APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Feb. 1993, p. 458-4660099-2240/93/020458-09$02.00/0Copyright © 1993, American Society for Microbiology

DNA Sequence and Transcriptional Analysis of the tbL4 GeneRequired for Tabtoxin Biosynthesis by Pseudomonas syringae

TERESE M. BARTA,lt THOMAS G. KINSCHERF,l THOMAS F. UCHYTIL,2AND DAVID K. WILLIS12*

Department of Plant Pathology' and Agricultural Research Service, U. S. Department ofAgriculture,2University of Wisconsin, Madison, Wisconsin 53706

Received 23 July 1992/Accepted 5 December 1992

The tbL4 gene of Pseudomonas syringae is required for tabtoxin biosynthesis and is under the control of a

regulatory gene, lemA. We have determined the nucleotide sequence of the tblA gene and identified the 5' endof the tbUA gene transcript. The sequence of the tblU gene was identical to that of the recently reported openreading frame 1 gene of the tabA region of the BR2 chromosome. The open reading frame of the tblA genepotentially encodes a protein of 231 amino acids. mRNA from the tbUA gene was detected at all phases of cellsgrown in minimal medium. This result is correlated with the constitutive production of tabtoxinine-13-lactam(the biologically active part of the toxin) by P. syringae BR2R in minimal medium, as quantitated by aphenylisothiocyanate derivatization method.

Tabtoxinine-i-lactam (TPL), a potent inhibitor of glu-tamine synthetase, is produced by particular strains of theplant pathogen Pseudomonas syringae (for a review, seereferences 15, 16, and 51). The production of tabtoxin hasvarious effects on the pathogenicity of the producing bacte-rium. Loss of tabtoxin production by the tobacco wildfireorganism P. syringae pv. tabaci or the oat halo blightorganism P. syringae pv. coronafaciens eliminates the char-acteristic chlorosis caused by the toxin but not the ability ofthese bacteria to cause lesions (5, 30). However, loss oftabtoxin production by the bean wildfire bacterium BR2leads to the complete loss of pathogenicity as determined byseveral inoculation methods (30). Tabtoxin is actually thedesignation of the inactive dipeptide pretoxin that is cleavedby aminopeptidases to yield the active moiety TEL (31, 46,47, 49). Although the biochemical pathway for tabtoxin hasnot been fully elucidated, the DNA believed to encode thebiosynthetic enzymes has been cloned from two differenttabtoxin-producing strains (30). In addition, we have identi-fied a regulatory gene necessary for tabtoxin production inall P. syringae strains that we have examined (5). The DNAsequence of this gene, lemA, suggests that it encodes a

sensor protein that is part of a two-component regulatorysystem. The lemA gene appears to regulate tabtoxin produc-tion via the tblA gene, which is located within the tabtoxinbiosynthetic cluster (5, 30). mRNA from the tblA gene canbe detected only if the P. syringae strain is carrying afunctional lemA gene. Although the lemnA gene is requiredfor the expression of several other phenotypes in P. syringae(25, 41, 52), to date, the tblA gene is the only lemA-regulatedgene that has been cloned.

In this paper, we report the initial characterization of thetblA gene (5). We have sequenced the tblA gene and deter-mined the start of the tbL4 transcript. Northern (RNA)hybridization analysis revealed that the tbl4 transcript canbe detected at all stages of bacterial growth in minimal saltsmedium. The presence of this transcript is correlated with

* Corresponding author. Electronic mail address: DKW@PLANTPATH.WISC.EDU.

t Present address: Gray Freshwater Institute, Navarre, MN55392.

the detection of T,BL in culture filtrates at all stages ofbacterial growth in minimal medium. Our sequence analysisrevealed that the tblA gene encodes an open reading frame(ORF) of 231 amino acids in length.

MATERIALS AND METHODS

Bacterial strains, growth conditions, and plasmids. Allstrains and plasmids used in this study are listed in Table 1.Strains of P. syringae were maintained on King's medium B(29). Luria-Bertani medium (43) was used to culture strainsof Escherichia coli. The minimal defined growth medium forboth Pseudomonas strains and E. coli was M9 medium (35)containing 0.2% glycerol in place of glucose as the carbonsource or Woolley's minimal medium (53). For growth of E.coli DH5ao, M9 medium was supplemented with 15 ,ug ofthiamine per ml. Antibiotics were added to media for growthof P. syringae at the following concentrations: 100 ,ug ofrifampin per ml, 10 ,ug of kanamycin per ml, and 10 pLg oftetracycline per ml. For E. coli, concentrations were asfollows: 50 ,ug of kanamycin per ml and 15 ,ug of tetracyclineper ml. Stock solutions of rifampin and tetracycline weremade in 100% methanol at 10 mg/ml. Kanamycin wasdissolved in water at a concentration of 10 or 50 mg/ml.Aqueous solutions were filter sterilized. All antibiotic solu-tions were stored at 4°C.A note on the host range ofP. syringae BR2. The production

of tabtoxin (or any nonspecific toxin) complicates the deter-mination of the range of plants that are natural hosts for thedisease organism. The tabtoxin-producing strain P. syningaepv. tabaci (originally designated Bacterium tabacum) was

previously thought to have a host range that included 23genera of plants (27). However, careful analysis revealedthat this expansive host range reflected artifactual symptomscaused by production of the nonspecific toxin tabtoxin andthat P. syringae pv. tabaci was pathogenic only on tobacco(11). Clayton (11) found that the inoculation of P. syringaepv. tabaci cultures that had not been extensively washed toremove tabtoxin in the medium was a major factor in theartifact. The production of tabtoxin has also led to confusionconcerning the host range of the bean wildfire organism P.syringae BR2. This strain was originally designated BW2

458

Vol. 59, No. 2

on June 19, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

SEQUENCE OF THE tbL4 GENE 459

TABLE 1. Bacterial strains and plasmids

Strain(s) or plasmid(s) Relevant characteristicsa Source or reference(s)

E. coliHB101 recA13 rspL hsdS20 (hsdR hsdM) thi-1 leuB6proA2 ara-14 lacYl 10

galK2 xyl-5 mitl-1 supE44 X-DH5ot recAl hsdR17 endA1 thi-1 gyrA96 relA1 supE44 +80 blacZAM15 A- Bethesda Research Laboratories

