of March 19, 2018.This information is current as

Protease-1 in BirdsMannan-Binding Lectin-Associated Serine

: Absence ofGallus gallusComplement in Composition of the Lectin Pathway of

and Wilhelm J. SchwaebleStover, Sara M. Sandrini, Denise Marston, Julia S. Presanis Nicholas J. Lynch, Saeed-ul-Hassan Khan, Cordula M.

http://www.jimmunol.org/content/174/8/4998doi: 10.4049/jimmunol.174.8.4998

2005; 174:4998-5006; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/174/8/4998.full#ref-list-1

, 17 of which you can access for free at: cites 47 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2005 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on March 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on March 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Composition of the Lectin Pathway of Complement in Gallusgallus: Absence of Mannan-Binding Lectin-Associated SerineProtease-1 in Birds1

Nicholas J. Lynch,2* Saeed-ul-Hassan Khan,2* Cordula M. Stover,* Sara M. Sandrini,*Denise Marston,† Julia S. Presanis,‡ and Wilhelm J. Schwaeble3*

The lectin pathway of complement is activated by multimolecular complexes that recognize and bind to microbial polysaccharides.These complexes comprise a multimeric carbohydrate recognition subunit (either mannan-binding lectin (MBL) or a ficolin), threeMBL-associated serine proteases (MASP-1, -2, and -3), and MAp19 (a truncated product of the MASP-2 gene). In this study wereport the cloning of chicken MASP-2, MASP-3, and MAp19 and the organization of their genes and those for chicken MBL anda novel ficolin. Mammals usually possess two MBL genes and two or three ficolin genes, but chickens have only one of each, bothof which represent the undiversified ancestors of the mammalian genes. The primary structure of chicken MASP-2 is 54%identical with those of the human and mouse MASP-2, and the organization of its gene is the same as in mammals. MASP-3 is evenmore conserved; chicken MASP-3 shares �75% of its residues with human and Xenopus MASP-3. It is more widely expressedthan other lectin pathway components, suggesting a possible function of MASP-3 different from those of the other components.In mammals, MASP-1 and MASP-3 are alternatively spliced products of a single structural gene. We demonstrate the absence ofMASP-1 in birds, possibly caused by the loss of MASP-1-specific exons during phylogeny. Despite the lack of MASP-1-likeenzymatic activity in sera of chicken and other birds, avian lectin pathway complexes efficiently activate C4. The Journal ofImmunology, 2005, 174: 4998–5006.

T he lectin pathway provides an Ab-independent route ofcomplement activation. It is an ancient system that ante-dates the evolution of adaptive immunity and the classical

complement pathway, and it is thought to be particularly importantin lower animals such as the urochordates and cephalochordates,which lack an adaptive immune system. In vertebrates, the lectinpathway provides a first line of defense during the lag phase thatprecedes the onset of an adaptive response (1–3). Deficiencies ofthe lectin pathway are associated with susceptibility to infectiousdisease, particularly in infants, young children, and those with an-other acquired immunodeficiency, such as cancer patients under-going chemotherapy (4–8).

Activation of the lectin pathway occurs when a multimolecularfluid phase activation complex, comprising a recognition subcom-ponent and associated serine proteases, binds to carbohydratestructures present on microbial surfaces. Two types of fluid phaserecognition molecule have been described, the mannan-bindinglectin(s) (MBL),4 and the ficolins (9–12). Structurally they are

very similar, being homotrimers of a single polypeptide chain,with an N-terminal collagen-like domain and a C-terminal carbo-hydrate recognition domain (CRD). In MBL, the CRD is a C-typelectin domain, whereas the CRD in ficolins is a fibrinogen-likedomain. In plasma, the basic homotrimers form higher order oli-gomers, which, in turn, form complexes with the MBL-associatedserine proteases, MASP-1, -2, and -3 (13–16). Only MASP-2cleaves C4 and C4b-bound C2, generating C4b2a, the same C3convertase that results from activation of the classical pathway (17,18). The roles of MASP-1 and -3 in these complexes are stillunclear.

All three MASPs share a conserved domain structure. Five N-terminal domains (the C1r/C1s/Uegf/bone morphogenetic protein I(CUBI), epidermal growth factor (EGF)-like, CUBII, complementcontrol protein I (CCPI), and CCPII domains) precede a C-termi-nal serine protease domain. When activated, the enzymes split intotwo disulfide-linked chains, the A chain, which contains the fiveN-terminal domains, and the B chain, which contains the serineprotease domain (2, 19). The mRNAs encoding MASP-1 and -3are alternatively spliced products of one single gene. The A chainis common to both proteins, the B chain of MASP-1 is encoded byfive or six exons (depending upon the species), and the B chain ofMASP-3 is encoded by a single exon, located between the exonsencoding the shared A chain and those coding for the B chain ofMASP-1 (16, 19, 20). This genomic arrangement is found in am-phioxus (a cephalochordate) and in all vertebrates investigated todate, but not in the ascidians, indicating that it arose after thedivergence of the urochordates, but before the divergence of thecephalochordates (21). The lectin pathway activation complexesalso contain MAp19, a protein composed of the two N-terminal

*Department of Infection, Immunity, and Inflammation, University of Leicester, Le-icester, United Kingdom; †Institute for Animal Health, Compton, United Kingdom;and ‡Medical Research Council Immunochemistry Unit, Department of Biochemistry,University of Oxford, Oxford, United Kingdom

Received for publication November 24, 2004. Accepted for publication January31, 2005.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by Wellcome Trust Grants 060574 and 062696.2 N.J.L. and S.-u.H.K. contributed equally to this work.3 Address correspondence and reprint requests to Dr. Wilhelm J. Schwaeble, Depart-ment of Infection, Immunity, and Inflammation, University of Leicester, UniversityRoad, Leicester, U.K. LE1 9HN. E-mail address: ws5@le.ac.uk4 Abbreviations used in this paper: MBL, mannan-binding lectin; AMC, 7-amino-4-methylcoumarin; CCP, complement control protein; CRD, carbohydrate recognition

domain; CUB, C1r/C1s/Uegf/bone morphogenetic protein; EGF, epidermal growthfactor; MASP, MBL-associated serine protease; qRT-PCR, quantitative RT-PCR; UT,untranslated.

The Journal of Immunology

Copyright © 2005 by The American Association of Immunologists, Inc. 0022-1767/05/$02.00

by guest on March 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

domains of MASP-2 encoded by a truncated mRNA transcript thatarises through alternative splicing of the MASP2 gene (19, 22–24).MAp19 has no enzymatic activity, and its function within the lec-tin pathway activation complexes remains unclear.

