Upload
others
View
5
Download
0
Embed Size (px)
Citation preview
University of IowaIowa Research Online
Theses and Dissertations
Fall 2009
CrdA regulates endogenous beta-lactamase activityin Myxococcus xanthusDi LiUniversity of Iowa
Copyright 2009 Di Li
This thesis is available at Iowa Research Online: https://ir.uiowa.edu/etd/398
Follow this and additional works at: https://ir.uiowa.edu/etd
Part of the Microbiology Commons
Recommended CitationLi, Di. "CrdA regulates endogenous beta-lactamase activity in Myxococcus xanthus." MS (Master of Science) thesis, University ofIowa, 2009.https://doi.org/10.17077/etd.wq35fgd0
CRDA REGULATES ENDOGENOUS BETA-LACTAMASE ACTIVITY IN
MYXOCOCCUS XANTHUS
by
Di Li
A thesis submitted in partial fulfillment of the requirements for the Master of
Science degree in Microbiology in the Graduate College of
The University of Iowa
December 2009
Thesis Supervisor: Associate Professor John R. Kirby
Graduate College The University of Iowa
Iowa City, Iowa
CERTIFICATE OF APPROVAL
_______________________
MASTER'S THESIS
_______________
This is to certify that the Master's thesis of
Di Li
has been approved by the Examining Committee for the thesis requirement for the Master of Science degree in Microbiology at the December 2009 graduation.
Thesis Committee: ___________________________________ John R. Kirby, Thesis Supervisor
___________________________________ Alexander R. Horswill
___________________________________ Craig D. Ellermeier
TABLE OF CONTENTS
LIST OF TABLES............................................................................................................. iii
LIST OF FIGURES ........................................................................................................... iv
LIST OF ABBREVATIONS ............................................................................................. vi
CHAPTER
I. INTRODUCTION ............................................................................................1 Myxococcus xanthus and Two-component Signal Transduction......................1 NtrC Family Regulators....................................................................................2 Sporulation of M. xanthus and Beta-lactamase Activity ..................................4 Beta-lactam Resistance Mechanism .................................................................5 Chemosensory Systems in M. xanthus .............................................................7
II. MATERIALS AND METHODS ...................................................................17 Bacterial Strains, Plasmids and Media ...........................................................17 Construction of Mutants .................................................................................17 Growth and Development Phenotypes Analysis ............................................18 Assay for Beta-galactosidase and Beta-lactamase Activity............................18 Sonication and Heat Resistance Assay ...........................................................20 Protein Over-expression, Purification and Dialysis........................................20 Gel Shift Assay ...............................................................................................21
III. RESULTS.......................................................................................................24
In silico Analyis..............................................................................................24 crdA .........................................................................................................24 Beta-lactamases in M. xanthus ................................................................26
Affect of Ampicillin During Aggregation, Sporulation and Growth .............27 Developmental Phenotype Analysis........................................................27 Starvation-independent Sporulation Analysis .........................................28 Ampicillin Resistance Assay...................................................................29
crdA Regulates Beta-lactamase Activity ........................................................29 Specific Induction of Beta-lactamases ....................................................29 Non-specific Induction of Beta-lactamases.............................................30
Regulation of the che3 Cluster, crdS and crdA...............................................31 lacZ Expression from che3, cheB3,crdS and crdA Promters...................31 DNA-binding Assay of CrdA..................................................................33
IV. CONCLUSIONS AND FUTURE DIRECTIONS .........................................57
General Discussion .........................................................................................57 Model for CrdA ..............................................................................................59
REFERENCES ..................................................................................................................63
ii
LIST OF TABLES
Table
II.1. Strains and Plasmids Used in This Study ...............................................................22
II.2. Primers Used in This Study….................................................................................23
III.1. Numbers of Beta-lactamases in Different Organisms ............................................34
III.2. Sonication and Heat Resistance of Glycerol-induced Spores …............................35
III.3. Sonication and Heat Resistance of Ampicillin-induced DZ4513 cells...................36
iii
LIST OF FIGURES
Figure
I.1. Life Cycle of Myxococcus xanthus ...........................................................................9
I.2. The Classical Model of a Two-component Signal Transduction System...............10
I.3. Regulation of Transcription by NtrC......................................................................11
I.4. Promoters of the glnALG operon ............................................................................12
I.5. Positively and Negatively Regulated NtrCs ...........................................................13
I.6. Induction of Beta-lactamase ...................................................................................14
I.7. Chemotaxis and Chemosensory Systems ..............................................................15
I.8. Eight Chemosensory Gene Clusters in M. xanthus................................................16
III.1. Predicted Domains in crdA. ...................................................................................37
III.2. Alignment of CrdA and Its Homologs...................................................................38
III.3. Prediction of Coiled Coils in crdA.........................................................................39
III.4. Comparison of crdA-crdB gene neighborhoods in M. xanthus and Anaeromyxobacter Fw109-5.....................................................................................40
III.5. Structures of Beta-lactamases in M. xanthus .........................................................41
III.6. Beta-lactamase Expression Patterns during Development ....................................44
III.7. Affect of ampicillin on development of M. xanthus cells......................................45
III.8. Affect of ampicillin and EDTA on growth and development of M. xanthus cells ...........................................................................................................................46
III.9. Affect of ampicillin on growth of M. xanthus .......................................................47
III.10 Ampicillin-induced Sporulation ............................................................................48
III.11 Glycerol-induced Sporulation................................................................................49
III.12. Beta-lactamase Activity Induced by Ampicillin....................................................50
III.13. Induction of Beta-lactamase Activity by Glycerol and EDTA..............................51
III.14 lacZ Expression of the Promoters in WT and the crdA Mutant Background .......52
III.15 Solubility and Purity Analysis of CrdA................................................................55
iv
III.16 CrdA and crdAB Promoter-binding Assay ...........................................................56
IV.1. Model for Chemosensory Regulation of CrdA to Affect Cell Wall Stability .....62
v
vi
LIST OF ABBREVIATION
BLAST............................................................................. Basic local alignment search tool
BP…………………………………………………………………………………Base pair
BSA………………………………………………………………..bovine serium albumin
CF....................................................................................................................Clone-fruiting
CYE.................................................................................................... Casitone yeast extract
DMSO...........................................................................................……..Dimethyl sulfoxide
HK………………………………………………………………………....Histidine kinase
KU…….………………………………………..…………………………………Klett unit
PBP…….. ……………………………………………………....Penicillin-binding protein
PCR............................................................................................. Polymerase chain reaction
RR…………………………………………………………………..….Response regulator
TCST............................................................................Two-component signal transduction
1
CHAPTER I
INTRODUCTION
Myxococcus xanthus and Two-component Signal Transduction
Myxococcus xanthus is a rod-shaped, gram-negative bacterium, which has a life
cycle requiring interactions between individual cells. It is a model organism for studying
the genetic, biochemical, and mechanistic basis in prokaryotic multicellular structures.
When there are enough nutrients in the environment, cells grow vegetatively and swarm
as groups using type IV pili (TFP), which is referred to as S-motility, or as individuals,
which is called A-motility and explained by a slime extrusion model (Wall and Kaiser,
1999, Wolgemuth, 2002). When M. xanthus cells encounter prey bacteria, they move in
a coordinated manner and consume other bacteria efficiently (Berleman and Kirby, 2007,
Berleman et al., 2006, Berleman et al., 2008). When the prey or nutrients are not enough
to support the population, the M. xanthus cells begin to aggregate and form fruiting
bodies that contain environmentally resistant myxospores (Dworkin, 1963, Shimkets,
1999). Some reagents, such as glycerol, DMSO and antibiotics that interrupt
peptidoglycan synthesis, are able to induce starvation-independent sporulation even when
there are enough nutrients to support growth (Dworkin and Gibson, 1964, O'Connor and
Zusman, 1997). During starvation-independent sporulation, individual cells differentiate
into spores directly without aggregation. When the environment is appropriate,
myxospores germinate and the life cycle restarts (Fig I.1).
M. xanthus has a large number of signal transduction proteins, which enable it to
respond rapidly to all kinds of stimuli and survive in changing environmental conditions.
One class of the regulators is the two-component signal transduction (TCS) system. It
classically is comprised of a membrane-bound sensor histidine kinase (HK) and a cognate
response regulator (RR), which are usually located in the same operon. The HK is able to
sense an environmental stimulus such as osmolarity, sugars, or nitrogen, via its input
2
domain, and the resulting protein conformational change leads to auto-phosphorylation at
a conserved histidine residue in its transmitter domain (Mascher, 2006). This phosphoryl
group is then transferred to the conserved aspartate-containing receiver domain of the RR
(Fig I.2). Phosphorylation of the RR receiver domain usually modifies the activity of the
output domain, which is most frequently a helix–turn–helix DNA-binding domain
(Gooderham, 2008). The RR may control gene transcription, chemotaxis, methylation, or
other aspects of physiology (Stock, 2000).
NtrC Family Regulators
NtrC, which is also called NRI or GlnG, is a sigma54-dependent response
regulator. In Escherichia coli, NtrC and its cognate HK NtrB compose a TCS system,
which regulates nitrogen status of the cell. NtrB phosphorylates NtrC under nitrogen
limiting conditions and dephosphorylates NtrC under nitrogen-excess conditions (Jiang,
2000). The phosphorylated form of NtrC activates transcription of glnALG, nifA, and
other operons involved in nitrogen fixation and assimilation (Reitzer, 1985, Zhang,
2005).
NtrC family regulators are composed of receiver, AAA ATPase, and sequence-
specific DNA-binding domains. The receiver domain has a conserved aspartate which
can be phosphorylated by NtrB. The ATPase domain is able to interact with the sigma54
polymerase-DNA complex. The DNA-binding domain usually binds 100-150 bp
upstream of the promoter sequence. Some sequences have one binding site, whereas
others have two. Generally, when NtrC is unphosphorylated, two NtrC molecules form a
dimer and bind to a single binding site on the DNA. If there are two binding sites, two
dimers can interact with each other cooperatively, which appears to strengthen the
binding (Yang, 2004). When NtrC is phosphorylated, central domain-mediated
oligomerization is stimulated so that the structure of the ATPase active site becomes
complete (Lee, 2003). The hydrolysis of ATP is required for remodeling the sigma54
3
polymerase-DNA complex and initiates the transcription (Weiss, 1991, De, 2006) (Fig
I.3).
NtrC can also function as a repressor of transcription. It has been found that some
genes have both sigma54 and other sigma factor-dependent promoters, which are induced
under different conditions (Reitzer, 1985, Shiau, 1993, Kiupakis and Reitzer, 2002,
Zhang and Rainey, 2007, Schwab, 2007). For example, the ast operon in E.coli is
transcribed from sigma54-dependent promoter during exponential phase in glucose-
arginine minimal medium, and from the sigmaS-dependent promoter during stationary
phase in Luria-Bertani (LB) medium. These two types of transcription inhibit each other
and do not happen at the same time (Kiupakis and Reitzer, 2002). NtrC binding DNA
prevents start of transcription from the other promoter (Fig I.3) (Shiau, 1993, Yang, 2004,
Zhang and Rainey, 2007). The central domain of NtrC is not required for the repressing
function (Yang, 2004).
Auto-regulation of transcription of ntrC has been studied (Reitzer, 1985,
Magasanik, 1989). In E. coli, glnA, which encodes glutamine synthetase, ntrB (glnL) and
ntrC (glnG) compose a glnALG operon (Fig I.4). There are two promoters in front of
glnA, which are glnAp1 and glnAp2. Another promoter, which is glnLp, is between glnA
and ntrB. Both glnAp1 and glnLp promote transcription by the sigma70 form of RNA
polymerase, which provides a basal level of production of GlnA, NtrB and NtrC. They
are inhibited by unphosphorylated NtrC under nitrogen excess condition. There are two
NtrC binding sites in front of glnA and one in front of ntrB. When nitrogen is limited,
NtrC is phosphorylated by NtrB, and then activate transcription of glnALG from glnAp2
and glnLp, which enhances the protein level of GlnA, NtrB and NtrC.
NtrC family regulators can be divided into two groups: positively regulated and
negatively regulated (Fig I.5), considering the function of the receiver domain. If
phosphorylation of the receiver domain facilitates ATPase assembly, the group is
positively regulated by the receiver domain, such as NtrC from Salmonella enterica
4
Serovar Typhimurium (Lee, 2000). If the unphosphorylated status represses ATPase
assembly, the NtrC family is negatively regulated by the receiver domain, such as NtrC1
from Aquifex aeolicus (Doucleff, 2005, Lee, 2003). In general, there are three differences
between the structures of these two groups of proteins. Negatively regulated proteins
have (1) a GHG motif (2) a coiled-coil linker between the receiver domain and the central
domain, and (3) a shorter linker between the central domain and DNA-binding domain
(C-D linker) compared to that in positively regulated ones (Doucleff, 2005).
