence length is used in the phylogenetic analysis of bacterium in question. >R_solanacearum__CaRs-Mep_ (911) [ppsA + fliC + hrpB + gdhA + adk + gyrB + egl] GACGAAGACGTGGTCGAGCTGGCCAAGTACGCCGTCATCATCGAGAAGCACTAC GGTCGCCCGATGGACATCGAGTGGGGTAAGGACGGCAAGGACGGCAAGATCTAC ATCCTGCAGGCCCGCCCCGAGACGGTGAAGAGCCAGTCGGTCGGCAAGGTCGAG CAGCGCTTCCGCCTGAAGGGCTCGGCGCCGGTGCTGACCACCGGCCGCGCGATCG GCCAGAAGATCGGTACGGGCCCCGTGCGCGTGATCAACGATCCGGCCGAAATGG AGCGCGTGCAGCCGGGCGACGTGCTGGTCGCCGACATGACCGACCCGAACTGGG AGCCGGTGATGAAGCGCGCCTCGGCCATCGTCACCAACCGTGGCGGCCGCACCT GTCACGCCGCCATCATCGCGCGTGAGCTGGGCGTGCCGGCCGTGGTCGGCTGCGG CGACGCCACCGACCTGCTGAAGGACGGCACGCTGGTCACCGTGTCCTGCGCCGA GGGCGACGAAGGCAAGATCTACGACGGCCTGCTCGAGACGGAAATCACCGAAGTGCGCCGCGGCGAGATGCCGCCGATCGACGTCAAGATCATGATGAACGTCGGCAA CCCGCAGCTGGCCTTCGAGTTCGCGCAGATCCCGAACGGCGGCGTGGGCCTGGCC CGCCTCGAGTTCATCATCAACAACAACATCGGCGTCCACCCGAAGGCGATCCTCG ACTACCCGCAAGCCGACTCGTACCTGGGCCAGGTTGAAAACAACCTGCAACGTAT GCGCCAACTGGCTGTGGAATCCAACAACGGCGGTCTGTCGGCAGCCGACCAGAC CAACCTGGACAAGGAATACCAACAGCTGGCAACGGCTAACAAGAACATCGAAAC CAACGCCAACTACAACGGCAACAAGCTGTTCGACGGCTCGGTGGCTTCGACGAC CTTCCAATATGGCCAGAACGCAGCCACGGACGTGACCACGGTCACCAACGTCAA CATGTCGACCTTCGGCACGCTGACCGGCACGAGCGTGACCAGCGCTGCCAACGC GACCGTGCTGGCGATGGCCGATGCCTCGCTGCTGCTCGAGTGCGATGAAGAAGC GGAAGAAGGCTTCCGCCTGGCGCAGCGCCTGATCCGCCATTCGGATGACCAGCTG CGCGTGGTGTCGTGCCGCAATACCGGCTGGCAGGCACTGCTGCGCGATCGCTACG CCGCGGCGGCGAGCTGCTTCTCGCGCATGGCCGAAGACGATGGCGCGACCTGGA CCCAGCAGGTCGAGGGCCTGATCGGCCTGGCGCTGGTGCATCACCAGCTCGGCCA GCAGGATGCCTCCGACGACGCGCTGCGGGCGGCGCGCGAGGCCGCAGACGGCCG CAGCGATCGCGGCTGGCTGGCCACCATCGATCTGATCATCTACGAATTCGCCGTG CAGGCCGGCATCCGCTGCTCCAACCGCCTGCTCGAGCATGCGTTCTGGCAATCGG CCGAAATGGGCGCGACCCTGCTGGCCAACCACGGCGGCCGCAACGGTTGGACGC



CGACCGTATCGCAGGGCGTACCGATGCCGGCGCTGATCCAGCGCCGCGCCGAAT ACCTCAGCCTGCTGCGCCGCATGGCCGACGGGGACCGCGCGGCAATCGACCCGC TGATGGCGACCCTCAACCACTCGCGCAAGCTCGGCAGCCGCCTGCTGATGCAGAC CAAGGTGGAAGTCGTGCTGGCCGCGCTGAGCGGCGAGCAGTACGACGTCGCCGG CCGCGTCTTCGACCAGATCTGCAACCGCGAGACCACCTACCGCGCGCGCCGCTGG AATTTCGACTTCCTCTACTGCCGCGCCAAGATGGCCGCCCAGCGCGGCGACTCGG TCAAGAACGCGGCCGTCAACGTGCCGTACGGCGGCGCCAAGGGCGGCGTCCGCG TCGATCCGCGCAAGCTGTCGTCGGGCGAACTCGAGCGCCTGACCCGCCGCTACAC CAGCGAGATCGGCATCATCATCGGCCCGAACAAGGACATCCCGGCGCCGGACGT GAACACCAACGCGCAGATCATGGCGTGGATGATGGACACGTACTCCATGAACGA AGGCGCCACCGCCACCGGCGTGGTGACCGGCAAGCCGATCGCGCTGGGCGGCAG CCTGGGCCGCCGCGAGGCGACCGGCCGCGGCGTGTTCGTGGTCGGCAGCGAGGC TGCACGCAATCTGGGCATCGACGTCAAGGGTGCGCGCATCGTGGTGCAAGGCTTC GGCAACGTCGGCAGCGTGGCCGCCAAGCTGTTCCAGGATGCCGGCGCCAAGGTG ATCGCGGTGCAGGACCACAAGGGCATCGTGTTCAACGGCGCGGGCCTGGACGTC GACGCGCTGATCCAGCACGTGGACCATAACGGCAGCGTCGACGGCTTCAAGGCC GAGACCCTGTCGGCGGACGATTTCTGGGCGCTGGAATGCGAATTCCTGATCCCGG CCGCGCTCGAAGGCCAGATCACCGGCAAGAACGCGCCCCAAATCAAGGCAAAAA TTGTCGTTGAAGGTGCAAACGGCCCCACGACGCCCGAAGCGGACGACATCCTGC GCGATCGCGGCATCCTGGTCTGCCCGGACGTGATCGCCAATGCCGGCGGCGTCAC GGTGAGCTATTTCGGCATTCCGCAGATCTCCACCGGCGACATGCTGCGCGCCGCC GTCAAGGCCGGCACCCCGCTGGGCATCGAAGCCAAGAAGGTGATGGACGCCGGC GGCCTGGTGTCCGACGACATCATCATCGGCCTGGTGAAGGACCGCCTGCAGCAGT CCGACTGCAAGAACGGCTACCTGTTCGACGGCTTCCCGCGCACCATCCCCCAGGC CGAAGCCATGAAGGATGCCGGCGTGCCGATCGACTACGTGCTGGAAATCGACGT GCCGTTCGACGCCATCATCGAGCGCATGAGCGGCCGCCGCGTGCACGTGGCCTCG GGCCGGACCTATCACGTCAAGTACAACCCGCCCAAGAACGAGGGCCAGGACGAC GAAACCGGCGATCCGCTGATCCAGCGCGACGACGACAAGGAAGAAACCCCTGAC CGGCCTGCGCGCCGCGATGACGCGCGTCATCAACAAGTACATCGCCGACAACGA GATCGCCAAGAAGGCCAAGGTCGAAACCTCCGGCGACGACATGCGCGAAGGCCT GACCTGCGTGCTGTCGGTGAAGGTGCCCGAGCCCAAGTTCAGCTCGCAGACCAA GGACAAGCTCGTTTCGTCCGAAGTGCGCCTGCCGGTGGAAGAAGTCGTGGCCAA GGCGCTGACGGACTTCCTGCTGGAGACGCCCAACGACGCCAAGATCATCTGCGG CAAGATCGTTGAAGCCGCGCGTGCCCGCGAAGCCGCCCGCAAGGCCCGCGAGAT GACGCGCCGCAAGGGCGTGCTCGACGGCATGGGCCTGCCCGGCAAGCTGGCCGA CTGCCAGGAGAAAGACCCGGCACTGTCCGAACTGTTCATCGTCGAGGGTGACTCCGCAGGCGGCTCGGCCAAGCAGGGCCGCGACCGCAAGTTCCAGGCGATCCTGCCG CTCAAGGGCAAGATCCTGAACGTGGAGCGCGCGCGCTTCGACAAGATGCTCTCC AGCCAGGAAGTGCTCACGCTCATCACCGCCATGGGCACCGGCATCGGCAAGGAC GACTACAACCTCGACAAGCTGCGCTATCACCGCATCATCATCATGACCGACGCGG ACGTGGACGGCTCGCACATCCGCACGCTGCTGCTGACGTTCTTCTACCGCCAGAT GCCCGAGATCATCGAGCGCGGCCACGTGTACATCGCCCAGCCGCCGCTGTACAA GATCAAGCACGGCAAGGAAGAGCGCTACATCAAGGACGACAACGAGATGGCCG CGTACCTGATGCGCCAGGCGCTCGACACCGCCATCCTGGTGCGCGCCGACGGCAC CACCCTCAGTACGGCGGCCGCTACCGACACCACGACCCTGAAGACGGCCGCCAC CACCTCGATCTCGCCGTTGTGGCTCACCATCGCCAAGGACAGCGCGGCGTTCACG GTGAGCGGCACGCGCACGGTGCGCTATGGCGCCGGCAGCGCGTGGGTGGCGAAG AGCATGTCCGGCACAGGCCAGTGCACCGCCGCCTTCTTTGGCAAGGATCCGGCGG CCGGTGTCGCCAAGGTATGCCAGGTGGCGCAGGGCACGGGCACCCTGCTGTGGC GCGGCGTCAGCCTGGCCGGCGCCGAGTTCGGGGAGGGCAGCCTGCCGGGCACCT ACGGGAGCAACTACATCTATCCGTCCGCCGACAGCGCGACCTACTACAAGAACA



AGGGCATGAACCTCGTGCGCCTGCCGTTCCGCTGGGAGCGGCTGCAGCCCACGCT CAACCAGGCGCTCGACGCGAACGAGCTGTCGCGCCTGACCGGGTTCGTCAACGC CGTGACGGCGGCCGGCCAGACGGTGCTGCTCGATCCGCACAACTACGCGCGCTA CTACGGCAACGTGATCGGCTCGAGCGCGGTGCCCAACAGCGCGTACGCCGATTTC TGGCGGCGCGTGGCCACCCAGTTCAAGGGCAATGCCCGCGTCATCTTCGGGCTGA TGAACGAGCCCAATTCGATGCCGACCGAGCAGTGG Fig.6. Concatenated sequence obtained for a strain of Ralstonia solanacearum Selected reading Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb

Miller, and David J. Lipman (1997), "Gapped BLAST and PSIBLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.

