Danger signal adenosine via adenosine 2a receptor stimulates growth of Porphyromonas gingivalis in primary gingival epithelial cells.pdf

Danger signal adenosine via adenosine 2areceptor stimulates growth of Porphyromonasgingivalis in primary gingival epithelial cellsR. Spooner1,*, J. DeGuzman1,*, K.L. Lee1 and O. Yilmaz1,2

1 Department of Periodontology, University of Florida, Gainesville, FL, USA

2 Emerging Pathogens Institute, University of Florida, Gainesville, FL, USA

Correspondence: Ozlem Yilmaz, Department of Periodontology, College of Dentistry, and Emerging Pathogens Institute, University ofFlorida, Gainesville, FL 32610-0434, USA Tel.: + 1 352 273 8003; fax: +1 352 273 6192; E-mail: [email protected]*These two authors contributed equally to the primary authorship of this article.

Keywords: A2a receptor; epithelial mucosa; periodontal disease; persistence; purinergic signalingAccepted 16 December 2013DOI: 10.1111/omi.12045

SUMMARY

Extracellular signaling during inammation andchronic diseases involves molecules referred toas Danger Signals (DS), including the small mol-ecule adenosine. We demonstrate that primarygingival epithelial cells (GEC) express a family ofG-protein coupled receptors known as adenosinereceptors, including the high-afnity receptors A1and A2a and low-afnity receptors A2b and A3.Treatment of Porphyromonas gingivalis-infectedGEC with the A2a receptor-specic agonist CGS-21680 resulted in elevated intracellular bacterialreplication as determined by uorescence micros-copy and antibiotic protection assay. Additionally,A2a receptor antagonism and knockdown viaRNA interference signicantly reduced metaboli-cally active intracellular P. gingivalis. Further-more, analysis of anti-inammatory mediatorcyclic AMP (cAMP) following A2a receptor selec-tive agonist CGS-21680 stimulation inducedsignicantly higher levels of cAMP during P. gin-givalis infection, indicating that adenosine signal-ing may attenuate inammatory processesassociated with bacterial infection. This studyreveals that the GEC express functional A2areceptor and P. gingivalis may use the A2a recep-tor coupled DS adenosine signaling as a meansto establish successful persistence in the oral

mucosa, possibly via downregulation of thepro-inammatory response.

INTRODUCTION

Porphyromonas gingivalis is a gram-negative opportu-nistic pathogen that has been strongly involved insevere forms of periodontitis and recently associatedwith a number of other chronic pathologies. Gingivalepithelial cells (GEC), which form the initial barrier tothe colonizing bacteria in the gingival crevice andfunction as an important arm of the immune system,are among the rst host cells populated by P. gingiva-lis (Yilmaz et al., 2008). The organism has been dem-onstrated to successfully enter and replicate in GECand exhibit highly specialized host-adaptive mecha-nisms to establish persistence in the oral epithelium(Yilmaz 2008; Yao et al., 2010; Choi et al., 2011,2013).Infected, dying or stressed cells release danger

signals (DS) that are normally found in the cytosoland nucleus of healthy cells, including ATP and aden-osine. A key DS molecule is adenosine triphosphate(ATP), a nucleoside molecule involved in cellularenergetics. Despite its commonly understood role asan energy source, it is becoming increasingly evident

molecular oral microbiology

2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd 67Molecular Oral Microbiology 29 (2014) 6778

molecular oral microbiology

InspironResaltar

that ATP is a potent regulator of inammation (Ishii &Akira, 2008). ATP released from inamed tissues actsthrough ionotropic purinergic receptors, notably P2X7receptor, to activate specic pro-inammatory signal-ing cascades (Miller et al., 2011). These downstreameffects of ATP-P2X7 coupling can also limit the abilityof opportunistic pathogens to establish intracellularinfections (Coutinho-Silva & Ojcius, 2012). We previ-ously demonstrated that P. gingivalis effectively sub-verts the ATP-P2X7-mediated host response in GECto support its colonization in the oral mucosa (Yilmazet al., 2008; Choi et al., 2013).A less appreciated component of the innate

immune armamentarium is the DS adenosine, ametabolite of ATP that is generated via a series ofenzymatic reactions in normal, stressed and infectedtissues (Yegutkin, 2008). The pro-inammatory fea-tures of ATP, especially for limiting of intracellularinfections, have been thoroughly studied, whereasthe anti-inammatory nature of adenosine duringinfection remains largely unexplored (Bours et al.,2006). Adenosine receptors are G-protein-coupledreceptors belonging to the P1 superfamily, includingA1, A2a, A2b and A3 subtypes, all of which havevarying degrees of sensitivity to adenosine. The A2areceptor is highly sensitive to adenosine and sup-presses inammation by relying on cAMP-dependentactivation of downstream effectors including Akt (orprotein kinase B), cAMP response element-bindingprotein and nuclear factor-jB (Jacobson & Gao,2006). Recent studies demonstrate that stimulation ofthe A2a receptor with the receptor-specic agonistCGS-21680 reduces lung inammation by interferingwith neutrophil migration (Impellizzeri et al., 2011)and protects activated T-cell lymphocytes from activa-tion-induced cell death (Himer et al., 2010). Duringinfection, the A2a receptor has been shown to sup-press inammation caused by gastric T-cell lympho-cytes while simultaneously promoting persistence ofHelicobacter pylori (Alam et al., 2009). While addi-tional studies have evaluated the importance of otheradenosine receptors in infection, notably A2b duringinfections by Chlamydia (Pettengill et al., 2009) andKlebsiella (Barletta et al., 2012) in neutrophils andHeLa cells, little is known about A2a receptor functionin controlling intracellular bacterial infections. Further-more, the role of adenosine signaling in the contextof oral bacteria and gingival epithelium interactionremains completely uncharacterized.

