EFFECT OF SMOOTH AND ROUGH STRAIN BRUCELLA ABORTUS …

EFFECT OF SMOOTH AND ROUGH STRAIN BRUCELLA ABORTUS LPS

(LIPOPOLYSACCHARIDES) ON IMMUNE STIMULATION OF

BOVINES

By

RAHEELA AKHTAR (2004-VA-143)

DOCTOR OF PHILOSPHY In

PATHOLOGY

Faculty of Veterinary Sciences UNIVERSITY OF VETERINARY AND

ANIMAL SCIENCES, LAHORE-PAKISTAN

2010

DEDICATION Dedicated to my dear parents who devoted their lives to me. My success was made possible by my father who made me learn to fight against failure, and of course my mother as what I am today is all because of her prayers.

DR. RAHEELA AKHTAR

“IN THE NAME OF ALLAH,

THE COMPASSIONATE,

THE MERCIFUL”.

“Behold! In the creation of the heavens and the earth; in the alternation

of night and day; in the sailing of the ships through the ocean for the

benefit of mankind; in the rain which Allah Sends down from the skies,

and the life which He gives therewith to an earth that is dead; in the

beasts of all kinds that He scatters through the earth; in the change of the

winds, and the clouds which they trail like their slaves between the sky

and the earth -- (Here) indeed are Signs for a people that are wise."

(Surah Al-Baqarah, 2:164)

WISDOM IS THE PART AND PARCEL

OF MY RELIGION,

KNOWLEDGE MY WEAPON,

PATIENCE MY DRESS,

FAITH MY DIET,

AND

SINCERITY MY COMPANION.

(HADIS-E-NABVISAW)


(LIPOPOLYSACCHAIRDES) ON IMMUNE STIMULATION OF

BOVINES

RAHEELA AKHTAR 2004-VA-143

A THESIS SUBMITTED IN THE PARTIAL FULFILLMENT OF THE

REQUIREMENT FOR THE DEGREE

Of

DOCTOR OF PHILOSOPHY

(PhD)

In

PATHOLOGY

UNIVERSITY OF VETERINARY AND ANIMAL SCIENCES, LAHORE.

2010

To,

The Controller of Examinations, University of Veterinary and Animal Sciences, Lahore.

We, the supervisory Committee, certify that the contents and form of the

thesis, submitted by RAHEELA AKHTAR, have been found satisfactory and

recommend that it be processed for the evaluation by the External Examiner(s) for

Award of the Degree.

SUPERVISORY COMMITTEE: Chairman/Supervisor: ______________________________ Prof. Dr. Zafar Iqbal Chaudhary Member: ___________________________________ Prof. Dr. Azhar Maqbool Member: ____________________________________ Prof Dr. Mansur ud Din Ahmad

ACKNOWLEDGMENT

I owe special thanks to the most Gracious, Merciful, and Almighty

ALLAH who gave me the inspiration, thoughts and opportunity to complete

this task. I bow before my compassionate endowments to HOLY PROPHET

MUHAMMAD (peace be upon him) who is, ever a torch of guidance and

knowledge for humanity as a whole.

I deem it as my utmost pleasure to avail this opportunity to express the

heartiest gratitude and deep sense of obligation to my dedicated Supervisor,

Professor Dr. Zafar Iqbal Chaudhary, Dean Faculty of Veterinary Sciences,

Bhaud Din Zikria University, Multan, Pakistan, for his valuable suggestions,

keen interest, dexterous guidance, enlightened views, constructive criticism,

unfailing patience and inspiring attitude during my studies, research project,

and writing of this manuscript. Infect his day and night pursuance and sincere

efforts made this work to fruitful conclusion.

I gratefully acknowledge invaluable help render by my reverend co-

supervisor and renowned Brucella worker Prof. Dr. Yongqun Oliver HE,

Associate Professor and his research team (Prof. George W Jourdian, Dr.

Fang Chen, Charles B Larson, Halen, Kerthi, Andrew and Thom) University

of Michigan Medical School, USA, for giving me a chance to work with them

at world’s sixth ranked university. They gave me time, energy and offered me

solace, substances and insight during the conduct of this study. They were

always available when I needed them. In fact I do not hesitate to say that

without their untiring efforts, it would not have been possible for this work to

reach its present effective culmination.

I have the honor to express my deep sense of gratitude and profound

indebtedness to Dr. Beatriz Arellano, Department of Microbiology and

Immunology, National University of Mexico, USA for providing me with

moral support and all around help for the fulfillment of my research project.

I am deeply thankful to DR. Mansur ud Din Ahmad, Dr Aftab Anjum,

Dr Azhar Maqbool, Dr Muhammad Younus, UVAS, Lahore and Dr Nasir

Mehmood, School of Biological Sciences, University of Punjab, Lahore,

Pakistan for their personal interest, and valuable advices in my research

project, infect their advices will always serve as a beacon of light throughout

the course of my life. They always shared his extraordinary knowledge with me

that illuminated complex issues and enabled me to grasp their significance.

A big share of thanks goes to Dr Jean Namzek and her lab fellows

(Christ and Dolla), Unit of Laboratory Animal Medicine, University of

Michigan, USA for their technical guidance in research work and

constructive suggestions during my research.

I have no words to thank Dr Carlos Abril, University of Bern,

Swetzerland for his help in completion of this uphill task. It is imperative for

me to thank Dr David O Challghan, France, Dr Commander Nicky,

Veterinary Laboratory Agency, UK for their valuable suggestions and

guidance.

Last but not least, I am grateful to my family members for their endless

cooperation, assistance and encouragement during this research project.

DR. RAHEELA AKHTAR

ABBREVIATION

ACD: Anticoagulant citrate dextrose

ACK: Ammonium chloride potassium

APS: Ammonium persulfate

Av-HRP: Avidin- Horse Reddish Peroxidase

BCG: Bacillus Calmette-Guerin

CFU: colony forming unit

Con: Concentrated

CRPMI: Complete RPMI medium with supplements

DCs: Dendritic cells

ddH2O: Double distilled water

DMEM: Debcco’s minimal eagle medium

FBS: Fetal bovine serum

GM-CSF: Granulocyte-macrophage colony stimulating factor

HBSS: Hanks Balanced Salt Solution

iNOS: Inducible nitric oxide synthase

Kdo: 2-keto-3-deoxyoctonate

kDa: KilDalton

LPS: Lipopolysaccharide

LPSs: Lipopolysaccharides

LRT: Lysozyme Release Test

LSM: Lymphocyte separating media

LZ: Lysozyme

MOI: Multiplicity of Infection

NAG: N-acetylglucosamine

NAM: N-acetylmuramic acid

NBT: Nitro Tetrazolium blue

NO2: Nitric oxide

OD: Optical density

OPS: O-polysaccharides

PAMPs: Pathogen-associated molecular patterns

PBS: Phosphate buffer saline

PBMC: Peripheral blood mononuclear cells

PMNs: Polymorph nuclear cells

P.i: Post infection

ROI: Reactive oxygen intermediates

ROS: Reactive oxygen species

RNI: Reactive nitrogen intermediates

RI: Refractive Index

RLPS: Rough lipopolysaccharide

RT: Room temperature

SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis

SG: Specific gravity

SLPS: Smooth lipopolysaccharide

Spp. : Species

TEMED: Tetramethylethylenediamine

µg Microgram

µl: Microliter

WHO: World Health Organization

Acronyms

RPMI 1640: Roswell Park Memorial Institute

TABLE OF CONTENTS

Dedication Acknowledgement List of Tables List of Figures

S. No. Chapters Page no.

1. INTRODUCTION 1

2. REVIEW OF LITERATURE 7

3. MATERIALS AND METHODS 27

4. RESULTS 46

5. DISCUSSION 89

6. SUMMARY 110

LITERATURE CITED 112

ANNEXURES 137

LIST OF FIGURES

Sr. No. Title Page No.

1 Flow Chart of the Study 27

2 Rapid urea positive test for identification of Brucella abortus 47

3 A: SDS-PAGE of Brucella abortus smooth and rough lipopolysaccharides by silver staining.

B: SDS-PAGE of Brucella abortus smooth and rough lipopolysaccharides fractions by Coomassie blue staining.

49

4 4: Standard curve for Rf values of BioRad precision protein marker.

51

5 Purpald standard curves for LPS quantification 52

6 A: Isolated bovine neutrophils at magnification of 10x

B: Densogram showing isolated bovine neutrophils (a & c) and non neutrophils (b& d).

C: Histograms showing the separation of CH138A positive neutrophils and IgG negative control.

53

54-55

56

7 A: Isolated bovine peripheral blood macrophages are visualized at 10x.

B: Bovine isolated macrophages after seven days of culturing are visualized at 100x. Arrow indicates a mature macrophage.

58

8 Subcultured murine RAW 264.7 macrophages magnified at 10x

59

9 Visualization of lysozyme release using the agarose plate assay. The LPS samples are (a) rough RB51 LPS, (b) smooth S2308, and (c) combined S2308+RB51 LPSs. The concentration of LPS fractions were 200µg/mL per well.

61

10 10: Standard curve of lysozyme release test 62

11 A: Induction of Lysozyme from Bovine Macrophages Treated with rough, smooth and combined Brucella LPS Fractions.

B: Induction of Lysozyme from Murine Mcrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

C: Induction of Lysozyme from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.

63

64

65

12 A: Induction of Reactive Oxygen Species from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

B: Induction of Reactive Oxygen Species (ROS) from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

C: Induction of Reactive Oxygen Species (ROS) from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.

67

68

69

13 Nitric Oxide Induction from bovine Macrophages Treated with Rough,

71

14 Sodium nitrite standard curve of for nitric oxide determination

71

15 A: Induction of Nitric Oxide by Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

B: Induction of Nitric Oxide from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

C: Induction of Nitric Oxide from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.

72

73

74

16 A: TNF-α Induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

B: TNF-α Induction from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

76

17 A: IL-β Induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

B: IL-β Production from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

77

78

18 A: IL-6 induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

B: IL-6 Induction from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

79

19 A: IL-10 Induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.


81

20 A : IL-12 Induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.


83

21 CFU Analysis for Determination of Intracllular Survival of Brucella in Bovine Macrophages

85

22 A. Intracellular Survival of Brucella in Bovine Macrophages

B. Intracellular Survival of Brucella in Murine Macrophages.

86

23 PCR Amplification Products from Brucella abortus Positive Lymph Node Samples.

88

LIST OF TABLES

Sr. No. Title Page No.