Buddenhagen, I, L Sequeria and A Kelman. 1962. Designation of races of Pseudomonas solanacearum. Phytopathology 52:726. (Abstract)

Castillo, Jose A., Greenberg, Jean T. 2007 Evolutionary dynamics of Ralstonia solanacearum Appl. Environ. Microbiol.73: 1225-1238

Nalvo F. Almeida, Shuangchun Yan, Rongman Cai, Christopher R. Clarke, Cindy E. Morris, Norman W. Schaad, Erin L. Schuenzel, George H. Lacy, Xiaoan Sun, Jeffrey B. Jones, Jose A. Castillo, Carolee T. Bull, Scotland Leman, David S. Guttman, João C. Setubal, and Boris A. Vinatzer 2010PAMDB, A Multilocus Sequence Typing and Analysis Database and Website for Plant-Associated Microbes, Phytopathology 100:3, 208-215

Fegan M, Prior P (2005) How complex is the “Ralstonia solanacearum species complex”? In: Allen C, Prior P, Hayward AC (eds) Bacterial wilt disease and the Ralstonia solanacearum species complex. APS Press, St. Paul, pp 449–461

Feil EJ, Li BC, Aanensen DM, Hanage WP, Spratt BG. 2004 eBURST: inferring patterns of evolutionary descent among clusters of related bacterial genotypes from multilocus sequence typing data. J Bacteriol. Mar;186(5):1518-30

Hayward, AC. 1964. Characteristics of Pseudomonas solanacearum. J. App. Bacteriol. 27:265-277 Hayward AC (1991) Biology and epidemiology of bacterial wilt caused by Pseudomonas

solanacearum. Annu Rev Phytopathol 29:65–87 Kumar, A., Sarma, Y. R., and Anandaraj, M. 2004. Evaluation of genetic diversity of Ralstonia

solanacearum causing bacterial wilt of ginger using REP-PCR and PCRRFLP. Curr. Sci. 87:1555-1561.

Prior P, Fegan M (2005) Recent developments in the phylogeny and classification of Ralstonia solanacearum. Acta Hortic 695:127–136

Spratt BG, Hanage WP, Li B, Aanensen DM and Feil EJ. (2004) Displaying the relatedness among isolates of bacterial species -- the eBURST approach. FEMS Microbiol Lett. Dec 15;241(2):129-34

Wicker E, Grassart L, Coranson-Beaudu R, Mian D, Guilbaud C, Fegan M, Prior P (2007) Ralstonia solanacearum strains from Martinique (French West Indies) exhibiting a new pathogenic potential. Appl Environ Microbiol 73:6790–6801

Yabuuchi E, Kosako Y, Yano I, Hotta H, Nishiuchi Y (1995) Transfer of two Burkholderia and an Alcaligenes species to Ralstonia gen. Nov.: proposal of Ralstonia pickettii (Ralston, Palleroni and Doudoroff 1973) comb. Nov., Ralstonia solanacearum (Smith 1896) comb. Nov. and Ralstonia eutropha (Davis 1969) comb. Nov. Microbiol Immunol 39:897–904



Rolling circle amplification-RACE (RCA-RACE) K.Johnson George, and I.P. Vijesh Kumar


Isolation of full-length gene transcripts is important to determine the protein coding region and study gene structure. However, isolation of novel gene sequences is often limited to expressed sequence tags (ESTs) (i.e., short cDNA fragments that predominantly represent the 3′ end of the transcript). Rapid amplification of cDNA ends (RACE) is today by far the most popular approach for obtaining full-length cDNA when only part of the transcript’s sequence is known. Since its original description in 1988 by Frohman et al, numerous modifications and improvements of the method have been developed and consist of a collection of PCR-based cloning procedures that extend a known cDNA fragment toward the 3′ (3′ RACE) or the 5′(5′ RACE) cDNA end. The original method is based on attachment of an anchor sequence to one end of the cDNA that can be used as a primer binding template in PCR with a second gene-specific primer from the known part of the gene.

Alexios et. al. (2003) developed an improved inverse-RACE method, which uses CircLigase™ (Epicentre Biotechnologies, Madison, WI, USA) for cDNA circularization, followed by rolling circle amplification (RCA) of the circular cDNA with �29 DNA polymerase (New England Biolabs, Ipswich, MA, USA). In this way, a large amount of the PCR template is produced, allowing the simultaneous isolation of the 3′ and 5′ unknown ends of a virtually unlimited number of transcripts after a single reverse transcription reaction. Figure 1 illustrates this method, named RCA-RACE. The process takes advantage of the properties of CircLigase to circularize single-stranded cDNA molecules via an intramolecular link. This ATPdependent ligase can circularize singlestranded DNA (ssDNA) templates that have a 5′-phosphate and a 3′-hydroxyl group and are longer than 30 nucleotides. According to the manufacturer, under standard reaction conditions, the enzyme makes essentially no linear or circular concatemers, since it catalyzes only intramolecular ligations. In addition, although CircLigase is influenced by the ssDNA sequence, high concentrations of the enzyme can effectively circularize difficult templates (www.epibio.com/pdftechlit/222pl085. pdf). The circularized cDNA is then amplified in a RCA reaction using the �29 DNA polymerase and random primers. This would allow the generation of enough template for the cloning of rare transcripts, as well as high-throughput cloning of cDNA ends for large numbers of genes from scarce tissue, which cannot be effectively performed with standard RACE methodologies. Variation of the technique is the famRCA-RACE (Apostolos et al 2010) for amplification of isolating a family of homologous cDNAs (Fig.1)

FIGURE 1 The family rolling circle amplification rapid amplification of cDNA ends (famRCA-RACE) method (degenerate primers for isolation of members of a family of homologous genes present in the mRNA preparation). In step 1, messenger RNA is reverse transcribed into cDNA using an oligo(dT) primer harboring a 5’ phosphorylated adaptor (circle). After RNaseH treatment, the resulting cDNA in step 2 is circularized using CircLigase. The circular cDNA is then amplified by RCA using �29 DNA polymerase (gray oval) and random hexamer primers (small squares attached to gray ovals) to multicopy concatemers. For each transcript family of interest, an aliquot of the RCA reaction serves as a template in an inverse PCR using degenerate primers to obtain simultaneously the transcript’s 5’ and 3’ ends (step 3). Degenerate primers are designed outworking (arrows) on conserved regions (thicker regions on concatemers). An agarose gel with the range of the cloned PCR products to isolate the genes is presented in step 3.

Labo

Fig. 1

Proto

Plant lengthbe fol

12

3

4.

5

Natio

ratory Manu

1.

ocol:

Material: Piph gene viz., Wllowed.

. Extract to

. Synthesizeadaptor priAdd 0.5 mmurine leuto be incubat 70°C for

. Incubate thusing the Q

. Circularize1X reactioa total reaheating atkit(Qiagen

. Rolling CicontainingEngland Bpolymeras

onal training o

ual

per colubrinumWRKY expect

tal RNA usine firststrand cDimer [5′-GGC

mM dNTPs, 10ukemia virus (bated at 37°Cr 15min. he reaction atQIAquick® Pe half of the p

on buffer(Epicaction volumet 80°C for 1n). ircle Amplifi

g a 15-μL aliBiolabs),1X e and

on “Allele Mi

m challenge ited to be upre

ng Spectrum PDNA using 3

CCACGCGTC0 mM dithioth(MMLV) rev

C for 1 h, follo

t 37°C for 20 PCR purificatipurified cDNAcentre), 50µMe of 50μl and10 minutes.

ication (RCAquot of the cΦ29 DNA peither 10

ining” 12th - 2

inoculated wiegulated durin

PlantTotal RN3μg RNA in aCGACTAGThreitol (DTT)erse transcrip

owed by heat

min after the ion kit A (15 μl )usin

M ATP and 1 d incubate at Purify the m

A): RCA reaccircularized cpolymerase

0µM rand

25th Sept, 201

ith Phytophthng the interac

NA kit(Sigmaa reaction conTAC(T)18-3′] ), 1× first straptase. The reainactivation o

addition of 2

ng CircLigasμl 50 mM Mn60°C for 1 h

mixture usin

ctions may bcDNA, 1 mMreaction buf

dom hexam

11, IISR, Cali

ora capsici foction. The foll

a-Aldrich) ntaining 0.5 μg phosphoryla

and buffer, anaction ( total vof MMLV rev

2 U RNaseH,

e - final con.5nCl2 ( final chour. Inactivag QIAquick

be performed M dNTPs, 20ffer (NEB), mers or

icut

or isolating a lowing steps m

g oligo(dT)-ated at the 5′ end 200 U Molvolume 50 μl)verse transcri

Purify the rea

5 U/μl (Epicecon. 2.5 mM/μate the enzymPCR purific

in 50 μL vo00µg/ml BSA

10 U Φ29 1µM In

65

full may

end. loney ) is iptase

action

entre), μl) in me by cation

olume A(New

DNA nVUP



primer(5’GTACTAGTCGACGCGTGGCC-3’) both modified by the addition of two phosphothioate linkages on the 3’ end. Incubate at 30°C for 21 hour and heat inactivate the enzyme at 60°C for 10 minutes. Verify RCA products by electrophoresis.

6. Inverse-PCR: Perform the Inverse-PCR reaction using using 0.5 μL neat or serially diluted (10-2, 10-4, and 10-6) RCA reaction as template, along with the 0.4µM each of gene specific forward and Reverse primer primers [To be designed based on gene of interest ] and DyNAzyme™ II DNA polymerase (Finnzymes, Espoo, Finland). The cycling parameter of 94°C for 3 min, followed by 35 cycles of 94°C for30 s, 56°C for 45 s, 72°C for 1.5 min ( depending on the expected size of the product), and a final extension step of 72°C for 10 min are to be followed.

7. Run the PCR products in agarose gel stained with ethidium bromide. 8. Clone the large fragment obtained using TOPO- TA cloning kit (Invitrogen) 9. Screen the clones for the insert and do sequencing.