Recent literature supports the importance of adeno-sine signaling in the oral cavity, particularly for peri-odontal disease. Bitto et al. (2013) reported anadenosine-dependent reduction in periodontal inam-mation in rat models, while another study detectedelevated A2a receptor mRNA expression in gingivaltissues of patients diagnosed with chronic periodontaldisease (Sun et al., 2011). Furthermore, macrophag-es have been shown to upregulate A2a receptormRNA when challenged with lipopolysaccharide(Streitova et al., 2009). For the opportunistic patho-gens, Staphylococcus aureus and Bacillus anthracis,manipulation of adenosine concentration appears tobe a key survival mechanism and contributor to path-ogenesis (Thammavongsa et al., 2009). Given theanti-inammatory nature of P. gingivalis infection inthe GEC, including antagonism of pro-inammatorycytokine interleukin-8 induced by other pathogens(Takeuchi et al., 2013) and attenuation of host cellapoptosis, it became logical for us to explore adeno-sine and the A2a receptor coupling during P. gingiva-lis infection.The present study demonstrates for the rst time

that primary GEC express the full complement ofadenosine receptors, including the A2a receptor thatis distributed across the cell membrane. Stimulationof P. gingivalis-infected GEC with the A2a receptor-specic agonist CGS-21680 strongly induces prolifer-ation of intracellular P. gingivalis, whereas treatmentwith the broad-spectrum adenosine receptor agonistNECA has much less effect on the amount ofinfection. Antibiotic protection assay of P. gingivalis-infected GEC treated with A2a receptor-specic ago-nist CGS-21680 revealed signicantly higher amountsof recoverable P. gingivalis than the unstimulatedinfected cells. Treatment of P. gingivalis-infectedGEC with A2a receptor-specic antagonist SCH-58261 inhibited intracellular growth of bacteria. Addi-tionally, small interfering (siRNA) depletion of the A2areceptor resulted in substantially reduced levels ofmetabolically active avin mononucleotide-baseduorescent protein-expressing P. gingivalis (PgFbFP),further strengthening the results of this study. Further-more, stimulation of GEC with the A2a receptor-specic agonist CGS-21680 resulted in elevated cAMP,indicating activation of anti-inammatory A2a receptorsignaling. This study shows a novel anti-inammatoryimmune response used by P. gingivalis to furtherpromote successful subsistence in the oral mucosa.

68 2013 John Wiley & Sons A/S. Published by John Wiley & Sons LtdMolecular Oral Microbiology 29 (2014) 6778

Adenosine stimulates Porphyromonas growth R. Spooner et al.

InspironResaltar

InspironResaltar

METHODS

Bacteria and cell culture

The P. gingivalis ATCC 33277 was cultured anaerobi-cally for 24 h at 37C in trypticase soy broth supple-mented with yeast extract (1 lg ml1), hemin(5 lg ml1) and menadione (1 lg ml1). Bacteria weregrown for 24 h, harvested by centrifugation at 6000 gand 4C for 10 min, washed and re-suspended inDulbeccos phosphate-buffered saline (PBS), pH 7.3,before incubation with host cells. Bacteria were quan-tied using a KlettSummerson photometer.Primary GEC were obtained after oral surgery in

the clinics of the University of Florida from healthygingival tissue as previously described (Yilmaz et al.,2002). Cells were cultured as monolayers in serum-free keratinocyte growth medium (Lonza, Walkersville,MD) at 37C in 5% CO2. The GEC were used forexperimentation at 80% conuence and cultured for48 h before infection with bacterial cells or exposureto other test reagents in keratinocyte growth medium.The passage number of the primary GEC used forthe experiments ranged from three to seven with con-sistently similar results.

Reverse transcription polymerase chain reactionanalysis for adenosine receptors

Total RNA was isolated from primary GEC using anRNeasy kit (Qiagen, Hilden, Germany) following themanufacturers instructions. Total RNA was convertedinto cDNA by standard reverse transcription (RT) withMoloney-murine leukemia virus-Reverse Transcrip-tase (Promega, Madison, WI). Complementary DNAswere amplied using the MJ, Mini (BIO-RAD Labora-tories, Hercules, CA) in a 25-ll reaction mixture con-taining one-fteenth of the cDNA generated from RTreaction, 10 9 PCR buffer, 2.5 mM MgCl2, 0.25 mM

(each) dNTPs, 0.5 lM forward and reverse primers,and 1 U GoTaq DNA polymerase (Promega). Thesequences of the primers used for A1, A2a, A2b andA3 were designed and obtained from Invitrogen(Carlsbad, CA; Table 1). The optimum annealing tem-peratures for each set of primers was determinedbefore beginning the polymerase chain reaction (PCR)cycling (data not shown). The PCR protocol for therespective primers was initiated at 94C for 1 min,pre-determined annealing temperature for 1 min, and72C for 1 min. The protocol was conducted for 30cycles and included an initial 5-min enzyme activationstep at 94C and a nal 5-min extension step at 72C.No reverse transcriptase control was included in theassays. The PCR products were electrophoresed on a1.5% agarose gel and visualized by ethidium bromidestaining. At least three different cell lines of GEC wereused for the analysis.