Commercial poultry are vulnerable to bacterial, viral, andparasitic infections that cause considerable mortality and eco-nomic loss. They are also reservoirs for transmissible humanpathogens, including Salmonella, Campylobacter, and poten-tially dangerous stains of influenza, such as the H5N1 (Guang-dong) virus that caused the 1997 bird flu outbreak in HongKong (25, 26). Although the adaptive immune system of thechicken has been extensively studied (27), the complement sys-tem and, in particular, the lectin pathway, is less well under-stood. It is known that Ab-independent activation of the com-plement system plays an important role in the host response tofowlpox virus; fowlpox virus infection is aggravated in chick-ens treated with cobra venom factor (28).

The classical pathway components C1 and C3 through C9 havebeen found in chickens (29). Because a homologue for C2 was notfound in these early studies, it was assumed that the role of C2 maybe fulfilled by the chicken factor B-like protease, an evolutionaryremnant of a common C2/factor B ancestor described previously(29, 30). However, subsequent studies identified and mapped thechicken homologues of both the C2 and factor B genes and showedthat chickens are not deficient in C2 (K. Skjoedt and J. Kaufman,unpublished observations). MBL is the only lectin pathway com-ponent that has been described in the chicken to date. Althoughmost mammals have two separate genes for MBL (31), only onegene was found in the chicken, and phylogenetic analysis of itsamino acid sequence indicated that it may represent an undiversi-fied ancestor of the mammalian MBLs (32). The concentration ofMBL in chicken serum ranges from 0.4 to 37.8 �g/ml (mean, 5.8�g/ml), with no strain-to-strain variation and no deficiencies de-tected (33). MBL levels increase �2-fold in chickens infected withinfectious bronchitis virus, infectious laryngotracheitis virus, andinfectious bursal disease virus, indicating that MBL is a mild acutephase protein (34).

This report describes the molecular cloning of chicken MASP-2,MASP-3, and MAp19 and the organization of their genes andthose for chicken MBL and a novel ficolin. We demonstrate theapparent absence of MASP-1 and MASP-1-like enzymatic activityin chickens and other birds.

Materials and MethodsRNA extraction and cDNA synthesis

Total RNA was prepared using TRIzol reagent (Invitrogen Life Technol-ogies), according to the manufacturer’s instructions. Poly(A)� mRNA waspurified from total RNA using the Oligotex mRNA Midi kit, from Qiagen.

For cDNA synthesis, �8 �g of total RNA was digested with RNase-freeDNase I (Promega), extracted once with phenol/chloroform/isoamyl alco-hol (25/24/1), precipitated, washed with ethanol, then redissolved in water.The concentrations of the RNA samples were determined by measuring theabsorbance at 260 nm. Three micrograms of each RNA sample was primedwith oligo(dT)12–18, and single-stranded cDNAs were synthesized usingthe SuperScript First-Strand Kit (Invitrogen Life Technologies) accordingto the supplier’s instructions.

cDNA cloning

A �ZAP chicken liver cDNA library (Stratagene) was screened by filterhybridization using [�-32P]dCTP-labeled cDNA probes prepared with theRandom Primed Labeling kit (Roche). Isolated �ZAP clones were con-verted into pBluescript SK� plasmid clones by in vivo excision, followingthe supplier’s protocol, and sequenced (Genterprise). The 5� and 3� ends ofsome cDNA sequences were extended by RACE, using chicken liver RNAand kits (Invitrogen Life Technologies). RACE products were cloned intopGEM-Teasy (Promega) and sequenced.

Northern blotting

For Northern blot analysis, 10 �g of total RNA or 100 ng of poly(A�)mRNA was separated on formaldehyde-containing 1.2% agarose gels,transferred to nylon membrane, and hybridized with [�-32P]dCTP-labeledcDNA probes using standard methods (35). The cDNA probes used were:for the A chain of MASP-2, a 376-bp RT-PCR product amplified fromchicken liver cDNA with primers M2A-ch-F and M2A-ch-R (Table I); forthe B chain of MASP-2, a 430-bp RT-PCR product generated with primersM2dg-F2 and M2dg-R1; for the A chain of MASP-3, a 740-bp RT-PCRproduct amplified with primers M1&3dg-F and M1&3dg-R; and for the Bchain of MASP-3, a 1200-bp NcoI fragment of clone CM3/5, encompass-ing the last 500 bp of the coding sequence and the first 700 bp of the3�-untranslated (3�UT) region. For controls, rat liver RNA was hybridizedwith rat MASP-3 A and B chain-encoding cDNA probes, as previouslydescribed (20).

In situ hybridization

mRNA was localized by in situ hybridization using 35S-labeled antisenseRNA probes generated by in vitro transcription. The templates for in vitrotranscription were RT-PCR products, amplified from liver cDNA andcloned into pGEM-Teasy. For the A chain of chicken MASP-3 and for theB chain of chicken MASP-2, the cloned RT-PCR products were thosedescribed above. For the B chain of chicken MASP-3, a 564-bp RT-PCRproduct was generated using primers M3SP-F1 and -R1 (Table I); forchicken MAp19, a 170-bp product was obtained using primers MAp19-F1and -R1; for chicken MBL, a 330-bp product was generated with primersMBL-F1 and MBL-R1; for chicken ficolin, a 324-bp product was amplifiedusing primers ChkFCN_F1 and ChkFCN_R1; for the B chain of ratMASP-1, a 400-bp product was generated using primers RM1sp-F1 andRM1sp-R1; and for the B chain of rat MASP-3, a 407-bp product wasobtained with primers RM3-BCF1 and RM3-BCR1. Antisense RNAprobes were transcribed from the cloned templates using the method de-scribed by Melton et al. (36). For controls, the templates were transcribedin the opposite direction, generating sense RNA probes. Twenty-micron-thick tissue sections were cut using a cryostat, mounted on poly-lysine-coated microscope slides (Merck), and hybridized with the 35S-labeledprobes according to the method of Schafer et al. (37). After hybridizationand washing, the signals were detected by exposing the sections to KodakBioMax MR x-ray film (Sigma-Aldrich).