Sporulation of M. xanthus and Beta-lactamase Activity
As mentioned above, there are two types of sporulation in M. xanthus: starvation-
dependent and starvation-independent. In the laboratory, starvation-dependent
sporulation is induced by spotting cell suspension on low nutrient plates (CF plates).
Starvation-independent sporulation is induced by incubating cells in rich media
containing reagents, such as glycerol, DMSO, etc. Antibiotics which affect peptidoglycan
synthesis or assembly (ampicillin and cephalosporins), are all able to induce the
starvation-independent sporulation, while those that may inhibit translation and DNA
replication do not (neomycin and novobiocin) (O’Connor, 1997). It suggests that damage
to the peptidoglycan induces starvation-independent sporulation. The peptidoglycan layer
is degraded during the transition from vegetative cells to glycerol-induced myxospores.
Newly constructed spherical coat contains no muropeptides, and has different protein
expression patterns compared to that in fruiting bodies (Downard, 1985, McCleary, 1991,
Bui, 2009), which may be the reason why glycerol spores are less resistant to sonication
and heat.
Some M. xanthus mutants are only defective in one type of sporulation. For
example, asgA and csgA mutants can form spores induced by glycerol but not starvation
(LaRossa, 1983). An early study isolated glc mutants, which cannot form glycerol spores.
Some of them still sporulate well during starvation (Burchard, 1975). The Omega7536
5
mutant, a transposon insertion in a gene encoding a chain length determinant protein
homolog, cannot change from rod to sphere under both conditions (Licking, 2000), which
suggests that these two types of sporulation use different pathways yet share some
common steps.
Sporulation occurring through starvation-dependent and independent pathways is
accompanied by an increase in endogenous beta-lactamase activities. Agents that induce
glycerol spores also induce beta-lactamase. Beta-lactamase activity peaks when the cells
change from rod to sphere (O’Connor, 1997). However, the role of beta-lactamases in
sporulation remains unclear. It is possible that beta-lactamase plays a role in restructuring
the cell wall during morphogenesis, or it is induced by signals which also induce
sporulation.
Beta-lactam Resistance Mechanism
Beta-lactam antibiotics can bind penicillin-binding proteins (PBP) to prevent
them from cross-linking the nascent peptidoglycan layer, an important part of cell wall
structure (Zapun, 2008). Beta-lactamases are enzymes which are able to deactivate beta-
lactam antibiotics like penicillins, cephalosporins, etc. There are currently more than 300
known beta-lactamases, which have been subdivided into four classes: A, B, C and D.
Class A, C and D have a serine active site. Class B is a metallo-enzyme which uses zinc
to catalyze hydrolysis of the beta-lactam ring.
Two beta-lactam resistance mechanisms have been developed by bacteria. Some
strains have evolved PBPs with low affinity for beta-lactams while some have
chromosomally-encoded beta-lactamases which are induced in the presence of certain
beta-lactams (Poole, 2004). The latter mechanism is dominant in gram-negative rod-
shaped bacteria (Livermore, 1995) (Fig I.6). Among gram-negative rods, the most widely
distributed beta-lactamases are AmpC homologs, which belong to class C beta-
lactamases. Generally, ampC is divergently transcribed from ampR, which encodes a
6
LysR-type global transcriptional regulator that activates the transcription of ampC (Kong,
2005). The activity of AmpR is regulated by muropeptides. ampC is negatively regulated
by AmpD, a N-acetyl-anhydromuramyl-L-alaline amidase, in the cytoplasm ((Lindberg,
1987, Langaee, 1998, Lee, 2009). During the bacterial life cycle, peptidoglycan is
consistently degraded. Degraded peptidoglycan is transported into the cytoplasm by a
permease AmpG, and then digested by AmpD and some other enzymes, such as Mpl,
LdcA, etc. Peptides, sugars, amino acids generated are used to construct new cell wall or
just as nutrients (Park and Uehara, 2008) It is believed that recycling intermediates, such
as UDP-MurNAc-pentapeptide, repress activation of ampC by inhibiting the activity of
AmpR. Recently, inactivation of PBP4 in Pseudomonas aeruginosa has been found to
activate the production of ampC, which is parallel from AmpD pathway (a defect in one
of them can be complemented by increasing the amount of the other). Both of them are
AmpR-dependent (Moya et al, 2009). It is considered that inactivation of PBP4 causes
accumulation of some kind of muropeptides, which activate AmpR. This study also found
that a CreBC/BlrAB two component system, which regulates ampC in Aeromonas
hydrophila (Niumsup, 2003, Avison, 2004), does not affect AmpC expression in P.
aeruginosa.
Compared to P. aeruginosa or A. hydrophila, which only has one ampC gene in
the chromosome, M. xanthus has 9 AmpC variants and 20 metallo-beta-lactamases, but
none of the ampC homologs are encoded next to an ampR homolog. Why beta-lactamase
activity is up-regulated during sporulation has not been studied yet. One possible
mechanism is that old peptidoglycan layer is degraded and new cell wall is constructed
during sporulation, so that the change of the amount of intermediate peptides may induce
the transcription of beta-lactamases. Why M. xanthus has such a large number of beta-
lactamases is also a mystery. Considering that beta-lactamases have similar structures as
penicillin-binding proteins, they may be able to interact with some kind of muropeptides
and play a role in sporulation. It is also possible that M. xanthus employs beta lactam
7
antibiotics to digest other prey bacteria so that it needs a large amount of beta-lactamase
to protect itself.
Chemosensory Systems in M. xanthus
Chemotaxis systems are used by bacteria to perceive environmental stimuli and
generate responses. The most well known chemotaxis system is that in E. coli and
regulates motility via flagellar rotation (Khan, 2000). The chemotaxis pathway makes use
of a phosphorelay to pass information through the methyl-accepting chemotaxis proteins
(MCPs) that serve as sensors and are coupled to the histidine kinase, CheA, through the
coupling protein CheW. The response regulator, CheY, interacts with the flagellar
switch, altering the direction of motor rotation. CheA also phosphorylates CheB, a
methylesterase, which is then activated and able to demethylate the MCPs. The system
contains a methyltransferase, CheR, which serves to adapt the system to the presence of
the stimulus in conjunction with CheB (Fig I.7). The steady state level of methylation
provides the cell with a primitive memory and is the hallmark feature of chemosensory
regulation. Without stimulus the cell executes a random walk by alternating runs and
tumbles. When a stimulus is provided, the walk becomes biased through the suppression
of tumbling. In order to remain in an area of optimal stimulus concentration the system
adapts through the actions of CheB and CheR on the MCP. This returns the system to the
pre-stimulus state and the cell begins a random walk even in the presence of a stimulus.
Some other chemotaxis genes are found in the genomes of other organisms, such as cheC
and cheD in Bacillus subtilis. CheC is a CheY-P phosphotase (Kirby, 2001) and CheD is
a chemoreceptor modification enzyme (Kristich, 2002).
The adaption module is not only employed to regulate motility, such as in E.coli,
Bacillus subtilis and Vibrio cholerae (Rao, 2008, Hyakutake, 2005), but also used to
regulate a variety of cell functions first discovered in M. xanthus (Kirby, 2003) (Fig I.7).
The latter system is called a chemosensory system, which differs from a chemotaxis
8
system in that genes other than the che genes are found within the operons. For example,
Rhodospirillum centenum has a chemosensory system that regulates timing of
differentiation (Berleman, 2005) and Pseudomonas aeruginosa has Wsp chemosensory
cluster, which is involved in biofilm formation (Hickman, 2005).
There are eight chemosensory systems in M. xanthus (Fig I.8). The Frz system
regulates reversal frequency of the cells while the Che4 system couples velocity and
reversal frequency when the cell is using type IV pilus (TFP) based motility (Blackhart,
1985, Vlamakis, 2004). The Dif system regulates exo-polysaccharide production, which
is required to stimulate TFP retraction (Yang, 2000). The Che3 system regulates
developmental gene expression (Kirby, 2003) and response to cell wall stress (Muller and
Kirby, unpublished data). The mRNA level of cheA3(the cheA kinase gene within the
che3 cluster) is up-regulated during development (Jakobsen, 2004), and the mcp3B (the
MCP gene within the che3 cluster) mutant is premature in development (Kirby, 2003).
The che3 operon does not have a CheY homolog. CrdA, a NtrC homolog, is known to be
the output of the Che3 system, because the crdA mutant and crdAmcp3B double mutant
show a delayed phenotype in development (Kirby, 2003). The Che5, Che6, Che7 and
Che8 systems have not yet been fully characterized, but are predicted to regulate
alternative cellular functions (Kirby, 2009).
9
Fig I.1. Life Cycle of Myxococcus xanthus. When there are enough nutrients, the cells are able to grow and swarm on a solid surface. They form rippling patterns while preying on other bacteria. If there are not enough nutrients, the cells aggregate and form fruiting bodies that contain myxospores. Fruiting bodies are also developed during predation. Cell wall stress can induce individual cells to sporulate without aggregation, even in rich media. The heat and sonication resistant spores are able to germinate and restart the life cycle when nutrients become available.
10
HK
RR
P
P
stimulus
RR inactive
active
Fig I.2. The Classical Model of a Two-component Signal Transduction System. The histidine kinase (HK) senses the external stimulus and autophosphorylates a histidine residue, the phosphoryl group (P) is then transferred to an aspartate residue on the response regulator (RR). Phosphorylated RR may control gene transcription, chemotaxis, methylation, or other aspects of physiology.
11
A
Transcriptional start site
Sigma54 binding sequenceNtrC Binding Sites
P PP
Complex of Sigma54
and RNA polymerase
B
Transcriptional start site
Complex of Sigma70 and RNA polymerase
Sigma70 binding site
Sigma54 binding sequenceNtrC Binding Sites
Fig I.3. Regulation of Transcription by NtrC. (A)Unphosphorylated NtrC forms dimers and binds to binding sites on the DNA. When NtrC is phosphorylated, central domain-mediated oligomerization is stimulated. NtrC oligomers interact with the sigma54 polymerase-DNA complex and initiate transcription. (B) When NtrC binding sites overlap with a sigma70 binding site, interaction between unphosphorylated NtrC and DNA represses transcription from sigma70.
12
glnAp1 glnAp2 glnLp1glnA
ntrB(glnL)
ntrC(glnG)
Sigma70 binding site NtrC binding site
Fig I.4. Promoters of the glnALG operon. Two promoters (glnAp1 and glnAp2) are in front of glnA. glnAp1 contains a sigma70 binding site. glnAp2 contains two NtrC binding sites. Another promoter, which is glnLp, is between glnA and ntrB. It has both sigma70 and NtrC binding sites. Under nitrogen excess condition, transcription is started from glnAp1 and glnLp by the sigma70 form of RNA polymerase to provide a basal level of production of GlnA, NtrB and NtrC. When nitrogen is limited, transcription is activated by phosphorylated NtrC from glnAp2 and glnLp.
13
PP
P P
Positive
Negative
GHG
Fig I.5. Positively and Negatively regulated NtrCs Positively regulated NtrCs form dimers via their DNA-binding domains. After being phosphorylated, the receiver domain interacts with the central domain, which helps form oligomers. The oligomeric form interacts RNA polymerase complex and initiates the transcription. Negatively regulated NtrCs form dimers tightly via their receiver domains, which contain a GHG motif, in the absence of phosphorylation. Binding inhibits the formation of oligomers. After being phosphorylated, the receiver domains induce a conformational change, which allows the interaction between central domains, so that oligomers can be formed, which results in activation of transcription.
14
Beta‐lactam drug
PBP
OM
IM
ampCAmpR
beta‐lactamase
peptidoglycanrecycling
AmpD
ampR
transcription regulator
energy
AmpG
muropeptides
Fig I.6. Induction of Beta-lactamase. ampC is divergently transcribed from ampR, which is a LysR-type global transcriptional regulator that activates transcription of ampC. When beta-lactam drugs penetrate into the periplasm, they bind penicillin-binding protein (PBP) to prevent synthesis of the peptidoglycan layer. Inactivation of PBPs up-regulates the transcription of ampC, which is AmpR-dependent, which may due to accumulation of some kind of muropeptides. AmpC is secreted into periplasm and deactivates beta lactam drugs. Components of peptidoglycan are transported into cytoplasm by a permease AmpG, and digested by a N-acetyl-anhydromuramyl-L-alaline amidase AmpD. The products are used to re-construct peptidoglycan or are consumed in other metabolic pathways. The muropeptide intermediates bind AmpR, which activates or inhibits the transcription of ampC.