References:

Alexios N Polidoros, Konstantinos Pasentsis and Athanasios. S. Tsaftaris (2006) Rolling circle amplification-RACE: a method for simultaneous isolation of 5′ and 3′ cDNA ends from amplified cDNA templates. BioTechniques 41:35-42.

Apostolos Kalivas, Konstantinos Pasentsis, Anagnostis Argiriou, Nikos Darzentas and Athanasios S. Tsaftaris (2010) famRCA-RACE: A Rolling Circle amplification RACE for isolating a family of homologous cDNAs in one reaction and its application to obtain NAC genes transcription factors from Crocus (Crocus sativus) flower. Preparative Biochemistry and Biotechnology 40:177-187.

Frohman MA, M K Dush and G R Martin (1988). Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotideprimer. Proc. Natl. Acad. Sci. USA 85:8998-9002.



Protocols in development and analysis of mutants for functional genomics Ramesh S. Bhat

Email: [email protected] Department of Biotechnology

University of Agricultural Sciences, Dharwad – 580 005

Conventional mutagenesis Commonly used chemical mutagens are ethylmethane sulfonate, diepoxybutane, N-methyl-

N-nitrosourea and sodium azide. Irradiation mutagens include fast neutron, gamma irradiation and X-rays and accelerated ions (Bhat et al., 2007). Raising mutant populations

1. After treatment with an appropriate mutagen, M1 generation is grown. Progenies of selfed M1 plants are used to grow M2 generation.

2. M2 plants are used to prepare pooled DNA samples for reverse genetics screening, while their seeds are inventoried.

3. Forward genetics screening (phenotypic analysis) is normally performed on M3 plants. 4. For assaying quantitative traits, it is particularly important to advance the lines to M4 or

beyond because of the need to evaluate phenotypes in replicated trials. 5. For the purpose of identifying mutated genes, it is better to aim for a moderate to high

mutation density in the genome so that fewer mutants are needed to achieve genome coverage.

6. However, too high a dose presents practical problems. At high doses, lethality and sterility of M1 plants make it difficult to produce an appropriately large population in a single attempt.

7. Producing a useful mutant population therefore is often a trade-off between the need to produce high-density mutations and the practicality of keeping a vigorous population without too many deleterious effects and background mutations.

Forward genetics Phenotyping

1. Mutant populations harbor a large amount of genetic variability that can be revealed when the mutants are subjected to appropriate phenotypic screening.

2. Morphological mutants can be identified based on phenotypic categories. 3. Conditional mutants are studied with appropriate experimental conditions.

Map-based cloning DNA sequence responsible for the trait is identified by “walking down” the chromosome

using genetic markers. Availability of the genome sequence will hasten gene identification considerably. It can be used to identify any gene, given an adequate map of the region of the chromosome in which it is located. The gene is first mapped to a specific region of a given chromosome by genetic crosses. The gene is next localized on the physical map (in a library) of this region of the chromosome. Candidate genes in the segment of the chromosome identified by physical mapping are then isolated from mutant and wild type individuals and sequenced to identify mutations that would result in a loss of gene function. An example of map-based cloning is the cloning of a fertility restorer gene, Rf-1, in rice (Komori et al., 2004). Detecting genomic changes using genome-wide chips

Single-feature polymorphisms (SFP) are detected using oligonucleotide (oligo) chips containing 24-mer oligos representing genes to detect deletions (Borevitz et al., 2003; Chang et al., 2003; Wang et al., 2004). Genes/probes that generate hybridization signals below those of the wild-type cultivar (based on significant t-test) are considered as candidate genes. Genome coverage of the oligoarray chip can be increased with newer versions of oligoarrays such as the 44K Agilent oligoarray genome chips such as the 51K Affymetric GeneChip®. Large deletions or multiple



mutations across the genome can be overcome by pooling of DNA from segregants with common phenotypes. This also masks irrelevant mutations. Differential cDNA screening

Useful for the identification of differentially expressed cDNAs. A recent resurgence in the popularity of differential screening has come about through the development of DNA microarrays (Meldrum, 2000). Alternatively, subtracted cDNA library is generated by enriching with differentially expressed clones and by removing sequences that are common in two sources.

Arbitrarily primed PCR uses pairs of short arbitrary primers to amplify pools of partial cDNA sequences. If the same primer combinations are used to amplify cDNAs from two different sources, the products can be fractionated side by side on a sequencing gel, and differences in the pattern of bands is generated, and reveal differentially expressed genes. In differential display PCR technique (Liang and Pardee, 1992), the antisense primer is an oligo-dT primer with a specific two base extension, which thus binds at the 3’ end of the mRNA. Conversely, in the arbitrarily primed PCR (Welsh et al., 1992), the antisense primer is arbitrary and can in principle anneal anywhere in the mRNA. In both these methods, an arbitrary sense primer is used, allowing the amplification of partial cDNAs from pools of several hundred mRNA molecules. Following electrophoresis, differentially expressed cDNAs can be excised from the gel and characterized further.

In PCR subtraction method (Lisitsyn and Wigler, 1993), common sequences between two sources are eliminated prior to amplification. cDNA from the two sources are prepared, digested with restriction enzyme and amplified. The amplified products from one source (tester) are then annealed to specific linkers that provide annealing sites for a unique pair of primers. These linkers are not added to the driver cDNA. A large excess of driver cDNA is then added to the tester cDNA and the populations are mixed. Driver/driver fragments posses no linkers and cannot be amplified, while driver/tester fragments possess only one primer annealing site and will only be amplified in a linear fashion. However, cDNAs that are present only in the tester will possess linkers on both strands and will be amplified exponentially, and can therefore be isolated and cloned.

Global gene expression profiling can be made with large scale sequencing of random clones from cDNA libraries. Further improvement in expression profiling has been made with serial analysis of gene expression (SAGE) (Velculescu et al., 1995) and massively parallel signature sequencing (MPSS) (Brenner et al., 2000). Reverse genetics PCR screening

Small to medium-sized deletions in genomes are detected through PCR analysis (Jansen et al., 1997). This method identifies smaller than expected amplicons due to the presence of a deletion (Li et al., 2001; Li and Zhang, 2002). Primers flanking a genomic region containing a target gene are designed in such a way that the product generated by the wild-type allele is difficult to PCR amplify because of its large size. When a deletion reduces the length of the region flanked by the primers, the fragment with such deletion can often be amplified with higher efficiency. As a result, such smaller product can be detected even if the DNA from the individual allele carrying the deletion is mixed with DNA from many wild-type individuals. TILLING

Targeting Induced Local Lesions in Genomes (TILLING) is a high-throughput reverse-genetic technique for gene identification (Bhat et al., 2007). It is employed to discover point mutations in the mutant libraries created via traditional chemical mutagenesis. TILLING approach makes use of DNA strand mismatches formed between mutant and wild-type DNA. DNA from individual M2 plants is isolated, pooled and arrayed in 96-well plates. Primers are designed to bracket a 1-kb region that most likely contains a deleterious mutation in a target gene. The primers are then used to amplify the gene of interest followed by denaturing and reannealing of DNA to allow formation of homo- and heteroduplexes in the DNA pool. Originally, denatured high-performance liquid chromatography (HPLC) was used to detect the presence of a DNA mismatch, but now it is



detected by enzymatic cleavage of PCR-amplified heteroduplexed DNA (Xin et al., 2008) and band visualization using fluorescent endlabeling and denaturing polyacrylamide gel electrophoresis. A modified procedure of TILLING, called EcoTILLING was applied to identify natural allelic variants (Comai et al., 2004). Gene tagging and trapping Most popular mutagenesis strategy in functional genomics, where a piece of known DNA (tag) is randomly inserted into the genome to have loss-of-function or gain-of-function of the tagged gene (Guiderdoni et al., 2007; Johnson et al., 2007; Zhu et al., 2007; Upadhyaya et al., 2010). These tags can be modified into traps by recombining reporters to gain additional information on the expression pattern of the gene. Insertional inactivation tagging with T-DNA

1. The construct may have gene trap feature (uni-directional or bidirectional), selection markers/reporters and plasmid rescue cassette (Guiderdoni et al., 2007; Upadhyaya et al., 2010).

2. Take up high throughput transformation, select the transgenics and confirm. 3. Check the copy number of T-DNA, select those with single copy. 4. Look for gene trap based on reporter gene expression. 5. Look for novel/mutant phenotype. 6. Isolate the flanking sequence tag using plasmid rescue or TAIL-PCR (Liu et al., 1995). 7. Identify the tagged gene. 8. Study the co-segregation between the tagged gene and mutant phenotype. 9. Validate gene function by complementation, RNAi etc.

Activation tagging with T-DNA 1. The construct shall have enhancer or strong promoter at one or both the ends of T-DNA along

with selection markers/reporters and plasmid rescue cassette (Johnson et al., 2007). 2. Take up high throughput transformation, select the transgenics and confirm. 3. Check the copy number of T-DNA, select those with single copy. 4. Look for novel/mutant phenotype. 5. Isolate the flanking sequence tag using plasmid rescue or TAIL-PCR. Identify the tagged

gene. 6. Study the co-segregation between the tagged gene and mutant phenotype. 7. Validate gene function by over-expression.

Insertional inactivation tagging with transposable element 1. The Ds construct may have gene trap feature (uni-directional or bidirectional), T-DNA

selection markers/reporters, Ds tracer, Ds excision marker, plasmid rescue cassette, T-DNA gene trap counter selector, T-DNA repeat counter selector (Upadhyaya et al., 2006; Zhu et al., 2007).

2. Ac construct can have T-DNA selection markers/reporters, transposase coding region, Ac reporter.

3. Develop independent T-DNA/Ds lines and Ac lines by high throughput transformation. Select Ds lines with single copy T-DNA/Ds and not showing T-DNA gene trap and repeats.

4. Alternatively develop double transformants by co-transformation (with Ds and Ac constructs) or super-transformation. Select lines with single copy Ds.

5. Ds tagged mutants can be developed by a. Independent Ds and Ac lines are crossed. F1s are mutagenic (contain both Ds and Ac).