Table I. Oligonucleotides used in this study

Primer Sequence (5�-3�)

M2A-ch-F ATTGACAACACCCTCACGGTCM2A-ch-R CCACATTAAAGGTCTCCACM2dg-F2 TGACAATGAYATWGCWYTGATM2dg-R1 ATTTYGTGTAKACHCCATAYTGM1&3dg-F SARRGARASCACHGAYACHGARCM1&3dg-R CRTTATCCTTYAGCACTYKGTASMAp19-F1 AGGACGTGCACAGCGTGAMAp19-R1 GCTGGAGGAAGGAGGTCTGAMBL-F1 TGACCTGCACCGACAAATAACTGATMBL-R1 GTTGCTGTAAGTTAAAGGCCCACCAChkFCN-F1 ACTGTCTTCTGCGATATGGACAChkFCN-R1 GTACGATAAGGAGTCTCCAGCARM3-BCF1 CATAGTGGTGGAAGACACATCARM3-BCR1 CTGTCACATTAGGGTTGGAGARM1sp-F1 TGACGGCTGCTCACTGTCTCRM1sp-R1 GTGTAGGCCTCTTGGCAGGTAM3Ach-F1 GACTCCTATCCCAGCGACTCM3Ach-R1 GTTGGAGAAGTCGGACCTGAM3SP-F1 GATCATCAAGCGCATCATCGM3SP-R1 CTTGCACTCTGCATGCAGCM3race-R1 CCAGCTTTGATCTTGATGTAM3race-R2 CAGGCAGTCCGAGCTCTTGGGGTAGGM3race-R3 CGGCCGTGTAATGTGCGTCGAATCCM2race-R1 GTAGCTGCAGGTGCTGM2race-R3 GGCTGGCAATTTCTCCAGTTCM2race-R4 GTTCTGACACTGGGCTGTGCAMAp19-F2 TTCCTGCCCCCAGGGCTCMAp19-R2 CAACAAGTAATGGCCTCTTTATTG

4999The Journal of Immunology

by guest on March 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Analysis of gene expression by quantitative RT-PCR (qRT-PCR)

cDNA was analyzed by quantitative PCR using a LightCycler (Roche) tofollow the incorporation of SYBR Green I into the PCR products in real-time. Each 15 �l of PCR contained 1/100th of the original cDNA synthesisreaction (corresponding to 30 ng of total RNA), 0.5 �M of each primer,and 7.5 �l of QuantiTect SYBR Green Master Mix (Qiagen). Forty-fivecycles of amplification were performed; the annealing temperature wasreduced from 70 to 58°C during the first 15 cycles and was kept constantat 58°C thereafter. The fluorescence signal was detected at the end of eachcycle, and results were analyzed using the Fit Points option in the LDCA

software supplied with the machine (38). Melting curve analysis was usedto confirm the specificity of the products (39). The primers used to amplifythe A chain of MASP-3 were M3Ach-F1 and -R1 (generating a 261-bpproduct); for the B chain of MASP-3, M3SP-F1 and M3SP-R1 (564 bp);for MAp19, MAp19-F1 and MAp19-R1 (170 bp); for MASP-2, M2A-ch-Fand M2A-ch-R (376 bp); for MBL, MBL-F1 and MBL-R1 (330 bp); andfor chicken ficolin, ChkFCN-F1 and ChkFCN-R1. Standard curves wereproduced for each analysis using serial dilutions of the corresponding cD-NAs cloned in pBluescript SK� (for MASP-2 and -3) or pGEMTeasy (forMAp19 and MBL).

Enzyme assays

Mannan-coated microtiter plates were used to capture MBL-MASP com-plexes from pooled normal human serum, chicken serum (from a pool offive animals), and turkey serum (also pooled from five animals). C4 cleav-age activity of the captured complexes was assayed using the method de-veloped by Petersen et al. (40), with minor modifications (41). MASP-1-like activity was measured using the fluorescent substrate, butyloxy-carbonyl-Val-Pro-Arg-7-amino-4-methylcoumarin (AMC), as previouslydescribed (42).

Sequence analysis

The chicken genome database is available at �www.ensembl.org/Gallus_gallus/�. Similarity searches with nucleotide and polypeptide query se-quences were run on this server using BLASTN and TBLASTN, respec-tively. The MutliContigView option was used to create chicken/human

FIGURE 1. Alignment of thecDNA-derived peptide sequences ofchicken, human, and mouse MASP-3and X. laevis MASP-3a. Predictedleader peptides are italicized, poten-tial N-glycosylation sites are under-lined, conserved residues are markedwith an asterisk, conservative substi-tutions are marked with a colon, andconserved cysteines are shown inbold. The arginine/isoleucine cleav-age site that separates the A and Bchains is indicated by an arrow, andthe three residues that form the cata-lytic triad are boxed.

Table II. Cross-species comparison of MASP-3, MASP-2, and MAp19peptide sequences (percentage of identical residues).

Chicken

MASP-3 MASP-2

Map19(%)

Total(%)

B chain(%)

Total(%)

B chain(%)

Human 75 79 54 50 59Mouse 76 80 54 50 63Xenopus 75a 83a 47 45

a Xenopus MASP3a.

5000 LECTIN PATHWAY IN G. gallus

by guest on March 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

synteny maps. Signal peptides and N-linked glycosylation sites were pre-dicted using SignalP v3.0 and NetNGlyc v1.0, which can be found at�www.cbs.dtu.dk/services/�.

ResultscDNA cloning

Degenerate oligonucleotides were designed to match parts of theMASP-1/3 A chain and the B chain of MASP-2 that are conservedin the human, rat, mouse, and Xenopus laevis sequences. TheMASP-1/3 primers (M1&3dg-F and M1&3dg-R; Table I) wereused to amplify a 740-bp fragment of cDNA from chicken liverRNA by RT-PCR, and the MASP-2 specific primers (M2dg-F2and M2dg-R1) were used to amplify a 430-bp fragment from thesame source. Both products were cloned into pGEM-Teasy andthen sequenced to confirm that they encode the anticipated regionsof the chicken MASP cDNAs. The RT-PCR products were sub-sequently labeled with [�-32P]dCTP and used to screen a propri-etary chicken liver cDNA library.

Seven clones were obtained using the MASP-1/3 A chain probe.Sequencing showed that all seven were incomplete MASP-3 cD-NAs, the longest of which (clone CM3/5) was 3343-bp long andwas complete at its 3� end, but began with DNA encoding themiddle of the CUBI domain, �300 bp downstream of the expectedtranscription start. Where they overlapped, the sequences of theother six clones were identical with that of CM3/5. The 5� end ofthe MASP-3 sequence was completed by RACE, using chickenliver RNA and the primers M3race-R1, -R2, and -R3. A 565-bpRACE product was obtained, extending the known sequence by293 bp.

The complete chicken MASP-3 cDNA (GenBank accession no.AY567829) is 3636 bp long and comprises a 159-bp 5�UT region,followed by a 2190-bp open reading frame, a stop codon TGA, anda 3�UT region of 1284 bp. A putative polyadenylation signal islocated 13 bp upstream of the poly(A)� tail. Analysis of thecDNA-derived amino acid sequence revealed extensive similaritybetween chicken MASP-3 and MASP-3 from other species. Thechicken sequence shares 75% of its residues with the human se-quence, 76% with the mouse sequence, and 75% with the Xenopuslaevis MASP-3a sequence (Table II). The isoleucine/argininecleavage site that separates the A and B chains is conserved, as arethree residues that are important for catalytic activity (His, Asp,and Ser, the so-called catalytic triad). All the N-glycosylation sitesare also conserved, as are all the cysteine residues, including thetwo that form the methionine loop, a cystine bond around a me-thionine residue in the serine protease domain (Fig. 1).