Surface expression analysis of A2a adenosinereceptor via immunouorescence microscopy

Gingival epithelial cells were grown on four-well cham-bered glass slides (Nalge-Nunc International, Roches-ter, NY), washed with ice-cold PBS, and xed with10% neutral buffered formalin for 1 h at room tempera-ture. After washing twice with PBS, the cells were trea-ted with permeabilization solution (0.1% Triton X-100)for 15 min. Samples were then washed twice with PBSand incubated with antibody raised in mice against full-length recombinant human A2a receptor (Santa CruzBiotechnology, Dallas, TX) and detected with Alexa-Fluor 594 anti-mouse secondary antibody (Invitrogen).Samples with no primary antibody incubation wereincluded as control. Glass coverslips to visualizethe samples were mounted using media containing 4,6-diamidino-2-phenylindole (DAPI) 1 lg ml1 (VectorLabs, Burlingame, CA) to visualize the nuclei. Finally,

Table 1 Reverse transcription polymerase chain reaction primers for adenosine receptors with optimized annealing temperatures andexpected amplied product size

Subtype Forward (53) Reverse (35)

Expected

size

Optimized annealing

temperature (C)

A1 CCACAGACCTACTTCCACAC GTAGATGAGGACCATGAGGA 384 56A2a AACGTCACCACTACTTTGT AGTTGAAGTACACCATGTAG 430 61

A2b GCTCCATCTTCAGCCTTCTG ACCCAGAGGACAGCAATGAC 121 66A3 CTGCTTGAGTCCTGAGTCAC CCACACCTCAGAGACTGATT 801 61


R. Spooner et al. Adenosine stimulates Porphyromonas growth

the samples were washed twice with PBS and ana-lyzed using a Zeiss Axio Imager A1 uorescencemicroscope equipped with band pass optical lter setsappropriate for imaging of the dyes and a cooled CCDcamera (Qimaging, Surrey, BC, Canada). Single expo-sure images were captured sequentially and savedusing QCAPTURE software v.1394 (Qimaging).

Pharmacological treatment of adenosinereceptors in P. gingivalis-infected GEC

Gingival epithelial cells were infected at a multiplicityof infection (moi) of 100 with P. gingivalis for 24 h at37C in a 5% CO2 incubator. For analysis of effectsof adenosine receptors on P. gingivalis infection, theinfected GEC were treated at 1 h and 3 h post-infec-tion with 10 lM A2a receptor-specic agonist CGS-21680 (Tocris Biosciences, Bristol, UK), 100 lMbroad-spectrum adenosine receptor agonist 5-N-eth-ylcarboxamidoadenosine (NECA; Sigma, St Louis,MO), or 10 lM A2a-specic antagonist SCH-58261(Tocris Biosciences). Pharmacological reagents werechosen based on available literature (Jacobsen et al.,2006). All time-points for the infections were carriedbackwards, so that all incubations could be stoppedand assayed at the same time at the end of 24 h.

Impact of adenosine receptor on P. gingivalisinfection via immunouorescence microscopyanalysis

Immunouorescence labeling and microscopy fordetermining the level of infection were performed aspreviously described (Yilmaz et al., 2006). Briey,GEC cultivated on four-well chambered cover-glassslides were infected with P. gingivalis at an moi of100 at 37C for 24 h. The samples were incubatedwith anti-P. gingivalis 33277 antibody (a gift from Dr.Richard J Lamont) and reacted with Oregon Green488 secondary antibody (Invitrogen), and glass cover-slips were mounted using media with DAPI (VectorLabs). The samples were visualized using the uores-cence microscope system described above. Acquiredimages were analyzed for the intensity of uores-cence emitted from the infected samples withNational Institutes of Health (NIH) IMAGEJ analysis soft-ware. An average of 175 elds per sample were stud-ied from at least two separate experiments performedin duplicate.

Antibiotic protection assay

The GEC were infected at an moi of 100 with P. gin-givalis for 24 h at 37C in a 5% CO2 incubator. A2areceptor-specic agonist CGS-21680 was added toculture at 1 h post-infection to a nal concentration of10 lM. Three hours after infection, culture mediumwas replaced with 400 lM metronidazole and 500 lMgentamicin diluted in PBS and cells were incubatedfor an additional 1 h at 37C. Cells were washedthree times with PBS and lysed in 1 ml sterile H2O at37C for 30 min. Recovered lysate was then platedon blood agar plates and incubated at 37C for 48 hfor analysis of colony formation. The average of totalcolony-forming units ml1 of unstimulated infectedGEC was set as 100%.

Flavin mononucleotide-based uorescent protein-expressing P. gingivalis

Further analyses to verify immunouorescence obser-vations reported in this study were determined byusing a P. gingivalis ATCC 33277 transformant strain(PgFbFP) previously developed in our laboratory(Choi et al., 2011). GEC cultured in four-well cover-glass slides were infected at an moi of 100 withPgFbFP for 24 h at 37C in a 5% CO2 incubator. TheGEC were treated with A2a receptor-specic agonistCGS-21680 and A2a receptor-specic antagonistSCH-58261 at 3 h post-infection and A2a-knockdowncells were also used. Cells were washed with ice-coldPBS, and xed with 10% neutral buffered formalin for1 h at room temperature. Pictures were taken using aZeiss Axio Imager A1 microscope and a cooled-CCDcamera (Qimaging). Fluorescence intensity analysiswas carried out using NIH IMAGEJ software. An aver-age of 175 elds per sample were studied from twoseparate experiments performed in duplicate.

Depletion of A2a by RNA interference

Small interfering RNA (20 lM) solution was diluted in1 9 siRNA buffer (Dharmacon, Pittsburgh, PA) to anal concentration of 5 lM. Per culture dish well,10 ll of 5 lM siRNA solution was added to 190 llserum-free solution and 2 ll of DharmaFECT transfec-tion reagent was added to 198 ll serum-free medium;each solution was incubated at room temperatureafter mixing for 5 min. The siRNA and transfection



reagent solutions were then mixed gently togetherand incubated at room temperature for 20 min. TheGEC were cultured in six-well dishes at 37C for 24 hbefore siRNA transfection. Then, 1.6 ml of antibiotic-free medium was added along with 400 ll of pre-pared siRNA/transfection reagent solution to yield anal concentration of 25 nM siRNA per culture well.Non-target pool siRNA (Dharmacon) and transfectionagent alone were used as negative controls. A2areceptor knockdown GEC were veried using quanti-tative RT-PCR as described previously (Yilmaz et al.,2010), resulting in ~ 67% depletion of A2a receptor inknockdowns (data not shown).