15
Chemotaxis System
PP
CH3CH3
MCP
WCheR CheBCheA
motility
P
stimulus
CheY
PP
CH3CH3
MCP
WCheR CheBCheA
stimulus
Chemosensory System
motility other
RR RRP P
Fig I.7. Chemotaxis and Chemosensory Systems. In a typical chemotaxis system, the MCP senses the stimulus and interacts with the histidine kinase CheA and the coupling protein CheW. Conformational changes within the MCP induced by ligand binding leads to autophosphorylation of CheA. Phosphorylated CheA can phosphorylate the response regulators CheY and CheB. Phosphorylated CheY interacts with the flagellar motor, therefore affects the cell motility. CheR constitutively methylates the MCP while phosphorylated CheB demethylates the MCP. The methylation state of the MCP controls its ability to respond to attractants and repellents. The chemosensory system employs a similar pathway using other response regulators to control motility and other cell functions, such as gene expression.
16
Fig I.8. Eight Chemosensory Gene Clusters in M. xanthus. The color filled arrows represent chemotaxis homologs as annotated above the frz and dif clusters. The white arrows correspond to the non-chemotaxis homologs in the cluster. The small black arrows indicate the promoters.
17
CHAPTER II
MATERIALS AND METHODS
Bacterial Strains, Plasmids and Media
Bacterial strains and plasmids are listed in Table II.1. strains were grown in
Luria-Bertani broth at 37°C. . strains were grown at 32°C in Casitone Yeast
Extract (CYE) media (1% casitone, 0.5% yeast extract, 4 mM MgSO4, 10 mM Mops, pH
7.6) or agar (1.5%) plates. 100 ug/ml ampicillin (Amp), 100 ug/ml kanamycin (Km) or 10
ug/ml oxytetracycline (Tc) were used for selection. Development was assayed at 32°C
on Clone-fruiting (CF) (0.015% casitone, 1 mM potassium phosphate, 8 mM MgSO4, 1.5
mM (NH4)2SO4, 6.8 mM sodium citrate, 9.1 mM sodium pyruvate, 10 mM Mops, pH
7.6) agar (1.5%) plates.
Construction of Mutants
For construction of CrdA-expressing plasmids: the BamHI-HindIII fragment of
full-length was PCR amplified from the chromosome of wild-type strain
DZ2 and cloned into pUC18 and pQE80L to construct pDL162 and pDL180. pDL180 is
used in overexpression in . pDL162 served as the DNA template in mutagenesis. A
QuikChange site-directed mutagenesis kit (Stratagene) was used to mutate aspartate 53 in
to alanine or glutamate. Primers containing the mutation were used to amplify the
whole plasmid. Then the methylated parental DNA was digested by DpnI and the non-
methylated dsDNA containing the mutation was transformed into XL1-Blue competent
cells. Plasmids isolated from colonies on resulting plates were sequenced by the Nevada
Genomics Center to confirm the mutation. c fragments with or without the point
mutation were digested by BamHI and HindIII, and subcloned into pET28a. Then a
XbaI-BamHI fragment of promoter from bp -217 to 3 relative to its translational start
site, generated by PCR, was cloned into these plasmids. After that, the promoter and
fragments were digested from pET28a derivatives using XbaI and HindIII, and
E.coli
M xanthus
crdA M. xanthus
E. coli
crdA
rdA
pilA
pilA
crdA
18
subcloned into pWB300 to construct pDL336, pDL337 and pDL338.
For the construction of promoter-lacZ fusion plasmids: trpA-lacZ fragment was
digeste
transformed into M. xanthus strains
by elec
Growth and Development Phenotypes Analysis
For growth s cells were
harvest it
and
maging
Assay for Beta-galactosidase and Beta-lactamase activity
Sample ssay were
the sam
washed
d from pSM63 using EcoRI and HindIII, and inserted into pWB300 to construct
pDL323. Then different promoters were PCR amplified and cloned into pDL323, which
was digested by XbaI and EcoRI, or PvuI and XbaI.
Plasmids which are pWB300 derivatives were
troporation in a 0.2 cm cuvette at 25mF, 400Ω, 0.65kV (Xu, 2005). The pWB300
plasmid contains integrase and phage Mx8 attP attachment site. It is integrated at attB site
in the genome of M. xanthus by a mechanism of site-specific recombination. (Magrini,
1999) The integration was confirmed by PCR. All the primers used for construction were
synthesized by Integrated DNA Technologies. The sequences are listed in table II.2.
and development phenotypes observation, M. xanthu
ed from liquid CYE culture when the density was between 100 – 150 Klett Un
(KU). Cells were washed by water twice, and concentrated to 200 KU. 10 ul of the
resulting cell suspension was spotted on CYE or CF plates with appropriate reagents
allowed to dry at room temperature. Plates were incubated at 32°C for 48 hours.
Photographs were taken using a Nikon SMZ1500 dissecting microscope with Q-I
camera and software.
preparation for beta-galactosidase assay and beta-lactamase a
e. M. xanthus cells were harvested from liquid culture and concentrated to 500
KU. 200 ul of the resulting cell suspension was plated on the entire plate. After
incubation at 32oC for the time indicated, cells were scraped from the plates and
by water once, then re-suspended in the working buffer to be assayed later (Kirby, 2003).
Alternatively cells were harvested from liquid culture and concentrated to 200 KU. 500 ul
19
of the resulting cells was centrifuged and resuspended in the working buffer.
Cells in the working buffer were then sonicated using a Branson sonifier 150 set
at inten
ant was
sample supernatant was measured using the Bio-Rad
protein
or the beta-galactosidase activity assay, the working buffer was Z buffer (0.85%
Na2HP
on
amase activity assay, the working buffer was 0.1 M phosphate
buffer. in
x
sity 5 for 20 seconds or until the solution was clear. Sonicated cells were
centrifuged at 13,000 g for 5 min and the supernatant was collected. The supernat
used to determine the protein level and for the subsequent beta-galactosidase activity
assay or beta-lactamase assay.
The protein level of the
assay (Bio-Rad). 2-20 ul sample was added into 900 ul 1x dye reagent and
incubated for 5 minutes. Then the protein concentration was calculated by measured
OD585 using an Eppendorf Biophotometer (BSA was used to calculate the standard
curve).
F
O4, 0.55% NaH2PO4•H2O, 1 mM MgSO4, 10 mM KCl, pH 7.0). 10-100 ul sample
supernatant, 300 ul Z/BME buffer (Z buffer plus 0.05 M beta-mercaptoethanol), and 100
ul ONPG (4 mg/ml ONPG in Z buffer) were mixed together and incubated at 37oC. After
the solution became yellow, 500 ul of 1 M Na2CO3 was added into the reaction and the
time of incubation was recorded (Kirby, 2003). Then the OD420 was measured using
Nanodrop ND-1000 spectrophotometer. The beta-galactosidase specific activity was
calculated using the formula: 213 x OD420 / (sample volume (ml) x protein concentrati
(mg/ml) x time (min)).
For the beta-lact
20 ul sample was mixed with 1 ul nitrocefin stock solution (10 mg/ml nitrocefin
dimethylsulfoxide (DMSO) ), 1 ul EDTA (200 mM EDTA, pH 8.0), and 178 ul 0.1 M
phosphate buffer. The beta-lactamase activity was calculated using the formula: 228000
OD486 / (protein concentration (mg/ml) x time (min)) (King, 1980).
20
Sonication and Heat Resistance Assay
500 ul of 150 KU M. xanthus cells were incubated with reagents, such as EDTA
and/or ampicillin, for a period of time as indicated. Spores were collected and re-
suspended in 500 ul water. To test sonication resistance, samples were sonicated using a
Branson sonifier 150 set at intensity 4 for 30 seconds as previously described (Licking,
2000). To test heat resistance, samples were incubated in waterbath at 50oC for 2 h. After
sonication and heat treatment, spores were diluted 105 times and then mixed with 4 ml
CYE 0.7% agar, then plated on CYE plates. Seven days later, germinated colonies were
counted using an aCOLyte colony counter.
Protein over-expression, purification and dialysis
The E.coli strain containing plasmid pDL180 was grown in 25 ml LB broth at
37oC until the OD600 reached 0.4-0.6, then IPTG was added into the culture as the
inducer. After expressing at 32oC for 4 h, cells were lysed by adding Cell-Lytic Express
(Sigma) with shaking at room temperature for 20 minutes.
The transparent lysed cell solution was loaded to a polypropylene column (Pierce)
containing HIS-Select Nickel Affinity Gel (Sigma), which was pre-equilibrated with
equilibration buffer (50 mM Tris HCl, 0.3 M sodium chloride, 10 mM imidazole, pH
8.0), then washed with wash buffer (50 mM Tris HCl, 0.3 M sodium chloride, 20 mM
imidazole, pH 8.0) until the amount of the protein in the material eluting from the column
was very low and steady, which was measured using BioRad protein assay as mentioned
above. After that, the protein was eluted with elution buffer (50 mM Tris HCl, 0.3 M
sodium chloride, 250 mM imidazole, pH 8.0). Fractions were collected from the flow, run
on 12% polyacrylamide gel and stained with Coomassie Brilliant Blue to verify the size
and purity of the protein. The fraction having the highest protein amount was used for the
subsequent experiments.
1 ml purified CrdA was dialyzed in a dialysis cassette (BioRad ) in 1 L dialysis
21
buffer (50 mM Tris HCl pH 7.5, 50 mM KCl, 10 mM MgCl2, 1 mM CaCl2, 0.2 mM DTT,
50% Glycerol) at 40C overnight. The concentration of dialyzed CrdA was measured
using BioRad protein assay. To assay for the solubility of purified CrdA, 200 ul of
undialyzed and dialyzed CrdA were centrifuged at 100,000 g for 15 min. The supernatant
was removed and the pellet was resuspended in 200 ul elution buffer. After that, SDS-
PAGE was performed to detect the amount of CrdA in each fraction.
Gel Shift Assay
The gel shift assay was performed using the LightShift Chemiluminescent EMSA
kit (Pierce). DNA samples were generated by PCR using biotin 5’end-labeled primers
and cleaned by the PCR product purification kit (Qiagen). Each 20 ul reaction contains 2
ul 10x Binding Buffer (100 mM Tris, 500 mM KCl, 10 mM DTT; pH 7.5), 1 ul 50%
glycerol, 1 ul 2 mg/ml BSA, dialyzed CrdA , crdB promoter and DNA competitors. All
the reagents were mixed together and incubated at room temperature for 20 minutes, then
loaded to 5% native polyacrylamide gel in 0.5x TBE which had been pre-electrophoresed
for 30 minutes. Samples were run at 100 V until the bromophenol blue dye had migrated
to the bottom of the gel. After electrophoresis, samples were transferred to Nylon
membrane (Milipore) at 20 V for 30 minutes using a BioRad TRANS-BLOT SD semi-
dry transfer cell. The transferred DNA was cross-linked to membrane at 120 mJ/cm2
using a UV-light cross-linker (use the auto cross-link function twice). Biotin-labeled
DNA on the membrane was then detected by chemiluminescence according to
manufacturer’s instructions.