No MASP-1-like clones were obtained, either directly from thecDNA library or by 3�RACE using primers located in the A chainof MASP-3 (which is shared with MASP-1 in other species).

The largest clone obtained using the MASP-2 B chain probe was2082 bp long, which did not comprise the full-length coding se-quence. The 5� end of this clone extended to the cDNA encodingthe CUBII domain. 5�RACE using primers M2race-R1, -R3, and-R4 gave a 601-bp product, which extended the known sequenceby 336 bp and included the initiation codon. The completeMASP-2 cDNA (GenBank accession no. AY567828) is 2449 bplong and includes a 52-bp 5�UT region, a 2058-bp open readingframe, the stop codon, and a 336-bp 3�UT region, with a polyad-enylation signal 19 bp upstream of the poly(A)� tail. All the im-portant features found in the primary structure of human, mouse,and Xenopus MASP-2 are conserved in chicken MASP-2 (Fig. 2),although the degree of identity among the MASP-2 amino acidsequences is less than that among the MASP-3 sequences(Table II).

Chicken MAp19 cDNA was cloned by RT-PCR. First, the 3�sequence was obtained by 3�RACE using primers located withinthe DNA encoding the CUBI domain of MASP-2 (MAp-race-F1and MAp-race-F2). A 440-bp RACE product was obtained, clonedinto pGEM-Teasy, and sequenced. Next, primers representing the5� end of MASP-2 (MAp19-F2) and the 3� end of the MAp19RACE product (MAp19-R2) were used to amplify full-lengthMAp19 cDNA from chicken liver cDNA. The first 588 bp ofchicken MAp19 cDNA are identical with those of the MASP-2cDNA and encode the CUBI and EGF-like domains (Fig. 2). Theremainder of the cDNA is unique to MAp19 and includes the thirdnucleotide of the codon for the last residue, the stop codon, and a3�UT region of 177 bp (GenBank accession no. AY567830).Mammalian MAp19 proteins have a four-residue C-terminal ex-tension (EQSL) that is absent in the corresponding MASP-2 se-quences (23, 24). Chicken MAp19 lacks this feature; its entireamino acid sequence is contained within the MASP-2 sequence.

Organization of the lectin pathway genes

The genes for chicken MASP-2 and MASP-3 were characterizedby comparing the cDNA sequences with the recently completedchicken genome sequence.

The MASP-2 gene occupies �14 kb of chromosome 21, and itsintron/exon structure is identical with that reported for the humanand mouse MASP-2 genes (23, 24). Exon 1 encodes the 5�UTregion and the initiation codon, exons 2 and 3 encode the signalpeptide and the CUBI domain, and exon 4 encodes the EGF-likedomain. Splicing between exons 4 and 5 generates the MAp19mRNA. In mammals, the fifth exon encodes the last four residuesof MAp19 (EQSL), the stop codon, and the 3�UT region. In thechicken, exon 5 only contains the last nucleotide of the codingsequence, followed by the stop codon and the 3�UT region. Exons6 and 7 encode the CUBII domain of MASP-2, exons 8–11 encode

FIGURE 2. The cDNA-derived amino acid se-quences of chicken MASP-2 and MAp19. Predictedleader peptides are italicized. Features that are con-served in other species include the two N-glycosylationsites (underlined), all the cysteine residues shown inbold, the three residues that form the catalytic triad inMASP-2 (boxed), and the arginine/isoleucine cleavagesite that separates the A and B chains of MASP-2 (in-dicated by an arrow).

5001The Journal of Immunology

by guest on March 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

the two CCP domains, and exon 12 encodes the serine proteasedomain (Table III). The codon phases are conserved between thechicken and human genes (43). The region of chromosome 21 thatcontains the chicken MASP2 gene is syntenic with the MASP2 locion human chromosome 1p36, mouse chromosome 4E1, and ratchromosome 5q36. All four loci contain the genes TARDBP,MASP2, SRM, PMSCL2, and FRAP1 (or their homologues), in thatorder (43, 44).

The gene for chicken MASP-3 is located on chromosome 9. Itcomprises 11 exons, the organization of which is identical withthat of the first 11 exons in the human and mouse MASP1/3 genes.The first 10 exons encode the 5�UT region and the A chain ofMASP-3, and the 11th exon encodes the serine protease domain,stop codon, and 3�UT region. In the mammalian genes, exon 11 isfollowed by six additional exons, which encode the (TCN-type)serine protease domain of MASP-1. We looked for the equivalentexons in the chicken using the peptide sequences from the serineprotease domains of human, mouse, and X. laevis MASP-1 asquery sequences for TBLASTN searches of the chicken genomedatabase. There is no evidence for MASP-1-specific exons in thechicken genome, either 3� of the MASP-3 gene or elsewhere in thegenome. (The closest hits were actually MASP-2 and anticoagu-lant protein C.)

Examination of the sequence surrounding the MASP-3 gene re-vealed a possible explanation for the absence of MASP-1-specificexons in the chicken genome. The region 5� of the chickenMASP-3 gene, which includes the chicken homologues of hsBCL6and hsSST, is syntenic with the human MASP1/3 locus on chro-mosome 3q27, but the synteny ends immediately 3� of theMASP-3 gene (Fig. 3). TM7L_HUMAN is 20 kb downstream ofthe human MASP1/3 gene, followed by RPL39L and SIAT1. In thechicken, the homologues of TM7L_HUMAN and RPL39L aremissing altogether, and the homologue of SIAT1 (SAI1_chick) isfound 5.8 Mb 5� of the chicken MASP-3 gene. Likewise, ENS-

GALG00000007474 and TFR1_chick are found 3� of the chickenMASP-3 gene, but their human homologues (PCYTIA and TFRC)are located �9 Mb upstream of the human MASP1/3 gene. Thesefindings suggest that an early translocation event separated theMASP-1-specfic exons from the 3� end of the original MASP-1/3gene, and that the MASP-1-specific exons together with the ho-mologues of TM7L_HUMAN and RPL39L were either lost duringtranslocation or disappeared at a later stage.

We also identified genes encoding the two lectin pathway rec-ognition molecules in the chicken, MBL and a ficolin. Most mam-mals have two functional MBL genes, located on separate chro-mosomes, although in humans, MBL1 is a pseudogene, and onlyMBL2 produces a protein (31). The chicken has just one MBLgene, which is located on chromosome 6 in a conserved cluster thatincludes the gene for pulmonary surfactant protein D. It is homol-ogous to the human pseudogene (MBL1) and the mouse and ratgenes (Mbl1 and MABA_RAT).