1 Primer Sequences used for the Detection of Brucella abortus 43

2 A: Rf Values and Log Molecular Weight of Marker Bands.

B: Rf Values and Log Molecular Weight of Sample Bands.

50

3

A: Induction of Lysozyme from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

B: Induction of Lysozyme from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

C: Induction of Lysozyme from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.

62

63

64

4

A: Induction of Reactive Oxygen Species (ROS) from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

B: Induction of Reactive Oxygen Species (ROS) from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

C: Induction of Reactive Oxygen Species (ROS) from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.

66

67

68

5

A: Induction of Nitric oxide from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

B: Induction of Nitric Oxide from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

C: Induction of Nitric Oxide from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPSs Fractions.

72

73

74

Introduction

1

Chapter-1

INTRODUCTION

Brucellosis is a spreading disease transmitted to animals and humans mainly

by direct contact between infected hosts or through oral, respiratory, cutaneous,

ocular and sexual routes (Neta et al., 2009). The six Brucella species exhibit variation

in their host specificities and pathogenicities. Frequency of this disease varies from

country to country, but is higher in agrarian countries including the Middle East and

South West Asia (Pappas and Memish, 2007). Several studies demonstrated that

brucellosis is also endemic in Pakistan and its incidence is increasing (Akhtar et al.,

1990; Ahmad and Munir, 1995; Ramazan, 1996; Nasir et al., 2004; Nasir et al., 2005;

Hussain et al., 2008). Brucellosis has a major impact in terms of economic losses due

to abortion of calves, reduced milk yield, infertility in the male, and potential

infection of humans (Greiner et al., 2009).

The etiological agent of brucellosis is a non-motile, non sporforming and

facultative intracellular bacteria of genus Brucella (Jean, 2005). It is a potential agent

for biological warfare. This has sparked a growing interest in its biology (Department

of Army, USA, 1977).

Brucella LPS is a biologically active component present in the cell

membrane and comprised of three domains:

Polysaccharide or O-side chains or O-antigen (non toxic portion)

Core polysaccharide

Lipid A (toxic portion)

O-antigen is a homopolymer consisting of 96-100 units of α 1-2 linked

perosamine. It is considered the immunodominant subunit of LPS (Caroff et al.,

1984; Ugalde et al., 2003). Structurally, the O-antigen resembles with that of Vibrio

cholera LPS, but is totally different from other enterobacteriaceae LPS (Duenas et al.,

Introduction

2

2004). The Middle portion of the LPS, the core polysaccharide, consists of the

trisaccharide 2-ketodeoxy 3-octonate (Kdo). The embedded part of lipid A is

composed of long chain saturated fatty acids and small amounts of hydroxylated fatty

acids, but lack β-OH mystric acid-linked fatty acids (Aragon et al., 1996). Wild type

and attenuated Brucella strains present smooth or rough types of LPS based on the

presence or absence of an O-chain. The virulence of Brucella species has been linked

with the type of LPS present (Zygmunt et al., 2009).

Brucella LPS is released into body fluids where it is readily ingested by

phagocytic cells through pinocytosis or receptor-mediated endocytosis (Poussin et al.,

1998). Two days after ingestion, Brucella LPS molecules are found inside

macrophages in small vacuoles that coalesce together. The lipid A moiety of LPS is

deacylated and dephosphorylated (Wuorela et al., 1993; Leyva-Cobian et al., 1997).

Brucella LPS is designated as a non-classical endotoxin that plays a pivotal role in

pathogenesis and modifies phagocytosis, phagolysosome fusion, cytokine secretion,

and apoptosis (Beninati et al., 2009). In contrast to most endotoxins, it is

nonpyrogenic, does not induce a localized Shwartzman reaction, does not increase the

susceptibility to histamine and does not activate complement to any significant level.

Despite these properties, it is reported as the major antibody-inducing antigen present

in Brucella infections (Zaitseva et al., 1996).

Invading Brucellae are mainly found in and metabolized by short-lived

neutrophils and long-lived macrophages. Two mechanisms are used, non-oxidative or

oxidative pathways. Under non-oxidative conditions, antimicrobial proteins such as

lysozyme (LZ) and peptides are released, while under oxidative conditions,

brucellicidal oxidants are formed. These oxidants are recognized as reactive oxygen

species (ROS), including superoxide anions, hydrogen peroxide, chloramines,

hydroxyl radicals and hydrochlorous acid (Liautard et al., 1996) and reactive nitrogen

intermediates (RNI) (Jinkyung and Splitter, 2003).

Introduction

3

Killing Brucella requires enhanced macrophage and neutrophil stimulation

that augment the release of LZ, ROS, and RNI and ultimately cell mediated

immunity. Lysozyme has the ability to degrade Brucella cell walls by hydrolyzing

constituent peptidoglycan molecule and cleaving the glycosidic bonds between NAG

and NAM (Mc-Ghee et al., 1970; Maria et al., 2003), ROS damages fatty acid side

chains of the Brucella cell wall (Jinkyung and Splitter, 2003). RNI inhibits cellular

respiration (Gross et al., 1998). Therefore, taken together these metabolic functions

(LZ, ROS, RNI) are of importance for antibrucella activity. Additional support for

this statement comes from the observation that treatment of macrophages with

methylene blue (an electron carrier) enhances killing of intracellular Brucellae,

indicating their susceptibility to ROS. Similarly, inhibition of RNI by NG-

monomethyl L-arginine resulted in blocking of macrophage anti-Brucella activity

(Jiang et al., 1993b).

Activation of immune cells (macrophages and neutrophils) can be achieved

with number of stimulators including bacterial cell-wall components,

lipopolysaccharides (LPS), cytokines, interferon-gamma (IFN-γ) and tumor necrosis

factor (TNF-α). Each of these factors acts independently or in combination to elicit

various states of activation (Connelly et al., 2003). Evidence (Goldstein et al., 1992;

Rasool et al., 1992) exists that of the immune cells stimulators listed, Brucella LPS is

of particularly important to study, because it exhibits minimal endotoxic activity

compared to other stimulators (10,000 times less toxic than E. coli LPS and 1000

times less toxic than Salmonella typhimurium LPS). This property may contribute to

its potential use for immune cell stimulation studies and as an adjuvant in Brucella

vaccine (Goldstein et al., 1992). Attention has been focused on the fact that Brucella

LPS can serve as potential cell stimulator without adverse effect.

Previous studies on Brucella smooth and rough LPS have emphasized

extraction procedures (Alina et al., 2007), biological properties (Schurig et al., 1991;

Aragon et al., 1996), anti-LPS antibodies detection (Khatun et al., 2009), vaccine

Introduction

4

design (Apurba et al., 2002), immunogenic mimicking of LPS epitopes (Benninatic et

al., 2009), macrophage activation in an artificial metastasis model (Schultz et al.,

1978) and comparison of the LPS properties of Brucella with the LPSs of other

species (Escherichia coli and Salmonella) (Jarvis et al., 2002). However, the precise

role of LPS in induction of anti-Brucella immunity remains unresolved (Billard et al.,

2007). To better understand the differential immunological roles of smooth and

rough Brucella LPS, it is critical to study their differential stimulatory activities in

treated macrophages and neutrophils.

The present study focuses on the protective immunological properties of

rough Brucella LPS resulting from enhanced production of LZ, ROS, RNI and pro-

inflammatory cytokines. It is hypothesized that smooth and rough Brucella LPSs

utilize differential stimulatory activities on lysozyme resulting in oxidative burst, and

nitric oxide production which in turn could lead to different brucellicidal reactions of

infected cells (macrophages and neutrophils). In this study the rough and smooth

LPSs were used for the first time to study the reaction of immune cells and to

evaluate the differences in stimulatory activities of individual and combined LPSs.

Background of study

The unique properties of low pyrogenicity, minimal endotoxic shock and good

stimulation of immune cells suggests that Brucella abortus LPS has potential as a

candidate for vaccine preparation or as a vaccine carrier (Ayman et al., 2001).

However, most studies have emphasized the interaction of Brucella abortus LPS with

human and murine macrophages. Limited studies have focused on bovine

macrophages and neutrophils. Studies on the immune response of Brucella abortus in

bovines are of utmost importance since they are the major reservoir of brucellosis and

are responsible for transmitting the disease to humans. Moreover, there is a need for

insight into the differential activities of smooth and rough Brucella abortus LPSs, i.e.

which exhibits greater stimulatory activity. The present study also addresses possible

differential interaction of bovine and murine macrophages with Brucella abortus

smooth, rough, and with combined (rough + smooth) LPSs.

Introduction

5

Mice are not the natural host of Brucella and display a certain resistance to infection

(Zhan and Cheers, 1998). Much of the work has been performed in the mouse model

due to its convenient use as compared to other lab animals. In the present study, the

murine macrophages were compared with bovine macrophages after stimulation with

Brucella abortus LPSs.

Introduction

6

Objectives

The present study was designed to achieve the following objectives:

1- To extract, purify and characterize Brucella abortus smooth and rough LPSs.

2- To explore the mechanism of stimulation of bovine macrophages, neutrophils

and murine macrophages by Brucella rough and smooth LPS (separately and

in combination)

3- To determine (a) the outcome of infection by observing the interaction

between the pathogen (Brucella) and (b) LPS stimulated immune cells and to

find out the type of LPS (smooth, rough or combined) and optimal

concentration (00, 0.02, 0.2, 2, 20, 200 µg/ml) of Brucella LPS that yields

maximum stimulatory activity.

4- To compare the susceptibility of murine and bovine macrophages to Brucella

LPS stimulus in order to determine differences in species susceptibility.

5- To determine the major cellular organelles involved in Brucella death by

comparing LPS mediated stimulation of bovine macrophages and neutrophils.

Review of Literature

7

Chapter-2

REVIEW OF LITERATURE

Brucellosis or Malta fever is a serious public health problem caused by a

Gram-negative bacterium of the genus Brucella. The genus contains six species.