22
Table II.1. Strains and Plasmids used in This Study Strain or plasmid Relevant genotype Ref. M. xanthus strains DZ2 Wild Type Campos, 1975 DZ4513 DZ2 crdA::pJK412, KmR Kirby, 2003 JK1746 DZ4513 attB::pDL336, KmR, TcR This work JK1747 DZ4513 attB::pDL337, KmR, TcR This work JK1748 DZ4513 attB::pDL338, KmR, TcR This work JK1749 DZ2 attB::pWB300, TcR This work JK1750 DZ4513 attB::pWB300, KmR, TcR This work JK1751 DZ2 attB::pDL323, TcR This work JK1752 DZ2 attB::pDL418, TcR This work JK1753 DZ2 attB::pDL378, TcR This work JK1754 DZ2 attB::pDL381, TcR This work JK1755 DZ2 attB::pDL366, TcR This work JK1756 DZ4513 attB::pDL418, KmR, TcR This work JK1757 DZ4513 attB::pDL378, KmR, TcR This work JK1758 DZ4513 attB::pDL381, KmR, TcR This work JK1759 DZ4513 attB::pDL366, KmR, TcR This work E.coli strains
DH5a F- φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(rk-, mk+) phoAsupE44 thi-1 gyrA96 relA1 λ-
Invitrogen
XL1Blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F´ proAB lacIqZΔM15 Tn10 , TetR
Stratagene
BL21(DE3) F-ompT hsdSB dcm gal l(DE3) Stratagene Plasmid pUC18 Used for mutagenesis, AmpR Invitrogen pDL162 pUC18 with full-length crdA, AmpR This work pDL308 pUC18 with D to A mutation at bp 53 in crdA, AmpR This work pDL319 pUC18 with D to E mutation at bp 53 in crdA, AmpR This work pET28a Used for plasmid construction, KanR This work pDL313 pET28a with full-length crdA, KanR This work pDL320 pET28a with crdAD53A, KanR This work pDL321 pET28a with crdAD53E, KanR This work pDL330 pET28a with pilA promoter and crdA, KanR This work pDL331 pET28a with pilA promoter and crdAD53A, KanR This work pDL332 pET28a with pilA promoter and crdAD53E, KanR This work pWB300 Used for expression in M. xanthus, TcR Xu, 2005 pDL336 pWB300 with pilA promoter and crdA, TcR This work pDL337 pWB300 with pilA promoter and crdAD53A, TcR This work pDL338 pWB300 with pilA promoter and crdAD53E, TcR This work pQE80L Vector for protein expression in E.coli Qiagen pDL180 pQE80L with full-length crdA, AmpR This work pSM63 Plasmid offering trpA-lacZ fragment Mueller, 2006 pDL323 pWB300 with trpA-lacZ fragment, TcR This work pDL418 pWB300 with crdA promoter and trpA-lacZ fragment, TcR This work pDL378 pWB300 with crdS promoter and trpA-lacZ fragment, TcR This work pDL381 pWB300 with che3 promoter and trpA-lacZ fragment, TcR This work pDL366 pWB300 with cheB3 promoter and trpA-lacZ fragment, TcR This work
23
Table II. 2. Primers Used in This Study
Primers Sequence (5' - 3')
crdA fwd GGAAGGATCCATGCCCGCCGCCTCTGTCCTC
crdA rev GGAAAAGCTTTTACGACTCGGAGCTGCC
crdA D53A fwd CGCGGTGCTGATGGCCGTGAAGATGCCGG
crdA D53A rev CCGGCATCTTCACGGCCATCAGCACCGCG
crdA D53E fwd CGCGGTGCTGATGGAGGTGAAGATGCCGGAC
crdA D53E rev GTCCGGCATCTTCACCTCCATCAGCACCGCG
PpilA fwd GGAATCTAGAGGGAGCGCTTCGGA
PpilA rev GGAACATATGCATGGGGGTCCTCAGAGAAG
PcrdA fwd GGAACGATCGTCGGATAGGAAGGGGTGCAG
PcrdA rev GGAATCTAGACATCGACGATGAGGACAGAG
PcrdS fwd GGAATCTAGACTCAACAACCTGGGCCTCAC
PcrdS rev GGAAGAATTCTGATGAGCAGCCGCTTCGTC
Pche3 fwd GGAACGATCGTCTGATACCCCGCCAGTTGG
Pche3 rev GGAATCTAGAAGGTGTTCTCGGGAACCTGG
PcheB3 fwd GGAATCTAGACGTTCCAATCGCCATCGAAG
PcheB3 rev GGAAGAATTCAGATGAGGGAGTCATCGACC
attR fwd AAAAAAGCTTCCGGGCGGCCTTGCGGAATGAT
attR rev TCAGCGCTTCAGGTCCGGGACTGGGAC
PcrdAB fwd TCTGATACCCCGCCAGTTGG
PcrdAB rev TGTAGTCGTTGGCGTGTAGTC
asgB fwd GGAAGGTACCGCGCCATCCTGAAAATCTTCC
asgB rev GGAATCTAGACTGCTTCACTTCCGACATGTC
24
CHAPTER III
RESULTS
In silico analysis
crdA
A database search using NCBI-BLAST predicted the domains in CrdA and
identified homologs (Altschul, 1990, Altschul, 1997). As shown in Fig III.1, CrdA is a
NtrC homolog, composed of a receiver domain, an AAA ATPase domain and a helix-
turn-helix DNA-binding domain. The receiver domain has the conserved aspartate (D53)
for phosphorylation.
To determine whether CrdA is positively or negatively regulated by the receiver
domain, the sequence was aligned with twenty NtrCs randomly selected from other
organisms. Ten of them have a long C-D linker and don’t have a GHG motif, including
NtrC from E. coli and Salmonella enterica Serovar Typhimurium, which are positively
regulated. Ten of them have a short C-D linker and a GHG motif, including NtrC1 from
Aquifex aeolicus and DctD from Sinorhizobium meliloti, both of which are negatively
regulated. COILS (Lupas, 1991) was used to predict the coiled-coil motifs. CrdA has a
GHG motif (Fig III.2) and a coiled-coil motif (Fig III.3) between the receiver domain and
the central domain, which exist in negatively regulated NtrCs, such as NtrC1 and DctD,
but not in positively regulated NtrCs, such as NtrC from E. coli and S. enterica. The
receiver domain in negatively regulated NtrCs form dimers when it is unphosphorylated,
which inhibits the ATPase assembly. The receiver domain in CrdA may play the same
function. Usually, negatively regulated NtrCs have shorter C-D linkers than the positively
regulated ones do. However, CrdA has a C-D linker, which is about 30 residues longer
than that in positively regulated NtrCs (Fig III.2). It implies that the mechanism of DNA-
binding by CrdA may be more similar to positively regulated NtrCs.
25
Sequence analysis of the M. xanthus genome shows that crdA is not in an operon
with other genes. It is divergently transcribed from crdB, which encodes a lipoprotein
located in the cell membrane and is required for EDTA-induced cell wall stress
responses. CrdB is an input to the Che3 system, which is involved in the regulation of
development (Kirby, 2003, Muller and Kirby, unpublished data). We tried to predict the
functional partners of CrdA using SMART database (Jensen et al, 2009) and found that
co-occurrence of crdA, crdB, cheA3 and MXAN_5184, designated crdS, have high
confidence scores, meaning that these genes co-exist in many organisms. CrdS is
predicted to be a histidine kinase and encode a NtrB homolog, which is about 37kb away
from crdA in M. xanthus. It is in an operon including four other genes. One of them
encodes a penicillin-binding protein (PBP) homolog. PBPs synthesize the peptidoglycan
layer in the cell wall and they are the targets of beta-lactam antibiotics. We studied the
position of crdA homologs in the genome of other organisms and found that a similar
crdA-crdB fragment exists in other organisms, such as Anaeromyxobacter sp, Stigmatella
aurantiaca, Geobacter sulfurreducens. Alignment of the similar operons in M. xanthus
and Anaeromyxobacter sp Fw109-5 is shown in Fig III.4. Anaeromyxobacter sp has very
similar arrangement of crdA, crdB, crdF, crdG, crdH genes except that it doesn’t have
the che genes. The che3 cluster, with the exception of crdB, was either inserted into M.
xanthus or deleted from Anaeromyxobacter species. It implies that besides functioning in
a signal transduction pathway, CrdB may have other functions related to those genes
present in neighboring clusters, including synthesis of peptidoglycan. In
Anaeromyxobacter sp, the crdA-like gene and the crdS homolog are in the same operon,
which implies that CrdS may be the cognate histidine kinase of CrdA.
An in vitro assay was performed and the histidine kinase CrdS proved to be able
to phosphorylate CrdA (Willett and Kirby, unpublished data). Purified CrdS and/or CrdA
were incubated with 32P-labeled ATP for a certain amount of time and fractionated by
SDS-PAGE. CrdS can autophosphorylate and is stable in the buffer for several days.
26
Phosphorylated CrdS can transfer the 32P to CrdA within seconds. The phosphorylation
is inhibited by CheA3. As CrdA proved to be downstream of CheA3 by epistasis assay, it
might be the output of both the Che3 system and the CrdS pathway.
Considering the function of CrdB and the PBP are both related to peptidoglycan
layer and cell wall stability, CrdA is predicted to function in cell wall stress regulation.
Beta-lactamases in M. xanthus
Compared to other model organisms, M. xanthus has a large number of beta-
lactamases (Table III.1). There are twenty-nine beta-lactamase homologs in the
chromosome of M. xanthus. Their sequences and predicted domains were obtained from
the MiST2 database (Ulrich and Zhulin, 2007). Whether the gene contains a signal
peptide for secretion was predicted by PrediSi software (Hiller, 2004) (Fig III.5).
Twenty of these beta-lactamases belong to the metallo-enzyme class, which
utilize a catalytic zinc center and the other nine are serine-hydrolases. Beta-lactamase
expression patterns during the first 24 hours of development are shown in Fig III.6, along
with the evolutionary tree (Cullen and Kirby, unpublished data). The data is from
previous microarray experiment (Shi, 2008). RNA was isolated from M. xanthus cells
grown in liquid 1% CTT medium (reference RNA) or MC7 buffer (developmental RNA)
over a 24h period of time. cDNA of the reference probe was labeled with Cy5 and cDNA
of the developmental probe with Cy3. The M. xanthus DNA microarrays covered 88% of
all protein-coding genes in the M. xanthus genome. The data produced was filtered by the
Genepix Pro 6.0 spot-finding algorithm and signal-to-noise ratio. Therefore, not all the
beta-lactamases are included in the microarray data. Among metallo-enzyme class or
serine-enzyme class, some beta-lactamases are predicted to be secreted and some are not;
some are up-regulated during development and some are down-regulated. We found no
corresponding relationship between their structures, locations and functions.
27
Affect of Ampicillin during Aggregation, Sporulation and Growth
Affect of Ampicillin on Growth and Development
Based on previous studies and in silico analyses, the function of CrdA is an output
of the Che3 system, which is involved in regulation of development and responses to
cell wall stress. Therefore, developmental phenotype analysis was performed using
ampicillin as cell wall stress inducer (Fig III.7). The wild-type strain and the crdA mutant
containing the empty expression vectors respectively were assayed on CF media
containing 10ug/ml ampicillin. The crdA mutant cells formed smaller aggregation centers
compared to wildtype cells. Both of them grew well on CYE plates, which suggests that
the smaller aggregation is not due to growth defect. Wildtype crdA and the point mutants
crdAD53A and crdAD53E were fused to the promoter of pilA and the expression plasmids
were transformed into the crdA mutant. CrdAD53A doesn’t have the aspartate
phosphorylation site such that the mutant protein functions as the unphosphorylated form
of the response regulator. Glutamate is used to mimic the phosphorylated aspartate such
that CrdAD53E is likely to be constitutively active (Nohaile, 1997). Overexpression of
wildtype CrdA complemented the crdA null mutant phenotype, while overexpression of
CrdAD53A did not. The size of the aggregation centers formed by crdA/pCrdAD53E was
between the crdA mutant and crdA/pCrdA, indicating that CrdA-P is the active form of
CrdA, which is required for aggregation under stress. CrdAD53E is able to mimic the
phosphorylated form of CrdA, but may be not as functional as the wildtype CrdA-P.
In order to determine if more stress would cause more severe defects in
development, 5ug/ml ampicillin and 0.5 mM EDTA were added to the CF plates together
or separately (Fig III.8). EDTA chelates Mg2+ disrupting LPS and increases the fluidity of
cell membranes so that ampicillin can penetrate into the periplasm more easily. It also
chelates Zn2+, which is required for proper function of metallo-beta-lactamases, so that
the cells would be more sensitive to ampicillin. All strains looked similar on CF plates
28
containing only 5 ug/ml ampicillin or 0.5 mM EDTA (data not shown). However, when
both 5 ug/ml ampicillin and 0.5 mM EDTA were used, the crdA mutant displayed a
severe defect in aggregation. In contrast, at 48 h, the wildtype strain had already formed
large aggregates, which started to darken (indicating sporulation). Overexpression of
wildtype CrdA and CrdAD53E complemented the crdA mutant defect while overexpression
of CrdAD53A did not, indicating that CrdA is phosphorylated under this condition.
Furthermore, when these cells were plated on CYE containing the same amount of EDTA
and ampicillin, the crdA mutant and crdA/pCrdAD53A did not grow well. These results
suggest that the severe aggregation defect during development may due to growth defect.
Higher amounts of ampicillin were tested and found to cause a similar phenotype (Fig
III.9). The crdA mutant and crdA/pCrdAD53A didn’t grow on CYE plates containing
50ug/ml ampicillin, while the wildtype, crdA/pCrdA and crdA/pCrdAD53E grew well.
These results suggest that phosphorylation of CrdA is required for ampicillin resistance
during both growth and development.
Affect of Ampicillin on Cell Wall
The results above show that the crdA mutant cells are more sensitive to ampicillin
compared to the wildtype strain. Whether ampicillin kills the crdA mutant cells was
tested by incubating M. xanthus cells in CYE broth with 1 mg/ml ampicillin for 12 h.
After that, cells were observed by microscopy and photographed (Fig III.10). The
wildtype cells were still rod-shaped, while all the crdA mutant and crdA/pCrdAD53A cells
became spherical. crdA/pCrdA and crdA/pCrdAD53E had both rod-shaped and spherical
cells. The spherical crdA mutant cells were collected, resuspended in water, and plated on
CYE plates with or without heat and sonication treatment. The cells in water are viable,
but not resistant to sonication and heat (Table III.2), which suggests that the crdA mutant
spherical cells treated by ampicillin are neither pure spheroplasts nor mature spores. The
29
spherical cells of crdA/pCrdA, crdA/pCrdAD53A and crdA/pCrdAD53E also need to be
assayed in the future to identify the role of CrdA in cell wall synthesis and sporulation.