Stable Ds tagged mutants are identified by screening F2s by Ds excision marker and Ds tracer. Ac reporter is used to make sure that such plants are free from Ac.

b. Double transformants (T1) are mutagenic. Mutants are identified in T2 and T3.



c. Transient expression of transposase (TET) can be taken up by co-cultivating the calli derived from plants showing single copy T-DNA/Ds with Ac construct. Mutants are identified in T1 and T2.

6. In the mutant, look for gene trap based on reporter gene expression. 7. Look for novel/mutant phenotype. 8. Isolate the flanking sequence tag using plasmid rescue or TAIL-PCR. Identify the tagged

gene. 9. Study the co-segregation between the tagged gene and mutant phenotype. 10. Validate gene function by complementation, RNAi, Ds reversion etc.

Activation tagging with transposable element 1. The Ds construct may have enhancer or strong promoter at one or both the ends of Ds, T-

DNA selection markers/reporters, Ds tracer, Ds excision marker, plasmid rescue cassette, T-DNA gene trap counter selector, T-DNA repeat counter selector (Johnson et al., 2007).

2. Ac construct can have T-DNA selection markers/reporters, transposase coding region, Ac reporter.

3. Develop independent T-DNA/Ds lines and Ac lines by high throughput transformation. Select Ds lines with single copy T-DNA/Ds and not showing T-DNA gene trap and repeats.

4. Alternatively develop double transformants by co-transformation (with Ds and Ac constructs) or super-transformation. Select lines with single copy Ds.

5. Ds tagged mutants can be developed by a. Independent Ds and Ac lines are crossed. F1s are mutagenic (contain both Ds and Ac).

Stable Ds tagged mutants are identified by screening F2s by Ds excision marker and Ds tracer. Ac reporter is used to make sure that such plants are free from Ac.

b. Double transformants (T1) are mutagenic. Mutants are identified in T2 and T3. c. Transient expression of transposase (TET) can be taken up by co-cultivating the calli

derived from plants with single copy T-DNA/Ds with Ac construct. Mutants are identified in T1 and T2.

6. In the mutant, look for gene trap based on reporter gene expression. 7. Look for novel/mutant phenotype. 8. Isolate the flanking sequence tag using plasmid rescue or TAIL-PCR. Identify the tagged

gene. 9. Study the co-segregation between the tagged gene and mutant phenotype. 10. Validate gene function by Ds reversion and over-expression etc.

Reverse genetics with tagged mutants In the reverse genetics approach, one starts with a computer predicted gene from the genome

sequence and searches for an insertion mutant in that gene. Oligonucleotide primers from the insertional element and from the gene of interest are used for PCR amplification. Appropriately pooled DNA samples are used for high throughput screening for this often rare event in such populations. Once a mutation in the gene of interest has been identified homozygotes are isolated and the phenotype confirmed. Trans-activation

Used to activate a gene in a target tissue and cell type, where it is usually active. Trans-activation system makes use of enhancer trapping (Johnson et al., 2005; Johnson et al., 2007) efficiency of yeast GAL4 transcriptional activator.

1. GAL4 construct will have a minimal promoter-driven Gal4 and a reporter gene driven by upstream activating sequence (UAS) within T-DNA containing a selection marker.

2. Driver lines expressing GAL4 are produced by high throughput transformation. Tissue and cell specific expression of GAL4 is determined by reporter gene expression.

3. Endogenous responder lines are produced by high throughput transformation using T-DNA carrying single or multiple UAS elements and along with selection markers.



4. Cell or tissue specific activation tagged mutants are generated by crossing endogenous responders with selected GAL4 enhancer traps (driver lines)

5. The effect of gene activation in a mutant is studied for assigning the gene function. RNA silencing

RNAi provides a new, reliable reverse genetic method to investigate gene function (Curtin et al., 2007). Several platforms have been developed for delivering gene silencing in plants (Watson et al., 2005; Curtin et al., 2007). Sense strand transgene expresses the same mRNA as that of the target gene produces, whereas antisense transgenes express RNA complementary to target mRNA. In amplicon transgenes, the cDNA of a virus, driven by a constitutive promoter (such as CaMV 35S), is recombined with a target gene of interest. Hairpin RNA (hpRNA) is expressed from an inverted repeat construct consisting of a promoter, a targeted sense sequence, a spacer region, a complementary targeted antisense sequence, and a transcription terminator. The use of an intron instead of a nonspecific DNA spacer has been shown to increase the silencing efficiency of these hairpins. In direct repeat induced PTGS (driPTGS), RNA encoding multiple-copy direct repeats of the target gene is expressed. Silencing efficiency of direct-repeat transgenes can be further improved by increasing the number of repeats to three or four rather. To overcome the problem of multiple cloning steps, Gateway system can be used. In another strategy called constructs with 3′ inverted repeat, a fragment of the target gene is fused at the 3΄ end with an inverted repeat arrangement of a nontarget sequence. A transgene strategy that is similar to SHUTR uses a transgene of which the 5΄ end contains both an inverted repeat and a direct repeat of the 5΄-UTR of an ethylene biosynthetic gene, followed by the coding sequence of the target gene.

Artificial miRNAs are designed to target a specific gene, or a group of related genes using naturally occurring miRNA precursor sequences as a backbone. Original miRNA sequence and its complementary strand (miRNA*) are substituted with amiRNA and amiRNA* sequences, respectively. Initial stem-loop structures of the natural miRNA precursor are well maintained, and that the composition of the amiRNA sequences closely imitate those of the natural miRNAs. Other important parameters include a preference for uridine at the 5΄ terminus and an adenine at the tenth base of the amiRNA as these nucleotides are highly conserved in natural miRNA populations as well as in highly efficient siRNAs. A mismatch corresponding to the 5΄ end of the amiRNA sequence in the amiRNA/amiRNA* molecule, is included to increase the likelihood that the amiRNA strand is preferentially incorporated into the RISC complex. To avoid the possibility of transitive RNA silencing, triggered by a perfectly matching amiRNA hybridizing to the target and acting as a primer for RDR6, one to three mismatches are incorporated into the 3΄ end of the amiRNA. Virus-Induced Gene Silencing

It is a transient PTGS of plant genes by recombinant viruses carrying a near-identical sequence (Baulcombe, 1999; Burch-Smith et al., 2004). A 300- to 800-nt exogenous sequence is inserted into a specific location within the cDNA of PVX or TRV without the loss of infectivity of the RNA transcript. Recombinant virus is allowed to infect the plant. Viral infections can be established with naked viral RNA without the presence of coat proteins. In vitro-synthesized RNA transcripts, from a plasmid containing a cDNA encoding a complete virus genome, can also initiate virus infections. Also, the viral cDNA can be cloned into the T-DNA of Agrobacterium, which is delivered to a plant by agroinfiltration and expressed by the CaMV 35S promoter to initiate infections. Microprojectile bombardment can also be used for introducing DNA, and sometimes RNA, into cells. Satellite virus-induced silencing system (SVISS) uses the vectors derived from RNA and DNA satellite viruses. The target sequence is inserted into the satellite and coinoculated with its respective helper virus, either TMV or tomato yellow leaf curl (TYLCV) geminivirus. Gene targeting

Targeted mutagenesis is a powerful revesre genetic tool for generating specific and precise DNA sequence alterations that enable a greater understanding of gene function (Iida et al., 2007). Recently, zinc finger nucleases (ZFNs), which are the chimeric proteins composed of a synthetic zinc



finger–based DNA binding domain and a DNA cleavage domain are being used to create double strand breaks at specific sites. Such cleavages are then repaired by error-prone non-homologous end joining (NHEJ). Hence this mode can be successfully used for gene targeting (Lloyd et al., 2005; Osakabe et al., 2010; Zhang et al., 2010). FOX hunting

FOX hunting system (full-length cDNA overexpressor gene hunting system) is an alternative method of producing gain-of-function mutants for the ectopic expression of plant genes (Ichikawa et al., 2006). A gene is over-expressed using DNA or cDNA of its own or from other system. Generally it is done with constitutive promoter leading to ectopic expression. The mutants developed are called gain-of-function mutants. In FOX hunting system, each cDNA from a normalized full-length cDNA is introduced into plant, and the transgenic plant is observed for mutant phenotype (Nakamura et al., 2007; Kondou et al., 2009).

References: Baulcombe, D. C., 1999, Curr. Opin. Plant Biol., 2 (2): 109-113. Bhat, R. S., et al., 2007. In: Upadhyaya N. M., ed. New York, USA. Springer Life Sciences, pp. 149-

180. Borevitz, J. O., et al., 2003, Genome Res., 13 (3): 513-523. Brenner, S., et al., 2000, Nat. Biotechnol., 18 (6): 630-634. Burch-Smith, T. M., et al., 2004, Plant J., 39 (5): 734-746. Comai, L., et al., 2004, Plant J., 37 (5): 778-786. Curtin, S. J., et al., 2007. In: Upadhyaya N. M., ed. New York. Springer Life Sciences, pp. 291-332. Guiderdoni, E., et al., 2007. In: Upadhyaya N. M., ed. New York. Springer Life Sciences, pp. 181-

222. Ichikawa, T., et al., 2006, Plant J., 48 (6): 974-985. Iida, S., et al., 2007. In: Upadhyaya N. M., ed. New York. Springer Life Sciences, pp. 273-289. Jansen, G., et al., 1997, Nat. Genet., 17 (1): 119-121. Johnson, A. A. T., et al., 2005, Plant J., 41 (5): 779-789. Johnson, A. A. T., et al., 2007. In: Upadhyaya N. M., ed. New York. Springer Life Sciences, pp. 333-

353. Komori, T., et al., 2004, Plant J., 37 (3): 315-325. Kondou, Y., et al., 2009, Plant J., 57 (5): 883-894. Li, X., et al., 2001, Plant J., 27 (3): 235-242. Li, X., et al., 2002, Funct Integr Genomics, 2 (6): 254-258. Liang, P., et al., 1992, Science, 257 (5072): 967. Lisitsyn, N., et al., 1993, Science, 259 (5097): 946. Liu, Y. G., et al., 1995, Plant J., 8 (3): 457-463. Lloyd, A., et al., 2005, Proc. Natl. Acad. Sci. U.S.A., 102 (6): 2232-2237. Meldrum, D., 2000, Genome Res., 10 (9): 1288. Nakamura, H., et al., 2007, Plant Mol. Biol., 65 (4): 357-371. Osakabe, K., et al., 2010, Proc. Natl. Acad. Sci. U.S.A., 107 (26): 12034-12039. Upadhyaya, N. M., et al., 2010. In: Pereira A., ed. New York. Springer Life Sciences, pp. 147-177. Upadhyaya, N. M., et al., 2006, Theor. Appl. Genet., 112 (7): 1326-1341. Velculescu, V. E., et al., 1995, Science, 270 (5235): 484. Wang, G. L., et al., 2004, Theor. Appl. Genet., 108 (3): 379-384. Watson, J. M., et al., 2005, FEBS Lett., 579 (26): 5982-5987. Welsh, J., et al., 1992, Nucleic Acids Res., 20 (19): 4965. Xin, Z., et al., 2008, BMC Plant Biol., 8 (1): 103. Zhang, F., et al., 2010, Proc. Natl. Acad. Sci. U.S.A., 107 (26): 12028-12033. Zhu, Q. H., et al., 2007. In: Upadhyaya N. M., ed. New York. Springer, pp. 223–271.