These are Brucella abortus, Brucella melitensis, Brucella suis, Brucella neotomae,

Brucella ovis and Brucella canis. Brucellosis has been an emerging disease of interest

since 79 A.D when skeletons of Romans buried with carbonized cheese revealed

brucellosis lesions on examination by scanning electron microscope (Capasso, 2002)

and later the discovery of Brucella melitensis by Bruce in 1887 until the identification

of marine reservoirs (Godfroid et al., 2005). Bovine brucellosis is characterized by

abortion in last trimester of gestation, stillbirth and weak calves. The commonly

observed clinical signs are pyrexia, anorexia, polyarthritis, meningitis, pneumonia

and endocarditis. The postmortem lesions include in placentitis in dam and interstitial

pneumonia in aborted foetus (Sauret and Vilissova, 2002). Human infection is due to

consumption of contaminated and/or unpasteurized milk, and milk products (cheese),

or laboratory acquired infection. (Young, 1983). Brucellosis is currently ranked at

number fifth on the list of important diseases of the world (Corbel, 1997). In some

geographical areas, Brucella melitensis has emerged as a cause of brucellosis

infection in non-bovine species including ovines and caprines. Brucellosis has been

an important animal and health issue in Pakistan from many years (Sheikh et al.,

1967). The incidence of diseases is very high in different districts of Punjab province

(Akhtar et al., 2010c). It not only affects humans zoonotically, but also exerts an

adverse influence on the Pakastani economy by perturbing the livestock sector. This

sector comprises 49.6% of Pakastan’s agriculture income and shares 10.4% of its

national gross domestic product (GDP) (Economy survey 2008-09). Consumption of


8

contaminated foods and occupational contact with animals remain the major sources

of infection. Human-to-human transmission by tissue transplantation or sexual

contact has been rarely reported. Brucellosis can be diagnosed by culturing and

isolating the pathogen and is standardized by the rose Bengal plate test (RBPT), milk

ring test (MRT), serum agglutination (SAT), complement fixation (CFT) and PCR

assay. Prevention of human brucellosis depends on the control of this disease in

animals.

Extraction and Purification of Brucella abortus Rough and Smooth Strains LPS The presence of LPS as round bodies embedded in Brucella cell wall was

reported by Bobo and Foster, (1964). With the aid of electron microscopy they

proposed that LPS was a subunit of cell wall. They used several sequential treatments

for lysis of Brucella cell wall including trypsin, pronase and lysozyme. These

reagents were more effective for the extraction of LPS than ribonuclease, pepsin,

lipase and non-enzymatic agents. The properties of Brucella LPS were studied by

Nicolas et al., (2006) who demonstrated by biochemical techniques and electron

microscopy that Brucella abortus LPS was recirculated through macrophages.

Furthermore, LPS was shown to act as detergent and was able to remain intact for

many months in macrophages by resisting destruction by methyl β-cyclodextrin

through the development of rigid surface membrane complexes. Many Brucella

workers developed different methods of LPS extraction to observe the relationship

between the extraction procedure and the biological properties of Brucella LPS.

Westphal and Tann, (1965) showed that rough Brucella LPS could isolated from an

aqueous phase whereas smooth LPS could be purified only from the phenol phase.

This was confirmed by Redfearn (1960) who showed that Brucella rough and smooth

LPSs were not only different from each other in their mode of isolation, but also with

respect to their biological properties. Baker and Wilson (1965) compared the

chemical composition and biological properties of B. abortus LPS and E. coli LPS

(based upon nitrogen, phosphorus, fatty acid amides, ester, hexose, hexosamine and


9

total fatty acids). They found that LPS preparations from E. coli possessed much

greater biological activity of hypoferremia and lethality in mice than B. abortus LPS.

Smooth and rough Brucella LPS preparations were also compared by Moreno et al.,

(1979), using two different modifications of phenol-water extraction method

(Westphal and Tann, 1969). They used chemical, immunological and SDS-PAGE

analysis to determine the difference in properties of Brucella rough and smooth LPS.

They not only revealed differences in the protein contents of two fractions (S-LPS

and R-LPS) but also in their isolation characteristics. The smooth LPS was obtained

from the phenol phase and the rough LPS was obtained from the aqueous phase. The

differences noted in biological activity of LPS were on per mass basis. The LPS

associated proteins were not the part of either LPS structure; rather they were firmly

attached to S-LPS and were not removed during purification.

Differences in the biological properties of smooth and rough Brucella LPSs

found by various laboratories prompted development for more effectual isolation

methods of each LPS. Jones et al., (1976b) demonstrated that both S and R LPS could

not be consistently extracted by previously developed methods as that the aqueous

phase was totally deficient in LPS while phenol phase had chief fraction of LPS.

Darveau and Hancock, (1983) developed an improved method for the extraction of

both smooth and rough LPS with high yields (51 to 81%) and purity. They used a

combination of cell breakage and nucleic acid digestion along with ethanol water

extraction method. The dried bacterial cells were preferred over wet cells for isolation

of large quantity of LPS. The contamination with protein (0.1%), nucleic acids (1%),

lipids (2 to 5%), and other bacterial products was much less than that obtained using

previously used methods. Subsequently, it was affirmed by the studies of Kreutzer et

al., (1979 a) that smooth intermediate (45/0) LPS was present in the aqueous and

phenol phases. Rough LPS (45/20) was only present in the aqueous phase. It was

proposed that in addition to being toxic, the phenol-soluble S-LPS could be a major

virulence factor in intracellular survival of B. abortus. The authors also proposed that


10

in addition to LPS, the rest of the components of aqueous and phenolic phase also

differed. LPS in the phenolic phase contained nine to 16 times less heptose and lower

amounts of dideoxyaldoses than did the aqueous phase. The major neutral sugars

found were glucose, galactose, and mannose. fβ-hydroxymyristic acid which is a

fatty acid and a common marker of enteric LPS, was absent. The only fatty acids

present, hydroxylated and nonhydroxylated with chain lengths of 16, 18, and 20

carbons respectively (Kreutzer et al., 1979 a), were present in the higher amounts.

Detailed characterization of the LPS from rough B. abortus, B. melitensis, B. ovis and

B. canis LPSs was made by Moreno et al., (1984). These authors also compared the

structural properties of Brucella rough and smooth LPSs side by side and

demonstrated a granular pattern on electron micrograph of Brucella R-LPS. This was

in contrast to characteristic lamellar structures found for S-LPS. The chemical,

physical and serological characteristics of Brucella rough and smooth LPS were

studied and monospecific mouse sera were developed against B. ovis R-LPS. Another

advanced, modified and specific method for Brucella rough LPS extraction was

described by Galanos et al., (1969). The extraction mixture was monophasic,

containing aqueous phenol, chloroform and petroleum ether. This method offers the

advantage that it can be carried out below 10°C and is easy to perform and yields

higher amounts of LPS than phenol-water extraction procedures.

Much of the LPS extraction had been performed with Brucella smooth strains

(Moreno et al., 1981; Caroff et al., 1984; Moriyon and Montanes, 1985; Aragon et

al., 1996) using Moreno’s method. However, this method has some drawbacks.

Therefore, Wu et al., (1987) attempted to modify Moreno’s procedure by employing

quick freezing and thawing to lyse B. abortus cells. This was followed by

ultrasonication to eliminate non-membrane-bound material, extraction with phenol

and washing ten times with water to remove chromogen, polysaccharides and nucleic

acids (Velasco et al., 2000). Protein contamination varied between 16% and 42%

(wt/wt) as estimated by the dye binding test using Coomassie Brilliant Blue (G-250)


11

as suggested by Bradford et al., 1976, and 17% and 60% by using the Lowry phenol

method (Lowery et al., 1951) with bovine serum albumin as a standard. Contrary to

previous techniques used, a higher yield of smooth LPS (3.6% to 7.7%) was obtained.

Suarez et al., (1988) introduced the use of hot saline for LPS extraction from

rough Brucella LPS. The pelleted LPS was analyzed for lipids, sugars, Kdo content,

and by immunoelectrophoresis and SDS-PAGE methodologies.

By the end of 1980, many techniques for extraction of Brucella rough and

smooth LPS had been reported. In an attempt to select the best technique, Malikov et

al., (1989) compared various methods of LPS extraction. LPS was purified from

Brucella virulent and vaccine strains using phenol water extraction. They used

Bovin's method of LPS extraction (Bovin and Mesrobeanu., 1935) and a mild alkaline

hydrolysis method, separately and in conjunction. Each LPS preparation (rough and

smooth) was analyzed for its chemical composition, immunological characteristics

and serological activity. The results suggested that the mild alkaline hydrolysis

method according to Bovin's protocol was optimal and the resulting LPS preparation

from virulent strains yielded a more consistent and sensitive product for use for the

passive hemagglutination tests than LPS from a vaccinal strain. Their work also

showed that the soluble complex of lipid A obtained from Brucella LPS had

serological activity. Garin-Bastuji et al., (1990) also combined several methods for

the extraction of smooth LPS from different biovars of B. abortus, B. melitensis, and

B. suis. They used a combination of hot phenol-water treatment, hot sodium dodecyl

sulfate followed by treatment with proteinase K and extraction with dimethyl

sulfoxide.

All methodologies that had been used up to this point in time for extraction of

either rough or smooth Brucella LPS were quite laborious and time consuming.

Sunsequently, Yi and Hackett (2000) developed a fast method of LPS extraction

using a commercial RNA-isolating reagent that facilitated the separation of LPS or

lipid A from small amounts of bacterial cells. The method did not require specialized


12

equipment and permit the use of large numbers of samples. The major constituents of

the commercial RNA isolating reagent (Tri-Reagent) were phenol and guanidinium

thiocyanate contained in aqueous solution. Bacterial cell membranes were lysed with

guanidinium thiocyanate, which eliminated the need for specialized equipment. LPS

and its main components such as lipid A were analyzed and the results compared to

the conventional hot phenol-water extraction. SDS-PAGE analysis revealed that the

LPS fraction was cleaner and less degraded, although loss of phosphate or fatty acyl

side chains from lipid A occurred. This method also yielded preparations with low

free fatty side chains and phosphate content. The total phosphate content was up to

11% by this method compared to 58% by hot phenol-water extraction. This method

required only two days for the isolation of LPS as compared to the hot phenol-water

extraction that took two weeks. Alina et al., (2007) obtained highly purified LPS

preparations by repurification of commercial or laboratory prepared LPS. They used

three methods for the repurification including; heat-detergent promoted

repurification, heat promoted repurification and acid-solvent promoted repurification

method. The last method was further selected and used. They also used triethylamine-

deoxycholate sodium for repurification after extraction of LPS and major

contaminants removal. This method is applicable to various LPS preparations and

does not require the use of phenol. The integrity and purity of the Brucella LPS

obtained was established by SDS-PAGE and matrix-assisted laser desorption

ionization mass spectrometry.

LPS Purification

Brucella LPS was purified by Zygmunt et al., (1988) using ultrafiltration,

repetitive gel filtration, high-performance liquid chromatography, SDS-PAGE, gas-

liquid chromatography mass spectroscopy, and 13C and 1H NMR spectroscopy.