P. syringaeBR2R Rif Tox+; causal agent of bean wildfire 30, 40KW233 Tox- Rif Kanr; generated by marker exchange with lemAp,s3::TnS; 5

previously designated BR2R (lemAp,,::Tn5)P. syringae pv. coronafaciensPc27R Tox+; causal agent of halo blight of oats (Rifr derivative of Pc27) 5KW203, KW205 Rif' Kanr Tox-; lemApsc3::TnS and lemAp c5::TnS derivatives of S

Pc27RPlasmids

pBluescript II KS+ Ampr; cloning vector Stratagene, La Jolla, Calif.pLEM12 Tetr; pRK415 with a 12-kb insert containing the lemA allele from 5

strain BR2RpLEM57 Tetr; pRK415 with lemAp,, in 5.7-kb Asp 718-HindlIl fragment 5pRK415 Tetr; cloning vector N. T. Keen, University of

California-RiversidepWT38R Amp'; pBluescript II KS+ derived from pWT53L by XbaI digestion This work

and religationpWT53L, pWT53R Ampr; pBluescript II KS+ containing the conserved 5.3-kb PvuII 30

fragment from the BR2R tabtoxin biosynthetic cluster, cloned inEcoRV site in both orientations

pWT15R Ampr; pBluescript II KS+ containing the 1.5-kb PvuII-XbaI This workfragment derived from pWT53R by XbaI digestion and religation

a Rif, rifampin; Tet, tetracycline; Kan, kanamycin; Amp, ampicillin; r, resistant. R at the end of strain name denotes a spontaneous Rif' derivative.

and is unusual in that, while taxonomically related to P.syningae pv. tabaci strains, it is not pathogenic on tobacco(40). For this reason, Ribeiro et al. (40) concluded that thebean wildfire isolates such as BR2 should constitute aseparate taxonomic group that is distinct from P. syringaepv. tabaci. By using several inoculation techniques, the lackof pathogenicity of BR2 on tobacco has been confirmed byour work (30) and by investigations in two other laboratories(32, 50). In addition, our analysis of the plasmid-cured strainPTBR2.024 (7) did not confirm the reported pathogenicity ofthis mutant on tobacco (18, 42). We consider the originaldescription of BR2 as a pathogen of bean but not tobacco tobe correct and, therefore, the effect of the loss of tabtoxinproduction on the pathogenicity of this strain on tobacco tobe moot.DNA procedures. Large-scale preparations of plasmid

DNA were carried out by alkaline lysis (43) and purified bytwo cesium chloride-ethidium bromide gradients. Small-scale preparations of plasmids were performed by a boilingmethod (24). General techniques for restriction endonucle-ase digests, agarose gel electrophoresis, Klenow reactionsfor filling in recessed DNA ends, DNA ligation, and trans-formation were performed according to standard methods(43). Generation of radioactively labeled DNA probes withrandom oligonucleotide primers was carried out as previ-ously described (12). Southern blot hybridization experi-ments were done as described by Holden et al. (23).

Isolation of bacterial RNA and Northern hybridizations.Large-scale preparations of total cellular RNA were carriedout as previously described (55). Rapid RNA isolations wereperformed by a smaller-scale method (1) with the addition ofa DNase treatment and phenol-chloroform extraction. Afterethanol precipitation, the RNA was dissolved in steriledistilled water and stored at -80°C. The methods used forgel electrophoresis, Northern transfer to Zetabind mem-

branes, and hybridization have been described elsewhere(23, 43).

Generation of RNA probes. Strand-specific RNA tran-scripts generated from inserts cloned into the vector pBlue-script II KS+ (Stratagene) were synthesized according toprotocols provided with the transcription kit (Stratagene).This kit utilizes the T3 and T7 RNA polymerases whichspecifically recognize their own polymerase-binding sites.As controls, transcription reactions were carried out withnonradioactive nucleotides and the products were electro-phoresed and blotted with the mRNA samples.DNA sequencing and RNA primer extension to determine

the 5' end of the mRNA. Plasmid pWT38R was partiallysequenced by the dideoxy chain termination method (44)using T7 DNA polymerase (Pharmacia) and [a-35S]dATP orwith avian myeloblastosis virus reverse transcriptase (Mo-lecular Genetic Resources) and end-labeled primers. Se-quence reactions with reverse transcriptase were carried outessentially as reported by Karls et al. (28). Deaza nucle-otides were used in place of standard dideoxy nucleotides inall reactions except when DNA sequence reactions wereused for comparison with RNA primer extension products.Sequencing primers (17 nucleotides in length) were synthe-sized by the University of Wisconsin-Madison Biotechnol-ogy Center.For RNA primer extension experiments, DNA primers (20

to 100 pmol per reaction) were labeled with [Y-3 P]ATP (50,uCi; specific activity, 6,000 Ci/mmol) with 15 U of T4polynucleotide kinase (NEB) in a total volume of 20 ,ul at37°C for 1 h. The kinase buffer consisted of 50 mM Tris-HCl(pH 8.0), 10 mM MgCl2, 5 mM dithiothreitol, 100 ,uMspermidine, and 100 ,uM disodium EDTA. The reaction wasterminated by heating (65°C, 10 min). RNA primer exten-sions were carried out as described elsewhere (26) with thefollowing modifications. Ten to 40 ,ug of RNA was precipi-

VOL. 59, 1993

on June 19, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

APPL. ENvIRON. MICROBIOL.

tated, dried, and resuspended in 9 ,ul of hybridization buffer(60 mM NaCl, 50 mM Tris-HCl [pH 8.0], 10 mM dithiothre-itol). Two microliters of labeled primer was added, andhybridization was allowed to take place at 42°C for 15 min.The primer extension incubation was done at 45°C with 2 Uof reverse transcriptase (Molecular Genetics Resources) andactinomycin D (Boehringer Mannheim) present at 150 ,uglml.DNA sequencing reactions used for comparison with RNAprimer extension were carried out as described above, butwith the y-32P-end-labeled primers.

All sequencing and primer extension reaction mixtureswere electrophoresed in 6% acrylamide 50% urea gels with0.5 x TBE buffer (33) for 1.5 to 6 h. DNA sequencingsamples were heated for 2 to 3 min at 75°C before loading.RNA primer extension samples were boiled for 3 min priorto loading on sequencing gels.