Quantitative RT-PCR Prasath D., Johnson K. George, Vijesh Kumar I.P.

Indian Institute of Spices Research, Calicut 673 012, Kerala

Introduction

The real-time polymerase chain reaction uses fluorescent reporter dyes to combine DNA amplification and detection steps in a single tube format. The increase in fluorescent signal recorded during the assay is proportional to the amount of DNA synthesised during each amplification cycle. Individual reactions are characterised by the cycle fraction at which fluorescence first rises above a defined background fluorescence, a parameter known as the threshold cycle (Ct) or crossing point (Cp). Consequently, the lower the Ct, the more abundant the initial target. This correlation permits accurate quantification of target molecules over a wide dynamic range, while retaining the sensitivity and specificity of conventional end-point PCR assays. The homogeneous format eliminates the need for postamplification manipulation and significantly reduces hands-on time and the risk of contamination. Real-time PCR is often abbreviated to qPCR, although that abbreviation is not universally accepted.

Real-Time chemistries allow for the detection of PCR amplification during the early phases of the reaction. Measuring the kinetics of the reaction in the early phases of PCR provides a distinct advantage over traditional PCR detection. Traditional methods use Agarose gels for detection of PCR amplification at the final phase or end-point of the PCR reaction.

There are three main chemistries in general use: Intercalating dyes, such as SYBR-Green, which fluoresce upon light excitation when bound to double stranded DNA. These are cheap, easily added to legacy assays and amplification products can be verified by the use of melt curves. They can lack specificity and fluorescence varies with amplicon length. In general, they are one Ct or so more sensitive than probe-based assays. Fluorophores attached to primers, e.g. Invitrogen's Lux or Promega's Plexor primers. These are relatively inexpensive and amplification products can be verified by melt curves. Specificity depends on the primers and specific, usually company-specific design software needs to be used for optimal performance. This is not necessarily a bad thing (indeed the Plexor software is very useful), but it is not always possible to change primer design parameters. Hybridisation-probe based methods, e.g. hydrolysis (TaqMan) or Molecular Beacons. These are the most specific, as products are only detected if the probes hybridise to the appropriate amplification products. There are many variations on this theme, with melt curve analysis possible for some chemistries. Their main disadvantages are cost, complexity and occasional fragility of probe synthesis. There are potential problems associated with the fact that probe-based assays do not report primer dimers that can interfere with the efficiency of the amplification reaction. The 5’ Nuclease Assay In the 5’ nuclease assay, an oligonucleotide called a TaqMan® Probe is added to the PCR reagent master mix. The probe is designed to anneal to a specific sequence of template between the forward and reverse primers. The probe sits in the path of the enzyme as it starts to copy DNA or cDNA. When the enzyme reaches the annealed probe the 5’ exonuclease activity of the enzyme cleaves the probe. SYBR Green Dye SYBR Green chemistry is an alternate method used to perform real-time PCR analysis. SYBR Green is a dye that binds the Minor Groove of double stranded DNA. When SYBR Green dye binds to double stranded DNA, the intensity of fluorescent emissions increases. As more double stranded amplicons are produced, SYBR Green dye signal will increase. SYBR Green dye will bind to any double stranded DNA molecule, while the 5’ Nuclease assay is specific to a pre-determined target. The increase in reporter signal is captured by the Sequence Detection instrument



and displayed by the software. The Figure below shows an increase in the reporter signal over time. The amount of reporter signal increase is proportional to the amount of product being produced for a given sample. When the fluorescent signal Reporter increases to a detectable level it can be captured and displayed as an Amplification Plot, The Amplification Plot contains valuable information for the quantitative measurement of DNA or RNA. The Threshold line is the level of detection or the point at which a reaction reaches a fluorescent intensity above background. The threshold line is set in the exponential phase of the amplification for the most accurate reading. The cycle at which the sample reaches this level is called the Cycle Threshold, Ct. These two values are very important for data analysis using the 5’ nuclease assay.

Protocol Reaction Set up 1. Gently vortex and briefly centrifuge all solutions after thawing. 2. Prepare a reaction master mix by adding the following components(except template DNA) 3. Usually the total reaction volume is 25µl, prepare reaction as follows :

Reagents Con. required volume SYBR Green Qiagen master Mix(2X)

2X 12.5µl

Foraward primer 10pM 1µl Reverse Primer 10pM 1µl Template cDNA (diluted cDNA) 5µl Nuclease free water - 9.5µl Total = 25 µl

Reaction Conditions 95°C 5 min - 1 cycle 95°C 30 sec 58°C 30 sec 35 cycles 72°C 30 sec Hold @ 4oC

Labo

ampliRNA.incubprodupyropequipDNA comppotenlow csensittwo ospecifhighesucceal., 20al., 20 Desig

FIP (the F2F3: FBIP (the B2B3: BFL (Fand FBL (B1 an

Natio

ratory Manu

L

Loop med

ification of D. LAMP is aation thereby

uct can be phosphate in ment (Notom

amplificatiolexation of m

ntial to be usecost, LAMP ctivity. In LAMor three sets fic nature of tr than PCR ssfully used f000; Mori et a010) .

gning prime

(Forward I2c region, andForward Oute(Backward 2c region, and

Backward OutForward Lo2 regions on Backward

nd B2 regions

onal training o

ual

Loop medi

Indian

diated isotheNA. It may b

a novel approy obviating tby photomesolution or w

mi et al., 2000on is possiblmanganese b

ed as a simplecould provideMP, the targetof primers anthe action of tbased ampli

for the detectal., 2001; Nag

ers

nner Primed the same seqr Primer consInner Prim

d the same seter Primer conoop): sequenthe 5' end of Loop): sequ

s on the 5' end

on “Allele Mi

iated isoth

n Institute of S

ermal amplifbe combined oach to nuclthe need for etry for turbwith addition0; Mori et al.,le using manby pyrophospe screening ae major advat sequence is nd a polymethese primersification. Hention several fugamine et al.,

er): consists quence as thesists of the F3

mer): consistsequence as thensists of the Bnces complemthe dumbbell

uences compld of the dumb

ining” 12th - 2

hermal amA.I.Bh

Spices Resear

fication (LAMwith a reverseic acid ampexpensive th

bidity causedn of SYBR g, 2001; Nagamnganese loadphate during assay in the fiantages compamplified at rase with hig

s, the amount nce, LAMP fungal, bacter

2002; Fukuta

of the F2 rege F1c region a3 region that is of the B2 ree B1c region B3 region thatmentary to thel-like structurementary to t

bbell-like struc

25th Sept, 201

mplificatiohat rch, Calicut 6

MP) is a sse transcriptioplification whhermal cyclerd by increagreen, a colomine et al., 2

ded calcein win vitro DN

field. Due to pared to PCRa constant tem

gh strand disof DNA prodcan also be

rial and viral a et al., 2003;

gion (at the 3at the 5' end.is complemenegion (at the 3at the 5' endt is complemee single strandre the single strcture

11, IISR, Cali

n (LAMP

73 012, Kera

single tube ton step to allohich uses a srs. Detectionasing quantitor change can2002). Also inwhich starts NA synthesis its simplicity

R without commperature of

splacement acduced in LAMquantitative.pathogens of; 2004; Nie, 2

' end) that is

ntary to the F33' end) that is

entary to the ded loop regi

randed loop r

icut

)

la

technique foow the detectisingle tempen of amplificty of magnen be seen wn-tube detecti

fluorescing s. LAMP hay, ruggednessmpromising of 65 °C using ctivity. Due tMP is conside LAMP has

f plants (Noto2005; Tomlin

complement

3c region complement

B3c region ion between t

region betwee

75

or the ion of rature cation esium

without ion of upon

as the s, and on the either to the erably

been omi et son et

ary to

tary to

the F1

en the



General considerations for primer design: The distance between 5' end of F2 and B2 is considered to be 120-180bp, and the distance between F2 and F3 as well as B2 and B3 is 0-20bp; The distance for loop forming regions (5' of F2 to 3' of F1, 5' of B2 to 3' of B1) is 40-60bp; About 50-60% in the case of GC rich and Normal, about 40-50% for AT rich; Primers should be designed so as not to easily form secondary structures. 3' end sequence should not be AT rich or complementary to other primers; If the restriction enzyme sites exist on the target sequence, except the primer regions, they can be used to confirm the amplified products. Performing LAMP General procedure for performing LAMP reaction includes isolation of nucleic acid, amplification and detection. In order to perform amplification, six primers (FIP, F3, BIP, B3; F- Loop and B-Loop), DNA polymerase with strand displacement activity, substrates (deoxynucleotide triphosphate), and the reaction buffer are required. The procedure simply consists of incubating the template sample and the above reagents at a constant temperature between 60-65°C for 15 minutes to 1 hour. The presence of amplified product can be detected in a short time so as to provide a simple and rapid gene amplification method. Both simple detection and real-time detection of the reaction are possible. Various detection methods include: Visual methods:

The turbidity of magnesium pyrophosphate, a by-product of the amplification reaction, is produced in proportion to the amount of amplified products. Since LAMP amplification can produce extremely large amount of amplified products, white turbidity can be visually observed. From this feature, the presence of turbidity can indicate the presence of target gene and visual detection can be achieved

If the tube containing the amplified products in the presence of fluorescent intercalating dye (ethidium bromide, etc.) is illuminated with a UV lamp, the fluorescence intensity increases. From this feature, the presence of fluorescence can indicate the presence of target gene and visual detection can be achieved.