Humans have two ficolin genes, FCN1 and FCN2, arrangedback-to-back on chromosome 9q34, and a third, FCN3, on chro-mosome 1p35. FCN1 encodes M-ficolin, which is expressed on thesurface of immature macrophages, whereas FCN2 and FCN3 en-code L-ficolin and H-ficolin, which are both plasma proteins. Themouse homologues of FCN1 and FCN2 (Fcna and Fcnb, respec-tively) are arranged back-to-back on chromosome 2. Chickenshave a single ficolin gene located on chromosome 17, which ap-pears to represent an undiversified ancestor of FCN1 and FCN2. Itsputative protein sequence is 60% identical with that of L-ficolin(the product of FCN2) and 57% identical with that of M-ficolin(the product of FCN1).

Expression of the lectin pathway components

In situ hybridization was used to analyze mRNA expression inembryonic tissue (Fig. 4); Northern blotting and qRT-PCR wereused to analyze adult tissue (Figs. 5–7).

In the chicken, as in other species (23, 24), MASP-2 and MAp19mRNA expression is restricted to liver tissue (Fig. 4, A and B).Northern blotting using a cDNA probe comprising the 5�-codingsequence for the A chain of MASP-2 revealed two mRNA speciesin adult liver, the �2.5-kb MASP-2 message and the �0.8-kbMAp19 mRNA (Fig. 5A). Using a probe comprising the codingsequence for the B chain, only the 2.5-kb MASP-2 message wasseen (Fig. 5B). The qRT-PCR analysis showed that MAp19mRNA is �3.5 times more abundant than the MASP-2 message inadult liver (data not shown).

Chicken MBL mRNA is restricted to the liver in both embryos(Fig. 4I) and adult tissue. This is in contrast to murine and humanMBL, which is expressed in hepatic and extrahepatic tissues (45).The putative chicken ficolin gene is expressed in embryonic andadult liver tissue only (see Fig. 4J).

FIGURE 3. Comparison of the chicken MASP-3and human MASP1/3 loci. Homologous genes arejoined by dashed lines, and arrowheads indicate the di-rection of transcription. This figure is not to scale.

Table III. Structure of the chicken MASP2 gene

Exon EncodesSize(bp)

CodonPhase

Next Intron(bp)

1 5� UT and ATG 57 II 2702 Signal peptide and CUBI 220 0 13693 CUBI 178 I 1934 EGF-like 132 I 14375 Stop codon and 3� UT of MAp19 183 NAa 46116 CUBII 197 0 5597 CUBII 145 I 5548 CCPI 119 0 9979 CCPI 79 I 311

10 CCPII 141 I 40111 CCPII 72 I 78212 Serine protease 1091 NAa

a NA, not applicable.

5002 LECTIN PATHWAY IN G. gallus

by guest on March 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

In humans, rats, and mice, MASP-1 expression is liver specific,whereas MASP-3 is expressed in the liver and in nonhepatic tis-sues, including the spleen, lung, small intestine, thymus, and brain

(Fig. 4, F and G) (N. J. Lynch, unpublished observations). In day12 chicken embryos, MASP-3 mRNA was detected by in situ hy-bridization in the liver, spleen, thymus, gizzard, mesonephros, andneuronal areas of the brain, but not in the lung. The same distri-bution and intensity of expression were observed using separatecRNA probes for the A and B chains of MASP-3 (Fig. 4, C and D).This result underlines the findings of the Northern blot analysis,showing that no evidence for a MASP-1-like transcript can befound.

This is also confirmed by the results obtained by qRT-PCR anal-ysis of adult chicken tissues: MASP-3 expression was most abun-dant in the liver, followed by spleen, kidney, tonsil, duodenum,and brain. Again, using a combination of oligonucleotides thatamplifies mRNA sequences specific for either the A chain or the Bchain shows that identical abundances for MASP-3 A chain- andMASP-3 B chain-encoding mRNAs were detected and providedno evidence for the presence of a MASP-1-like transcript. More-over, the amount of A and B chain message was identical in alltissues tested (Fig. 6).

Northern blot analysis using separate probes for the A and Bchains of MASP-3 revealed a single 3.7-kb message in chickenliver, reinforcing the evidence that the MASP-1 transcript is miss-ing (Fig. 7, first lane). This is in contrast to what was seen inmammals, where both MASP-3 and MASP-1 mRNA transcriptswere detected (Fig. 7, upper last lane) (20). Analyzing liver

FIGURE 6. The qRT-PCR analysis of MASP-3 expression in adultchicken tissues. cDNA was prepared from the tissues indicated and wasanalyzed by real-time PCR using a LightCycler instrument. Results shownare copies per microgram of RNA and are the means of four separateexperiments (two cDNA syntheses per sample, two analyses per cDNA).Error bars represent the SD.

FIGURE 4. Localization of lectin pathway mRNAs by in situ hybrid-ization. Cryostat sections (20 �m) were hybridized with 35S-labeled cRNAprobes and exposed to Kodak BioMax MR film for 48 h. A–D, Day 12chicken embryos hybridized with antisense probes for: MASP-2 B chain,MAp19, MBL, MASP-3 A chain, and MASP-3 B chain. E, Control sectionhybridized with a sense probe for MBL. F and G, Day 19 rat embryoshybridized with antisense probes for the B chains of MASP-1 andMASP-3. H, Control section hybridized with a sense probe for MASP-1 Bchain. I and J, In situ hybridization results for chicken embryo sectionsobtained with antisense probes specific for the chicken lectin pathway rec-ognition molecules MBL (I) and ficolin (J).

FIGURE 5. Expression of MASP-2 and MAp19 mRNA in chickenliver. Northern blots, prepared from chicken liver RNA, were hybridizedwith cDNA probes corresponding to the A chain (A) and the B chain (B)of MASP-2.

5003The Journal of Immunology

by guest on March 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

mRNA from other birds (including turkey, duck, goose, ostrich,and pigeon) on Northern blots suggested that the absence ofMASP-1 may be a general phenomenon in birds (Fig. 7).

Enzymatic activity of MBL-MASP complexes in avian sera

We tested the enzymatic activity of MBL-MASP complexes cap-tured from chicken and turkey sera. Serum samples were diluted ina high salt buffer, which dissociates C1, thus avoiding interferencefrom the classical pathway serine proteases, C1r and C1s (40). Thediluted sera were added to ELISA plates coated with mannan, apolysaccharide that binds MBL-MASP complexes, then the boundcomplexes were assayed for MASP-1 and MASP-2. MASP-1-likeactivity was measured using the fluorescent substrate, Val-Pro-Arg-7-AMC, which is cleaved by MASP-1, but not by MASP-2(42). The activity of MASP-2 was measured by following thecleavage of human C4.

MASP-1-like activity could be detected in MBL-MASP com-plexes from human serum, which was included as a control, butnot in the avian sera, whereas MASP-2-like activity was present inall sera tested (Fig. 8). Subsequent experiments showed that MBL-MASP complexes from goose and ostrich sera also lack MASP-1-like enzymatic activity (data not shown).