Detection of T13L in culture filtrates. Strains were grown atroom temperature with vigorous aeration on Woolley'smedium containing 10 ,uM zinc. At various stages of growth,monitored spectrophotometrically at 600 nm, the cells wereremoved by centrifugation (12,000 x g for 5 min) and 1.0 mlof the supernatant was diluted with 5.0 ml of 95% ethanoland stored at -20°C overnight. The precipitate was removedby centrifugation as before, and one-third of the supernatantwas concentrated in vacuo to dryness. The dried preparationwas dissolved in 200 ,ul of coupling buffer (acetonitrile-pyridine-triethylamine-water, 10:5:2:3). The coupling bufferwas removed to dryness under vacuum. Then 100 ,ul ofcoupling buffer containing 5 p.l of phenylisothiocyanate(PITC; Sigma P-1034, protein-sequencing grade) was added.After a 5-min reaction at room temperature, the solventswere removed in vacuo and the product of the reaction (PTCderivatives) was dissolved in 200 ,ul of 0.05 M ammoniumacetate, pH 6.8 (21).Chromatographic analysis of derivatized TEL was per-

formed on a Beckman high-pressure liquid chromatography(HPLC) system composed of two model 100A pumps and amodel 421 controller. Aliquots (5 to 10 ,ul) of the PTCderivatives were separated on an octyldecyl silane reversephase column (Perkin-Elmer; Pecosphere 3X3C cartridge,3-,um-particle-size packing). An isocratic mobile phase con-sisting of 90% 0.1 M ammonium acetate (pH 6.8; Mallinck-rodt AR) and 10% H20-methanol (20% H20, 80% methanol[Burdick and Jackson HPLC grade]) was delivered at 1.0ml/min. Sample peaks were monitored at 254 nm on a KratosSF 770 spectral flow detector using a detection range of 0.04absorbance unit, full scale; the signal output was recordedby a Hewlett-Packard 3390A integrator. This system gavebaseline separation for the standard T,BL at 3.05 min. Theretention time for the culture filtrate PTC derivative of TPILwas 3.35 min. Tabtoxin-5-lactam (the inactive form of TELoften found in culture filtrates) was eluted from the columnwith 95% ammonium acetate and 5% H20-methanol and hada retention time of 3.73 min.

Standard T,BL (48) was purified on a Beckman 5-,um-diameter ultrasphere octyldecyl silane preparative column (8mm by 25 cm). It was then tested for positive biologicalactivity, as shown by visible leaf chlorosis on tobaccoplants, before being used. The HPLC-purified T,BL wasdried in vacuo (without heat to maintain stability) until aconstant weight was reached. Six aliquots were PITC de-rivatized and chromatographed. The peak areas were aver-aged, and at 0.04 absorbance unit, full scale, 5 p.g of TELgave an amount per area of 0.0000011 on the Hewlett-Packard integrator. A series of three TEL concentrations(10, 20, and 30 1.l of the TEL standard solution) with three

repetitions each was derivatized and chromatographed. Theresponse of the derivative over this concentration range wasfound to be linear. The tabtoxin-b-lactam preparation wasderived from the T,BL chromatographic standard by adjust-ing the pH to 11 with 0.2 N NH40H and incubation at roomtemperature overnight before the PITC derivatization. Afterevery third run of PITC-derivatized culture filtrates, 25 ml of100% methanol was used to remove other reaction productsthat strongly bind to the HPLC column.

RESULTS

Production of the tblA gene transcript and detection ofT3Lat different growth phases. We have previously shown thatthe tbL4 transcript is produced in stationary-phase culturesof tabtoxin-producing bacteria grown in both minimal andrich media (5). This 1-kb transcript is present in extractsfrom tabtoxin-producing strains, has been localized to thetbLA gene, and is truncated in strains containing an Qfragment insertion within the tbL4 gene (5). In order todetermine whether the tbl4 gene was temporally regulated,we isolated total RNA from cultures of the tabtoxin-produc-ing strains BR2R and Pc27R at different phases of bacterialgrowth in Woolley's or M9 minimal medium, respectively.Northern blot hybridization analysis of these RNA sampleswith a probe consisting of the 5.3-kb PvuII fragment thatcontains the tblA gene revealed that the tblA transcript waspresent at all time points assayed (Fig. 1). The phases ofbacterial growth analyzed ranged from early log phase(optical density at 600 nm [OD600] = 0.138, or 4.4 x 107CFU/ml) to early stationary phase (OD600 = 1.150, or 3.0 x109 CFU/ml). The steady-state level of transcript appearedto be approximately the same at all time points.

In order to correlate the presence of the tblA transcriptwith the production of TEL, strain BR2R was grown inWoolley's minimal salts medium and 333-1.l aliquots ofculture supernatants were analyzed for the presence of TELby derivatization with PITC and HPLC analysis. Figure 2shows that T,BL was detected at all stages of bacterial growthranging from early log phase (OD600 = 0.260) to earlystationary phase (OD600 = 1.09). Samples were also takenfrom late-stationary-phase cultures (OD600 = 1.789), and alarge amount of T,L was detected in the culture superna-tant. However, these data were not included in Fig. 2because of artifacts caused by the accumulation of extracel-lular polysaccharides and pigments that interfere with mea-suring the OD600 and make accurate quantitation of TEL perCFU difficult. We also tested the supernatant of the BR2RlemA mutant KW233 (Table 1) by the derivatization methodand could not detect TEL at any growth phase. The limit ofT,BL detection was 1.72 ng/p.l (10 puM) under the describedconditions. However, the sensitivity of the method can beincreased fourfold by setting the range of the UV detector to0.01 absorbance unit, full scale. In contrast to the PITCderivatization method, the detection of T3L by bioassay ismuch less sensitive. We cannot detect active TEL by thebioassay of culture filtrates until mid-log phase (6).We were unable to test the supernatants of strain Pc27R

for the presence of TEL using the PITC derivatizationmethod because this strain does not express the aminopep-tidase activity necessary to cleave tabtoxin to T,BL underlaboratory growth conditions (50). As described above,tabtoxin cannot be accurately quantified by the PITC deriva-tization method. The lack of TEL production by Pc27R doesnot affect the ability of this strain to cause disease, since

460 BARTA ET AL.

on June 19, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

SEQUENCE OF THE tblA GENE 461

A OD600 B OD600o co o- o co ., 0o 0C40 n0 0 0-. 0n 0In

2.9kb (23S)>) w1.5kb(16S)-*. __>0J:X i2.9kb(23S)-*-1.0 (tblA) A 1.5kb (16S)-.*_1.0 kb(tblA)->