Detection by electrophoresis

LAMP products are run on a 2% agarose gel. Electrophoresis pattern of LAMP amplified product is not a single band but a ladder pattern because LAMP method can form amplified products of various sizes consisting of alternately inverted repeats of the target sequence on the same strand.

Procedure DNA isolation Samples used: Piper yellow mottle virus infected black pepper. The procedure is as follows:

1. Grind 100 mg of leaf tissue in 500 µl extraction buffer (100mM Tris Hcl (pH8.0), 4mM EDTA,1.4 mM NaCl, 2% CTAB, 1% PVP,0.5% β-Mercaptoethanol) using chilled mortar and pestle and collect the filtrate in an Eppendorff tube.

2. Incubate in a water bath at 65oC for 30 min. 3. The homogenate is allowed to cool to room temperature and add equal volume of

Phenol:Chlorofom:Isoamylalcohol (25:24:1) and mix well. 4. Centrifuge at 2500g for 10 min at room temperature. 5. Collect the supernatant in a new tube and add 0.1 V of 10% CTAB, equal volume

Chloroform:isoamylalcohol (24:1)and mix well. 6. Centrifuge at 2500g for 10 min at room temperature.



7. Collect the supernatant in a new tube and add 0.1V of 3M sodium acetate (pH 5.2) and add equal volume of ice-cold isopropanol.

8. Mix well and incubate in ice for 30min. 9. Centrifuge the mixture at 10,000 rpm for 15 min at 4oC. 10. Discard the supernatant. Add about 500 µl of 70% ethanol to the pellet and centrifuge for 5

min at 12,000 rpm. 11. Discard the supernatant and air dry the pellet. 12. Dissolve the pellet in 100 µl of HPLC grade water and store the DNA at -20oC.

LAMP reaction mix

Thermopol buffer (10x) 2.5 µl MgSO4 (50 mM/µl) 4.0 µl dNTP mix (10 mM/µl) 3.5 µl F3 Primer (10 µM/µl) 0.5 µl B3 primer (10 µM/µl) 0.5 µl FIP Primer (100 µM/µl) 0.5 µl BIP primer (100 µM/µl) 0.5 µl F-Loop primer (100 µM/µl) 0.25 µl B-Loop primer (100 µM/µl) 0.25 µl Betaine (5M) 5.0 µl Bst Polymerase (8U/ µl) 1.0 µl Water 5.5 µl Template 1.0 µl Total 25.0 µl

Incubate the above reaction mix at 65 C for 60 min followed by 80 C for 10 min Products (10 µl) run on 1.2% agarose gel at 130 V for 45 min along with a marker. Positive reaction identified by presence of multiple bands of different sizes. Selected references Fukuta, S., Iida, T., Mizumkami, Y., Ishida, A., Ueda, J., Kanbe, M., and Ishimoto, Y. 2003.

Detection of Japanese yam mosaic virus by RT-LAMP.Arch. Virol. 148:1713-1720. Fukuta, S., Ohishi, K., Yoshida, K., Mizukami, Y., Ishida, A., and Kanbe,M. 2004. Development of

immunocapture reverse transcription loopmediated isothermal amplification for the detection of Tomato spotted wilt virus from chrysanthemum. J. Virol. Methods 121:49-55.

Mori, Y., Nagamine, K., Tomita, N., and Notomi, T. 2001. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem. Biophys. Res. Commun. 289:150-154.

Yasuyoshi Mori, Masataka Kitao, et al. 2004.Real-time turbidimetry of LAMP reaction for quantifying template DNA. Journal of Biochemical and Biophysical Methods, Vol.59 145-157.

Nagamine, K., Hase, T., and Notomi, T. 2002. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell.Probes 16:223-229.

Nie, X. 2005. Reverse transcription loop-mediated isothermal amplification of DNA for detection of Potato virus Y. Plant Dis. 89:605-610

Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., and Hase, T. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28:e63.

Tomlinson, J.A., Dickinson, M.J. and Boonham, N. 2010. Rapid detection of Phytophthora ramorum and P. kernoviae by two minute DNA extraction followed by isothermal amplification and amplicon detection by generic lateral flow device. Phytopathology, 100: 143-149.



Two Dimensional Gel Electrophoresis

R. Viswanathan, Sugarcane Breeding Institute, Coimbatore 641007

P. R. Rahul, Division of Crop Improvement, IISR, Calicut 673012

Introduction Two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) is a method of protein

separation, by which proteins in a mixture are separated according to their isoelectric point (pI) in the horizontal direction (isoelectric focusing [IEF]) and molecular weight in the vertical direction (sodium dodecyl sulfate polyacrylamide gel electrophoresis [SDS-PAGE]). 2D-PAGE is used for the isolation/separation/purification of proteins and further characterization with mass spectrometry and identification of specific proteins. The isoforms of a protein can easily be isolated with 2D-PAGE. 2.1. Sample Preparation Appropriate sample preparation is absolutely essential for excellent 2-D results. In general, it is advisable to keep sample preparation as simple as possible. A sample with low protein and high salt concentration, for example, could be diluted normally and analyzed or desalted, then concentrated by lyophilization or precipitated with TCA and ice-cold acetone, then re-solubilized with rehydration solution. The composition of sample solution is particularly critical for 2-D because solubilization treatments for the first-dimension separation must not affect the protein pI, nor leave the sample in a highly conductive solution. The protocol described herein has been used in the Plant Pathology lab, Sugarcane Breeding Institute, Coimbatore. The protocol has been standardized for use with sugarcane leaf and cane samples. Suitable methodologies may be adapted for different crops based on experimental results using different methods of protein extraction. Sample preparation includes the following steps:

1. Take one gram of fresh tissue, grind in liquid nitrogen to a fine powder. 2. Resuspend the powder in an ice-cold solution of 10% w/v trichloroacetic acid (TCA) in

acetone with 0.07% w/v Dithiotrietol (DTT) for at least 1 h at -20 °C. 3. Centrifuge it for 30 min at 12,000 rpm and discard the supernatant. 4. Rinse the pellet thrice with acetone containing 0.07% w/v DTT for 1 h at -20 °C. 5. Lyophilize the pellet for two hours to remove any traces of acetone. 6. Solubilize the resulting lyophilized powder in lysis buffer (7 mM urea, 4% CHAPS, 14 mM

DTT, and 0.2% Ampholyte) for 1 h at 37°C. 7. Centrifuge at 12,000 rpm for 15 min. 8. Collect the supernatant in a fresh tube. 9. Quantify the protein concentration using the Bradford method (Bradford, 1976).

Note:

The samples must be stored at -80° C, if stopped at any step during the sample preparation. All the reagents and buffers should be prepared with ultra pure chemicals and use ddH2O in

all the steps. DTT should be added freshly wherever applicable.

2.2. Rehydration Dissolve 100g of protein in rehydration buffer containing 8 M urea, 2% w/v CHAPS, 18 mM

DTT, 0.5% w/v IPG buffer pH 4–7 and a trace of bromophenol blue. The steps mentioned below are to be carried out. 1. Clean the Immobiline strip tray (Ettan IPGphor) and wipe out with paper towels and Kimwipes. 2. Take the strips from - 80 °C and remove the plastic cover carefully.



3. Apply the sample on the strip tray and carefully place the strip over the sample, ensuring that the entire length of the strip touches the sample.

4. Cover the strip tray with coverfluid and close the tray. 5. Leave the sample tray at room temperature for 18 h. Note : Care should be taken to wear gloves while handling the strips and ensure that the gel side of

the strip faces down. 2.3. First Dimension – Isoelectric focusing (IEF) 1. After rehydration, wet the pre-made IEF strips with HPLC-grade water. 2. Dry the strips slightly between two pieces of Whatman paper to remove water. 3. Make sure that the square end of each strip is at the cathode (Black/-) and the ‘+’pointed end at

the anode (Red/+). Also note that the anode and cathode ridges are in the correct orientation. 4. Electrophores for 24-36 hr or 45000 Vhrs, using the following sequence of settings:

Voltage Amps Wattage Time 500 V 100mA 33V 1 hr

1000 V 110mA 70V 1 hr 2950 V 140mA 32V 24 hr

5. Bromophenol blue migrates towards the anode within 1 hr from the start of the electrophoresis. Note: If by the next day the bromophenol blue has not disappeared (strip becomes colorless),

continue running until the dye disappear. 2.4. Second Dimension 2.4.1. Equilibration

Equilibrate the focused strips twice for 15 min in 20 ml equilibration solution as follows: 1. First equilibration in solution containing 6 M urea, 30% glycerol, 2% SDS, 2%

DTT, 50 mM TRIS-HCl buffer (pH 8.8). 2. Second equilibration in solution containing 2.5% iodoacetamide in place of DTT.

2.4.2. Second-Dimension SDS-PAGE: Perform second dimensional electrophoresis with 1 mm thick, 12 % SDS- polyacrylamide gel in BioRad Protean xi - vertical slab gel electrophoresis unit.

Casting of acrylamide gels (70 ml) and Reagents Preparation: Acrylamide gel % 12 % 15 % 40 % Acrylamide 21 ml 26.5 ml 1.5 M Tris HCl pH 8.8 17.5 ml 17.5 ml ddH2O 31.5 ml 26.25 ml 10% (w/v) APS* 0.35 ml 0.35ml TEMED 17.5 µl 17.5 µl

*Ammonium persulphate (APS): 0.1 g per ml of ddH2O. Prepare freshly each time. Electrophoresis buffer (25 mM Tris, 190 mM glycine and 0.1% SDS) 1% agarose in electrophoresis buffer.

After casting the gel, perform the following steps: 1. Add 1x running buffer powder and 2 liter ddH2O to the electrophoresis tank.

Allow the buffer to mix and cool at least 3 hr before running the gels. 2. Rinse top of gel with 1x electrophoresis buffer. 3. Align the acidic end of the strip with the left end of the gel and lower the strip carefully using a

pair of forcep. Make sure that the strip lies flat on the surface of the gel by gently pressing down with two rulers. Eliminate bubbles between the gel surface and the strip.