cAMP level detection

Assessment of intracellular cAMP levels was carriedout by using cyclic AMP (Direct) Enzyme Immuno-metric Assay kit per manufacturers instructions(Assay Designs, Ann Arbor, MI). Uninfected, non-trea-ted GEC were used as baseline controls. Analysisconditions included non-treated P. gingivalis-infectedGEC, 10 lM A2a receptor-specic agonist CGS-21680-treated uninfected GEC, P. gingivalis-infectedGEC treated with 10 lM CGS-21680 1 h post-infec-tion, uninfected GEC treated with 10 lM A2a recep-tor-specic antagonist SCH-58261 and subsequentlystimulated with 10 lM CGS-21680 1 h after initialtreatment, and SCH-58261-treated GEC 1 h beforeinfection with P. gingivalis. Samples were preparedper the manufacturers specications in microtiterplates and cAMP signal was detected via absorbanceat 405 nm. Time courses of infections and pharmaco-logical treatments were carried out backwards, so allconditions could be assayed at the same time.

RESULTS

Primary GEC express functional adenosinereceptors

A2a receptors are expressed in a variety of tissues,and their presence in oral tissues has been reportedto occur in gingival broblasts (Murakami et al., 2001)and epithelium (Murakami et al., 2002). To conrmthe adenosine receptor expression prole of primaryGEC, we used RT-PCR and immunouorescencemicroscopy. RT-PCR analysis revealed that primaryGEC express all four adenosine receptor subtypes,

as amplicons were detected for A1, A2a, A2b and A3receptors (Fig. 1A). Immunouorescence microscopyconrmed the surface expression of the A2a receptoruniformly throughout the primary GEC cell membrane(Fig. 1B). Hence, cells of the oral mucosa liningexpress all members of the adenosine receptor familyincluding the A2a receptor.

Stimulation of the A2a receptor promotesenhanced infection by P. gingivalis

A variety of chemical compounds are known to serveas agonists for adenosine receptors. To ascertain theeffects of the A2a receptor specically, 10 lM CGS-21680, an A2a receptor-specic agonist, was added to

A

B

Figure 1 Primary gingival epithelial cells (GEC) express adenosinereceptors. (A) Reverse transcription-polymerase chain reactionanalysis of adenosine receptor expression prole in primary GEC.Amplicons of expected sizes were detected for A1 (384 bp), A2a

(430 bp), A2b (121 bp) and A3 (801 bp) receptors. The results arerepresentative of at least three different GEC lineages. (B) Detectionof A2a receptor expression at the cell membrane of GEC via immu-nouorescence microscopy. Cells were xed and subsequently

incubated with A2a receptor primary antibody. Staining of cells withconjugated Alexa-Fluor 594 secondary antibody (red) and DAPI(blue) was used to visualize expression pattern of A2a receptor.

The staining revealed a diffuse expression of the A2a receptorthroughout the cell membrane.



the P. gingivalis-infected GEC culture medium at 1 hand 3 h post-infection. NIH software IMAGEJ was usedto analyze captured images and quantify uorescencecorresponding to intracellular P. gingivalis. A2a recep-tor-specic agonist CGS-21680 treatment of P. gingi-valis-infected GEC resulted in twice the amount ofintracellular P. gingivalis compared with untreated con-trols (signicant at P < 0.001; Fig. 2). The establishedbroad-spectrum adenosine receptor agonist NECA(100 lM), was also used to determine the effects ofgeneral adenosine receptor stimulation on P. gingivalisinfection. Treatment of P. gingivalis-infected GEC at1 h and 3 h post-infection with broad-spectrum adeno-sine receptor agonist NECA resulted in minimal effectson the level of intracellular P. gingivalis compared withuntreated control (see Fig. S1AD).To better evaluate the role of A2a receptor in

the intracellular proliferation of P. gingivalis, we

performed an antibiotic protection assay comparingthe amount of live recoverable bacteria in A2a recep-tor-specic agonist CGS-21680-treated and untreatedinfected GEC (Fig. 3). The results of this experimentfurther conrmed our earlier ndings, with twice asmany live P. gingivalis recovered from GEC that hadbeen treated with A2a receptor-specic agonist CGS-21680, compared with untreated controls. Hence,A2a receptor activation likely plays a key role inpromoting elevated levels of intracellular P. gingivalisin primary GEC.

Inhibition and depletion of A2a receptorsuppresses P. gingivalis infection

Although the ndings presented above indicate thatstimulation of the A2a receptor appears to be importantfor P. gingivalis infection, our examinations led us to

A

B

i ii iii

Figure 2 A2a receptor activation results in elevated number of intracellular Porphyromonas gingivalis. Gingival epithelial cells (GEC) wereinfected with P. gingivalis at a multiplicity of infection of 100 for 24 h total infection time. Samples were xed and stained with P. gingivalisprimary antibody and subsequently stained with Oregon Green 488 secondary antibody (green) and DAPI (blue) to visualize infection.

(A) i. Infected untreated GEC, ii. Infected GEC treated 1 h post-infection with A2a receptor selective agonist CGS-21680. iii. Infected GECtreated 3 h post-infection with CGS-21680. Images presented here are representative of at least 175 elds studied in experiments that wereperformed on two separate occasions in duplicate. (B) Analysis of uorescent levels using IMAGEJ software revealed elevated levels of P. gin-

givalis in both treatment conditions compared to control. At 1 h post-infection P. gingivalis levels were ~ 2.5 times that of control and were~ 3 times higher at 3 h post-infection. Asterisks (*) denote statistical signicance (P < 0.001 Student t-test).



inquire about what effect preventing A2a receptor acti-vation would have on P. gingivalis infection. SCH-58261, an A2a receptor-specic antagonist, was usedto assess the impact that A2a receptor blockade hason infection. Infected GEC were treated with 25 lMSCH-58261 at 3 h post-infection and P. gingivalis lev-els were determined at 24 h total infection time usinguorescence microscopy. Quantication of P. gingiva-lis uorescence levels revealed a signicant(P < 0.001) suppression of infection compared withcontrol and CGS-21680 treatment conditions (Fig. 4A,B). These ndings prompted us to further examine therelationship between A2a receptor and P. gingivalisinteraction by using RNA interference. We rst deter-mined that A2a siRNA did not induce cell death in unin-fected GEC (data not shown). A2a gene silencingsignicantly (P < 0.001) hindered intracellular numbersof P. gingivalis at 24 h, with infection levels ~ 50% ofinfected controls (Fig. 4A,B). Hence, a functional A2areceptor appears to be important for successful coloni-zation of P. gingivalis in primary GEC.