FIG. 1. Autoradiographs of Northern-blotted RNA isolated at different times during bacterial growth in minimal medium. Lanes arelabeled with the OD6. at which samples of culture were taken for RNA isolation. Arrows indicate the tblA transcript that hybridized withthe 5.3-kb PvuII fragment from the tabtoxin biosynthetic cluster (30). The positions of bacterial 16S and 23S rRNA are also indicated. Thevariation in the signal intensity seen from lane to lane is most likely due to variation in the amount of sample loaded and does not accuratelyreflect differences in transcript amount at the various growth stages. (A) P. syingae BR2R grown in Woolley's minimal medium.Approximately 10 ,ug of total RNA was loaded in each lane. In liquid culture of P. syringae, the production of significant amounts ofextracellular polysaccharide affects the ability to predict the CFU at a given stage of growth based on the OD in a strain-dependent manner.For this reason, we include the cell densities corresponding to each OD, and they were as follows: OD6. = 0.14, 4.4 x 107 CFU/ml; OD6w= 0.28, 1.2 x 108 CFU/ml; OD600 = 0.51, 1.7 x 108 CFU/ml; OD6. = 0.69, 3.1 x 108 CFU/ml; OD6. = 0.78, 5.6 x 108 CFU/ml; and OD600= 1.15, 3.0 x 109 CFU/ml. (B) P. syringae pv. coronafaciens Pc27R grown in M9 medium. Approximately 20 1lg of RNA was loaded in eachlane of the gel. The cell densities corresponding to each optical density were as follows: OD6w = 0.35, 3.7 x 107 CFU/ml; OD6. = 0.50, 7.6x 108 CFU/ml; OD6. = 0.77, 1.1 x 10 CFU/ml; and OD6w = 0.90, 1.0 x 109 CFU/ml.

tabtoxin can be cleaved to the active form by plant-encodedaminopeptidase activity (49).

Localization and direction of transcription of the tbIA gene.In earlier work, we observed that the regulatory gene lemAwas required for detection of a transcript from a locusdesignated tblA within the tabtoxin biosynthetic cluster. ThetblA gene spans the left XbaI site within the conserved5.3-kb PvuII fragment (5). To better define the location of thetblA gene, we isolated total RNA from Pc27R (tbl-9::TnS)and probed the RNA with a 1.7-kb XbaI-HindIII fragmentinternal to the conserved 5.3-kb PvuII fragment (Fig. 3A).

(U

(U

u9

c-

,0

1.0.

0.8 .

0.6.

0.4-

0 2 4 6 8 10 12 14 16 18 20 22 24 26

ng of TOL per g1 of Culture SupernatantFIG. 2. Relationship between cell density and quantity of T,3L

detected. Each datum point represents the mean of three derivati-zations using 333 ,ul of the culture supernatant. Bars representstandard error of the samples.

The tblA gene transcript was still present in Pc27R(tbl-9: :TnS) (data not shown), which contains a TnS insertionapproximately 1.9 kb to the right of the XbaI site (Fig. 3A).To determine the direction in which tbUA is transcribed in

vivo, strand-specific probes were generated from pWT15R(Fig. 3B), which contains the 1.5-kb XbaI-PvuII fragmentcloned into pBluescript II KS+. The plasmid was linearizeddistal to either the T3 or T7 promoter, depending on which ofthe promoters was being used to generate RNA. RNAtranscripts were synthesized in vitro from either the T3 or T7polymerase-binding sites present in the vector and flankingthe insert on different DNA strands. These transcripts,labeled with [a-32P]UTP, were hybridized individually toNorthern-blotted mRNA from wild-type and lemA mutantstrains. Only the probe generated by the T3 polymerasereaction strongly hybridized to a transcript of the sizeexpected for tbLA. Although the probe generated by the T7polymerase hybridized to the products produced by the T3polymerase, it did not hybridize strongly to the mRNA fromstrain Pc27R (data not shown). A weak hybridization signalwas detected, but this was expected since some nonspecificinitiation of RNA transcription may occur at the ends of thetemplate (Stratagene protocol). Since the T3 polymerase-generated RNA was complementary to the tbLA mRNA, thetblA gene must be transcribed in the same direction as thetranscript produced by T7 polymerase (Fig. 3B). Therefore,transcription of tblA begins in the 3.8-kb PvuII-XbaI frag-ment and proceeds into the 1.5-kb XbaI-PvuII fragment (Fig.3A).DNA sequence of the tbU gene. The DNA sequence of the

region surrounding the XbaI site within the tbLA gene re-vealed several ORFs (Fig. 4) (6). One of these ORFs spannedthe XbaI site that is the location of the tbl1: :Q mutation (5)and was identified as the putative tbLA ORF. The predictedThlA protein encoded by this ORF is 231 amino acids inlength with a molecular mass of 26 kDa. The predicted tbLAnucleotide and amino acid sequences were used to conduct aFASTA (38) search of the GenBank (version 68) data base

U

VOL. 59, 1993

on June 19, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

APPL. ENVIRON. MICROBIOL.

E B BA Xa . . I

EBX EA2 kb

1 5.3 kb I

4%

A

P

tblAl::Q2H X

4-

tabA tblA

Region Sequenced

tbl-9-.:Tn5XH

I113.8kb

1 kb

x

T3

B

FIG. 3. (A) Location of the tblA gene and the tabA ORF within the tabtoxin biosynthetic gene cluster ofP. syringae BR2R. The filled circlemarked tbl-9::TnS indicates the site of a Tn5 insertion into this region (30). The tbl41::fl mutation has been described previously (5).Abbreviations: P, PvuII; H, HindIII; E, EcoRI; B, BamHI; A, Asp 718; X, XbaI. The XbaI site marked with an asterisk is subject to Dammethylation in E. coli (36), and therefore, this site is not cut in DNA isolated from DH5a. (B) Map of pWT15R showing the position of thepBluescript II KS+ T7 and T3 promoters relative to the 1.5-kb PvuII-XbaI insert. The locations and direction of transcription of the tblA andtabA genes are also indicated.

(9). Interestingly, this search revealed sequence identitybetween the tblA gene and ORFi of the tabA chromosomalregion required for tabtoxin production by P. syringaePTBR2.024 (18). Strain PTBR2.024 is a plasmid-cured deriv-ative of P. syringae BR2 (42). No additional significantsequence similarity between tbLA and other entries in thedata base was found.