4. Overlay 1-2ml of agarose and allow it to solidify (10 min). 5. Place the 2-D gels into the electrophoresis tank by sliding gel plate sets between the rubber gaskets.

Lubricate the gasket with the running buffer prior to inserting the plates. Make sure gaskets are not folded and that they form a smooth seal along the entire length of each set of gel plates.



6. Place the lid over the gel tank, ensuring the electrodes make good connection. Plug leads into power supply.

7. Run the gel at a constant current of 8 mA for 18-20 hr. 8. Turn off the power supply and remove gels from unit 9. Gels can be stained by either coomassie brilliant blue (CBB) staining or silver staining methods. Note: Do not let the agarose to solidify for more than 15 min as the proteins will begin to diffuse. If

agarose solution fails to polymerize fully within the first 10 min, place the gel plate at 4°C for approximately 2 to 4 min.

2.5. Gel Staining I. Coomassie brilliant blue staining

Reagents: Fixing solution : 7% acetic in 50% methanol prepared with ddH2O Dye solution : 0.1% Coomassie brilliant blue R 250 in fixing solution Destaining solution : 5% acetic acid in 20% methanol prepared with ddH2O

1. After SDS-PAGE, transfer the gel to a plate containing the fixing solution and shake for at least 1 h.

2. Pour out the fixing solution, and replace with the dye solution and incubate for 20 min. 3. Destain the gel with destaining solution and continue with fresh solution until the background is

clear. 4. Wash the gel thrice with ddH2O for 5 min. 5. Acquire the image of the gel in a densitometer (Bio-Rad or GE health care). 6. Gels can be stored in ddH2O at 4°C for several months. II. Silver Staining

Reagents Fixing solution : 10% acetic acid in 40% ethanol prepared with ddH2O. Sensitizing solution* : 30% ethanol, 0.2% sodium thiosulphate and 6.8%

sodium (oxidizer) acetate in ddH2O. Silver nitrate solution * : 0.25% silver nitrate in ddH2O. Developing solution* : Add 0.015% formaldehyde to 2.5% sodium carbonate prepared in ddH2O just before use. Stop solution : 5% acetic acid in ddH2O.

Note: * - To be prepared fresh. Staining procedure (with gentle shaking all through) 1. Place the gel in a tray containing fixing solution and agitate on a shaker for at least 1 hr. Ensure

that the fixer solution covers the gel completely. 2. Drain the fixer solution from the tray. 3. Add sensitizing solution and agitate for 30 min. 4. Drain the sensitizing solution from the tray. 5. Wash the gel thrice in ddH2O for 5 min. 6. Add silver nitrate solution and agitate for 20 min. 7. After 20 min, drain the silver nitrate solution into an appropriate waste beaker. 8. Wash the gel twice in ddH2O for 1 min. 9. Add developing solution to the gel, and agitate until yellow or until brown "smokey" precipitate

appears. Then pour off developer, add fresh developer as needed and continue in this manner until desired intensity of spots is achieved.

10. Drain the developing solution, add stopper solution and agitate for 10 min. 11. Wash the gel thrice in ddH2O for 5 min. 12. Acquire the image of the gel with a densitometer. 13. Store the gels in ddH2O at 4°C. Note: Gels can be stored at 4°C in ziplock bags for up to two years.



2.6. Image Analysis Analyze gel image using IMAGE MASTER Software (GE Health care) or other suitable softwares and mark protein spots for excision. 2.7. Excision of Protein Spots (for sequencing by Mass spectrometry)

1. Assign the spot(s) in the gel that are to be sequenced. 2. Cut out the protein spot with a pipette tip. 3. Transfer the gel piece to a microfuge tube. 4. Chop up the gel piece with pipette tip. 5. Add a solution of 50% methanol/10% acetic acid to the gel pieces. 6. Incubate for 30 min. 7. Spin down and discard the supernatant. 8. The sample is ready for Mass Spectrometry Sequencing.

2.8. Useful Links and references : Ramesh Sundar, A., Nagarathinam, S., Ganesh Kumar, V., Rahul, P.R., Raveendran, M., Malathi, P., Ganesh Kumar, A., Rakwal, R., Viswanathan, R. (2010) Sugarcane proteomics: Establishment of a protein extraction method for 2-DE in stalk tissues and initiation of sugarcane proteome reference map. Electrophoresis 31: 1959-1974. Commercial 2-D Electrophoresis and Proteomics Sites Amersham Biosciences http://www5.amershambiosciences.com/APTRIX/upp00919.nsf/Content/proteomics_HomePage BioRad Proteomics Workstation http://www.proteomeworks.bio-rad.com/ Genomic Solutions http://www.genomicsolutions.com/ 2-D Analysis Software Sites Nonlinear Dynamics: http://www.phoretix.com/ PDQuest: http://proteomeworks.bio-rad.com/html/tech5.html Flicker for 2D gel analysis: http://www-lecb.ncifcrf.gov/flicker/ NCI/NCRDC LMMB Image Processing Section (GELLAB software): http://www-lecb.ncifcrf.gov/lemkin/gellab.html Compugen (Z3 software): http://www.2dgels.com/ Expasy Index to 2D PAGE databases and services: http://www.expasy.ch/ch2d/2d-index.html HSC 2DE Gel Protein Databases list: http://www.harefield.nthames.nhs.uk/nhli/protein.html Phosphoprotein Database: http://www-lecb.ncifcrf.gov/phosphoDB/ Cambridge Proteomics Facility: http://www.bio.cam.ac.uk/proteomics/index.html Rice 2D Database: http://semele.anu.edu.au/2d/2d.html COMPLUYEAST-2D PAGE Database: http://babbage.csc.ucm.es/2d/2d.html Danish Centre for Human Genome Research 2D PAGE Databases (Aarhus): http://proteomics.cancer.dk/ Siena-2DPAGE: http://www.bio-mol.unisi.it/2d/2d.html PMMA-2D Page at Purkyne Military Medical Academy, Czech: http://www.pmma.pmfhk.cz/ HP-2D PAGE (Max Delbruck Center, Berlin):

http://www.mdc-berlin.de/~emu/heart MitoDat—Mendelian Inheritance and the Mitochondrion: http://www-lmmb.ncifcrf.gov/mitoDat/ SWISS-2DPAGE at Geneva University Hospital:



http://www.expasy.ch/ch2d/ch2d-top.html Proteome BioKnowledge® Library: http://www.proteome.com/YPDhome.html Yeast Proteome Map: http://www.ibgc.u-bordeaux2.fr/YPM/ Melanie: http://us.expasy.org/melanie Sources of Information and Methods on 2-D Electrophoresis and Proteomics Australian Proteome Analysis Facility: http://www.proteome.org.au/ The Tubingen Proteome Project: http://www.uni-tuebingen.de/uni/kxm/Proteome/ University of Aberdeen Protein Lab and Proteomics Facility: http://www.abdn.ac.uk/~mmb023/proteome/index.htm The EXPASY Swiss 2D-PAGE http://www.expasy.ch/ The Harefield Hospital in London provides links to worldwide databases,upcoming meetings, 2-D gel analysis software, and more: http://www.harefield.nthames.nhs.uk/nhli/protein/ The laboratory of Dr. James R. Jefferies, parasitology Group, Institute of Biological Sciences, University of Wales at Aberystwyth, Ceredigion, Wales, UK: http://www.aber.ac.uk/~mpgwww/Proteome/Tut_2D.html#Section 1 Proteomics tools for mining sequence databases in conjunction with Mass Spectrometry experiments: http://prospector.ucsf.edu/ Websites for theoreticaland technical procedures on 2-D gel electrophoresis

http://www5.amershambiosciences.com/applic/upp00738.nsf/vLookupDoc/172581038-R140/$file/80-6429-60AB_Version_May_2002.pdf

http://www.bio-rad.com/LifeScience/pdf/Bulletin_2651.pdf http://proteomics.cancer.dk/procedures/procedure.html http://www.aber.ac.uk/parasitology/Proteome/Tut_2D.html http://ca.expasy.org/ch2d/protocols



Bioinformatics- Data mining tools, Identification of microsatellite sites, EST analysis and Annotation

S. J. Eapen Indian Institute of Spices Research, Calicut 673 012, Kerala

In Silico Analysis - Annotation of EST’s, SSR and SNP identification

SSR identification

Exercise 1. Collection of ESTs. 1. Go to NCBI site http://www.ncbi.nlm.nih.gov/ select db EST and type Citrus macrophylla in

text box. 2. Observe the results and download the fasta format file for analysis. 3. By selecting the display format as fasta will provide the fasta file. 4. By selecting file, whole ESTs can be downloaded in a single file.

Exercise 2. Assembling the ESTs 1. Go to CAP3 website http://mobyle.pasteur.fr/cgi-bin/MobylePortal/portal.py?form=cap3 and

type your Email ID. 2. Paste the EST sequences in the text box or upload the file by selecting file option. 3. Click the run button. 4. CAP3 will make the EST sequence in to contigs and singletons. 5. Once analysed, save the contigs file and singleton file. 6. These contigs were used for further analysis.

Exercise 3. Detecting SSRs using contigs ESTs 1. Go to WEBTROLL (Tandom Repeat Occurrence Locator) website

(http://wsmartins.net/webtroll/troll.html). 2. In WEBTROLL upload the contigs file for the analysis of SSRs (mono, di, tri, tetra, penta

repeats). 3. Click troll it button. 4. Observe the results and by clicking the Design primer button you can design the primers. 5. Collect the repeats and make a table in a proper manner using Excel.

Exercise 4. Detecting SSRs using MISA- MIcroSAtellite identification tool (MISA) tool 1. Go to MISA website http://pgrc.ipk-gatersleben.de/misa/ download misa.pl and misa.ini and

put in a folder in LINUX OS. 2. Download fasta file and put it in a same folder. 3. In command line type misa.pl <FASTAfile> 4. Get the result output <FASTfile>.misa, <FASTfile>.statistics and interpret your results.