Porphyromonas gingivalis infection elevatesintracellular cAMP levels via A2a receptor

Adenosine receptors, including A2a, are G-proteincoupled receptors that act through adenylyl cyclase

to alter the concentration of intracellular cAMP (Jac-obson & Gao, 2006). Recent studies of other intracel-lular organisms indicate an important role for cAMPduring infection that contributes to persistence ofinfection (Macdonald et al., 2013). Cytosolic cAMPlevels during infection or CGS-21680, SCH-58261treatments were measured to verify the effect ofadenosine via A2a receptors over a time course rang-ing from 30 min to 24 h (Fig. 5). Levels of cAMP inGEC showed two-fold increase at 6 h followingA2a-selective CGS-21680 treatment and infectionwith P. gingivalis showed a similar trend. Theincrease in cAMP level was inhibited when A2areceptor-stimulated GEC were treated with the A2areceptor-specic antagonist SCH-58261. An initialincrease was observed in P. gingivalis-infected sam-ples, but began receding to normal levels at 8 h afterinfection in the presence of SCH-58261. These dataindicate that during P. gingivalis infection, cAMPlevels are elevated in GEC, and the A2a receptorcontributes to this observed effect (Figs 5 and 6).

DISCUSSION

Small molecules including ATP and adenosine act asDS in tissues and help prime the innate and adaptiveimmune arms to respond to tissue insult via puriner-gic signaling (Sitkovsky & Ohta, 2005; Bours et al.,2006; Ishii & Akira, 2008). Purinergic signalingthrough ATP has been shown to be strongly involvedin mediating inammatory responses, including upreg-ulation of proinammatory cytokines, production ofreactive oxygen species and cell death. Conversely,adenosine is associated with reduction in inamma-tion and immunosuppressive actions including inhibi-tion of neutrophil migration through vascular wallsand preventing T-cell-mediated tumor destruction(Ohta et al., 2006; Karmouty-Quintana et al., 2013).Hence, the extracellular environment containingpotent DS ATP and adenosine can act through theirrespective receptors (e.g. P2X7 or A2a receptors) tomodulate the inammatory status of tissues infectedby opportunistic pathogens.The complex nature of the relationship between

intracellular pathogens and their host cells involvesinside-out and outside-in signaling. Adenosine recep-tor activation appears to be a conserved theme forbacterial pathogens, with several reports highlightingthe importance of adenosine receptors in bacterial

Figure 3 Antibiotic protection assay of Porphyromonas gingivalis-infected gingival epithelial cells (GEC) yields more live bacteriarecovered after stimulation of A2a receptor. Stimulation of A2areceptor in P. gingivalis-infected GEC resulted in greater amountsof live bacteria recovered after host cell lysis and plating of intracel-

lular contents on blood agar plates. There was greater than twicethe amount of P. gingivalis recovered after A2a activation comparedwith unstimulated infected control. Asterisk (*) indicates statistical

signicance (P < 0.001 Student t-test) between untreated infectedcontrols and A2a receptor activated infected GEC.



infections. For example, persistent infections of epi-thelial cells by Chlamydia trachomatis were found tobe dependent upon A2b receptor activation (Pettengillet al., 2009) and A2b receptors were found to beresponsible for Clostridium difcile-mediated inam-mation and disease in murine gut epithelium models(Li et al., 2012). Further studies of the A2b receptorreveal enhanced clearance of Klebsiella pneumoniaein lung tissues of A2b-decient mice, suggesting thatthis adenosine receptor may provide protection forbacterial infection (Barletta et al., 2012). In addition,Popov et al. (2011) reported that stimulation of theA3 receptor contributes to resolution of B. anthracisinfections, suggesting a potential role for adenosinereceptors in cutaneous infections by this pathogen.The role of A2a receptor in bacterial infections on theother hand, remains yet to be fully characterized, withfew studies directly examining the effects of A2a

receptor on infected tissues. Despite this, there is areal need to characterize the interaction between A2areceptor and opportunistic persistent bacteriabecause the anti-inammatory nature of adenosinesignaling makes it a target for chronic pathogens. Todate, studies have only examined the A2a receptorinfection relationship in the context of sepsis models(Sullivan et al., 2004; Nemeth et al., 2006; Li et al.,2012) and bacterial toxin-challenged macrophages ormonocytes (Souza et al., 2009; Sun et al., 2010).Only Alam et al. (2009) directly examined the impactof A2a receptor activation on bacterial survival duringinfection, with the results showing increased Helicob-acter pylori present in tissue sections of gut mucosa.Our ndings on the interaction between the A2a

receptor and the opportunistic infection represent arst direct visualization of colonizing bacteria insidethe host cells using the A2a receptor-specic agonist