Determination of the tbl4 transcriptional start. On the basisof the direction of transcription and the DNA sequenceinformation, 17-base oligodeoxynucleotide primers thatwere complementary to the tbLA mRNA and near the begin-ning of the predicted tblA ORF were synthesized (Fig. 4).These primers were used in reactions with reverse tran-scriptase, and the reaction products were electrophoresednext to a DNA sequence ladder initiated from the same

primers. A primer complementary to the RNA locatedbetween nucleotides 571 and 587 revealed that the tbLAtranscript begins with the A at nucleotide 420 (Fig. 4 and 5).This 5' end was confirmed with another primer complemen-tary to the nucleotides between positions 510 and 526 (datanot shown). Only one transcriptional start was detected, and

the start was the same for both Pc27R grown in either M9medium or King's medium and BR2R grown in M9 medium(Fig. 5). Surprisingly, a weak band was detected in thePc27R lemA mutant KW203 grown in minimal medium (Fig.5A). This indicates that the tbL4 transcript is produced in thislemA mutant at a level too low to be detected by Northernblot hybridization (5). The 5' end of the tbl4 mRNA is alsothe same in restored lemA mutants of Pc27R and BR2Rcontaining a functional lemA gene on a plasmid (Fig. 5),indicating that tblA mRNA is produced from the samepromoter when the lemA gene is provided in trans.We observed no sequences upstream of the transcriptional

start that resembled E. coli u70 consensus -10 or -35promoter regions. However, the upstream region containeda GC at -12 and a GG at -24 (Fig. 4), a motif found in theRpoN-regulated promoters of Pseudomonas aeruginosa

(14). Further upstream at position 416 is a 14-bp region ofdyad symmetry. In addition, a short direct repeat (AGTTTTA) was observed starting at positions 286 and 342. Thereis also a 16-bp sequence beginning at position 253 that isrepeated (near perfectly) starting at position 298. It is inter-

1.5kb

462 BARTA ET AL.

on June 19, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

SEQUENCE OF THE tbLA GENE 463

XhoI1 GTTGCAAGAAGTCGCGGCGGATGTTTTCGGCATCCTGGTCCTTGCCCAAGTCTGGGGCCCCGCGCTGCAAATCCCGCTCQAGCAGGTAC

90 TCGAATACTACCTGGGTGAGTGCTTGCGTTACGTAAACCGGGGGCTCGGGCTTTTCCCCGATTGCGACGGGATGTACTTGCAATTGTCTT

PstI180 ATTTCGTCCAGCTAGGAGCTCTGACTCTGCAGCATGGAGGTGATCAACCCGTAAAACTGCTGGTCGATCATGGCGCCTTGCTCGCTGGCT

270 TGCGCTCGCTAGCACGA&TTTTGCCGACGCCCTGCTCGCGG CAATCCTGAGGCTGCTGTCGCCTTCTACC,GTTTTACGGACCAGCAC

tblA mnRNA startPstI ** ** * * * * * Start of tblA ORF #2

360 GGCTGCAGCCG TTGCAGCCACTGGTCACTGCGCTAGGCAACTCGCCCGCGCAGTCCATCGAATACGTGCAAGAACCTGTAC ACCAA>MetTyrGln

Start of tblA ORF #1450 CGGACTGCGACGCAACTTGCGCGCAAGCCCGCCTCTAAACAAGGAGAGACAGAGET2%ACAATTCGATACAGGACCTCAAACAGGTCGAA

>ArgThrAlaThrGlnLeuAlaArgLysProAlaSerLysGlnGlyGluThrGluMetAsnAsnSerIleGlnAspLeuLysGlnValGlu

540 GACTACTACGGCACCACCCGCCGGTTTGGCGATAGCGATGCCACGATATACGAGATCTGGGAACAGGGTGGAGCGTTCAACGACTCCATC>AspTyrTyrGlyThrThrArgArgPheGlyAspSerAspAlaThrIleTyrGluIleTrpGluGlnGlyGlyAlaPheAsnAspSerIle

630 ACGCCATCCACCTACAGCCAAGAATATCGCTCGCATCTGGGGCTCAAGCTCAAGTCCCTCACAGAGGAAGGCGCGATAATTTTCTCCATT>ThrProSerThrTyrSerGlnGluTyrArgSerHisLeuGlyLeuLysLeuLysSerLeuThrGluGluGlyAlaIleIlePheSerIle

720 GGCTGCGGTAATGGTTTTGTCGAGGGCGATCTGGTGCAAGCCAAACGTCGCGTGCTGGCTATCGACTTCAACGATGAAGCAGTTGCGCTG>GlyCysGlyAsnGlyPheValGluGlyAspLeuValGlnAlaLysArgArgValLeuAlaIleAspPheAsnAspGluAlaValAlaLeu

XhoI810 AGCCGGAAAAAAGGAGTGGATGCGTACACAGCCGACTTCTTCGAAC.TQaGACCCGGCGCTCTCGCTGGCGTCAAGTCGATCTACGCAGAC

>SerArgLysLysGlyValAspAlaTyrThrAlaAspPhePheGluLeuGluProGlyAlaLeuAlaGlyValLysSerIleTyrAlaAsp

XbaI900 GGTTTGCTCGGCCACTTGTTCCACCCAGAGTTAGAGCTCAAGCCAACTTTCGAAAAACTCAAGGAGCTGAATCTAGAATCCGGCACAACC

>GlyLeuLeuGlyHisLeuPheHisProGluLeuGluLeuLysProThrPheGluLysLeuLysGluLeuAsnLeuGluSerGlyThrThr

990 CTAGTTTTCTCCAACGACTCGCCTCGCGATCCAGAGGCTCTCTTTGCCGCCCACGATAAAGTCGACGGCTTCTGGTTCATATCCAGAGAC>LeuValPheSerAsnAspSerProArgAspProGluAlaLeuPheAlaAlaHisAspLysValAspGlyPheTrpPheIleSerArgAsp

1080 TACCTGCGTGATGCGCTGACTGAGGCTGGCTTCAAGATCGAAGAGTCGTACTACTTCCCTTACACACGCCCGATCAGTGGTCTGCGTAAT>TyrLeuArgAspAlaLeuThrGluAlaGlyPheLysIleGluGluSerTyrTyrPheProTyrThrArgProIleSerGlyLeuArgAsn

Start of tabA ORF HindJiI1170 CGAACCCTTTGCGTCGCACTAGTGCCCTGAGTCAATCACGCCTGCGCCGCGAGGAGAAACCGCCraCAATATCCGAAAGTTCGCCCG

>ArgThrLeuCysValAlaLeuVa1Provv >MetProIleSerGluSerPheAlaArFIG. 4. DNA sequence of the region encompassing the tblA gene. The start of the tblA transcript is marked by an arrow, and the first

nucleotide (an A) is in boldface type. Restriction sites are indicated by underlined bases and named. Boxed sequences represent possibletranslation initiation codons for the tbL4 and tabA ORFs, and the corresponding amino acid is in boldface type. The elements observed in or"RNA polymerase-transcribed promoters in the Pseudomonas sequence that located upstream from the tblA gene are in boldface type andmarked by asterisks, as are potential Shine-Dalgarno sequences. Repeated sequences and sequences with dyad symmetry are underlined andin boldface type.