Peptidoglycan is the shape-determining structure in the cell envelope of M.
xanthus. It is degraded during sporulation when the cells differentiate from rod-shaped
vegetative cells to spherical spores. Ampicillin inhibits the synthesis and assembly of
peptidoglycan. Without the support of peptidoglycan, rod-shaped cells become spherical.
The wildtype cells are still rod-shaped after being incubated with high amounts of
ampicillin for 12 h, which suggests that M. xanthus employs a mechanism that makes
cells strongly resistant to ampicillin. The crdA mutant data indicates that CrdA must be
involved in this regulatory pathway.
Glycerol-induced Sporulation Analysis
Starvation-independent sporulation is thought to occur by the interruption of cell
wall synthesis. As the crdA mutant cells can not be induced to mature spores by
ampicillin, whether they have normal glycerol-induced sporulation was tested. After 12 h
of incubation with 0.5 M glycerol, the cells of all the strains become spherical (Fig
III.11). Spores formed by the crdA mutant cells are resistant to sonication and heat as
well as those formed by wild-type cells (Table III.3). It suggests that crdA is not required
for starvation-independent sporulation. Spores formed by crdA/pCrdA, crdA/pCrdAD53A
and crdA/pCrdAD53E cells will be assayed in the future to confirm this conclustion.
crdA Regulates Beta-lactamase Activity
Specific Induction of Beta-lactamase
Ampicillin is a beta-lactam antibiotic targeting cell wall synthesis. In some
bacteria, it can specifically induce the production of beta-lactamases, which inactivate
ampicillin to protect the cells. The crdA mutant shows defects in sporulation and growth
30
when the medium contains ampicillin. Therefore, the beta-lactamase activity assays were
performed to test whether crdA is required for induction of beta-lactamases. The wild-
type strain and the crdA mutant cells were assayed after incubation with 100 ug/ml
ampicillin overnight. After ampicillin treatment, the beta-lactamase activity in wild-type
is up-regulated about four fold, whereas beta-lactamase activity in the crdA mutant
remains unchanged. Overexpressing CrdA in the crdA mutant background complements
this defect (Fig III.12). The results suggest that CrdA regulates beta-lactamase
production and that decreased beta-lactamase activity may be the reason for the crdA
mutant’s sensitivity to ampicillin being not resistant to ampicillin during development
and growth.
Non-specific Induction of Beta-lactamase
Both starvation-dependent and independent sporulation are accompanied by the
induction of beta-lactamases (O’Connor, 1997, O’Connor, 1999). The crdA mutant is not
able to induce beta-lactamases when grown with ampicillin, and it has a defect in
ampicillin-induced sporulation. However, it can undergo glycerol-induced sporulation
normally. We then assayed whether beta-lactamase activity would be stimulated by
glycerol or other reagents in the crdA mutant. Beta-lactamase activity was assayed in the
presence of glycerol and EDTA as inducers. Cells were grown with different amounts of
glycerol or EDTA overnight, and then collected for the assay. Beta-lactamase activity of
the crdA mutant cells is lower than the wild-type cells under all conditions. However,
higher concentrations of glycerol and EDTA are also able to enhance beta-lactamase
activity in the crdA mutant cells (Fig III.13), which may explain why the crdA mutant
produces normal spores when induced by glycerol. The results also indicate that there is
more than one pathway in addition to Che3-CrdA, capable of regulating beta-lactamase
gene expression.
31
Regulation of the che3 Cluster, crdS and crdA
lacZ Expression from che3, cheB3, crdS and crdA Promoters
Because NtrC performs auto-regulation when it responds to nitrogen
concentration in E. coli, we tested various promoters in the Che3 system to see if they are
under the control of CrdA. Transcription levels of the crdA, crdS, cheB3 and che3
operon were assayed when cell wall stress is induced. Promoter regions from ~200 to
500 bp upstream of the transcriptional start site for each of these genes were fused to lacZ
and the plasmids were transformed into the wild-type strain and the crdA mutant. Beta-
galactosidase activity was measured under both growth and development conditions with
or without stress inducer. A pilA promoter was used as a positive control and lacZ gene
only was used as a negative control (Fig III.14). All the strains were cultured in CYE
until the cell density was approximately 150 KU when cells were harvested. Some of the
cells were directly used for beta-galactosidase assays and are labeled as “CYE” (Fig
III.14). Some of the cells were subsequently incubated in fresh CYE broth with 200
ug/ml ampicillin for 4 more hours before being collected, labeled as “CYEAmp” in Fig
III.14. In addition, some of the cells were plated on CF plates with or without 5 ug/ml
ampicillin and 0.5 mM EDTA, and harvested at 48 h. These samples are labeled as “CF”
or “CFEA” (Fig III.14).
The results show that the promoters of crdS, crdA and cheB3 are up-regulated
when wildtype cells enter development (CF plates) (Fig III.14B). However, the
transcription level of crdB doesn’t change, which was unexpected based on previous
results that showed the che3 genes upregulated during development (Jakobsen, 2004).
One possible explanation is that the promoter of crdB is not long enough so that some
activator binding sites are missing. The upregulation of crdA and cheB3 in the crdA
mutant is not to the level of wild type, which suggests that CrdA stimulates the
transcription of crdA and cheB3 during development as predicted, similar to other NtrC
32
homologs that are known to be autoregulatory (Reitzer, 1985, Schwab, 2007). Increasing
the level of CheB3 and CheR3 would allow the Che3 system to adapt to the signals more
quickly, which may be important during development because multiple signals play roles
in different stages during starvation-dependent sporulation.
The results in Fig III.14(C) shows that in both wildtype and the crdA mutant
background, the promoters of crdB and cheB3 are down-regulated by ampicillin during
growth. The down-regulation is not CrdA-dependent. As CheA3 inhibits the
phosphorylation of CrdA, down-regulation of crdB and cheB3 would lead to an increase
in phosphorylated CrdA, which is required for ampicillin-resistance mechanism.
The results in Fig III.14(D) shows that under developmental conditions, all the
promoters tested are down-regulated by ampicillin and EDTA in the wild-type
background, but not in the crdA mutant. This result was surprising because we expected
that crdS and crdA would be up-regulated during stress response. One possible
explanation is that cells initiate the starvation-independent sporulation process
responding to damage of the cell wall. In contrast, during sporulation, peptidoglycan is
degraded such that the amount of CrdA, which helps to stabilize the peptidoglycan layer,
needs to be decreased.
To access whether CrdA functions to regulate these promoters, the ratio of the
promoter activities for the crdA mutant relative to the wild-type is presented in Fig
III.14E. Numbers smaller than 1 suggest that the genes are activated by CrdA under
those conditions. Numbers bigger than 1 suggest repression by CrdA. The results indicate
that when cells are grown in rich liquid media (CYE), crdB is activated by CrdA. This
induction is attenuated after incubation with ampicillin. During development (CF), crdA
and cheB3 are upregulated by CrdA. However, inducing stress during development did
not lead to CrdA dependent upregulation of crdA, crdB and cheB3. Lastly, cell wall
induced stress during development (CFEA) revealed that the transcription of crdA is
33
repressed by CrdA itself. Together, the results imply that without severe stress, CrdA
functions as an activator, and with severe stress, CrdA functions as a repressor.
DNA-binding Assay of CrdA
Whether CrdA directly binds promoter sequences was further tested using a gel
shift assay. CrdA was over-expressed in E.coli, then purified and dialyzed (see Materials
and Methods part). Dialyzed and undialyzed solution was centrifuged at 100,000 g for 15
min. CrdA was present in the soluble fraction indicating the purified protein was soluble
(Fig III.14). Binding between CrdA and PcrdAB (the 255 bp fragment between crdA and
crdB) was assayed. The protein and DNA form a large complex and a shift was observed
at the top of the gel. The shift disappears partly or completely when adding competitor
DNA such as polydIdC or a M. xanthus asgB fragment into the reaction. The results
suggest that binding between CrdA and PcrdAB may be non-specific, which can be
inhibited by other DNA fragments. Further analysis of larger promoter regions is required
to determine if CrdA regulates a promoter in this region.
34
Table III. 1. Numbers of Beta-lactamases in Different Organisms
Organism Number of Beta-lactamases
E.coli K12 1
Staphylococcus aureus subsp. aureus JH1 14
Pseudomonas aeruginosa PAO1 1
Helicobacter pylori Shi470 0
Bacillus subtilis subsp. subtilis str. 168 2
Mycobacterium tuberculosis CDC1551 7
Streptococcus pneumoniae TCH8431/19A 5
Haemophilus influenzae 86-028NP 1
Klebsiella pneumoniae 342 10
Myxococcus xanthus DK 1622 29
35
Table III.2 Sonication and Heat Resistance of Ampicillin-induced crdA mutant Cells
Treatment Germinated spores (per ml)
None ( 7.35±0.64 ) x 106
Sonicate for 30 s and heat at 50oC for 2 h 0*
Note: * - Sonicated and heated spores were diluted 105 times and plated, no colonies grow.
36
Table III.3 Sonication and Heat Resistance of Glycerol-induced Spores
Strain Germinated spores (per ml)
WT ( 9.4±0.85 ) x 106
crdA ( 9.7±0.42 ) x 106
Note: P = 0.698 > 0.05. P is the probability associated with a Student’s t-Test, which determines whether two samples are likey to have come from the same two underlying population that have the same mean.
37
REC AAA ATPase HTH
Fig III.1. Predicted Domains in crdA, crdA contains a signal receiver (REC) domain, an AAA ATPase domain and a helix-turn-helix (HTH) DNA-binding domain. The REC domain is a CheY-homologous receiver domain, which receives the signal from the sensor partner in a two-component system and contains a phosphor-acceptor site that is phosphorylated by histidine kinase homologs. The AAA ATPase domain is characterized by a conserved ATP-binding motif, which is involved in manipulation of protein structure via nucleotide-dependent conformational changes
38
A
GHG motif
B
C-D linker
Fig III.2. Alignment of CrdA and Its Homologs. NtrC family regulators randomly selected from different organisms are aligned. Ten of them have long C-D linker, without GHG motif , which are the signs of positively regulated NtrCs. Ten of them have GHG motif and short C-D linker, which are the signs of negatively regulated NtrCs. CrdA has a both GHG motif and a long C-D linker, suggesting it may regulate gene expression using elements of both mechanisms. (A) The red-line square represents the GHG motif. (B) The blue-line square shows the C-D linker.