A

Bi ii iii iv

Figure 4 Suppression of Porphyromonas gingivalis infection via pharmacological inhibition or RNAi knockdown of A2a receptor. (A) Primarygingival epithelial cells (GEC) were infected with the PgFbFP strain at a multiplicity of infection of 100 for 24 h, xed and stained with DAPI(blue) to visualize nuclei. The relative amount of intracellular bacteria determined by IMAGEJ software analysis of images detected using uo-rescence microscopy. Treatment of infected GEC with A2a receptor specic agonist CGS-21680 resulted in a ~ 100% increase in levels of

metabolically active bacteria compared with untreated infected control. A2a receptor specic antagonist SCH-58261 treated infected GECyielded ~ 30% less infection compared with control. A2a receptor knockdown GEC were infected with the PgFbFP strain and the intracellularbacteria levels at 24 h post-infection were quantied and compared with wild-GEC controls. Asterisks (*) indicate statistical signicance

(P < 0.001 Student t-test) between CGS-21680 and control, SCH-58261 and control, A2a knockdown condition and control. (B) The represen-tative images of the conditions described above i. PgFbFP-infected GEC, ii. PgFbFP-infected GEC were treated with A2a receptor-specicagonist CGS-21680, iii. PgFbFP-infected GEC were treated with A2a receptor-specic antagonist SCH-58261, iv. PgFbFP-infected A2a recep-tor knockdown GEC. Images presented here are representative of at least 175 elds studied in experiments that were performed on two sep-

arate occasions in duplicate.



and a stable analogue of adenosine, CGS-21680.Additionally, using A2a selective agonist CGS-21680to stimulate P. gingivalis-infected GEC induced recov-ery of more live bacteria as determined by antibioticprotection assay. This nding indicates that there aremore P. gingivalis within the host cell upon stimulationby the agonist treatment and the bacteria are replicat-ing at signicantly high rates. The observed increasein numbers of intracellular P. gingivalis was abolishedwhen P. gingivalis-infected GEC were treated with theA2a receptor-specic antagonist SCH-58261, implicat-ing A2a receptor as the key contributor to observedelevation in bacterial number. Treatment of the P. gin-givalis-infected GEC with adenosine, which is unstablein vitro, at 10 lM, also enhanced the intracellular infec-tion by ~ 50% (data not shown). Furthermore, the useof a self-uorescing P. gingivalis transformant strain(PgFbFP) enabled us to demonstrate that the A2areceptor-specic agonist CGS-21680 signicantlyincreased the number of metabolically active P. gingi-valis within the host cells and the depletion of A2a

receptor by siRNA substantially reduced the metaboli-cally active/live P. gingivalis. These results suggestthat not only does intracellular P. gingivalis respond toactivation of A2a receptor, but that the bacteriabecome more active and proliferate at higher rates.Previous literature demonstrates that adenosine

directly enhances growth of pathogenic strains ofenteropathogenic Escherichia coli (Crane & Shulgina,2009). Our own data indicate that directly supplyingadenosine to P. gingivalis cultures has a detrimentaleffect on tryptic soy broth cultured P. gingivalis growth(see Fig. S2A), suggesting that P. gingivalis mayrequire a concerted interaction between host cellmachinery to use adenosine signaling for proliferation.However, elevated cAMP production by adenylylcyclase after A2a receptor activation could explain theobserved increase in bacterial number in P. gingivalis-infected GEC by dampening and/or evading the innateimmune response. A2a engagement has been shownto play a non-redundant role in downregulating inam-mation in vivo, and adenosine was demonstrated toinhibit interleukin-8 secretion by intestinal epithelialcells through its ability to prevent nuclear factor-jBactivation. This is consistent with the ability of P. gingi-valis to inhibit interleukin-8 production and suppressinterleukin-1 secretion in GEC (Yilmaz et al., 2010;Takeuchi et al., 2013). On the other hand, elevatedintracellular cAMP has been shown to promote growthof Mycobacterium species in macrophages (Bai et al.,2009), so it is plausible that cAMP could serve as anenergy source for the replicating P. gingivalis in theA2a receptor-activated GEC (Figs 5 and 6).Recent studies from our laboratory indicate that the

P. gingivalis effector enzyme nucleoside-diphosphate-kinase (Ndk) is secreted extracellularly from P. gingi-valis-infected GEC. This nucleotide-convertingenzyme homologue catalytically depletes extracellularATP, resulting in inhibition of P2X7 receptor-mediatedcellular reactive oxygen species production and hostcell apoptosis (Yilmaz et al., 2008; Choi et al., 2013).The inside-out effect we observed suggests thatP. gingivalis has the capacity to reduce extracellularnucleotide concentrations of ATP, thereby acting as agenerator of adenosine. It remains to be determined ifP. gingivalis Ndk facilitates adenosine receptor acti-vation; however, it is tempting to speculate that therecould be a connection between inhibiting pro-inammatory ATP while simultaneously generatinganti-inammatory adenosine. Interestingly, alteration

Figure 5 Activation of A2a receptor during Porphyromonas gingiva-lis infection increases intracellular cAMP levels. Uninfected andnon-treated gingival epithelial cells (GEC) were used as control(CON). GEC infected with P. gingivalis, A2a receptor-specic ago-

nist CGS-21680 treated GEC (CGS), A2a receptor-specic antago-nist SCH-58261-treated GEC (SCH), A2a receptor stimulated andinfected GEC (CGS + P. gingivalis), A2a receptor stimulated and

subsequently inhibited GEC (CGS + SCH), and A2a receptor antag-onist treatment followed by infected GEC (SCH + P. gingivalis) wereused as experimental conditions. Intracellular cAMP levels were

measured using an ELISA-based cAMP detection kit (AssayDesigns) at 30 min, 2, 6, 12 and 24 h post-infection. Resultsrepresent normalized levels of cAMP compared with uninfectednon-treated controls and were obtained from experiments performed

in triplicate.