Phillip et al., (1989) found that purification of LPS using proteinase K-treatment was

advantageous since proteinase K did not change the immunochemical, and other

defining properties of LPS. Butanol was used to extract LPS from smooth B. abortus


13

(S2308 and S-19). These procedures together yielded LPS preparations containing

less than one percent proteins. The LPS obtained was analyzed by chemical analysis,

SDS-PAGE, cesium chloride gradients, electron microscopy and gel

immunodiffusion. Furthermore, the butanol procedure proved the method of choice

for the extraction of LPS from B. abortus. Analysis of proteinase K treated LPS

preparations from sixteen smooth Brucella strains by SDS-PAGE after periodic acid

oxidation and silver staining revealed two differing profiles. LPS from B. abortus

was exhibited as regularly spaced narrow bands; while for theB. meliensis LPS, gels

contained regularly spaced doublets (Dubray and Limet, (1987).

SDS-PAGE Analysis

Sodium dodecyle sulfate polyacrylamide gel electrophoresis (SDS-PAGE)

uses an anionic detergent (SDS) to denature proteins. The protein molecules are

“linearized”. One SDS molecule binds to two amino acids. The charge to mass ratio

of the denatured proteins in a mixture is constant. Therefore, the protein molecules

moves toward the anode in the gel based on their molecular weights only, and thus

are separated.

A modified silver staining method for LPS detection was developed by Tsai

and Frasch, (1982). The silver stain is 500 times more sensitive than periodic acid-

Schiff stain of LPS and is able to detect less than 5 ng of R-LPS. Polypeptide and

polysaccharide components of B. abortus smooth LPS (S99) were analyzed by

Dubray and Charriaut, (1983) using SDS-PAGE gels stained with Coomassie blue or

silver staining. Triton X-100 was used to separate the cell wall from cytoplasmic

material prior to LPS isolation. Triton X-100 is a non-inonic surfactant which has a

hydrophilic polyethylene oxide group. The surface active agents (surfactants) have

been known for many years to possess bactericidal activity and in some cases

bacteriolytic activity as well. The bactericidal effects of ionic surfactants were

attributed to their ability to electrostatically bind to, and denature cellular enzymes

(Volko, 1946) or to disrupt the cellular components (Hotchkiss, 1946). The liquid


14

effects of surfactants on bacteria; however, require a more complex interpretation due

to the presence of rigid peptidoglycan layer surrounding bacterial cells which is not

present in erythrocytes. Triton X-100 may induce cellular lysis by releasing a lipid

inhibitor of the cellular autolytic enzyme. The SDS-soluble fraction revealed two

major components: a high molecular weight broad band (S-LPS) and a 43kDa

polypeptide band. The B. abortus outer membrane was composed of four major

components: LPS (43kDa) and polypeptides (36-37-38kDa) and glycopeptides (25-

26-27kDa). The S-LPS fraction appeared as broad band of high molecular weight as

compared to the multiple regularly spaced bands of high molecular weight found in

Escherichia coli S-LPS gels. A phenol extracted, alkali-treated LPS preparation from

the vaccine strain (S 19) of B. abortus was analyzed by Sowa et al., (1986) using

SDS-PAGE and silver staining. Their gels revealed ten polydispersed bands.

Nitrocellulose immunoblots showed that all ten reacted with bovine anti-B. abortus

polyclonal sera. Only six bands were antigenically reactive with anti-B. abortus O-

antigen murine monoclonal antibody. These findings are attributed to differences in

either the core or O-antigen side chain structure and covalently bound protein.

Schurig et al., (1991) suggested that the SDS-PAGE profile of Brucella rough (RB51)

LPS was not sufficient evidence for the absence of O-chain. Therefore, they

performed Western blot analysis with a monoclonal antibody (BRU 38) specific for

the O-chain of smooth Brucella LPS. Their results established that R-LPS lacked O-

chain as compared to the parenteral smooth strain 2308, although rough RB51

resembled its parental 2308 strain in its ability to metabolize erythritol. Moreover,

intraperitoneal inoculation of RB51 strain into mice or undergoing in vitro passages

did not convert it back to the smooth form. Freer et al., (1995) measured the

molecular size of each LPS component (O-polysaccharide, core oligosaccharide and

lipid A). SDS-PAGE and Western blotting revealed antigenic heterogeneity in

Brucella LPSs. Three dense high-molecular-weight bands related to S-LPS, a low-

molecular-weight band corresponding to the O-antigen were absent in rough LPS. B.


15

abortus R-LPS displayed four bands. On other hand, Cloeckaert et al., (2002) found

that RB51 strain produced low levels of a M-like O-antigen. This group used

monoclonal antibodies directed against O-polysaccharide and performed SDS-PAGE

along with Western blots to show that B. abortus RB51 lacked the O-side chain.


16

Purpald Assay

Although the increasing periodate concentration and reaction time of LPS

with sodium periodate can affect efficacy of this assay, still it is an improved method

for LPS quantification (Quesenberry and Lee 1996). The utility of this method is

shown by low Kdo content attributed to incomplete hydrolysis as well as conversion

of a portion of the Kdo to inert molecular species during hydrolysis (Brade et al.,

1983; McNicholas et al., 1987). These problems were circumvented by using the

purpald assay. Lee and Tsai, (1999) for first time used the purpald assay for the

quantification of lipopolysaccharide. This technique was based on the oxidation of

vicinal glycol groups in Kdo. After reaction with purpald reagent, the formaldehyde

released was measured at 550 nm.

Neutrophil Isolation

Neutrophils are the first line of defense against infections and are considered

the major cells involve in resisting invading Brucella. Several methods for the

isolation of neutrophils from different animal species have been suggested. Isolation

of neutrophils from human blood using enzymes such as Escherichia fmundii endo-β-

galactosidase and neuraminidase along with direct probe mass spectrometry is

possible, but the results are not comparable with the routine dextran isolation method

(Macher and Klock, 1981). A fast and simple magnetic cell sorting system based on

the principle of using specific cell surface markers could be helpful for separation of

large numbers of neutrophils (Forsell et al., (1985). The use of gradient magnetic

columns has been suggested by Milteny et al., (1990). The isolated cells, after

staining with biotinylated antibodies (fluorochrome-conjugated avidin and

superparamagnetic biotinylated-microparticles), were passed through magnetic

column. The labeled cells retained while the unlabelled cells passed through the

column. More than a million cells could be isolated in fifteen minutes. The use of

flow cytometry employing fluorochrome tagged cells and light scattering fluorescent

parameters did not alter the viability and proliferation of the isolated neutrophils. The


17

findings of Cotter et al., (2001) also suggested the potential of negative selection for

the immunomagnetic separation for the isolation of viable, highly pure and unaltered

neutrophils. They suggested that this technique could be used for in vitro and in vivo

inflammatory studies and provided neutrophils. Blood was incubated with antibodies

specific against surface markers of non-desired cells and subsequently with secondary

antibody-coated magnetic beads. The purity of the neutrophils in the effluent was

>95%, and had with <97% viability. Differences in surface L-selectin and CD18

expression of isolated neutrophils were compared with neutrophils in whole blood

using flow cytometry. On the basis of a comparison of the magnetic separation to

conventional percoll density gradient techniques in terms of neutrophil function,

purity, yield, morphology, oxidative burst and pre-activation, supports the use of

magnetic separation as a simple and fast method. This method yields highly purified

(99%), functional neutrophils. Neutrophils isolated by the percoll method contained

6% eosinophils. Each method yielded preparations contaminated with platelets. Using

magnetic separation, CD11b expression of neutrophil activation was lower than that

found with ficoll separation, but magnetic separation did not change oxidative burst

(Zahler et al., 1997). Another comparative study by Watson et al., (1994) showed that

cells isolated by combined dextran/ficoll procedure had a greater ability to produce

reactive oxygen species (ROS) than cells isolated by a one-step procedure using

Mono-Poly Resolving Medium (M-PRM). Cells isolated by the M-PRM method

could be primed in vitro more efficiently by GM-CSF than cells isolated by ficoll.

The ability of neutrophils for ROS generation and CD11 expression in response to

fMet-Leu-Phe was increased 10-fold if blood was pre-incubated with GM-CSF, rather

than the neutrophils in whole blood.

In order to circumvent problems associated with density gradient material, Oh

et al., (2005) used commercially available separation medium containing sodium

metrizoate and Dextran 500. After layering whole blood over the density gradient

medium, the samples were centrifuged and the residual erythrocytes lysed. The


18

neutrophils were washed, counted, and resuspended in buffer to desired

concentration. This modified method provided preparations with >95% purity and

>95% viability.

Although the density gradient separation and magnetic separation are the two

most common techniques in use they are not easy to perform because of the laborious

methodology. In order to replace these techniques Dodek et al., (1991) developed a

one step method for neutrophil separation. Perfusate (0.2% gelatin and 0.1 % glucose

in phosphate buffer saline) was pumped into an eluriator rotor at 2370 rpm followed

by loading with twenty milliliters of anticoagulated porcine blood mixed with 60 mL

perfusate. The concentration of neutrophils was measured in each fraction. Percentage

of total neutrophils was plotted against flow rate. This method yielded neutrophil

preparations of 95.1% that retained their morphology and contained intact granules

and lobulated nuclei. The isolated neutrophils produced superoxide in the presence of

phorbol myristate acetate (PMA) and phagocytosed zymogen particles. The

characteristics of neutrophils isolated by this method were not different from cells

obtained by conventional sedimentation methods. Using this method, human

neutrophil preparations were 94% pure.

Redbruch and Recktenwald (1995) isolated peripheral neutrophils, and

reviewed techniques for their isolation and analysis. Most isolation studies for

neutrophils have been performed on human blood samples (Saeed and Georgina

1998; Stickle, 1996).

Murine neutrophils were partially characterized by Gaines et al., (2005). They

studied multiple functional responses such as chemotaxis, adhesion, transmigration

across endothelial cells, phagocytosis, and pathogen destruction.

Stie and Jesatis, (2007) used two isolation procedures for the isolation of

neutrophils: a gelatin-based method and a pyrogen-free dextran-based method.

Neutrophils isolated by the gelatin method stimulated more superoxide generation as

compare to the neutrophils isolated by dextran method. Similarly the percentage of


19

cell adherence was more in the neutrophils isolated by gelatin based method than the

dextran based method. Similar results were obtained after neutrophil stimulation with

LPS, TNF- and GM-CSF. The authors also concluded that stimulation of suspended

and circulating neutrophils had a relationship with reorganization of the plasma

membrane.