378 390 400 410 420 430 440 450 460 470 4(378)TVMAPGQTIEVADLPPEMRDR------PERE-----------------------------MPVAWVDGLAVEADRLIATSPGEVFDRLTREFERTLIRRALTANtrC A. aromaticum(366)TVMAPGQTVEIKDLPQDLVEERVHAPQPAQNRGCSGIGGSPSDGLYRACPGVASASADGAAGASWITLLETEAAQMLASEQPEVMDILGRQFEAALIKVALKHNtrC H. seropedicae(364)TVMAAGQEVLIQDLPGELFESTVAES------------------------------TSQMQPDSWATLLAQWADRALRSGHQNLLSEAQPELERTLLTTALRHNtrC E. coli(368)TVMASGREVHIDDLPPELLTQPQDS----------------------------------APAANWEQALRQWADQALGRGQSNLLDSAVPAFERIMIETALKHNtrC P. aeruginosa(369)TVMASSREVLIGDLPPELLNLPHDA----------------------------------APVTNWEQALRQWADQALARGQTSLLDSAVPSFERIMIETALKHNtrc P. putida(369)TVMASGQEILPQDLPPELLKEPTSIN------------------------------PMAKGSQDWQSALTEWIDQKLSEGNSDLLTEVQPAFERILLETALRHNtrC S. oneidensis(370)TVMASSQEVLPSDLPPELFSTPIPQ--------------------------------QQHQITDWQEQLSSWVENQLNKGEEDILNKVIPNVERILLDKALHHNtrC V. fischeri(370)AALYPQDVITASVIDGELA---PPSVSPGAAVQQGV---------------------DNLGGAVEAYLSSHFQGFPNGVPPPGLYHRILKEIEVPLLTAALAANtrC B. japonicum(367)TALYPQDVITREIIENELRSEIPDSPIEKAAARSGS---------------------LSISQAVEENMRQYFASFGDALPPSGLYDRVLAEMEYPLILAALTANtrC S. melilot i(366)MVTSAEAEITRAEVEAVLGN--QPAMEPLKGGGEG----------------------EKLSSSVARHLRRYFDLHGGALPPPGVYQRILREVEAPLIEIALDANtrC R. sphaeroides(340)AILCEGPIVTRTDALELLPRGRNVPPPAPVETPASPLPPPSPE------AAVVLASSTPAPAIAAPVATEPPAPVGFRPRADRTFREQVEDAEREIIQHVLSHCrdA M. xanthus(367)VLFSEGKFIDRGELSCLVNS-----------------------------------------------------------KGIKNKHKSIKEIEKEEIIKVLKENtrC1 A. aeolicus(367)LILSDGPTITARDVQRYVHPGSTSGSG----------------------------------------------SLQELIERYPTFAEFRDAAEKLFLEHKLRENtrC R. marinus(373)LILVEGDVIEGDDIDQFVQPGGN-GDG----------------------------------------------PTQELIEAYNDFSDARDQFEKHFIQHKLHENtrC S. ruber(372)LIMYAGDEVGPEHLPGDVEAPMAGGHERG-------------------------------------------------VGWDDDFKNARARFEKDFLTQKLEQNtrC D. retbaense(370)VIMTPGKVITPDQVPDTIGSAAGEAHR------------------------------------------------PGAPLELNSLREAREGFEREFILQKLEENtrC G. metallireducens(368)VIMTPGRTITVNQIPDYIGAGEATREMGG--------------------------------------------SKPGSALELSSLREAREEFEKEFIIQKLEENtrC G. uraniireducens(368)VIMSPSQTISSADLPSSVLAAGPSAQP----------------------------------------------TKFDLPASDLSLRQAREEFEKEFILQKLQENtrC P. carbinolicus(367)ALGVEGNLGVPAAAPASSG---------------------------------------------------------------ATLPERLERYEADILKQALTADctd S. melilot i(373)VIMTPGQRIGPRDLPLDFLNRLPKPPE------------------------------------------------EAGPYQCATLREARSVFERAYLLRKLDENtrC S. fumaroxidans(368)AILCDGPEIGADDVVAMLPGAR--------------------------------------------------RPRGDRLRAGAAFHELVEEAEREIVLAALEANtrC A. dehalogenans(368)
1 10 20 30 40 50 60 70 80 90(1)---MNTVWIVDDDRSIRWVIEKALSRENISHRSFASAGEALTALETAPHPPKVLVSDIRMPGESGLGLLQRVKTLHPHLPVIIMTAYSDLESAVSAFQGNtrC A. aromaticum (1)---MKPIWIVDDDESIRWVLEKALARENLATQSFSSARDAIAALQNG--TPQVLVSDIRMPGASGLELLQTVKAKHPGIPVIIITAFSDLDSAVSAFQGNtrC H. seropedicae (1)-MQRGIVWVVDDDSSIRWVLERALAGAGLTCTTFENGAEVLEALASK--TPDVLLSDIRMPGMDGLALLKQIKQRHPMLPVIIMTAHSDLDAAVSAYQQNtrC E. coli (1)MSRSETVWIVDDDRSIRWVLEKALQQEGMTTVSFDSADSVIGRLGRQ--QPDVIISDIRMPGASGLDLLAQIRELHPRLPVIIMTAHSDLDSAVASYQGNtrC P. aeruginosa (1)MSRSETVWIVDDDRSIRWVLEKALQQEGMTTQSFDSADGVMGRLARQ--QPDVIISDIRMPGTSGLDLLAQIREQHPRLPVIIMTAHSDLDSAVASYQGNtrc P. put ida (1)MRISEQVWILDDDSSIRWVLEKALQGAKLSTASFAAAESLWQALEIS--QPRVIVSDIRMPGTDGLTLLERLQIHYPHIPVIIMTAHSDLDSAVSAYQANtrC S. oneidensis (1)-MSKGFIWVVDDDSSIRWVLEKTLTSTNMMCESFGDAESVIQALERN--VPDVIISDIRMPGMDGLSLLHHIQENYPELPVIIMTAHSDLDAAVSAYQKNtrC V. fischeri (1)-MPAGSILVADDDTAIRTVLNQALSRAGYEVRLTGNAATLWRWVSQG--EGDLVITDVVMPDENAFDLLPRIKKMRPNLPVIVMSAQNTFMTAIRASERNtrC B. japonicum (1)-MTGATILVADDDAAIRTVLNQALSRAGYDVRITSNAATLWRWIAAG--DGDLVVTDVVMPDENAFDLLPRIKKARPDLPVLVMSAQNTFMTAIKASEKNtrC S. melilot i (1)--MDGTVLVADDDRTIRTVLTQALTRAGCKVHATSSLMTLMRWVEEG--KGDLVISDVVMPDGNGLEALPRISKLRPGLPVIVISAQNTIMTAIQAAEANtrC R. sphaeroides (1)--MPASVLIVDDEKNILLTLSQSLQLAGYQTHLANSGQVALDVVSAR--PVDAVLMDVKMPDMDGLTALAKLTELKPELPVIMMSGHGTIDTAVKATQLCrdA M. xanthus (1)----MNVLVIEDDKVFRGLLEEYLSMKGIKVESAERGKEAYKLLSEK--HFNVVLLDLLLPDVNGLEILKWIKERSPETEVIVITGHGTIKTAVEAMKMNtrC1 A. aeolicus (1)--MAATILVVDDERSIRRTLREILEYEGYAVEEAADGDEALEKLREG--RYDLVLLDIKMPRRDGMEVLRTLAAEQPELPVVMISGHGTIETAVEATRLNtrC R. marinus (1)---MPTILVVDDEASIRRTLREILEYEDFGVEEAVDGEEALVALREN--AYDLVILDVKMPKMDGMEVLETIADEGYEVPVLMISGHGTIETAVESTKLNtrC S. ruber (1)--MQARILVVDDELDIRVSLSGILEDEGHTVMEADSGEAGLTAMAGK--EIDLVFLDIWLPGMDGLAVLERLRQEWPDIPVIMISGHGTIETAVSAIKNNtrC D. retbaense (1)--MNETILVVDDEQNIRTALAGILEDEGYRPVFAKDGLEALDMAKKE--NPDLVLLDIWMPRLDGLETLQALKEFHPLLTVVMMSGHGTIETAVKSTKLNtrC G. metallireducens (1)--MSATILVVDDEESIRTSLAGILEDEGYRTLFAVDGVEALSVVQQE--MPALVLLDIWMPRMDGMETLQKLKELYPVLTVIMMSGHGTIETAVKSTKMNtrC G. uraniireducens (1)---MKTILIVDDEQSIRESLDGILQDEGFRTLSAETGEDALTLLCGE--NPDLILLDIWLPGMDGLETLRRIRDNDPEQIVIMMSGHGTIETAVKATKLNtrC P. carbinolicus (1)MSAAPSVFLIDDDRDLRKAMQQTLELAGFTVSSFASATEALAGLSAD--FAGIVISDIRMPGMDGLALFRKILALDPDLPMILVTGHGDIPMAVQAIQDDctd S. melilot i (1)--MKPKILVVDDEISILQSLRGVLQDEGYRIGVAASGEEALEELRRD--TPDLMLLDIWMPGMDGLAVLEEIKKSHAHLPVIIISGHGNIETAVKATRMNtrC S. fumaroxidans (1)--MPATVLVVDDERNIQLTLSRALSMEGYAVETASGGREALEKLAAL--PVDVVVMDVRMPDLDGLAVLQKARETRPELPVVIMSGHGSIDTVRSAFKLNtrC A. dehalogenans (1)
39
Fig III.3 Predition of Coiled coils in CrdA. The sequence of CrdA is analyzed by
software COILS to predict coiled coils. The height of peaks represents the possibility of a coiled-coil structure. Scanning windows of 14, 21 and 28 residues are all tested. Each algorithm predicts a high possibility of coiled-coil structure between about 110 ~ 150 residues, which corresponds to the region between the receiver domain and the ATPase domain of CrdA.
40
Fig III.4. Comparison of crdA-crdB gene neighborhoods in M. xanthus and Anaeromyxobacter Fw109-5. The genome of Anaeromyxobacter has a crdA - crdB fragment similar to that in M. xanthus. The crdA homolog is in an operon including other four genes, one of which is an ntrB homolog. These four genes also exist in the genome of M. xanthus. The crdB homolog is next to crdF, crdG and crdH homologs. The chemosensory genes of the M. xanthus Che3 system are missing in Anaeromyxobacter
41
Fig III.5. Structures of Beta-lactamases in M. xanthus. The domains are predicted by MiST2 database. Each predicted domain is labeled in a white, bordered box. “Lactamase B” domain represents Metallo-beta-lactamase superfamily. “Beta-lactamase” domain represents the serine beta-lactamase-like superfamily. “RMMBL” represents RNA metabolising metallo-beta-lactamase. “Rhodanese” represents a single copy of a duplicated domain in rhodanese. It is also found in phosphatases and ubiquitin C-terminal hydrolases. “TRP_2” represents the tetratrico peptide repeat domain, which mediates protein-protein interactions and the assembly of multiprotein complexes. Blue vertical boxes ( ) represent transmembrane regions.
42
Gene Structure Signal Peptide
MXAN_0061 Lactamase B
No
MXAN_0179 Lactamase B
No
MXAN_0432 Lactamase B
Yes
MXAN_1394 Lactamase B
Yes
MXAN_1479 Lactamase B RMMBL
No
MXAN_1578 Lactamase B
No
MXAN_2354 Lactamase B
No
MXAN_2490 Lactamase B
No
MXAN_3951 Lactamase B
No
MXAN_4214 Lactamase B
No
MXAN_4319 Lactamase B
No
MXAN_5359 Lactamase B No
MXAN_5428 LactamaseB Rhodanese
No
MXAN_5720 Lactamase B
Yes
MXAN_5721 Lactamase B No
MXAN_5860 Lactamase B
No
MXAN_5949 Lactamase B
No
MXAN_6394 Lactamase B
No
MXAN_6901 LactamaseB
No
MXAN_1911 LactamaseB No
MXAN_7313 Lactamase B Yes
MXAN_2136 Beta‐lactamase Yes
MXAN_2150 Beta‐lactamase Yes
MXAN_2321 Beta‐lactamase
No
MXAN_2364 Beta‐lactamase TPR_2 No
MXAN_5519 Beta‐lactamase No
43
Figure III.5 - Continued
MXAN_6409 Beta‐lactamase TPR_2 Yes
MXAN_6450 Beta‐lactamase Yes
MXAN_7171 Beta‐lactamase Yes
44
A
0 2 4 6 9 12 15 18 24 h
serin
e be
ta-la
ctam
ase
met
allo
-bet
a-la
ctam
ase
B
0 2 4 6 9 12 15 18 24 h
Fig III.6. Beta-lactamases Expression Pattern during Development and Evolutionary Tree. (A) Left part of the pictures show the evolutionary tree of the betalactamases, which can be divided into metallo-beta-lactamase family and serine beta-lactamase family. Right part of the picture is a heat map indicating beta-lactamase expression patterns during the first 24 hours of development. Green squares represent down-regulation and red ones represent up-regulation. (B) The same date from above is rearrayed based on expression (Cullen and Kirby, unpublished data).
45
CF Amp10
CYE Amp10
WT
crdA
crdA pCrdA
crdA pCrdA D53A
crdA pCrdA D53E
Fig III.7. Affect of ampicillin on growth and development of M. xanthus. 7.5x photographs of cells were taken on CYE or CF plates with 10 ug/ml ampicillin at 48 h. The wildtype strain, the crdA mutant, and strains over-expressing wildtype CrdA, CrdAD53A, and CrdAD53E in the crdA mutant background were assayed.
46
CF
Amp5 EDTA0.5 CYE
Amp5 EDTA0.5
WT
crdA
crdA pCrdA
crdA pCrdA D53A
crdA pCrdA D53E
Fig III.8. Affect of Ampicillin and EDTA on Growth and Developmental of M. xanthus cells. 7.5x photographs of cells were taken on CYE or CF plates with 0.5 mM EDTA and 5 ug/ml ampicillin at 48 h. The wildtype strain, the crdA mutant, and strains over-expressing wildtype CrdA, CrdAD53A, and CrdAD53E in the crdA mutant background were assayed.
47
CYE Amp50
WT
crdA
crdA pCrdA
crdA pCrdA D53A
crdA pCrdA D53E
Fig III.9. Affect of Ampicillin on growth of M. xanthus cells. 7.5x photographs of cells were taken on CYE plates with 50 ug/ml ampicillin at 48 h. The wildtype strain, the crdA mutant, and strains over-expressing wildtype CrdA, CrdAD53A, and CrdAD53E in the crdA mutant background were assayed.
48
CYE
Amp 1000
WT
crdA
crdA pCrdA
crdA pCrdA D53A
crdA pCrdA D53E
Fig III.10. Ampicillin-induced Sporulation. Cells were incubated in CYE broth with 1 mg/ml ampicillin for 12 h. The wildtype strain, the crdA mutant, and strains over-expressing wildtype CrdA, CrdAD53A, and CrdAD53E in the crdA mutant background were assayed. 400x photographs were taken by microscopy.
49
CYE
Glycerol 0.5
WT
crdA
crdA pCrdA
crdA pCrdA D53A
crdA pCrdA D53E
Fig III.11. Glycerol-induced Sporulation. Cells were incubated in CYE broth with 0.5 M glycerol for 12 h. The wildtype strain, the crdA mutant, and strains over-expressing wildtype CrdA, CrdAD53A, and CrdAD53E in the crdA mutant background were assayed. 400x photographs were taken by microscopy.