of adenosine concentrations appears to be an impor-tant survival mechanism for some opportunistic patho-gens. Staphylococcus aureus and B. anthracis werefound to possess an enzyme, Adenosine synthase,which aids in evasion of host immune defenses(Thammavongsa et al., 2009). The study found thatadenosine synthase homologues have 5-nucleotid-ase activity, which synthesizes adenosine from ATP,resulting in enhanced survival in blood and reducedphagocytic clearance of these opportunistic patho-gens. The same study also found that other importantoral cavity bacteria including Enterococcus faecalisand Streptococcus mutans possess uncharacterizedhomologues of adenosine synthase. This line ofinquiry has not been fully explored to date; however,preliminary investigations carried out in our laboratoryagree that P. gingivalis also possesses a putativeadenosine synthase homologue (PGN 0282, 2,3-cyclic-nucleotide 2-phosphodiesterase, P. gingivalisATCC 33277) that has yet to be characterized.In summary, this study identied a novel mecha-

nism, specically the A2a adenosine receptor, which

may be used by P. gingivalis to sustain successfulpersistent infections in the oral epithelium. However,subsequent studies are strongly needed to determinethe precise mechanisms of A2a ligation on modula-tion of P. gingivalis infection in GEC. We also recog-nize that the presence of P. gingivalis in thesubgingival crevice is not a monoinfection, but rathera prominent component of a complex and diversemicrobial community. Other microbial species mightregulate the pathogenic potential of P. gingivalis viadifferential modulation of a number of purinoreceptorsin the gingival epithelium. Taken together, theseresults indicate an important role for A2a receptor inpromoting intracellular infection by P. gingivalis andthe adenosine receptors could represent a potentialtarget for therapeutic intervention in chronic periodon-titis.

ACKNOWLEDGEMENTS

We would like to thank to Dr. David M. Ojcius (UCMerced) for helpful discussions during the preparation

Figure 6 Anti-inammatory adenosine signaling network contributes to persistence of Porphyromonas gingivalis infection in primary gingivalepithelial cells (GEC). Exogenous sources of adenosine stimulate A2a receptor, resulting in cAMP formation via adenylyl cyclase activity. The

cAMP may indirectly serve as a potential energy source to promote proliferation of intracellular P. gingivalis. Additional activation ofanti-inammatory signaling networks such as protein kinase A (PKA), may also downregulate inammation of infected tissues. Adenosine-mediated reduction in inammatory state of P. gingivalis infected tissue and inadvertent energy source supplementation may contribute topersistent infections by P. gingivalis in the oral mucosa.



of this study. This study was supported by theNational Institute of Dental and Cranial Research(NIH) grant R01DE016593.

REFERENCES

Alam, M.S., Kurtz, C.C., Wilson, J.M. et al. (2009) A2Aadenosine receptor (AR) activation inhibits pro-inam-matory cytokine production by human CD4+ helper Tcells and regulates Helicobacter-induced gastritis andbacterial persistence. Mucosal Immunol 2: 232242.

Bai, G., Schaak, D.D. and McDonough, K.A. (2009) cAMPlevels within Mycobacterium tuberculosis and Mycobac-terium bovis BCG increase upon infection of macro-phages. FEMS Immunol Med Microbiol 55: 6873.

Barletta, K.E., Cagnina, R.E., Burdick, M.D., Linden, J.and Mehrad, B. (2012) Adenosine A(2B) receptor de-ciency promotes host defenses against gram-negativebacterial pneumonia. Am J Respir Crit Care Med 186:10441050.

Bitto, A., Oteri, G., Pisano, M. et al. (2013) Adenosinereceptor stimulation by polynucleotides (PDRN) reducesinammation in experimental periodontitis. J Clin Period-ontol 40: 2632.

Bours, M.J., Swennen, E.L., Di Virgilio, F., Cronstein, B.N.and Dagnelie, P.C. (2006) Adenosine 5-triphosphate andadenosine as endogenous signaling molecules in immu-nity and inammation. Pharmacol Ther 112: 358404.

Choi, C.H., DeGuzman, J.V., Lamont, R.J. and Yilmaz, O.(2011) Genetic transformation of an obligate anaerobe,P. gingivalis for FMN-green uorescent protein expres-sion in studying host-microbe interaction. PLoS One 6:e18499.

Choi, C.H., Spooner, R., DeGuzman, J., Koutouzis, T.,Ojcius, D.M. and Yilmaz, O. (2013) Porphyromonasgingivalis-nucleoside-diphosphate-kinase inhibits ATP-induced reactive-oxygen-species via P2X7 receptor/NADPH-oxidase signalling and contributes to persis-tence. Cell Microbiol 15: 961976.

Coutinho-Silva, R., Ojcius, D.M. (2012) Role of extracellu-lar nucleotides in the immune response against intracel-lular bacteria and protozoan parasites. Microbes Infect14: 12711277.

Crane, J.K. and Shulgina, I. (2009) Feedback effects ofhost-derived adenosine on enteropathogenic Escherichi-a coli. FEMS Immunol Med Microbiol 57: 214228.

Himer, L., Csoka, B., Selmeczy, Z. et al. (2010) Adeno-sine A2A receptor activation protects CD4+ T lympho-cytes against activation-induced cell death. FASEB 24:26312640.

Impellizzeri, D., Di Paola, R., Esposito, E. et al. (2011)CGS 21680, an agonist of the adenosine (A2A) recep-tor, decreases acute lung inammation. Eur J Pharma-col 668: 305316.

Ishii, K.J., Akira, S. (2008) Potential link between theimmune system and metabolism of nucleic acids. CurrOpin Immunol 20: 524529.

Jacobson, K.A. and Gao, Z.G. (2006) Adenosine recep-tors as therapeutic targets. Nat Rev Drug Discov 5:247264.

Karmouty-Quintana, H., Xia, Y. and Blackburn, M.R.(2013) Adenosine signaling during acute and chronicdisease states. J Mol Med (Berl) 91: 173181.

Li, Y., Figler, R.A., Kolling, G. et al. (2012) AdenosineA2A receptor activation reduces recurrence and mortal-ity from Clostridium difcile infection in mice followingvancomycin treatment. BMC Infect Dis 10: 342.