DiscussionMost vertebrates have three or four different lectin pathway rec-ognition molecules, with differing, but overlapping, carbohydratespecificities that allow them to recognize a broad spectrum of mi-crobial polysaccharides. The recognition molecules form com-plexes with three MASPs and MAp19 (the truncated, nonenzy-

matic form of MASP-2). Only one of these molecules haspreviously been reported in the chicken, namely MBL. In thisstudy we present the most complete description of the lectin path-way in the chicken to date.

Laursen et al. (31) cloned the cDNA for chicken MBL and(based on a phylogenetic comparison of its deduced amino acidsequence with those of its mammalian homologues) concluded thatit represents an undiversified ancestor of the two different forms ofMBL found in mammals. Our findings support their conclusion;the chicken has a single MBL gene located on chromosome 6.Genomic analysis showed that it is more closely related to MBL1,Mbl1, and MABA-RAT than to MBL2, Mbl2, and MABC_RAT, sug-gesting that the first group represents the common ancestor. Like-wise, the chicken has a single ficolin gene that appears to representan undiversified ancestor of FCN1 and FCN2. It is not particularlysurprising that the chicken has so few lectin pathway recognitionmolecules; the gene duplications that lead to the diversification ofMBL and the ficolins were relatively recent evolutionary events(1), and such chromosomal rearrangements are thought to occurmuch more slowly in birds (and reptiles) than in mammals or am-phibians (46, 47). Interestingly, chicken C1q (the recognition mol-ecule of the classical pathway) appears to be a homotrimer, en-coded by a single gene on chromosome 21. In this respect, it ismore closely related to the ancestral form found in the lampreythan to mammalian C1q, which is a heterotrimer of three differentpolypeptides encoded by three separate genes (48).

The serine proteases found in the classical and lectin pathwayactivation complexes can be divided into two evolutionary groups:the ancestral TCN type (which includes MASP-1 and the ascidianMASPs) has a TCN codon for the serine in its catalytic triad andsplit exons for the protease domain, whereas the AGY type (whichincludes MASP-2, MASP-3, and C1s) uses AGY to encode itsactive serine and has a single exon for the protease domain (49).The AGY type evolved after, and appears to be derived from, thegene rearrangement that gave rise to the alternatively splicedMASP-1/3 gene (1, 21).

As expected, chicken MASP-2 is an AGY-type serine protease.Its primary structure shows 54% identity with those of human andmouse MASP-2. The organization of its gene is highly conserved;the intron-exon structure and codon phases are identical with thoseof the human and mouse genes (Tables II and III). As in otherspecies, chicken MAp19 is an alternatively spliced product of theMASP-2 gene. It is slightly unusual in that it lacks the four-residueC-terminal extension found in mammalian MAp19 (22–24). In

FIGURE 7. Expression of MASP-3 mRNA in the livers of differentbirds. Poly(A)� mRNA was prepared from the species indicated and an-alyzed by Northern blotting. Blots were hybridized with �-32P-labeledcDNA probes corresponding to the A chain (A) and the B chain (B; serineprotease domain) of chicken MASP-3. As a control, rat liver RNA washybridized with the corresponding rat-specific probes encoding either the Aor B chain of rat MASP-3 (right lanes). Distinct signals for MASP-1 (5 kb)and MASP-3 (3.5 kb) were seen using the A chain probe.

FIGURE 8. Enzymatic activity of MBL-MASP complexes from humanand avian sera. Mannan-coated microtiter plates were used to captureMBL-MASP complexes from serum. The immobilized complexes wereassayed for MASP-1-like activity using the fluorescent substrate Val-Pro-Arg-7-AMC. To assay MASP-2, human C4 was added to the plates, and thedeposition of C4b was measured. Results shown are percentages of the activitymeasured in human serum and are the means of duplicate determinations.

5004 LECTIN PATHWAY IN G. gallus

by guest on March 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

mammals these four residues (EQSL) are encoded by exon 5,which is unique to MAp19; in the chicken, exon 5 encodes only thethird nucleotide of the last residue (which is identical with that ofMASP-2), the stop codon, and the 3�UT region.

MASP-3 is the most highly conserved protein in the activationcomplexes; the primary structure of the chicken MASP-3 is �75%identical with those of the human, mouse, and Xenopus proteins.Its expression is more widespread than that of the other lectinpathway components; significant amounts of MASP-3 mRNA arepresent in liver, spleen, thymus, neuronal tissue, and gastrointes-tinal tissues, not only in chickens, but also in mice, rats and hu-mans (Figs. 4 and 6) (N. J. Lynch, unpublished observations). Incontrast, the messages for MASP-1, MASP-2, and MAp19 mRNAare restricted to the liver in all species investigated to date, andthose for MBL and the plasma ficolins are mainly expressed in theliver (2, 20, 24, 45). The conservation of MASP-3 and its uniqueexpression pattern suggest that its function may be decidedly dif-ferent from those of the other lectin pathway components.

The 5� end of the chicken MASP-3 gene is similar to those ofthe mammalian MASP-1/3 genes and the Xenopus MASP1/3agene; 10 exons encoding the A chain precede a single (AGY-type)exon that encodes the serine protease domain. However, the mam-malian genes have an additional six exons that encode the (TCN-type) MASP-1 serine protease domain. In the chicken these exonsappear to have been lost as a result of translocation and simultaneousor subsequent deletion that removed not only the MASP-1-specificexons, but also the chicken homologues of TM7L_HUMAN andRPL39L (Fig. 3). We found four separate pieces of evidence indicat-ing that MASP-1 is absent in the chicken. 1) There are no MASP-1-specific exons, either 3� of MASP-3 gene or elsewhere the in thechicken genome. 2) Northern blots hybridized with a probe for the Achain of MASP-3 show a single mRNA species; two messages wouldbe expected if the chicken had an alternatively spliced MASP-1/3gene. 3) Similarly, qRT-PCR showed that the amount of MASP-3 Achain-encoding message is approximately equal to that of the B chain-encoding message in all tissues examined. If a second (MASP-1-like)message were present, we would expect the relative abundance of thecommon A chain to be greater than that of the MASP-3 B chain, atleast in the liver. 4) No MASP-1-like proteolytic activity could bedetected in MBL-MASP complexes from chicken serum. Moreover,we extended the Northern blot analysis and the analysis of enzymaticactivity of MBL-MASP complexes to include other birds and ob-tained similar results, suggesting that MASP-1 might be absent in allAves. The loss of the MASP-1 exons must have occurred after diver-sification of Reptilia and Mammalia, but might well predate the com-mon ancestor of Crocodilia and Aves. In this context, it would beinteresting to investigate whether the absence of MASP-1 extends toCrocodilia and perhaps other Reptilia.