esting to note that this 16-bp sequence strongly resembles a another possible start site 63 bases upstream of this ATG.conserved dodecameric sequence present in the toxA, toxR, There is an in-frame GTG codon upstream of the ATG, andand phospholipase C genes of P. aeruginosa (19, 39, 54). the GTG is preceded 12 bp by AAGAA (tblA ORF #2 in Fig.The DNA sequence revealed an ATG (methionine) codon 4). The codon GTG can encode N-formyl methionine (20),

at position 504 as part of an extended ORF (Fig. 4). Centered and the possible GTG translational start is 20 bp downstream10 bases upstream of the ATG is a sequence (AGGAGA) that from the site of transcription initiation.may represent a Shine-Dalgarno or ribosome binding site(45). On the basis of the location of the transcriptional start DISCUSSIONand the proximity of a Shine-Dalgarno-like sequence, webelieve that the ATG at position 504 is a likely candidate for We have undertaken a study of the tblA gene in order tothe translational start of the protein encoded by tblA (desig- better understand the mechanism of lemA regulation, as wellnated tbL4 ORF #1 in Fig. 4). However, we cannot discount as to aid in the genetic characterization of tabtoxin biosyn-

VOL. 59, 1993

on June 19, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

APPL. ENvIRON. MICROBIOL.

B vG A T C

Start of-<- tbiA

Transcript

Start of- thlATranscript

FIG. 5. The 5' end of the tblA mRNA determined by primer extension with avian myeloblastosis virus reverse transcriptase.Approximately 10 mg of RNA was annealed to the primer. The primer extension DNA product and the predicted RNA sequence is alsoshown. (A) Autoradiograph of primer extension and sequencing reactions. Lanes G, A, T, and C represent the DNA sequence laddergenerated with T7 polymerase. The letter designation of the DNA sequence and corresponding mRNA sequence is shown to the left of thefigure. The tbL4 primer extension product is indicated to the right of the autoradiograph. Strains analyzed are indicated at the top of the lanes.RNA from strain Pc27R was isolated from cultures grown in either M9 minimal broth (M9) or King's medium B broth (KB). All other strainsanalyzed were grown in M9 broth. Faint primer extension products comigrating with the Pc27R(M9) product were present in the extracts fromPc27R(KB) and KW203, but these products are difficult to see in the printed figure. (B) Autoradiograph of DNA sequence and primerextension products in extracts of BR2R and derivative strains grown in M9 medium. Lanes G, A, T, and C represent the DNA sequence laddergenerated with reverse transcriptase. The DNA sequence was identical to that shown in panel A. A faint extension product is present in theKW233(pLEM12) lane, but this product is difficult to see in the printed figure.

thesis. At present, we have no evidence that the tblA gene ispart of a multigenic operon. On the contrary, the tbl-9::Tn5mutation is upstream of the tblA gene and does not abolishproduction of the tblA transcript, although it does abolishtabtoxin production. In addition, operon fusion data suggestthe presence of a fairly strong promoter divergent from thetblA gene (3). The region transcribed by this divergentpromoter probably encompasses the tbl-9::TnS mutation.The tabA gene is immediately downstream of the tblA locus(18, 22); however, the 1-kb tblA transcript is not largeenough to encode the predicted gene products of both thetblA and tabA genes. In support of this, a TnS insertion in thetabA gene did not affect the size of the tblA mRNA or theability to detect it (3, 4), indicating that these two genes are

transcribed separately. However, we cannot rule out thepossibilities that the tabA gene is cotranscribed with the tblAgene and that posttranscriptional cleavage that stabilizes thetblA transcript occurs between the two genes. In otherbacteria, there are reports of segmental differences in mRNAstability regulating gene expression within an operon (8, 17,37).

A problem has arisen concerning the nomenclature of thetabtoxin biosynthetic region. Our previous work has desig-nated genes within the region as tbl (5, 30). The identificationof a gene within this region as tabA (18) is confusing. Inaddition, tab is already the designation of genes required forbacteriophage T4 replication in E. coli (2). Therefore, wesuggest that the tabA designation be changed to tblB forconsistency in nomenclature.Our studies show that the tblA message is produced

throughout all growth phases in minimal medium by twodifferent tabtoxin-producing strains. These results are sup-ported by the results from the detection of PITC-derivatizedTOL in supernatants from BR2 cultures at all phases ofbacterial growth. Consistent with our previous finding (5),we could not detect T,BL in the culture supernatants of theBR2R lemA mutant KW233. This indicates that tabtoxinbiosynthesis is under tight regulatory control by the lemAgene. Although we found evidence for some transcription ofthe tblA gene by primer extension using RNA from a lemA4mutant of Pc27R, this low level of transcription did not resultin the production of detectable levels of TOiL. Taken as a

DNA A v

AG G _A T;C?00-w> -*f>0fl >

mRNA G'

A 71U 'AA TAC GiG C)j

CGXA TA ^G CA ^A T

CG7

A TC fG cU AtG C3' 5'

464 BARTA ET AL.

on June 19, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

SEQUENCE OF THE tblA GENE 465

whole, our results indicate that unlike a number of knownsecondary metabolic antibiotics (13), TOL is produced con-stitutively by P. syringae and may accumulate in the culturemedium.As yet, we cannot determine whether T,BL is produced in

rich medium. The presence of other amino acids interfereswith the detection of T,L by both bioassay and amino acidanalysis (50). Since the tblA message is produced in richmedium (Fig. 5) (5), it is unlikely that the tbUA gene productwould be the limiting factor for tabtoxin production. There isno available information regarding the conditions underwhich other tabtoxin genes are transcribed, and it is possiblethat production of another message plays a determining rolein T3L production under rich growth conditions.An anomaly that we have consistently noticed in our

Northern hybridization analysis suggests that a transcriptlarger than the 1-kb tblA mRNA may span the tblA gene. Ascan be seen in Fig. 1, a smear of hybridizing RNA is presentbeginning in a size range that is larger than 2.9 kb (the size of23S rRNA) and extending to a size range below that of thetblA transcript. This smear is present in extracts fromtabtoxin-producing strains but is absent from bacteria thatlack the tabtoxin biosynthetic genes (5). In addition, both the1-kb transcript and the smear are present when RNA isprobed with either the 1.5-kb or the 3.8-kb PvuII-XbaIfragment from the 5.3-kb PvuII fragment (Fig. 3A) (5). Thepresence of an additional transcriptional unit that spans thisportion of the tabtoxin biosynthetic cluster is supported bythe apparent expression of the tblA and tabA (tblB) genes inE. coli in vitro transcription-translation extracts from aplasmid promoter located well upstream of the start of thetblA transcript (18). It is not surprising that an exogenouspromoter is required for the expression of the tblA gene in E.coli. We have shown previously that E. coli containing thetabtoxin biosynthetic cluster on pRTBL823 does not expressdetectable levels of tabtoxin (30). Recently, preliminaryresults using a tblA::lacZ fusion have shown that the tblAgene is not transcriptionally active within E. coli (3). Thislatter result is consistent with the requirement of the lemAgene for the transcription of the tblA gene (5). We have not,as yet, detected a functional analog of the lemA gene withinE. coli.