Macdonald, L.J., Graham, J.G., Kurten, R.C. and Voth, D.E.(2013) Coxiella burnetii exploits host cAMP-dependentprotein kinase signalling to promote macrophage sur-vival. Cell Microbiol. doi: 10.1111/cmi.12213

Miller, C.M., Boulter, N.R., Fuller, S.J. et al. (2011) Therole of the P2X7 receptor in infectious diseases. PLoSPathog 7: e1002212.

Murakami, S., Hashikawa, T., Saho, T. et al. (2001) Aden-osine regulates the IL-1b-induced cellular functions ofhuman gingival broblasts. Int Immunol 13: 15331540.

Murakami, S., Yoshimura, N., Koide, H. et al. (2002) Acti-vation of adenosine-receptor-enhanced iNOS mRNAexpression by gingival epithelial cells. J Dent Res 81:236240.

Nemeth, Z.H., Csoka, B., Wilmanski, J. et al. (2006) Aden-osine A2A receptor inactivation increases survival inpolymicrobial sepsis. J Immunol 176: 56165626.

Ohta, A., Gorelik, E., Prasad, S.J. et al. (2006) A2A aden-osine receptor protects tumors from antitumor T cells.Proc Natl Acad Sci USA 29: 1313213137.

Pettengill, M.A., Lam, V.W. and Ojcius, D.M. (2009) Thedanger signal adenosine induces persistence of chla-mydial infection through stimulation of A2b receptors.PLoS One 14: e8289.

Popov, S.G., Popova, T.G., Kashanchi, F. and Bailey, C.(2011) Targeting the inammasome and adenosinetype-3 receptors improves outcome of antibiotic therapyin murine anthrax. World J Biol Chem 26: 98104.

Sitkovsky, M.V. and Ohta, A. (2005) The danger sensorsthat STOP the immune response: the A2 adenosinereceptors? Trends Immunol 26: 299304.

Souza, L.F., Jardim, F.R., Sauter, I.P. et al. (2009) Lipotei-choic acid from Staphylococcus aureus increases matrix



metalloproteinase 9 expression in RAW 264.7 macro-phages: modulation by A2A and A2B adenosine recep-tors. Mol Immunol 46: 937942.

Streitova, D., Hofer, M., Hola, J., Vacek, A. and Pospsil,M. (2009) Adenosine A(1), A(2a), A(2b), and A(3) recep-tors in hematopoiesis. 2. Expression of receptor mRNAin resting and lipopolysaccharide-activated mouse RAW264.7 macrophages. Physiol Res 59: 139144.

Sullivan, G.W., Fang, G., Linden, J. and Scheld, W.M.(2004) A2A adenosine receptor activation improvessurvival in mouse models of endotoxemia and sepsis.J Infect Dis 15: 18971904.

Sun, W.C., Berghaus, L.J., Moore, J.N. et al. (2010) Lipo-polysaccharide and TNF-a modify adenosine A(2A)receptor expression and function in equine monocytes.Vet Immunol Immunopathol 135: 289295.

Sun, C.X., Wall, N.R., Angelov, N. et al. (2011) Changesin mRNA expression of adenosine receptors in humanchronic periodontitis. Chin J Dental Res. 14: 113120.

Takeuchi, H., Hirano, T., Whitmore, S.E., Morisaki, I.,Amano, A. and Lamont, R.J. (2013) The serine phos-phatase SerB of Porphyromonas gingivalis suppressesIL-8 production by dephosphorylation of NF-jB RelA/p65. PLoS Pathog 9: e1003326.

Thammavongsa, V., Kern, J.W., Missiakas, D.M. and Sch-neewind, O. (2009) Staphylococcus aureus synthesizesadenosine to escape host immune responses. J ExpMed 206: 24172427.

Yao, L., Jermanus, C., Barbetta, B. et al. (2010) Porphyro-monas gingivalis infection sequesters pro-apoptotic Badthrough Akt in primary gingival epithelial cells. Mol OralMicrobiol 25: 89101.

Yegutkin, G.G. (2008) Nucleotide- and nucleoside-convert-ing ectoenzymes: important modulators of purinergic

signalling cascade. Biochim Biophys Acta 1783: 673694.

Yilmaz, O. (2008) The chronicles of Porphyromonas gingi-valis: the microbium, the human oral epithelium andtheir interplay. Microbiology 154: 28972903.

Yilmaz, O., Watanabe, K. and Lamont, R.J. (2002)Involvement of integrins in mbriae-mediated bindingand invasion by Porphyromonas gingivalis. Cell Micro-biol 4: 305314.

Yilmaz, O., Verbeke, P., Lamont, R.J. and Ojcius, D.M.(2006) Intercellular spreading of Porphyromonas gingi-valis infection in primary gingival epithelial cells. InfectImmun 74: 703710.

Yilmaz, O^, Yao, L., Maeda, K., Rose, T.M. et al. (2008)ATP scavenging by the intracellular pathogen Porphyro-monas gingivalis inhibits P2X7-mediated host-cell apop-tosis. Cell Microbiol 10: 863875.

Yilmaz, O., Sater, A.A., Yao, L., Koutouzis, T., Pettengill,M. and Ojcius, D.M. (2010) ATP-dependent activation ofan inammasome in primary gingival epithelial cellsinfected by Porphyromonas gingivalis. Cell Microbiol 12:188198.

SUPPORTING INFORMATION

Additional Supporting Information may be found inthe online version of this article:Figure S1. Gingival epithelial cells (GEC) were

infected with Porphyromonas gingivalis at a multiplic-ity of infection (moi) of 100 for 24 h total infectiontime.

Figure S2. Direct effect of adenosine on bacterialculture.



Documents

Danger signal adenosine via adenosine 2a receptor stimulates growth of Porphyromonas gingivalis in primary gingival epithelial cells.pdf