Despite the apparent absence of MASP-1, chickens have func-tional MBL-MASP complexes that cleave C4, a finding that rein-forces the evidence that MASP-1 is not essential for downstreamcomplement activation (17). Nevertheless, given that MASP-1 hasbeen conserved throughout evolution, ranging from tunicates tomammals, it seems likely that MASP-1 fulfills a biological func-tion of which we are presently not aware.

AcknowledgmentsWe are most grateful to Dr. Gennadij Raivich (Center for Perinatal BrainProtection and Repair, University College London, U.K.) for providingchicken embryos, Dr. Karsten Skjoedt (Department of Medical Microbi-ology, University of Southern Denmark, Odense, Denmark) for providinga chicken liver cDNA library, and Drs. Robert B. Sim (Medical ResearchCouncil Immunochemistry Unit, University of Oxford, Oxford, U.K.) and

Jim Kaufman (Institute for Animal Health, Compton, U.K.) for kind at-tention and most valuable comments on the manuscript.

DisclosuresThe authors have no financial conflict of interest.

References1. Fujita, T. 2002. Evolution of the lectin-complement pathway and its role in innate

immunity. Nat. Rev. Immunol. 2:346.2. Holmskov, U., S. Thiel, and J. C. Jensenius. 2003. Collections and ficolins: hu-

moral lectins of the innate immune defense. Annu. Rev. Immunol. 21:547.3. Fujita, T., M. Matsushita and Y. Endo. 2004. The lectin-complement pathway: its

role in innate immunity and evolution. Immunol. Rev. 198:185.4. Super, M., S. Thiel, J. Lu, R. J. Levinsky, and M.W. Turner. 1989. Association

of low levels of mannan-binding protein with a common defect of opsonisation.Lancet 2:1236.

5. Summerfield, J. A., S. Ryder, M. Sumiya, M. Thursz, A. Gorchein, M. A. Monteil,and M. W. Turner. 1995. Mannose binding protein gene mutations associated withunusual and severe infections in adults. Lancet 345:886.

6. Summerfield, J. A., M. Sumiya, M. Levin, and M. W. Turner. 1997. Associationof mutations in mannose binding protein gene with childhood infection in con-secutive hospital series. Br. Med, J. 314:1229.

7. Peterslund, N. A., C. Koch, J. C. Jensenius, and S. Thiel. 2001. Associationbetween deficiency of mannose-binding lectin and severe infections after che-motherapy. Lancet 358:63738.

8. Neth, O., I. Hann, M. W. Turner, and N. J. Klein. 2002. Deficiency of mannose-binding lectin and burden of infection in children with malignancy: a prospectivestudy. Lancet 358:61418.

9. Ikeda, K., T. Sannoh, N. Kawasaki, T. Kawasaki, and I. Yamashina. 1987. Serumlectin with known structure activates complement through the classical pathway.J. Biol. Chem. 262:7451.

10. Matsushita, M., and T. Fujita. 1992. Activation of the classical complement path-way by mannose-binding protein in association with a novel C1s-like serineprotease. J. Exp. Med. 176:1497.

11. Matsushita, M., Y. Endo, and T. Fujita. 2000. Cutting edge: complement-acti-vating complex of ficolin and mannose-binding lectin-associated serine protease.J. Immunol. 164:2281.

12. Matsushita, M., M. Kuraya, N. Hamasaki, M. Tsujimura, H. Shiraki, andT. Fujita. 2002. Activation of the lectin complement pathway by H-ficolin(Hakata antigen). J. Immunol. 168:3502.

13. Sato, T., Y. Endo, M. Matsushita, and T. Fujita. 1994. Molecular characterizationof a novel serine protease involved in activation of the complement system bymannose-binding protein. Int. Immunol. 6:665.

14. Takayama, Y., F. Takada, A. Takahashi, and M. Kawakami. 1994. A 100-kDaprotein in the C4-activating component of Ra-reactive factor is a new serineprotease having module organization similar to C1r and C1s. J. Immunol.152:2308.

15. Thiel, S., T. Vorup-Jensen, C. M. Stover, W. Schwaeble, S. B. Laursen,K. Poulsen, A. C. Willis, P. Eggleton, S. Hansen, U. Holmskov, et al. 1997. Asecond serine protease associated with mannan-binding lectin that activates com-plement. Nature 386:506.

16. Dahl, M. R., S. Thiel, M. Matsushita, T. Fujita, A. C. Willis, T. Christensen,T. Vorup-Jensen, and J. C. Jensenius. 2001. MASP-3 and its association withdistinct complexes of the mannan-binding lectin complement activation pathway.Immunity 15:127.

17. Vorup-Jensen, T., S. V. Petersen, A. G. Hansen, K. Poulsen, W. Schwaeble,R. B. Sim, K. B. Reid, S. J. Davis, S. Thiel, and J. C. Jensenius. 2000. Distinctpathways of mannan-binding lectin (MBL)- and C1-complex autoactivation re-vealed by reconstitution of MBL with recombinant MBL-associated serine pro-tease-2. J. Immunol. 165:2093.

18. Rossi, V., S. Cseh, I. Bally, N. M. Thielens, J. C. Jensenius, and G. J. Arlaud.2002. Substrate specificities of recombinant mannan-binding lectin-associatedserine proteases-1 and -2. J. Biol. Chem. 276:40880.

19. Schwaeble, W. J., M. R. Dahl, S. Thiel, C. M. Stover, and J. C. Jensenius. 2002.The mannan-binding lectin-associated serine proteases (MASPs) and MAp19:four components of the lectin pathway activation complex encoded by two genes.Immunobiology 205:455.

20. Stover, C. M., N. J. Lynch, M. R. Dahl, S. J. Hanson, M. Takahashi,M. Frankenberger, L. Ziegler-Heitbrock, I. Eperon, S. Thiel, andW. J. Schwaeble. 2003. Murine serine proteases MASP-1 and MASP-3, compo-nents of the lectin pathway activation complex of complement, are encoded by asingle structural gene. Genes Immun. 4:374.

21. Endo, Y., M. Nonaka, H. Saiga, Y. Kakinuma, A. Matsushita, M. Takahashi,M. Matsushita, and T. Fujita. 2003. Origin of mannose-binding lectin-associatedserine protease (MASP)-1 and MASP-3 involved in the lectin complement path-way traced back to the invertebrate, amphioxus. J. Immunol. 170:4701.

22. Takahashi, M., Y. Endo, T. Fujita, and M. Matsushita. 1999. A truncated form ofmannose-binding lectin-associated serine protease (MASP)-2 expressed by alter-native polyadenylation is a component of the lectin complement pathway. Int.Immunol. 11:859.

23. Stover, C. M., S. Thiel, M. Thelen, N. J. Lynch, T. Vorup-Jensen, J. C. Jensenius,and W. J. Schwaeble. 1999. Two constituents of the initiation complex of themannan-binding lectin activation pathway of complement are encoded by a singlestructural gene. J. Immunol. 162:3481.