All of the information necessary for the activation oftranscription of the tblU gene by the lemA gene in P.syingae appears to be contained within the 5.3-kb PvuIIfragment. A plasmid containing only the 5.3-kb PvuII frag-ment, pRK53, was conjugated into a tabtoxin-naive P.syringae pv. syringae strain and an isogenic lemA mutant.The tblU transcript was detected in the wild-type but not thelemA mutant strain (3). The function of the tblA gene intabtoxin biosynthesis is still unknown. The tblU gene mayencode either a biosynthetic enzyme or a regulatory factor.Regulatory genes are commonly linked to biosynthetic genes(34). A FASTA search did not reveal any significant degreeof DNA sequence similarity between the tblA gene and anygenes of known function in the GenBank data base (38). ThetblA gene may share sequence similarity with other genesonly in a very small region (such as an active site), andtherefore, it might be difficult to determine its function bycomparing sequence information. The tblA gene may repre-sent a novel class of transcriptional regulators or a gene ofunique function.

ACKNOWLEDGMENTSWe thank Jessica J. Rich and Susan S. Hirano for helpful

suggestions on the manuscript.

This work was supported by NIH Training Grant GM07215(T.M.B.) and partially funded by USDA Competitive Grant 88-37263-2856 (D.K.W.) and NSF Grant MCB-9118384 (D.K.W.).

REFERENCES1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G.

Seidman, J. A. Smith, and K. Struhl. 1991. Current protocols inmolecular biology. John Wiley & Sons, Inc., New York.

2. Bachman, B. J. 1990. Linkage map of Escherichia coli K-12,edition 8. Microbiol. Rev. 54:130-197.

3. Barta, T. M. 1992. Regulation of tabtoxin production in Pseudo-monas syringae pv. coronafaciens. Ph.D. dissertation. Univer-sity of Wisconsin-Madison, Madison.

4. Barta, T. M., M. Hill, and D. K. Willis. Unpublished data.5. Barta, T. M., T. G. Kinscherf, and D. K. Willis. 1992. Regula-

tion of tabtoxin production by the lemA gene in Pseudomonassyringae. J. Bacteriol. 174:3021-3029.

6. Barta, T. M., T. G. Kinscherf, and D. K. Willis. Unpublisheddata.

7. Barta, T. M., and D. K. Willis. Unpublished data.8. Belasco, J. G., J. T. Beatty, C. W. Adams, A. von Gabain, and

S. N. Cohen. 1985. Differential expression of photosynthesis inR. capsulata results from segmental differences in stabilitywithin the polycistronic rxcA operon. Cell 40:171-181.

9. Bilofsky, H. S., and C. Burks. 1988. The GenBank® geneticsequence data bank. Nucleic Acids Res. 16:1861-1864.

10. Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementa-tion analysis of the restriction and modification of DNA inEscherichia coli. J. Mol. Biol. 41:459-472.

11. Clayton, E. E. 1934. Toxin produced by bacterium tabacum andits relation to host range. J. Agric. Res. 48:411-426.

12. Cobianchi, F., and S. H. Wilson. 1987. Enzymes for modifyingand labeling DNA. Academic Press, Inc., San Diego, Calif.

13. Demain, A. L., Y. Aharonowitz, and J.-F. Martin. 1983. Metaboliccontrol of secondary biosynthetic pathways, p. 49-65. In L. C.Vining (ed.), Biochemistry and genetic regulation of commerciallyimportant antibiotics. Addison-Wesley, Reading, Mass.

14. Deretic, V., W. M. Konyecsni, C. D. Mohr, D. W. Martin, andN. S. Hibler. 1989. Common denominators of promoter controlin Pseudomonas and other bacteria. Biotechnology 7:1249-1254.

15. Durbin, R. D. 1981. Toxins in plant disease. Academic Press,Inc., New York.

16. Durbin, R. D. 1982. Toxins and pathogenesis, p. 423-441. InM. S. Mount and G. S. Lacy (ed.), Phytopathogenic prokary-otes. Academic Press, Inc., New York.

17. Eddy, C. K., K. F. Keshav, H. An, E. A. Utt, J. P. Mejia, andL. 0. Ingram. 1991. Segmental message stabilization as amechanism for differential expression from the Zymomonasmobilis gap operon. J. Bacteriol. 173:245-254.

18. Engst, K., and P. D. Shaw. 1992. Identification of a lysA-likegene required for tabtoxin biosynthesis and pathogenicity inPseudomonas syringae pv. tabaci strain BR2. Mol. Plant-Microbe Interact. 5:322-329.

19. Gray, G. L., D. H. Smith, J. S. Baldridge, R. N. Harkins, M. L.Vasil, E. Y. Chen, and H. L. Heyneker. 1984. Cloning, nucle-otide sequence, and expression in Escherichia coli of theexotoxin A structural gene of Pseudomonas aeruginosa. Proc.Natl. Acad. Sci. USA 81:2645-2649.

20. Gren, E. J. 1984. Recognition of messenger RNA during trans-lational initiation in Escherichia coli. Biochimie 66:1-29.

21. Heinrikson, R. L., and S. C. Meredith. 1984. Amino acidanalysis by reverse-phase high-performance liquid chromatog-raphy: precolumn derivatization with phenylisothiocyanate.Anal. Biochem. 136:65-74.

22. Hill, M. H. 1991. Molecular genetics of tabtoxin. Ph.D. disser-tation. University of East Anglia, Norwich, United Kingdom.

23. Holden, D. W., J. W. Kronstad, and S. A. Leong. 1989. Mutationin a heat-regulated hsp70 gene of Ustilago maydis. EMBO J.8:1927-1934.