The effect of different anticoagulants such as EDTA, citrate and heparin on

isolation of human neutrophils was studied by Freitas et al., (2008). Each of three

anticoagulant tested yielded different populations of neutrophils. On the basis of their

calcium levels and reaction to phorbol myristic acetate (PMA), EDTA was suggested

to be a superior reagent for the isolation of neutrophils. Rezapour and Majidi., (2009)

found that due to contamination with lymphocytes, commonly used isolation methods

for neutrophils were not acceptable and proposed a new and easy method for

neutrophils isolation using meglumine compound. The neutrophils were not deformed

and of high purity (79.5%) and viability (>97.5%).

Isolation and Culturing of Bovine Macrophages

Price et al., (1990) isolated bovine peripheral blood macrophages and

evaluated their role in natural resistance to bovine brucellosis. They used mammary

and blood derived macrophages from 22 animals including 11 heifers and 11 bulls.

They suggested that macrophages from naturally resistant cattle exhibited a superior

ability to regulate in vitro intracellular replication of B. abortus. Furthermore,

mononuclear phagocytes from more than 80% of resistant cattle regulated

intracellular replication of B. abortus better than mononuclear phagocytes from

susceptible cattle. After isolation and use of various experimental indicies including

phagocytosis, and ROS production, the recovered cells were deemed satisfactory for

experimental use (Bounous et al., 1993). Macrophages from one animal exhibited

decreased levels of phagocytic activity, intracellular killing and ROS production. The

differential ability of macrophages to phagocytize, and to kill B. abortus was not

related to each other, or to oxidant production. Qureshi et al., (1996) obtained


20

peripheral blood monocyte-derived macrophages from cows for the study of in vitro

replication of Brucella abortus in bovine macrophages. The macrophages from

resistant cows were able to prevent the intracellular growth of Brucella abortus than

the macrophages from susceptible cows. These resistant and susceptible cows were

also challenged with in vivo injections of Brucella abortus strain S2308. The in vivo

results showed that the susceptible cows became more resistant for Brucella infection

after in vivo injection of Brucella abortus strain S2308.


21

Lysozyme Release Assay

Lysozyme is an enzyme and can catalyze the hydrolysis of the bacterial cell

wall. Cell lysis, or bursting, that usually follows is the basis for lysosome bactericidal

activity in vivo. Most assays for lysozyme are turbidometric, measuring the clearing

of a suspension of dead bacterial cells as their walls break down. The Petri dish

method is somewhat similar in principle to the widely used agarose gel diffusion

assay for antibiotics. The lysozyme produced by macrophages and neutrophils are

diffused into Micrococcus lysodeikticus cells that are spread on agarose producing a

visibly cleared circle within which bacteria have been lysed.

Factors influencing lysozyme production such as phagocytosis were

determined by (Gordon et al., (1974). They noted 70% of lysozyme was sedimented

with azurophilic and specific granules of rabbit neutrophils. High concentrations of

lysozyme were also detected in alveolar macrophages. Further, investigation showed

that lysozyme production increased upon BCG stimulation and phagocytosis. On the

other hand, mouse peritoneal macrophages and human monocytes also secreted

substantial levels of lysozyme. Riley and Robertson, (1984) compared lysozyme

production from azurophil and specific granules of bovine and human neutrophils

stimulated with Brucella smooth-intermediate 45/0 and rough 45/20 strains. They

observed that bovine neutrophils had a greater killing ability against a smooth-

intermediate strain of B. abortus (45/0) than did human neutrophils. However, both

types of neutrophils killed rough Brucella at the same rate. They further found that

smooth-intermediate strains were more resistant to intraleukocytic killing in each type

of neutrophil than were rough strains. B. abortus could not stimulate an effective

level of degranulation for neutrophil stimulation after ingestion as compared to

extracellular organisms such as Staphylococcus epidermidis. Moreover,

myeloperoxidase and lactoferrin released from neutrophils infected with S.

epidermidis were four and two times higher respectively, than neutrophils infected

with B. abortus 45/0. Evidence was presented that B. abortus LPS and lipid A


22

induced lower levels of ROS and lysozyme in human neutrophils in dose dependent

manner. The low levels of lysozyme induced by Brucella LPS was also confirmed by

Rasool et al., (1992). They postulated that this low induction of lysozyme by Brucella

LPS could contribute to Brucella survival inside phagocytes. Lysozyme production

was increased in the presence of autologus plasma. Brucella LPS and lipid A

stimulation resulted in a 100 fold lower lysozyme release than did Salmonella LPS.

Nitroblue Tetrazolium Assay

Reactive oxygen species (ROS) produced by activated macrophages

and neutrophils reduce Nitroblue tetrazolium (NBT) dye, a colorless compound, to a

dark blue formazan by oxygen metabolites found in immune cells. NBT gives an

indirect measure of oxidative metabolism; as ROS are produced; more formazan is

produced as is indicated by increased absorbance. Activated cells produce increased

levels of reactive oxygen species. Therefore, this assay is used as a parameter to

determine macrophage and neutrophil activation. Canning et al., (1985) reported that

in vitro interaction of Brucella S-LPS with bovine neutrophils lowered NBT

reduction and inhibited the myeloperoxidase-hydrogen peroxide-halide system. This

may be a possible reason for the escape of smooth Brucella from intracellular killing

by neutrophils. On other hand, ROS production was not down regulated by heat-

killed B. abortus. Oxidative metabolism of neutrophils and peritoneal macrophages

increases after experimental infection with sporotrichosis in contrast to non-infected

neutrophils and macrophages (Rodolfo and Mendoza, 1986). In 1988, Canning et al.,

evaluated the ability of nonopsonized B. abortus to stimulate superoxide anion

production in bovine neutrophils. B. abortus stimulation was dependent on presence

of bacterial associated opsonins. The ability of Brucella species to inhibit ingestion

by neutrophils or macrophages explained why the oxidative burst had a significant

role in antibacterial process of phagocytic cells and Brucella survival was related to

evasion from cellular defenses (Liautard et al., 1996). Further, in vivo and in vitro


23

studies by Baldwin and Parent (2002) also revealed anti-Brucella activity of reactive

oxygen intermediates.

Nitric Oxide Production in Macrophages and Neutrophils

Nitric oxide (NO2) is a product of immune cells and directly involved in

killing of intracellular Brucella. The Griess reaction may be used to determine NO2

concentrations (Becker et al., 2000). The reaction is based on enzymatic conversion

of nitrate to nitrite by nitrate reductase. Stimulated macrophages and neutrophils

produce elevated levels of nitric oxide to counteract infection. Nitric oxide is thought

to be involved as a defense mechanism against Brucella (Margaret et al., 2002), but

the efficiency of Brucella killing is not same in all the cells and also varies in

different species. Gross et al., (1998) described that in mice B. suis was sensitive to

NO2 killing whereas in rat macrophages, B. abortus LPS did not induce high amount

of NO2 and could not kill Brucella. These results explained the acute outcome of

Brucella infection in the rat, the low frequency of septic shock and prolonged

intracellular survival of Brucella (Lupis-Urrutia et al., 2000). The production of nitric

oxide also varies with different stimuli within the same species or same types of cells.

Intracellular survival of B. abortus revealed that as compared to E. coli LPS, it

released less nitric oxide. Nitrite production was increased by 140 μM after 72 hrs

exposure to 10 ng/mL E. coli LPS, while in B. abortus infected macrophages, nitrite

concentration was 60 μM after 72 hrs of infection. The number of surviving Brucella

decreased, from 6 to 24 hrs, in the presence of nitrite accumulation and NO2 increased

killing of intracellular B. abortus Gangtsetse et al., (2003).

When scientists recognized that nitric oxide had remarkable antibrucella

activity, research was conducted to confirm this fact in a number of cell types,

especially Brucella carrying phagocytes. Gross et al., (2003) reported that in human

macrophages, nitric oxide was not effective against Brucella since the NO2

production was not sufficient. Thus, lack of NO2 production in isolated human

macrophages infected with Brucella could not eliminate Brucella. To further explore


24

the relationship of enhanced nitric oxide production and Brucella survival, three

strains of B. abortus and two macrophage cell lines were studied by Serafino et al.,

(2007). It was found that NO2 production was higher in macrophages infected with

rough RB51 strain than macrophages infected with smooth Brucella strains S19 and

2308. Since these observations were limited to a single bacterial species, Petra et al.,

(2008) compared in vitro nitric oxide induction in rat, bovine and porcine

macrophages, and in vitro upon stimulation with LPS and other stimulators including

phorbol myristate acetate, ionomycin and recombinant interferon gamma. The Griess

reaction showed differences in NO2 production in pulmonary alveolar macrophages

in all the species tested. The highest amount of NO2 was produced by rat

macrophages and the lowest in bovine macrophages. Porcine macrophages failed to

produce NO2.

Cytokine ELISA

Cytokines are protein, and are classified into two categories: pro-

inflammatory cytokines and anti-inflammatory cytokines. The pro-inflammatory

cytokines include TNF-α, IL-1α, IL-1β, IL-6, IL-12 and IFN-γ. The most important

anti-inflammatory cytokine is IL-10.

TNF-α was considered to be necessary for full expression of macrophage

antibrucella activities. Macrophages were able to kill intracellular Brucellae in 12 to

24 hrs following infection (Jiang et al., 1993b). Maurin et al., (2001) observed that

B. suis Omp25 could not induce TNF- in human macrophages due to some non-

identified protein. Negative regulation of TNF- was observed by Bruce et al., (2002)

in human macrophages. They found that B. abortus rough LPS activated the same

mitogen-activated protein kinase signaling pathways (ERK and JNK) for TNF-α as

did E. coli LPS. However, Brucella LPS was found to be a weak agonist of TNF-α as

were most of other pro-inflammatory cytokines. The production of cytokines differs

in different species. For example in mice (infected with Brucella) all Th1 type

cytokine responses helped in reducing infection (Dornand et al., 2002). The human


25

macrophages infected with B. suis only produced IL-1 and IL-6 cytokines. There was

no production of TNF-α. Other than cellular differences, the type of stimuli used was

also important for cytokine induction. Kariminia et al., (2002) reported an elevated

induction of IL-10 by smooth Brucella LPS. Flow cytometric studies showed that

LPS alone could not stimulate IL-12 expression. Similarly, murine macrophage line

J774 infected with B. abortus smooth strain (S19) produced less IL-6 than when

infected with B. melitensis vaccinal, and virulent strains (Khatammi and Ardestani,

2005).