SNP identification

Exercise 4. SNP discovery using ESTs

1. This part is analysed only on LINUX OS. 2. AUTOSNP program is customized and used for detecting SNPs. 3. CAP3 is integrated in AUTOSNP is used for making contigs. 4. In command mode just type ./cap3snp.pl –f piper.fasta if it is ace file means type

./cap3snp.pl –a piper.ace for analysis. 5. AUTOSNP will convert the fasta file in to results of html files. 6. Count the detected SNPs and DNA substitution (indel, transition, transversion) for

interpretation



Expressed Sequence Tags Analysis & Annotation

EST clustering and assembly: Currently the majority of the coding portion is in the form of expressed sequence tags (ESTs), and the need to discover the full length cDNAs of each human gene is frustrated by the partial nature of this data delivery. There is significant value in attempting to consolidate gene sequences as they are produced, in lieu of a yet-to-be-completed reference sequence. ESTs offer a rapid and inexpensive route to gene discovery, reveal expression and regulation data, highlight gene sequence diversity and splicing, and may identify more than half genes of organisms. Unfortunately, most EST data remains unprocessed, and thus does not provide the important high value sequence consensus information that it contains. The low quality sequence data provided can be much improved on, and in order to achieve quality information, pre-processing, clustering and post-processing of the results is required. The steps for EST processing are given below. Exercise 1. Collection of EST’s. NCBI dbEST is a division of GenBank that contains sequence data and other information on "single-pass" cDNA sequences, or "Expressed Sequence Tags", from a number of organisms. For downloading the complete EST sequences of organisms of your interest type the scientific name of organism in the text box, available EST sequences of organism of your interest can be obtained

1. Go to NCBI site http://www.ncbi.nlm.nih.gov/ select db EST and type Phytophthora capsici in text box.

2. Observe the results and download the fasta format file for analysis. (FASTA format is a text-based format for representing either nucleotide sequences or peptide sequences, in which base pairs or amino acids are represented using single-letter codes. The format also allows for sequence names and comments to precede the sequences. Which begins with '>', and then give a name and/or a unique identifier for the sequence)

3. By selecting the display format as fasta will provide the fasta file. 4. By selecting file, whole ESTs can be downloaded in a single file.

Exercise 2: Vector Screening Downloaded EST’s may contain vector and poly A tail contaminations, these vector sequences and poly A tail sequences must be removed to avoid errors during annotation. The vector screening step will show you whether your EST sequences contain Vector contamination.

1. Go to http://www.ncbi.nlm.nih.gov/VecScreen/VecScreen.html for removing vector contamination.

2. Copy and paste your fasta file in to the text box. 3. Click Run VecScreen button. 4. Find the similarities using Vector Blast. If similarities found delete the similar sequence from

the fasta file. 5. Use the preprocessed file for further analysis.

Exercise 3: TrimEST If the vector sequence is detected during vector screening, use TrimEST tool to trim out the vector sequences present in the EST.

6. Go to the website http://inn.weizmann.ac.il/cgi-bin/EMBOSS/emboss.pl?_action=input&_app=trimest for removing PolyA tail.

7. Browse and choose your fasta file or paste your EST sequence. 8. Observe the options field manipulate it and click run trimEST. Immediately output file will

open. 9. For larger size sequences submit mail ID so that you will get a mail your job is over or not.

Exercise 4: TrimSeq – Trim ambiguous bits off the ends sequences. Specifically, it removes all gap characters from the ends, removes X's and N's (in nucleic sequences) from the ends, optionally removes *'s from the ends, optionally removes IUPAC ambiguity codes from the ends (B and Z in



proteins, M, R, W, S, Y, K, V, H, D and B in nucleic sequences). It then optionally trims off poor quality regions from the end, using a threshold percentage of unwanted characters in a window which is moved along the sequence from the ends. The unwanted characters which are used are X's and N's (in nucleic sequences), optionally *'s, and optionally IUPAC ambiguity codes.

1. Go to the website http://mobyle.pasteur.fr/cgi-bin/MobylePortal/portal.py?form=trimseq. 2. Check file option and browse and choose your file click the RUN button to trim the sequence. 3. Save the TrimSeq output file for further analysis.

Exercise 5. Repeat masking Repeat masking is not a necessary step; this tool is used to mask the repeated regions of EST, which may create problems for clustering algorithm for EST assembly.

1. RepeatMasker - screens DNA sequences in FASTA format against a library of repetitive elements and returns a masked query sequence ready for database searches.

2. Go to the website http://repeatmasker.org in services click repeatmasking 3. Browse and choose your fasta file or paste your EST sequence. 4. Check search engine as wublast and choose the DNA source. 5. Result output will be in HTML format. 6. This repeat masked file is used for clustering.

Exercise 6. Clustering and Assembling the ESTs A cluster is fragmented, EST data (DNA or protein) and (if known) gene sequence data, consolidated, placed in correct context and indexed by gene such that all expressed data concerning a single gene is in a single index class, and each index class contains the information for only one gene. Clustering refers to assembling sequences in specific order as such; they were placed in the genome of organism.

1. Go to CAP3 website http://mobyle.pasteur.fr/cgi-bin/MobylePortal/portal.py?form=cap3 and type your Email ID.

2. Paste the EST sequences in the text box or upload the file by selecting file option. 3. Click the run button. 4. CAP3 will make the EST sequence in to contigs and singletons. 5. Once analyzed, save the contigs file and singleton file. These contigs and singleton were used

to further analysis. EST Annotation: Genome or EST annotation is the process of attaching biological information to sequences. It consists of two main steps:

1. Identifying elements on the genome, a process called gene prediction, and 2. Attaching biological information to these elements.

The basic level of annotation is using BLAST for finding similarities, and then annotating genomes based on that. However, nowadays more and more additional information is added to the annotation platform. The additional information allows manual annotators to deconvolute discrepancies between genes that are given the same annotation. Some databases use genome context information, similarity scores, experimental data, and integrations of other resources to provide genome annotations through their Subsystems approach. Other databases (e.g Ensembl) rely on both curated data sources as well as a range of different software tools in their automated genome annotation pipeline. Structural annotation consists of the identification of genomic elements.

ORFs and their localization gene structure coding regions location of regulatory motifs

Functional annotation consists of attaching biological information to genomic elements. biochemical function biological function



involved regulation and interactions expression

These steps may involve both biological experiments and in silico analysis. A variety of software tools have been developed to permit scientists to view and share genome annotations. Steps Exercise 1. The clustered EST sequence obtained from EST clustering and assembly step is used for annotation of EST Exercise 2. Annotation of ESTs using blast

1. Go to BLASTX site (Search protein database using a translated nucleotide query) http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Translations&PROGRAM=blastx&BLAST_PROGRAMS=blastx&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on and paste your contigs sequence for blast search.

2. Type the organism as Phytophthora with default parameters. 3. Observe the search results. 4. In Blast results click the gene ontology GO and observe the function of the gene. 5. Prepare the table for the functional annotation. 6. Interpret your results.

Exercise 3. Annotation of ESTs using ESTEXPLORER 1. Go to ESTEXPLORER (Web server) site and observe the interface for EST analysis

(http://estexplorer.els.mq.edu.au/estexplorer/main_page.php ). 2. Select organism as Phytophthora 3. Check EST sequences and upload your data. 4. Tick PHASE I , PHASE II, PHASE III 5. Provide your name and mail ID 6. Click Process data button. 7. It will provide the request ID to see the results via status of the work.



SEQUENCE-BASED MARKER DESIGNING Rajesh M.K. 1and Senthil Kumar R.2

1 Central Plantation Crops Research Institute, Kasaragod 671124, Kerala 2 Indian Institute of Spices Research, Appangala, Karnataka

Introduction

The advent of next-generation sequencing (NGS) has revolutionized genomic and transcriptomic approaches to biology. These new sequencing tools are also valuable for the discovery, validation and assessment of genetic markers in populations. Restriction enzymes have been a core tool for marker discovery and genotyping for decades, ever since the development and use of RFLPs. The diversity of restriction enzymes available (which vary in the length, symmetry or GC versus AT bias of their recognition sites, and also in their methylation-sensitivity) makes them an extremely versatile assay tool. Their flexibilities allow researchers to customize marker discovery approaches to individual projects.

Methodology

1. Sequencing of the genome and comparison with the reference genome. When a reference genome sequence is available, sequence reads produced by any of the technologies can be aligned and positioned on a physical map. The higher the quality of the reference genome assembly, the easier it is to impute missing genotypes, thus reducing the coverage that is required to genotype each individual. Reference genomes can also be used to design marker discovery experiments by simulating in silico the number of markers produced by different enzymes. Challenges arise when a reference genome sequence is not available, or even when a reference sequence is available but is poorly assembled, comes from a distantly related taxon or is large and highly repetitive. Reference genomes can also be used to design marker discovery experiments by simulating in silico the number of markers produced by different enzymes.

2. SHORE analysis of the two genomes SHORE, for Short Read, is a mapping and analysis pipeline for short DNA sequences produced on a Illumina Genome Analyzer. It is designed for projects whose analysis strategy involves mapping of reads to a reference sequence. This reference sequence does not necessarily have to be from the same species, since weighted and gapped alignments allow for accuracy even in diverged regions. The reads of the newly sequenced genome are aligned to the reference genome to detect SNPs.

3. Retrieval of sequences around the region of SNP Sequences, around 500 bp, are retrieved from the two genome sequences.

4. Detection of restriction enzyme sites within the two sequences The two sequences are compared with respect to unique restriction enzyme site present in any one of the sequences.

5. Design of primers for amplification of the sequence of interest

Primers are designed for amplification of the sequence of interest using primer design softwares.



Annexure I

General Conversion Tables and Formulae

Common Conversions of Nucleic Acids and Proteins

Weight conversion

1g = 10-6 g

1 ng = 10-9 g

1 pg = 10-12 g

1 fg = 10-15 g

Spectrophotometric conversion 1 A260 unit of double-stranded DNA = 50 g/ml

1 A260 unit of single-stranded DNA = 33 g/ml

1 A260 unit of single-stranded RNA = 40 g/ml

DNA molar conversions 1 g of 1,000 bp DNA – 1.52 pmole (3.03 pmoles of ends)

1 pmole of 1000 bp DNA = 0.66 g

Protein molar conversion

100 pmoles of 100,000 dalton protein = 10 g



Protein/DNA conversion 1 kb of DNA = 330 amino acids of coding capacity – 3.7 x 104 dalton protein

10,000 dalton protein = 270 bp DNA

50,000 dalton protein = 1.35 kb DNA

100,000 dalton protein = 2.7 kb DNA

Documents

Compiled Practicals