50
0
500
1000
1500
2000
2500
3000
3500
4000
4500
5000
CYE
CYEAmp100
Beta‐lactam
ase activity
(mmol x m
in‐1 x m
g‐1).
WT crdA crdA/pCrdA
Fig III.12. Beta-lactamase Activity Induced by Ampicillin. Cells were incubated in CYE broth at 32oC with or without 100 ug/ml ampicillin overnight. The wildtype strain, the crdA mutant, and strains over-expressing wildtype CrdA in the crdA mutant background were assayed.
51
0
2000
4000
6000
8000
0.1 M 0.2 M
Beta‐lactam
ase
(mmol /g/min)
Glycerol
WT
crdA
0
500
1000
1500
2000
1 mM 3 mM
Beta‐lactam
ase
(mmol /g/min)
EDTA
WT
crdA
A B
Fig III.13. Induction of Beta-lactamase Activity by Glycerol and EDTA. (A) Cells were incubated in CYE broth at 32oC with 0.1 M or 0.2 M glycerol overnight. (B) Cells were incubated in CYE broth at 32oC with 1 mM or 3 mM EDTA overnight.
52
Fig III.14. lacZ Expression of the Promoters in WT and the crdA Mutant Background. (A) Strains containing a lacZ gene without a promoter or with the M. xanthus pilA promoter in the wildtype background were assayed as negative and
density
ter
positive controls. (B) Cells were harvested from liquid CYE when the cell was 100-150KU, or CF plates after 48 h of incubation. (C) Cells were harvested before and after incubation in liquid CYE with 200 ug/ml ampicillin for 4 h. (D)Cells were harvested from CF plates with or without 0.5 mM EDTA and 5 ug/ml ampicillin (CFEA) after 48 h of incubation. (E). Under each condition, the promoactivities in the crdA mutant background are divided by those in the wildtype background.
53
A
B
C
D
54
Figure III.14 - Continued
E
0.00
0.50
1.00
1.50
2.00
2.50
PcrdS PcrdA PcrdB PcheB3
CYE
CYEAmp
CF
CFEA
crdA / W
T
55
dialyzed undialyzed S P S P
132 kD
78
46
33
18
Fig III.15. Solubility and Purity Analysis of CrdA. 200 ul of dialyzed (~1mM) and undialyzed (~4mM) CrdA were centrifuged at 100,000 g for 15 min, 5 ul of the samples from the soluble fraction (S) and the pellet fraction (P) were loaded into the 12% polyacrylamide gel.
56
Positive control 1 2 3 4 5 6 + + + + CrdA - + + + PcrdAB - - asgB polydIdC Competitor
Fig III.16. CrdA and crdAB Promoter-binding Assay. Lane 1 and 2 are positive controls using Epstein-Barr Nuclear Antigen (EBNA) Extract and biotin EBNA control DNA. Lane 1 is DNA only. Lane 2 is DNA and EBNA extract. Lane 3 to 6 all have 0.25 nM 257 bp crdA and crdB promoter fragment, which is from -304 to -48 from the translational start site of crdB. Lane 3 has 200 nM CrdA only. Lane 4 is PcrdAB and 200 nM CrdA. Lane 5 is PcrdAB, 200 nM CrdA, and 980 nM asgB fragment. Lane 6 is PcrdAB, 200 nM CrdA, and 250 ng polydIdC.
CHAPTER IV
57
CONCLUSIONS AND FUTURE DIRECTIONS
General Discussion
The focus of this dissertation was to study the function of CrdA. CrdA is a
sigma54-dependent transcriptional regulator homolog, which belongs to the NtrC family.
The alignment of CrdA and other NtrC proteins shows that the structure of CrdA is
different from those that have been well studied. CrdA has a long linker between the
central domain and the DNA-binding domain compared to those NtrC homologs which
have been crystallized. It implies that the function and structure of CrdA may be different
from what is known for the NtrC homologs in other organisms.
Previous studies from our laboratory demonstrated that crdA is downstream of the
che3 pathway and may be involved in regulation of developmental genes (Kirby, 2003).
However, the developmental defect was not as apparent after our laboratory moved to the
University of Iowa. The change of this phenotype may be due to the change of water we
used. It implies that CrdA may function in a signal transduction pathway, which is able to
sense subtle changes in the environment.
Previous data, in silico analysis and new findings about CrdB’s function suggest
that CrdA may function in the regulation of cell wall stress. Therefore, we hypothesize
that CrdA is involved in a signal transduction pathway, which monitors the integrity of
peptidoglycan envelop. We used ampicillin and EDTA as stress inducers because
ampicillin is a beta-lactam drug, which affects peptidoglycan synthesis and has proved to
induce starvation-independent sporulation, and the crdB mutant has defect in response to
EDTA-induced stress. Experiments in this dissertation have demonstrated that under both
growth and developmental conditions, the crdA mutant is more sensitive to ampicillin
than the wild-type strain. In liquid CYE with high ampicillin concentrations, the wild-
type strain keeps growing, whereas the crdA mutant becomes spherical. Whether these
spherical cells are immature spores or are more similar to spheroplasts remains to be
58
elucidated. Under starvation conditions with ampicillin and EDTA, the crdA mutant
forms fewer and smaller aggregates compared to the wild type. When we added
ampicillin or EDTA separately into the plates, the crdA mutant didn’t show any obvious
defect (data not shown). One possible explanation for the synergistic effect is that EDTA
affects a large number of proteins and induces fluidization and destabilization of the cell
membrane, which helps ampicillin penetrate the periplasm more easily and therefore
causes much more damage to the cell wall. Under the conditions we have tested, the crdA
mutant shows normal glycerol-induced sporulation, which suggests that CrdA responds
to ampicillin specifically.
In many gram-negative rod-shaped bacteria, production of chromosomally-
encoded beta-lactamases is induced by beta-lactams to protect the cell wall. As the crdA
mutant is very sensitive to ampicillin, which is a beta-lactam, we assayed for beta-
lactamase activity. As we expected, the crdA mutant is not able to produce beta-
lactamases as much as the wild-type strain when ampicillin is present. Adding glycerol
and EDTA can still enhance beta-lactamase activity in the crdA mutant, but not to the
level of the wild type. It suggests that some beta-lactamases are not regulated by CrdA
and may explain why the crdA mutant shows a normal glycerol sporulation phenotype.
qPCR is being performed to study which beta-lactamases are under the control of CrdA.
NtrC proteins typically regulate the ntrBC operon (Shiau,1993). In order to
determine if CrdA regulates itself, the che3 operon or the crdS gene was studied by
measuring lacZ expression from these promoters. The results show that CrdA positively
regulates the che3 operon in CYE liquid, cheB3 and itself during starvation-dependent
development, and negatively regulates the che3 operon, cheB3, and itself during
starvation under cell wall stress. As CrdA can switch between phosphorylated and
unphosphorylated states, it is possible that in one state, CrdA functions as an activator
and in the other state, it functions as a repressor. We also noticed that, under the
conditions tested, all the promoters have a certain level of expression in the crdA mutant
59
background. This observation suggests that without CrdA, these genes are expressed at
basal level. It is possible that other transcriptional mechanisms are involved in regulation
of these genes.
Whether CrdA directly binds the promoter sequence between crdA and crdB was
tested using a gel shift assay. Under all the conditions we have tried, CrdA binds the
DNA but may be non-specific. It may due to the inappropriate in vitro condition, or other
proteins may be required for transcription.
Model for CrdA
We hypothesize that CrdA is regulated by both the CrdS pathway and the Che3
system. CrdS, the NtrB homolog, may phosphorylate CrdA corresponding to input from
the PBP (Mxan_5181). Phosphorylated CrdA activates the transcription of genes
necessary for resistance to envelope stress, including beta-lactamases. CrdB may sense
changes in the peptidoglycan layer and transfer the signal to the che3 system. CheA3 then
inhibits the phosphorylation of CrdA by an unknown mechanism. Dephosphorylated
CrdA can then act as a repressor. Therefore, the ratio between phosphorylated and
unphosphorylated CrdA determines whether the transcription is activated or repressed. It
may vary for different promoters.
When ampicillin is added into the CYE culture of the wild-type strain, it
inactivates the PBP, which is sensed by CrdS. CrdA is then phosphorylated and activates
the transcription of genes which stabilize the cell wall. At this time, the crdB and cheB3
genes are down regulated by an unknown CrdA-independent mechanism. Therefore, the
inhibition of phosphorylation of CrdA by CheA3 is relieved, which increases the amount
of phosphorylated CrdA. In the crdA mutant, genes that stabilize the cell wall are not
induced and synthesis of the peptidoglycan layer is quickly interrupted. Overexpression
of wildtype CrdA or CrdAD53E (constitutively active form of CrdA) is able to complement
60
this defect. CrdAD53A can not be phosphorylated, and therefore, overexpression of this
protein can not activate transcription of down-stream genes.
If there is damage to the cell wall, it may be better for the M. xanthus cells to
enter a starvation-independent sporulation program for protection and energy
consumption. Therefore, we hypothesize that when peptidoglycan damage occurs
quickly, the majority of CrdA will be dephosphorylated by CheA3 and the protein will
function as a repressor. This proposal is supported by the transcriptional results on the
crdA, crdB and cheB3 genes. One interesting question here is that why M. xanthus cells
want to employ a chemosensory system to monitor the cell wall change instead of a
prototypical one/two-component system. The biggest difference between a chemosensory
system and a two-component system is that a chemosensory system is able to adapt the
cells to the existing signal and a two-component system is not. Therefore, a
chemosensory system can sense the changing rate of the signal level, instead of the
absolute value of the signal level. Our hypothesis is that M. xanthus cells always need to
sense signals, such as cell wall integrity, etc, to determine whether they want to keep
replicating or start the sporulation process. How fast the cell wall is degraded may be
more important than how much cell wall is degraded, because if the cell wall damage is
severe, but peptidoglycan is no longer being degraded, then the cell would be able to fix
any damage by producing new peptidoglycan. Thus the Che3 system provides an
advantage over a simple switch-like mechanism.
This model is based on previous data, and results presented herein. To further
explore the mechanism of this system and confirm aspects of the model, many
experiments will need to be performed in the future. First, characterization of the crdS
operon is required. Whether ampicillin is able to bind the PBP and whether binding
triggers the phosphorylation of CrdA by CrdS needs to be assayed. Secondly, the target
genes of CrdA need to be determined. Whether CrdA directly regulates the transcription
of beta-lactamase genes is currently being tested by qPCR. If targets are confirmed,
61
further experimentation will determine if CrdA directly binds to the promoter sequences.
It is also unknown if CrdA directly regulates other cell-wall related genes to help stabilize
the peptidoglycan layer. The overexpression of beta-lactamases to complement the crdA
mutant’s phenotype would be further evidence that CrdA is needed for the transcription
of those genes. Third, the mechanism for Che3 regulation of CrdA remains unclear. More
biochemical experiments are needed to elucidate the relationship between CheA3 and
CrdA.
62
P CrdC
CH3CH3
PCrdA
CrdS
CrdB
CheR3
PCheB3
CheA3
W
Mcp3A
Pbp1A
ATP
Mcp3B
genes which help stabililize peptidoglycan layer
CrdA
Fig IV.1 Model for Chemosensory Regulation of CrdA to Affect Cell Wall Stability. CrdA is regulated by both the CrdS pathway and the Che3 system. CrdS senses the condition of PBP and phosphorylates CrdA corresponding to the signal. CrdB senses the condition of peptydoglycan layer and transfers the signal to the Che3 system. CheA3 inhibits the phosphorylation of CrdA. When CrdA is phosphorylated, it activates the transcription of genes which help stabilize the peptidoglycan layer. When CrdA is dephosphorylated, it functions as a repressor.
63
REFERENCES
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. (1990) Basic Local Alignment Search Tool. J Mol Biol 215:403-410.
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389-3402.
Avison MB, Niumsup P, Nurmahomed K, Walsh TR, Bennett PM. (2004) Role of the 'cre/blr-tag' DNA sequence in regulation of gene expression by the Aeromonas hydrophila beta-lactamase regulator, BlrA. J Antimicrob Chemother 53:197-202.
Berleman JE, Bauer CE. (2005) Involvement of a Che-like signal transduction cascade in regulating cyst cell development in Rhodospirillum centenum. Mol. Microbiol. 56:1457–66
Berleman JE, Chumley T, Cheung P, Kirby JR, (2006) Rippling is a predatory behavior in Myxococcus xanthus. J Bacteriol 188: 5888-5895.
Berleman JE, Scott J, Chumley T, Kirby JR, (2008) Predataxis behavior in Myxococcus xanthus. Proc Natl Acad Sci U S A 105: 17127-32.