Detection of Brucella Carrier Animals by PCR

Numerous PCR-based assays have been developed for the diagnosis of

brucellosis. Leal-Klevezas et al., (1995) introduced a novel method for the extraction

of Brucella DNA for PCR studies from body fluids (lymph node aspirates, blood and

milk) of infected animals. They synthesized two oligonucleotide regions of omp-2

gene and used PCR methodology to detect DNA of Brucella species in carrier cattle,

goats and humans. This method is sufficiently sensitive for the diagnosis of

brucellosis in animals and humans. Later, in 2000, Sreevatsan et al., (2000)

developed a multiplex PCR method for the detection of B. abortus DNA. This

method was highly sensitive and economical. It was used as an alternative to

serological tests. Differential PCR based assays are more complex and difficult to

carry out. Therefore, AMOS-PCR (named on basis of species it identifies: abortus,

melitensis, ovis) was developed (Bricker and Halling 1994). The genetic element

targeted is IS711. This work was extended by Hinic et al., (2008) who devised a

novel PCR assay for the rapid detection of Brucella. The assay was able differentiate

all six Brucella species. This method is highly specific for Brucella detection.

Intracellular Survival of Brucella

Most in vivo studies concerned with the intracellular survival of Brucella have

been performed in mice (Limet et al., 1989). Macrophages kill a majority of Brucella

cells at an early stage of infection, but the surviving bacteria are capable of avoiding


26

brucellacidal action at later stages of infection (He et al., 2006). Most of the active

brucellacidal activity occurred between 0 and 4 hrs post infection. Virulent smooth B.

abortus strain S2308 inhibited apoptosis in murine RAW 264.7 macrophages. B.

abortus strain RB51 induced both apoptotic and necrotic cell death. Similar results

were obtained in in vivo studies in mice immunized intraperitonially with vaccine

strain RB51. Inhibition of macrophage apoptosis may be a factor in the survival of

smooth Brucella cells inside macrophages (Chen and He, 2009).

LPS Mediated Immunity

Wu et al., (1988) studied B. abortus LPS and reported it as the most

immunodominant component among antigens of B. abortus examined. They

demonstrated that its immunochemical reactivity was quite stable and was not altered

prior to, or after non-enzymatic treatment. Goldstein et al., (1992) extracted LPS from

B. abortus by butanol extraction. The product was contaminated with less than 2%

protein, 1% nucleic acid and 1% ketodeoxyoctanic acid. These authors concluded that

B. abortus LPS could be a vaccine component because of its ability to serve as a

superior carrier. It could activate human B cells without involving T cells and was 10,

000 times less toxic than E. coli LPS. It is interesting to note that properties of B.

abortus LPS are similar to those of the whole bacterium.

Materials and Methods

27

Chapter-3

MATERIALS AND METHODS

Experimental Design:

A series of six sets of experiments were conducted to study and explore the

project as described in Fig 1 below.

FLOW CHART OF THE STUDY


28

3.1 Extraction, Characterization and Quantification of Brucella abortus

Lipopolysaccharides

3.1.1 Bacterial Strains

Brucella abortus rough attenuated strain RB51 and smooth virulent strain

S2308 were procured from Dr Gerhardt G. Schurig’s laboratory in Virginia Tech,

USA.

3.1.2 Cultivation

Freeze dried cultures of B. abortus were activated in a safety cabinet (class II

BSL lab, University of Michigan, Ann Arbor), in screw capped test tubes containing

tryptic soy broth (TSB), (Annex 01). TSB was prepared following the manufacturer’s

instructions. Tubes were placed in a shaking incubator (New Brunswick Scientific,

Edison NJ, USA) overnight at 37°C. The active cultures (100 µL each) were

transferred to Falcon tubes containing 10 mL of TSB and shaken at 37ºC for 24 hrs.

Brucella cultures (10 mL) were transferred to sterile plastic flasks containing one liter

of TSB and shaken at 37ºC at 180 rpm for 48 hrs, and were centrifuged at 4ºC at

4000 x g for one hour. The supernatant was discarded and the pellet was used for

lipopolysaccharide (LPS) isolation (Fiaori et al., 2000).

3.1.3. Differentiation of Rough and Smooth Brucella abortus Strains:

Differentiation of rough and smooth B. abortus strains was performed as

described by Bandara et al., (2009) using crystal violet staining. Tryptic soy agar

(TSA), (Annex 02) was prepared according to instructions of the manufacturer.

Autoclaved agar was poured in Petri plates and the plate sterility checked in an

incubation at 37ºC for 48 hrs. Plates free from contamination were streaked with

strains of B. abortus and cultured for 48 hrs. Crystal violet stock solution (Annex 03)

was diluted to 1:40 with sterile deionized distilled water and the surface of each plate

flooded with one milliliter of the diluted crystal violet solution and allowed to stand

for 30 seconds to one minute. The crystal violet solution was carefully removed


29

Rough colonies stained dark blue and the smooth colonies were unstained (white).

3.1.4 Gram Staining

Smears of Brucella abortus were prepared and heat fixed on glass slides.

Crystal violet solution was poured onto each smear for one minute and then the slide

was washed with water. Gram’s iodine solution was applied to the smears for one

minute followed by decolorization with alcohol for 5-6 seconds. The slides were

washed with water and counter stained with safrinin for 30 seconds. Microscopic

examination of slides revealed red colored coccobacilli rods indicating the Gram

negative character of Brucella.

3.1.5 Biochemical Profile

3.1.5a Catalase Test:

One drop of a fresh solution of 30% hydrogen peroxide was placed onto a

glass slide and a small number of Brucella cells were transferred into the solution.

The release of bubbles indicated a positive reaction.

3.1.5b Urease Test:

This test was used to test for the presence of urease in Brucella abortus

cultures. Brucella cultures were inoculated onto urea agar plates (Annex 04) using a

sterilized inoculating loop and the plates incubated at 37oC for 24 hrs. A change in the

color of the medium to deep pink color was considered positive assay for urease.

3.1.6a Lipopolysaccharides (LPS) Extraction from Brucella abortus Smooth

Strain

LPS from B. abortus smooth strain (S2308) was extracted using the protocol

of Apurba et al., (2002). The Brucella culture from the smooth S2308 strain was

pelleted at 4ºC at 2000 x g for 20 min in a GSA angle head rotor in a Sorvall RC-5B

refrigerated superspeed centrifuge. The Brucella pellet was resuspended in extraction

buffer (Annex 05) at 1:10 ratio. The extraction buffer containing the pellet was stirred

at room temperature for 24 hrs and kept at 5°C for five days until material in the


30

pellet changed into a colloidal suspension. This suspension was centrifuged at 4°C at

10,000 x g for 20 min, and supernatant obtained was dialyzed extensively against

cold distilled water. The dialyzed crude extract was filtered through a YM-10

membrane (Cat # 13651, 90 mm ultrafilteration membrane, Amicon corporation,

Ireland). The resulting filterate (25 mL) was centrifuged at 4°C at 105,000 x g for 16

hrs to obtain LPS pellet. The LPS pellet obtained was resuspended in a minimal

amount of distilled water and lyophilized (Section 3.1.8). The lyophilized LPS was

suspended in chloroform/methanol (2:1) and centrifuged at 4°C at 1800 x g for 20

min. The supernatant was poured off and the process was repeated. The resulting

pellet was lyophilized and the dried residue was suspended in water saturated

chloroform/water (1:1) and centrifuged at 4°C at 1800 x g for 15 min. The water

phase was decanted and an equal volume of distilled water added, this suspension was

mixed, re-centrifuged (at 4ºC at 1800 x g for 15 min) and the water phase was

removed. The water phase from the chloroform/water extraction was lyophilized to

obtain partially purified LPS.

3.1.6b Lipopolysaccharide (LPS) Extraction from the Brucella abortus Rough

Strain

Brucella abortus rough strain (RB51) (50g, wet weight) were mixed with 200

mL of extraction mixture (Annex 06), and the suspension was homogenized with an

ultra-Turrax homogenizer (Janke and Kunkel) for two minutes with cooling in ice so

that the temperature remained between 5-20°C. The mixture was centrifuged at 4°C at

2000 x g for 15 min and filtered through filter paper. The yellow brown bacterial

residue was removed by centrifugation and placed in a rotary evaporator at 30-40°C

to remove the remaining petroleum ether and chloroform. To the phenol crystallized

residual material, sufficient water was added to dissolve it. The solution was

transferred to a glass centrifuge tube and water added drop wise until the LPS was

precipitated. The precipitated LPS was centrifuged at 4°C at 1000 x g for 10 min. and

the supernatant was decanted. The precipitate was washed 2-3 times with small


31

portions of 80% phenol (about 5 mL). Finally, the precipitate was washed three times

with ether to remove residual phenol, and dried in a vacuum. The LPS was diluted to

50 mL with distilled water, warmed to 45°C and placed under vacuum to remove air.

The resulting viscous solution was placed in an ultra vibrator for five minutes and

centrifuged at 100,000 x g for four hrs. The LPS fraction in the clear, transparent

pellet was dissolved in distilled water and was freeze-dried (Section 3.1.8), (Galanos

et al., 1969).

3.1.6c Lipopolysaccharides (LPS) Extraction by Using a Commercial Kit

LPS was also extracted from smooth and rough Brucella abortus with the

used of a commercial kit. The packed cells were extracted of LPS as described by the

manufacturer (Intron Biotechnology, Cat # 17141).

The kit contained a Lysis buffer 100 mL and a Purification buffer 80 mL. The kit

components were stored at 4°C until used.

The yield of extracted LPS was proportional to the volume of culture. A

maximum yield was obtained when 5 mL of culture medium was used (OD of 0.8-

1.2). The Brucella broth culture was centrifuged at room temperature at 15,7000 x g

for 10 min. On average, 5 mL of packed bacterial cells were obtained. The

supernatants were decanted and one milliliter of lysis buffer was added and

vigorously mixed (vortex F/S-16, Telron Biotech). Chloroform (200 µL) was added,

and the mixture vortexed for 10-20 seconds and incubated at room temperature for

five minutes. Upon the addition of chloroform, a white line formed just beneath the

upper blue layer. This region was comprised of mixture of cell debris, protein, and

DNA and RNA. The addition of chloroform allowed separation of the phenol layer

from aqueous layer. Purification buffer (800 µL) was added with mixing following by

incubation at -20 °C for 10min. The mixture was centrifuged at 4°C at 15,7000 x g

for 10min and 400 µL of the supernatant were transferred to 1.5 mL Eppendroff tubes

and centrifuged. Two layers were formed. A white precipitate containing protein and

DNA was observed at the interface between the two layers. The supernatant was


32

carefully removed, avoiding the white precipitate. The supernatants were centrifuged

at 4°C at 15,7000 x g for 15 min and the pellets containing the crude LPS were

washed with one milliliter of 70% ethanol and dried.