5005The Journal of Immunology

by guest on March 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

24. Stover, C. M., S. Thiel, N. J. Lynch, and W. J. Schwaeble. 1999. The rat andmouse homologues of MASP-2 and MAp19, components of the lectin activationpathway of complement. J. Immunol. 163:6848.

25. Sahin, O., T. Y. Morishita, and Q. Zhang. 2002. Campylobacter colonization inpoultry: sources of infection and modes of transmission. Anim. Health Res. Rev.3:95.

26. Guan, Y., J. S. Peiris, A. S. Lipatov, T. M. Ellis, K. C. Dyrting, S. Krauss,L. J. Zhang, R. G. Webster, and K. F. Shortridge. 2002. Emergence of multiplegenotypes of H5N1 avian influenza viruses in Hong Kong SAR. Proc. Natl. Acad.Sci. USA 99:8950.

27. Davison, T. F. 2003. The immunologists’ debt to the chicken. Br. Poult. Sci. 44:6.28. Ohta, H., Y. Yoshikawa, C. Kai, K. Yamanouchi, H. Taniguchi, K. Komine,

Y. Ishijima, and H. Okada. 1986. Effect of complement depletion by cobra venomfactor on fowlpox virus infection in chickens and chicken embryos. J. Virol.57:670.

29. Barta, O., and N. L. Hubbert. 1978. Testing of hemolytic complement compo-nents in domestic animals. Am. J. Vet. Res. 39:1303.

30. Kjalke, M., K. G. Welinder, and C. Koch. 1993. Structural analysis of chickenfactor B-like protease and comparison with mammalian complement proteinsfactor B and C2. J. Immunol. 151:4147.

31. Hansen, S., and U. Holmskov. 1998. Structural aspects of collectins and receptorsfor collectins. Immunobiology 199:165.

32. Laursen, S. B., T. S. Dalgaard, S. Thiel, B. L. Lim, T. V. Jensen, H. R. Juul-Madsen,A. Takahashi, T. Hamana, M. Kawakami, and J. C. Jensenius. 1998. Cloning andsequencing of a cDNA encoding chicken mannan-binding lectin (MBL) and com-parison with mammalian analogues. Immunology 93:421.

33. Laursen, S. B., J. E. Hedemand, O. L. Nielsen, S. Thiel, C. Koch, andJ. C. Jensenius. 1998. Serum levels, ontogeny and heritability of chicken mannan-binding lectin (MBL). Immunology 94:587.

34. Laursen, S. B., and O. L. Nielsen. 2000. Mannan-binding lectin (MBL) in chick-ens: molecular and functional aspects. Dev. Comp. Immunol. 24:85.

35. Sambrook, J., E. F. Frisch, and T. Maniatis. 1989. Molecular Cloning; A Labo-ratory Manual. Cold Spring Harbor Laboratory Press, Plainview.

36. Melton, D. A., P. A. Krieg, M. R. Rebagliati, T. Maniatis, K. Zinn, andM. R. Green. 1984. Efficient in vitro synthesis of biologically active RNA andRNA hybridization probes from plasmids containing a bacteriophage SP6 pro-moter. Nucleic Acids Res. 12:7035.

37. Schafer, M. K., J. P. Herman, and S. J. Watson. 1992. In situ hybridizationimmunohistochemistry. In: Imaging Drug Action in the Brain. E. D. London, ed.CRC Press, Boca Raton, p. 337.

38. Wittwer, C. T., M. G. Herrmann, A. A. Moss, and R. P. Rasmussen. 1997.Continuous fluorescence monitoring of rapid cycle DNA amplification. BioTech-niques 22:130.

39. Ririe, K. M., R. P. Rasmussen, and C. T. Wittwer. 1997. Product differentiationby analysis of DNA melting curves during the polymerase chain reaction. Anal.Biochem. 245:154.

40. Petersen, S. V., S. Thiel, L. Jensen, R. Steffensen, and J.C. Jensenius. 2001. Anassay for the mannan-binding lectin pathway of complement activation. J. Im-munol. Methods 257:107.

41. Lynch, N. J., S. Roscher, T. Hartung, S. Morath, M. Matsushita, D. N. Maennel,M. Kuraya, T. Fujita, and W. J. Schwaeble. 2004. L-ficolin specifically binds tolipoteichoic acid, a cell wall constituent of Gram-positive bacteria, and activatesthe lectin pathway of complement. J. Immunol. 172:1198.

42. Presanis, J. S., K. Hajela, G. Ambrus, P. Gal, and R. B. Sim. 2003. Differentialsubstrate and inhibitor profiles for human MASP-1 and MASP-2. Mol. Immunol.40:921.

43. Stover, C., Y. Endo, M. Takahashi, N. J. Lynch, C. Constantinescu,T. Vorup-Jensen, S. Thiel, H. Friedl, T. Hankeln, R. Hall, et al. 2001. The humangene for mannan-binding lectin-associated serine protease-2 (MASP-2), the ef-fector component of the lectin route of complement activation, is part of a tightlylinked gene cluster on chromosome 1p36.2–3. Genes Immun. 2:119.

44. Stover, C. M., N. J. Lynch, S. J. Hanson, M. Windbichler, S. G. Gregory, andW. J. Schwaeble. 2004. Organization of the MASP2 locus and its expressionprofile in mouse and rat. Mamm. Genome. 15:887.

45. Wagner, S., N. J. Lynch, W. Walter, W. J. Schwaeble, and M. Loos. 2003.Differential expression of the murine mannose-binding lectins A and C in lym-phoid and nonlymphoid organs and tissues. J. Immunol. 170:1462.

46. Burt, D. W., C. Bruley, I. C. Dunn, C. T. Jones, A. Ramage, A. S. Law,D. R. Morrice, I. R. Paton, J. Smith, D. Windsor, et al. 1999. The dynamics ofchromosome evolution in birds and mammals. Nature 402:411.

47. International Chicken Genome Sequencing Consortium. 2004. Sequence andcomparative analysis of the chicken genome provide unique perspectives on ver-tebrate evolution. Nature 432:695.

48. Matsushita, M., A. Matsushita, Y. Endo, M. Nakata, N. Kojima, T. Mizuochi, andT. Fujita. 2004. Origin of the classical complement pathway: lamprey orthologueof mammalian C1q acts as a lectin. Proc. Natl. Acad. Sci. USA 101:10127.

49. Endo, Y., M. Takahashi, M. Nakao, H. Saiga, H. Sekine, M. Matsushita,M. Nonaka, and T Fujita. 1998. Two lineages of mannose-binding lectin-asso-ciated serine protease (MASP) in vertebrates. J. Immunol. 161:4924.

5006 LECTIN PATHWAY IN G. gallus

by guest on March 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from