24. Holmes, D. S., and M. Quigley. 1981. A rapid boiling method forthe preparation of bacterial plasmids. Anal. Biochem. 114:193-197.

VOL. 59, 1993

on June 19, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

APPL. ENVIRON. MICROBIOL.

25. Hrabak, E. M., and D. K. Willis. 1990. Molecular analysis of alocus from Pseudomonas syringae pv. syringae required forlesion formation. Phytopathology 80:984.

26. Inoue, T., and T. R. Cech. 1985. Secondary structure of thecircular form of the tetrahymena rRNA intervening sequence: atechnique for RNA structure analysis using chemical probes andreverse transcriptase. Proc. Natl. Acad. Sci. USA 82:648-652.

27. Johnson, J., C. M. Slagg, and H. F. Murwin. 1924. Host plantsof Bacterium tabacum. Phytopathology 14:175-182.

28. Karls, R., V. Schulz, S. B. Jovanovich, S. Flynn, A. Pak, andW. S. Reznikoff. 1989. Pseudorevertants of a lac promotermutation reveal overlapping nascent promoters. Nucleic AcidsRes. 17:3927-3949.

29. King, E. O., M. K. Ward, and D. E. Raney. 1954. Two simplemedia for the demonstration of pyocyanin and fluorescein. J.Lab. Clin. Med. 44:301-307.

30. Kinscherf, T. G., R. H. Coleman, T. M. Barta, and D. K. Willis.1991. Cloning and expression of tabtoxin biosynthesis andresistance from Pseudomonas syringae. J. Bacteriol. 173:4124-4132.

31. Levi, C., and R. D. Durbin. 1986. The isolation and properties ofa tabtoxin-hydrolysing aminopeptidase from the periplasm ofPseudomonas syringae pv. syringae. Physiol. Mol. Plant.Pathol. 28:345-352.

32. Lindgren, P. B. (North Carolina State University). Personalcommunication.

33. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

34. Martin, J. F., and P. Liras. 1989. Organization and expressionof genes involved in the biosynthesis of antibiotics and othersecondary metabolites. Annu. Rev. Microbiol. 43:173-206.

35. Miller, J. H. 1972. Experiments in molecular genetics. ColdSpring Harbor Laboratory, Cold Spring Harbor, N.Y.

36. Nelson, M., and M. McClelland. 1991. Site-specific methylation:effect on DNA modification methyltransferases and restrictionendonucleases. Nucleic Acids Res. 19:2045-2071.

37. Newbury, S. F., N. H. Smith, and C. F. Higgins. 1987. Differ-ential mRNA stability controls relative gene expression within apolycistronic operon. Cell 51:1131-1143.

38. Pearson, W. R., and D. J. Lipman. 1988. Improved tools forbiological sequence comparison. Proc. Natl. Acad. Sci. USA85:2444-2448.

39. Pritchard, A. E., and M. L. Vasil. 1986. Nucleotide sequenceand expression of a phosphate-regulated gene encoding a se-creted hemolysin of Pseudomonas aeruginosa. J. Bacteriol.167:291-298.

40. Ribeiro, R. D. L. D., D. J. Hagedorn, R. D. Durbin, and T. F.Uchytil. 1979. Characterization of the bacterium inciting beanwildfire in Brazil. Phytopathology 69:208-212.

41. Rich, J. J., S. S. Hirano, and D. K. Willis. 1992. Pathovar-specific requirement for the Pseudomonas syringae lemA genein disease lesion formation. Appl. Environ. Microbiol. 58:1440-1446.

42. Salch, Y. P., and P. D. Shaw. 1988. Isolation and characteriza-tion of pathogenicity genes of Pseudomonas syringae pv.tabaci. J. Bacteriol. 170:2584-2591.

43. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd ed. Cold Spring HarborLaboratory Press, Cold Spring Harbor, N.Y.

44. Sanger, F., S. Nicklen, and A. R. Coulsen. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

45. Shine, J., and L. Dalgarno. 1974. The 3-terminal sequence ofEscherichia coli 16S ribosomal RNA: complementarity to non-sense triplets and ribosome binding sites. Proc. Natl. Acad. Sci.USA 71:1342-1346.

46. Stewart, W. W. 1971. Isolation and proof of structure of wildfiretoxin (Pseudomonas tabaci). Nature (London) 229:174-178.

47. Taylor, P. A., H. K. Schnoes, and R. D. Durbin. 1972. Charac-terization of chlorosis-inducing toxins from a plant pathogenicPseudomonas sp. Biochim. Biophys. Acta 286:107-117.

48. Thomas, M. D., P. J. Langston-Unkefer, T. F. Uchytil, and R. D.Durbin. 1983. Inhibition of glutamine synthetase from pea bytabtoxinine-,B-lactam. Plant Physiol. 71:912-915.

49. Uchytil, T. F., and R. D. Durbin. 1980. Hydrolysis of tabtoxinby plant and bacterial enzymes. Experientia 36:301-302.

50. Uchytil, T. F., and R. D. Durbin (University of Wisconsin-Madison). Personal communication.

51. Willis, D. K., T. M. Barta, and T. G. Kinscherf. 1991. Geneticsof toxin production and resistance in phytopathogenic bacteria.Experientia 47:765-770.

52. Willis, D. K., E. M. Hrabak, J. J. Rich, T. M. Barta, S. E.Lindow, and N. J. Panopoulos. 1990. Isolation and characteriza-tion of a Pseudomonas syringae pv. syringae mutant deficient inlesion forming ability on bean. Mol. Plant-Microbe Interact.3:149-156.

53. Woolley, D. W., R. B. Pringle, and A. C. Braun. 1952. Isolationof the phytopathogenic toxin ofPseudomonas tabaci, an antag-onist of methionine. J. Biol. Chem. 197:409-417.

54. Wozniak, D. J., D. C. Cram, C. J. Daniels, and D. R. Galloway.1987. Nucleotide sequence and characterization of toxR: a geneinvolved in exotoxin A regulation in Pseudomonas aeruginosa.Nucleic Acids Res. 15:2123-2135.

55. Zhu, Y. S., and S. Kaplan. 1985. Effects of light, oxygen, andsubstrates on steady-state levels of mRNA coding for ribulose-1,5-bisposphate carboxylase and light-harvesting and reactioncenter polypeptides in Rhodopseudomonas sphaeroides. J. Bac-teriol. 162:925-932.

466 BARTA ET AL.

on June 19, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from