3.1.7 LPS Purification

The crude LPS pellets were dissolved in a solution containing 5 mM MgCl2 in

0.1 M Tris-HCl, pH= 7.0 at a level of 10 mg/mL. Each LPS preparation was digested

at 37°C with 50 µg/mL each of DNase and RNase for 30 min. This was followed by

digestion at 55°C with 50 µg/mL of proteinase K for three hours. Digestion with

proteinase K was repeated three times and each time the sample was reisolated after

exposure to proteinase K. The final incubation volume was brought to 26 mL with

distilled water and the suspension centrifuged at 4°C at 100,000 x g for six hours. The

resulting clear gelatinous pellet served as purified LPS (Velacso et al., 2000).

3.1.8 Lyophilization

Purified LPS was suspended in distilled water, transferred to a glass tube,

frozen in a dry ice acetone bath, and lyophilized in a lyophilizer (Freezemobile 12)

(Jones et al., 1976b).

3.2 Characterization of Brucella LPS

Partial characterization of Brucella LPS was performed bySodium dodecyl

sulfate polyacrylamide gel electrophoresis (SDS-PAGE) using the method of

Laemmli, (1970). The methods for preparation of the resolving gel buffer, stacking

gel buffer, and sample buffer are given in Annex 07, 08 and 09 respectively. The

resolving gel contained 15% and the stacking gel contained 4.9% polyacrylamide

(Annex 10 and 11). The composition of tank buffer and gel fixation solution is given

in Annex 12 and 13, respectively. The wells were loaded with a known protein

standard, Precision Plus Protein (Cat # 161-0375, Kaleidoscope Bio RAD) and

various volumes of samples. Electrophoresis was carried out at 80V.


33

3.2.1 Staining of gels

3.2.1a Silver staining

The gels were stained using a silver staining kit as recommended by the

manufacturer (Bio-RAD). The resulting bands on the gels were scanned with a

imager (Bio-RAD).

3.2.1b Coomassie Brilliant Blue Staining

Colloidal Coomassie stain (G-250, National Diagnostics) and 95% ethanol were

mixed in 9:1 ratio to prepare the final stain. The gel was placed overnight in this

solution. The staining solution was poured out and water added to overlay the gel for

washing, and the gel was visualized by scanning with HP Scanjet G4050.

3.3 Quantification of LPS

LPS was quantified by the Parpald assay procedure described by Lee and

Tsai. (1999). Fifty microliters of LPS samples were added in duplicate wells in a 96-

well culture plate. Fifty microliters of 32 mM sodium periodate (NaIO4) (Annex 14)

were added, and plates were incubated at 37ºC for 25 min. Parpald reagent (50 µL)

(Annex 15) in 2N sodium hydroxide (NaOH) was added to each well and the plates

were incubated for 20 min. Finally, fifty microliters of 64 mM sodium periodate

(NaIO4) were added and the plates were incubated for another 20 min. Formation of

bubbles in the wells was eliminated by addition of 20 µL of 2-propanol. Absorbance

was measured with an ELISA plate reader (Synergy Tech) at 550 nm. Standard

curves were generated using glycine (70 to 420 µg/mL).

3.4 Stimulation of Bovine Neutrophils and Macrophages

Samples of blood were collected from one hundred healthy bovines (Holstein)

at Green Meadow Farms Inc. Michigan, USA. The samples (20 mL) were taken

aseptically and the syringes contained EDTA for anticoagulation.

3.4.1a Isolation of Bovine Neutrophils

A novel means was developed for isolation of bovine neutrophils using a

modification of the method of Robert and Nauseef (2001). Lymphocyte separating


34

media (LSM, Annex 16), (2 mL) was pipetted into a 15 mL Falcon tube and four

milliliters of blood were carefully layered on the LSM. The tubes were centrifuged

(Eppendroff 5810 R) in a swinging bucket rotor and at 4°C at 652 x g for 10 min.

Four distinct layers were formed. The layer at the bottom contained red blood cells,

second layer from bottom had neutrophils followed by lymphocytes and monocytes

together in next layer. The topped layer was only plasma. The sediment was highly

enriched with neutrophils and erythrocytes. The sediment was mixed with equal

volume of 6% dextran contained in 0.9% NaCl. The cell suspension was incubated at

37°C for 45 min to allow sedimentation of the erythrocytes. The erythrocyte fraction

was discarded. The neutrophil-rich supernatant collected was mixed with an equal

volume of Hanks balanced salt solution (HBSS, GIBCO Invitrogen). The reaction

mixture was centrifuged at 4°C at 290 x g for 10 min. The pellet containing the

neutrophils was washed with HBSS and ACK lysing buffer (1 mL, Cat# 10-548E,

I.Onza, Annex 17) was added to lyse any remaining erythrocytes. The tubes were

incubated at 37°C for five minutes. Two volumes of HBSS were added, the tubes

centrifuged at 4°C at 652 x g for 10 min to remove the lysed erythrocyte particles.

3.4.1b Counting of Neutrophils

The neutrophils were resuspended in phosphate buffer saline (PBS) to achieve

an optimal concentration (2 mL). Ten microliters of this suspension were pipetted

onto a hemacytometer and the neutrophils were counted (25 squares inside the central

double lines). The neutrophils were identified by the specific multilobulated structure

of their nuclei. The neutrophil count was multiplied by 0.1mm3 and 1000 to get

number of neutrophils per milliliter (Cotter et al., 2001).

3.4.1c Determination of Neutrophil Viability

Viability of neutrophils was determined as described by Nagahata et al.,

(2004). The neutrophil suspension was mixed with an equal volume of trypan blue

and examined with a microscope. Transparent cells were considered viable. Blue

stained cells were counted as dead. .


35

3.4.1d Analysis of Neutrophil Purity.

Neutrophil purity was evaluated by two methods:

1- The use of hemocytometer employing differential counting of neutrophils

vs non-neutrophils. The neutrophils were identified by their multilobular nuclei by

observation with a microscope at 20X to 40X magnification (Kabbur et al., 1995).

2- Flowcytometry using CH138A antibodies.

3.4.1e Determination of Neutrophil Purity by Flow Cytometry

The technique used was that described by Piepers et al., (2009). The

neutrophils were suspended in 2% formaldehyde (2 mL of formaldehyde and 98 mL

of PBS). The cells were spun at 1000 x g for five minutes. The neutrophil fraction

(sediment) and was divided into two aliquots. Each aliquot was mixed with 100µL of

Flow buffer (Annex 18). One aliquot was mixed with 5µL of Anti-bovine granulocyte

IgM monoclonal antibody CH138A (Cat # CH138A VMRD) at a concentration of 2.5

µg/mL per million cells. The other aliquot was mixed with Mouse IgG APC (BD

Biosciences) and served as a negative control, at a concentration of 2.5 µg/ million

cells. The CH138A coated neutrophils and their negative controls lacking CH138A

antibody were placed in the dark at 4ºC for 30 min. The samples were centrifuged at

4ºC at 1000 x g for five minutes. The sediment obtained after centrifugation was

washed with 1X PBS (5 mL), at least two times. The neutrophils were resuspended in

200 µL of 2% (v/v) formaldehyde in PBS. Analyses were performed in a BD LSR II

Flow cytometer (Department of Pathology, University of Michigan) along with

Winlist 6.0 software to analyze the data.

3.4.2a Isolation and Cultivation of Bovine Macrophages:

Blood (30 mL) containing the anticoagulant citrate dextrose (ACD, Annex 19)

was gently poured into sterile centrifuge tubes (Falcon) and centrifuged at 4°C at

1000 x g for 30 min. The percoll working solution was prepared by diluting percoll

stock solution (Annex 20) with isotonic suspensions of desired specific gravities


36

containing bovine serum albumin (BSA) (5 mg/mL) (Annex 21) and 13 mM citrate

(Annex 22) using the following formula:

X(a) + 0.1 (b) + 0.1 (c) + (0.8 –X) (d)= desired specific gravity -1

X= mL of PBS/mL of final suspension

0.8-X= mL of stock percoll/mL of final suspension

0.1= mL of albumin and citrate/ml of final suspension

a: specific gravity of PBS-1 (a= 1.0056)

b: specific gravity of 0.5% albumin-1 (b= 1.0227)

c: specific gravity of 13mM citrate-1 (c= 1.0219)

d: specific gravity of stock percoll solution-1 (d= 1.1245)

The desired specific gravity for this study was 1.0770

The recipe for one liter working percoll may be found in Annex 23.

Blood was centrifuged at 4ºC at 1000 x g for 30 minutes. To a white cell

suspension (15 mL), was added 15 mL of PBS-citrate solution (PBS-C) (Annex 24).

The suspension was mixed gently, avoiding mixing the cells with percoll in a final

volume of 45 mL. The tubes were centrifuged at 4ºC at 1000 x g for 30 min. The

white cell fractions were transferred to another tube and PBS-C was added to a final

volume of 50 mL (This step eliminates any remaining percoll). The mixture was

mixed gently and centrifuged at 4°C at 500 x g for 10min. The PBS-C was discarded

and the pellet further processed by addition of ten milliliters of plasma and

homogenized. PBS-C was added to bring the volume up to 50 mL and centrifuged at

4°C at 500 x g for 10 min. This step is repeated twice. The pellet was resuspended in

Complete RPMI (CRPMI, Annex 25) containing 4% bovine calf serum. This

suspension was poured into a Teflon flask and incubated in a humified incubator

flushed with 5-10% CO2 at 37 ºC for 24 hrs. The medium was changed every 3-4

days. Six milliliters of fresh medium was added by keeping one milliliter of old

medium. (Qureshi et al., 1996).


37

3.4.2b Harvesting of Macrophages

After seven days of culture, macrophages were harvested with a cell scrapper.

The culture medium with cells was centrifuged at 4°C at 500 x g for 10 min and the

supernatant discarded. The cell number was counted and adjusted as needed in

CRPMI-10% FCS (Omar et al., 2003).