Berleman JE, Kirby JR. (2007) Multicellular development in Myxococcus xanthus is stimulated by predator-prey interactions. J Bacteriol 189: 5675-82.
Blackhart BD, Zusman DR (1985) "Frizzy" genes of Myxococcus xanthus are involved in control of frequency of reversal of gliding motility. Proc Natl Acad Sci U S A 82: 8767-8770.
Bui NK, Gray J, Schwarz H, Schumann P, Blanot D, Vollmer W. (2009) The peptidoglycan sacculus of Myxococcus xanthus has unusual structural features and is degraded during glycerol-induced myxospores development. J Bacteriol. 2009 191:494-505.
Burchard RP, Parish JH. (1975) Mutants of Myxococcus xanthus insensitive to glycerol-induced myxospore formation. Arch Microbiol 104:289-92.
Campos JM, Zusman DR. (1975) Regulation of development in Myxococcus xanthus: effect of 3':5'-cyclic AMP, ADP, and nutrition. Proc. Natl. Acad. Sci. USA 72:518–522.
De Carlo S, Chen B, Hoover TR, Kondrashkina E, Nogales E, Nixon BT. (2006) The structural basis for regulated assembly and function of the transcriptional activator NtrC. Genes Dev 20:1485-95.
Downard JS, Zusman DR. (1985) Differential expression of protein S genes during Myxococcus xanthus development. J Bacteriol 161:1146-55.
64
Doucleff M, Chen B, Maris AE, Wemmer DE, Kondrashkina E, Nixon BT. (2005) Negative regulation of AAA+ ATPase assembly by two component receiver domains: a transcription activation mechanism that is conserved in mesophilic and extremely hyperthermophilic bacteria. J. Mol Biol 353:242-255.
Dworkin M, (1963) Nutritional Regulation of Morphogenesis in Myxococcus xanthus. J Bacteriol 86: 67-72.
Dworkin M., Gibson S. (1964) A system for studying microbial morphogenesis: rapid formation of microcysts in Myxococcus xanthus. Science 146: 243-244.
Gooderham WJ, Hancock RE. (2009) Regulation of virulence and antibiotic resistance by two-component regulatory systems in Pseudomonas aeruginosa. FEMS Microbiol Rev 33: 279-94.
Hickman JW, Tifrea DF, Harwood CS. (2005) A chemosensory system that regulates biofilm formation through modulation of cyclic diguanylate levels. Proc Natl Acad Sci U S A. 102:14422-7.
Hiller K, Grote A, Scheer M, Münch R, Jahn D. (2004) PrediSi: prediction of signal peptides and their cleavage positions. Nucleic Acids Res 32:W375-9.
Hyakutake A, Homma M, Austin MJ, Boin MA, Häse CC, Kawagishi I. (2005) Only one of the five CheY homologs in Vibrio cholerae directly switches flagellar rotation. J Bacteriol. 187:8403-10.
Jakobsen JS, Jelsbak L, Jelsbak L, Welch RD, Cummings C, Goldman B, Stark E, Slater S, Kaiser D. (2004) Sigma54 enhancer binding proteins and Myxococcus xanthus fruiting body development.186:4361-8.
Jensen et al. (2009) STRING 8--a global view on proteins and their functional interactions in 630 organisms. Nucleic Acids Res 37:D412-6
Jiang P, Atkinson MR, Srisawat C, Sun Q, Ninfa AJ. (2000) Functional dissection of the dimerization and enzymatic activities of Escherichia coli nitrogen regulator II and their regulation by the PII protein. Biochemistry 39:13433-49.
Khan S, Pierce D, Vale RD. (2000) Interactions of the chemotaxis signal protein CheY with bacterial flagellar motors visualized by evanescent wave microscopy. Curr Biol. 10:927-30.
King A, Shannon K, Phillips I. (1980) In vitro antibacterial activity and susceptibility of cefsulodin, an antipseudomonal cephalosporin, to beta-lactamases. Antimicrob Agents Chemother 17:165-9.
Kirby JR, Kristich CJ, Saulmon MM, Zimmer MA, Garrity LF, Zhulin IB, Ordal GW. (2001) CheC is related to the family of flagellar switch proteins and acts independently from CheD to control chemotaxis in Bacillus subtilis. Mol Microbiol. 42:573-85.
65
Kirby JR, Zusman DR. (2003) Chemosensory regulation of developmental gene expression in Myxococcus xanthus. Proc Natl Acad Sci U S A 100:2008-13.
Kirby JR. (2009) Chemotaxis-like regulatory systems: unique roles in diverse bacteria.Annu Rev Microbiol 63:45-59.
Kiupakis AK, Reitzer L. (2002) ArgR-Independent Induction and ArgR-Dependent Superinduction of the astCADBE operon in Escherichia coli. J Bacteriol 184:2940-50.
Klose KE, Weiss DS, Kustu S. (1993) Glutamate at the site of phosphorylation of nitrogen-regulatory protein NTRC mimics aspartyl-phosphate and activates the protein.J Mol Biol 232:67-78
Kong KF, Jayawardena SR, Indulkar SD, Del Puerto A, Koh CL, Høiby N, Mathee K. (2005) Pseudomonas aeruginosa AmpR is a global transcriptional factor that regulates expression of AmpC and PoxB beta-lactamases, proteases, quorum sensing, and other virulence factors. Antimicrob Agents Chemother 49:4567-75.
Kristich CJ, Ordal GW. (2002) Bacillus subtilis CheD is a chemoreceptor modification enzyme required for chemotaxis. J Biol Chem. 277:25356-62.
Kroos L, Kuspa A, Kaiser D. (1986) A global analysis of developmen tally regulated genes in Myxococcus xanthus. Dev Biol 117:252–266.
LaRossa R, Kuner J, Hagen D, Manoil C, Kaiser D. (1983) Developmental cell interactions of Myxococcus xanthus: analysis of mutants. J Bacteriol 153:1394-404.
Langaee TY, Dargis M, Huletsky A. (1998) An ampD gene in Pseudomonas aeruginosa encodes a negative regulator of AmpC beta-lactamase expression. Antimicrob Agents Chemother. 42:3296-300.
Lee J, Owens JT, Hwang I, Meares C, Kustu S. (2000) Phosphorylation-induced signal propagation in the response regulator NtrC. J Bacteriol 182:5188-5195.
Lee M, Zhang W, Hesek D, Noll BC, Boggess B, Mobashery S. (2009) Bacterial AmpD at the crossroads of peptidoglycan recycling and manifestation of antibiotic resistance.J Am Chem Soc 131:8742-3.
Lee SY, De La Torre A, Yan D, Kustu S, Nixon BT, Wemmer DE. (2003) Regulation of the transcriptional activator NtrC1: structural studies of the regulatory and AAA+ ATPase domains. Genes Dev 17:2552-2563.
Licking E, Gorski L, Kaiser D. (2000) A common step for changing cell shape in fruiting body and starvation-independent sporulation of Myxococcus xanthus. J Bacteriol 182:3553-3558.
Lindberg F, Lindquist S, Normark S. (1987) Inactivation of the ampD gene causes semiconstitutive overproduction of the inducible Citrobacter freundii beta-lactamase. J Bacteriol 169:1923-8.
Livermore DM (1995) Beta-lactamases in laboratory and clinical resistance. Clin Microbiol Rev 8:557-584.
66
Lupas A, Van Dyke M, Stock J. (1991) Predicting Coled Coils from Protein Sequences, Science 252:1162-1164.
Magasanik B. (1989) Regulation of transcription of the glnALG operon of Escherichia coli by protein phosphorylation. Biochimie. 71:1005-12.
Magrini V, Creighton C, Youderian P. (1999) Site-specific recombination of temperate Myxococcus xanthus phage Mx8: genetic elements required for integration. J Bacteriol 181:4050-61.
Mascher T, Helmann JD, Unden G. (2006) Stimulus perception in bacterial signal-transducing histidine kinases. Microbiol Mol Biol Rev 70:910-38.
McCleary WR, Esmon B, Zusman DR. (1991) Myxococcus xanthus protein C is a major spore surface protein. J Bacteriol 173:2141-5.
Moya B, Dötsch A, Juan C, Blázquez J, Zamorano L, Haussler S, Oliver A. (2009) Beta-lactam resistance response triggered by inactivation of a nonessential penicillin-binding protein. PLoS Pathog. 5, e1000353.
Müller S, Shen H, Hofmann D, Schairer HU, Kirby JR. (2006) Integration into the phage attachment site, attB, impairs multicellular differentiation in Stigmatella aurantiaca. J Bacteriol 188:1701-9.
Niumsup P, Simm AM, Nurmahomed K, Walsh TR, Bennett PM, Avison MB. (2003) Genetic linkage of the penicillinase gene, amp, and blrAB, encoding the regulator of beta-lactamase expression in Aeromonas spp. J Antimicrob Chemother 51:1351-8.
Nohaile M, Kern D, Wemmer D, Stedman K, Kustu S. (1997) Structural and functional analyses of activating amino acid substitutions in the receiver domain of NtrC: evidence for an activating surface. J Mol Biol 17:299-316.
O'Connor KA, Zusman DR. (1997) Starvation-independent sporulation in Myxococcus xanthus involves the pathway for beta-lactamase induction and provides a mechanism for competitive cell survival. Mol Microbiol 24:839-50.
O'Connor KA, Zusman DR. (1999) Induction of beta-lactamase influences the course of development in Myxococcus xanthus. J Bacteriol. 181:6319-31.
Poole K (2004) Resistance to beta-lactam antibiotics. Cell Mol Life Sci 61:2200-2223.
Rao CV, Glekas GD, Ordal GW. (2008) The three adaptation systems of Bacillus subtilis chemotaxis. Trends Microbiol. 16:480-7.
Reitzer LJ, Magasanik B. (1985) Expression of glnA in Escherichia coli is regulated at tandem promoters. Proc Natl Acad Sci U S A. 82:1979-83.
Schwab S, Souza EM, Yates MG, Persuhn DC, Steffens MB, Chubatsu LS, Pedrosa FO, Rigo LU. (2007) The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA. Can J Microbiol. 53:100-5.
67
Shi X, Wegener-Feldbrügge S, Huntley S, Hamann N, Hedderich R, Søgaard-Andersen L. (2008) Bioinformatics and experimental analysis of proteins of two-component systems in Myxococcus xanthus. J Bacteriol. 190:613-24.
Shiau SP, Chen P, Reitzer (1993) Effects of insertions and deletions in glnG (ntrC) of Escherichia coli on nitrogen regulator I-dependent DNA binding and transcriptional activation.J bacterial 175:190-9.
Shimkets LJ. (1999) Intercellular signaling during fruiting-body development of Myxococcus xanthus. Annu Rev Microbiol 53:525-49.
Stock AM, Robinson VL, Goudreau PN. (2000) Two-component signal transduction. Annu Rev Biochem 69:183-215.
Vlamakis HC, Kirby JR, Zusman DR. (2004) The Che4 pathway of Myxococcus xanthus regulates type IV pilus-mediated motility. Mol Microbiol 52: 1799-1811.
Ulrich LE, Zhulin IB. (2007) MiST: a microbial signal transduction database. Nucleic Acids Research 35:D386-90.
Wall D, Kaiser D. (1999) Type IV pili and cell motility. Mol Microbiol 32: 1-10.
Weiss DS, Batut J, Klose KE, Keener J, Kustu S. (1991) The phosphorylated form of the enhancer-binding protein NTRC has an ATPase activity that is essential for activation of transcription. Cell 67:155-67.
Wolgemuth C, Hoiczyk E, Kaiser D, Oster G. (2002) How myxobacteria glide. Curr Biol 12: 369-377.
Xu Q, Black WP, Ward SM, Yang Z, (2005) Nitrate-dependent activation of the Dif signaling pathway of Myxococcus xanthus mediated by a NarX-DifA interspecies chimera. J Bacteriol 187:6410-6418.
Yang Z, Ma X, Tong L, Kaplan HB, Shimkets LJ, Shi W, (2000) Myxococcus xanthus dif genes are required for biogenesis of cell surface fibrils essential for social gliding motility. J Bacteriol 182: 5793-5798.
Yang XF, Ji Y, Schneider BL, Reitzer L. (2004) Phosphorylation-independent dimer-dimer interactions by the enhancer-binding activator NtrC of Escherichia coli: a third function for the C-terminal domain. J Biol Chem 279:36708-14.
Zapun A, Contreras-Martel C, Vernet T. (2008) Penicillin-binding proteins and beta-lactam resistance. FEMS Microbiol Rev 32:361-85.
Zhang Y, Pohlmann EL, Roberts GP. (2005) GlnD is essential for NifA activation, NtrB/NtrC-regulated gene expression, and posttranslational regulation of nitrogenase activity in the photosynthetic, nitrogen-fixing bacterium Rhodospirillum rubrum. J Bacteriol 187:1254-65.