3.4.3 Murine Macrophage Cultivation.

Murine RAW 264.7 macrophages were obtained from the American Type

Culture Collection (ATCC, cell line TIB-71) and as described by Cynthia et al.,

(2002). Macrophages were cultured in 24 well plates in Dulbecco's Modified Eagle

Medium (DMEM) 10% Fetal Bovine serum (FBS) and 1% penicillin, streptomycin

mixture at a concentration of 2.5x105 cells /mL. Composition of DMEM is described

as Annex 26.

3.4.4 Assay of Lysozyme Induction in LPS-Induced Bovine Macrophages,

Neutrophils and Murine Macrophages

The assay was performed with little modification from that described by

method of Stabili et al., (2009). Agarose gel 1% (Annex 27) containing 0.5 mg/mL of

dried Micrococcus lysodeikticus cells was suspended in a 0.1M phosphate citrate

buffer pH 5.8 (Annex 28). Agarose (25 mL) was poured into each plate. After

solidification, holes (35 mm diameter) were punched in the gel. Bovine macrophages

and neutrophils, each at a concentration of 2.5x105 /mL were cultured for in a 24 well

plate 24 hrs, in CRPMI containing 10% FBS. Murine macrophages (2.5x105 /mL)

were cultured for 24 hrs in 24 well plates in Modified Eagle Medium (MEM)

containing 10% FBS. At varying concentrations (0.02. 0.2, 2, 20, 200 µg/mL,

respectively). each LPS (rough, smooth alone or in combination) were added to each

well. The samples were incubated at 37°C for two hours with shaking. The incubation

mixtures were centrifuged at 4°C at 3000 x g for 10 min and supernatants stored at -

70°C until assayed. Sample suspensions of 25 µL were loaded into the wells in the

agarose plates. The plates were incubated at 37°C for 24 hrs. Each plate was scanned


38

(HP Scanjet G4050) and the radius of clarified zone around each well was measured

and amount of lysozyme released calculated from a generated standard curve. Each

sample was assayed in triplicate. Egg white lysozyme (0.00 to 16 µg/mL) was used to

generate a standard curve. All background values were obtained using media

(CRPMI) containing FBS and these background values were subtracted from

calculated value of each sample.

3.4.5 Induction of Reactive Oxygen Species (ROS) from LPS-Induced Bovine

Macrophages, Neutrophils and Murine Macrophages

A solution of 0.1% NBT of 200 µL (Annex 29) was added to each well and

the plates incubated at 37°C for 60 min. Following incubation, varying concentrations

of LPS (0.02, 0.2, 2.0, 20, 200 µg/mL, respectively) were added to each well.

Samples were incubated against at 37°C for 30 min. The reactions were stopped by

adding an equal volume (500 µL) of 0.1N HCl (Annex 30). The mixture was

centrifuged at 4°C at 800-1000 x g for 15 min. The resulting pellets obtained were

dried at 37°C in dark. Dioxane (1 mL) was added to each pellet and incubated at

85°C for 20 min. After incubation, the mixture was centrifuged at 4ºC at 800-1000 x

g for 15 min. The optical density of the clarified supernatant was determined at 580

nm with a dual beam spectrophotometer (Beckman Coulter, DU 530) at room

temperature. The polystyrene semimicro cuvettes (Cat# 14-385-942, Fisher

Scientific) were used that can read absorbance between 240-750nm. E. coli LPS and

superoxide dismutase (SOD) served as positive and negative controls, respectively

(Zembala et al., 1980).

3.4.6 Induction of Nitric Oxide from LPS-Induced Bovine Macrophages, and

Neutrophils, and Murine Macrophages

Bovine and murine macrophages and bovine neutrophils were cultured in 96

well plates at a concentration of 2.5x105/mL and incubated at 37ºC in 10% CO2 for 24

hrs. Cultured macrophages were treated with varying concentrations (0.02, 0.2, 2, 20,

200 µg/mL, respectively) of all three types of LPSs {rough, smooth and combined


39

(1:1)} and incubated at 37ºC in 10% CO2 for two hours. After incubation, LPS-treated

macrophages were centrifuged at 4ºC at 600 x g for 10 min and supernatant collected.

Supernatants were mixed with an equal volume of Griess reagent (Annex 31) in 96

well plates. The plates were held at 25°C for 10 min and color change (indicative of

nitrite presence) was quantified at OD540 by reading the plates on ELISA plate reader

(Synergy BioTech). Each experiment was performed in triplicate. A standard curve

was generated using increasing concentrations of sodium nitrite (0.3125 to 20 µg/mL)

dissolved in MEM. Macrophages pretreated with E. coli LPS served as a positive

control. Accumulation of nitric oxide was inhibited by NG monomethyl-L-arginine

(L-NMMA) which served as a negative control (Goldstein et al., 1992). Background

values of nitrite production by untreated macrophages were subtracted from sample

values. The absorbance of the standards, controls and test samples was converted to

ng/mL of nitrite by comparison with absorbance of sodium nitrite standards within a

linear curve fit (Waters et al., 2002).

3.4.7 Determination of Cytokines in LPS-Induced Bovine and Murine

Macrophages by Enzyme Linked Immunosorbant Assay (ELISA).

A sandwich ELISA assay was performed to determine the cytokine production

in LPS-activated macrophages (Rittig et al., 2003).

3.4.7a Sample Preparation

Macrophages were cultured at 37ºC in 24 well plates in DMEM containing

10% FBS and 1% penicillin-streptomycin (PS). After 24 to 48 hrs, the medium was

aspirated from the wells and either 200 µg/mL of rough RB51, smooth S2308 or a

combination of rough and smooth Brucella abortus LPSs (100 µg/mL each) were

added and the plates incubated for another 24 hrs. The samples were then centrifuged

at 4°C at 3000 x g for 10 min and the recovered supernatant was frozen prior to the

quantification of cytokines. The following cytokines served as positive controls:

recombinant bovine and murine interleukin-1-beta (IL1-β), interleukin-6 (IL-6),


40

interleukin-10 (IL-10), interleukin-12 (IL-12) and tumor necrosis factor alpha (TNF-

α) (Bio-Legend).

3.4.7b Coating of ELISA Plate

Unlabelled, captured antibody (10 µL) was diluted in 10 mL of coating buffer

(Annex 32, 1: 1000 dilution) and 100µL pipetted into a 96 well microtiter plate. The

plate was sealed with parafilm and incubated overnight at 4ºC.

3.4.7c Blocking the Plates

The plates were brought to room temperature for 10 min and the antibody

solution removed. Plate were washed three times with PBS/Tween-20 (Cat# BP337-

100, Fisher Scientific), 0.5% v/v, mentioned in Annex 33. Blocking solution (200 µL,

Annex 34) was added to each well. Plate were sealed with parafilm M and incubated

at room temperature for two hours. The blocking solution was discarded; plates dried

on tissue paper, after washing was repeated three times with PBS/Tween-20 (Annex .

3.4.7d Coating the Antigen

Samples (100 µL) were added to each well of a 96 well plate, sealed with

Parafilm and incubated at room temperature for 4 hrs. The plates were then washed

four times with PBS/Tween-20. After each wash, the plates were blotted with a paper

towel.

3.4.7e Coating with Secondary Antibody

Biotin labeled antibody diluted (1:1000) with blocking solution (100 µL) was

added to each well. The plates were sealed and incubated at room temperature for one

hour and then washed four times with PBS/Tween. Av-HRP conjugate was diluted

1:1000 in blocking buffer. 100 µL was added to each well and incubated at room

temperature for 30 min. The plates were washed six times with PBS/Tween. TMB

reagent A was mixed with TMB reagent B just prior to use and 100 µL of this reagent

were added to each well. The plates were incubated at room temperature for 30 min

and TMB stop solution (100 µL) added to each well. The optical density (OD) was


41

recorded with a microplate reader at 450nm. "KC4 software (Biotek Instruments Inc.

Vinooski, VT. U.S.A.) was used to calculate the levels of the cytokines present.

3.5 Determination of Intracellular Survival of Brucella in Bovine, and Murine

Macrophages

Twenty four well plates (Becton Dickinson) were seeded with bovine and

murine RAW 264.7 macrophages at a concentration of 2.5x105/mL and incubated at

37ºC for 24 hrs. After 24 hrs, the cells were stimulated with rough, smooth and

combined Brucella LPS (200 µg/mL) and incubated at 37ºC under 10% CO2 for 24

hrs. After incubation, the macrophages were challenged for one hour at a multiplicity

of infection (MOI) of 1:100 with the following Brucella treatments (Section 3. 5.1):

a) RLPS +macrophages+Brucella, b) SLPS +macrophages+Brucella

c)RLPS+SLPS+macrophages+Brucella d) Negative control (macrophages+Brucella)

3.5.1 Multiplicity of infection.

Cultures of Brucella (100 µL) previously stored at 4ºC were added to ten

mililiters freshly prepared trypticase soy broth and shaken at 37°C overnight. To

aliquots of the culture, were added medium (1 mL), and used to determine absorbance

at OD600. An absorbance of culture at OD600 was determined to be equivalent to 2

x109/mL cells (Sun et al., 2006).

To infect macrophages in most experiments, 2 x107 cells/mL were used (32

µL) per well. Each combination was performed in triplicate. The plates were

centrifuged at 300 x g at room temperature for three minutes, the geometry of the

plate was positioned turned, and the plates were centrifuged again for three minutes.

After centrifugation, plates were incubated at 37°C in a 5% CO2 atmosphere for 1, 6

and 24 hours respectively. Medium was gently aspirated and washed with sterile 1X

PBS (2 mL). DMEM (1 mL) containing 10% FBS and 50 µg of gentamycin was

added to each well and the plates were incubated at 37°C in 5% CO2 for one hour.

The macrophages were osmotically lysed with sterile 0.1% Triton X-100.

Lysates (100 µL) were aspirated from each well and transferred to the first well of a


42

96 well plate. Each of the remaining wells contained PBS (90µL). The lysate in well

one were serially diluted by increments of ten. The number of viable bacteria

remaining in the lysate was determined by serial dilution in the same manner,

followed by culture of a suitable aliquot in tryptic soy agar at 37ºC for 24-48 hrs.

3.6 In Vivo Stimulation of Carrier Bovine by Brucella abortus LPS:

3.6.1 Detection of Brucella abortus Carrier Bovine by Polymerase Chain

Reaction (PCR):

Bovines suspected for brucellosis (on the basis of clinical abortion, and

initially positive reactors for the Rose Bengal Plate Test) (Akhtar et al., 2010a) were

selected for in vivo studies. In order to confirm the presence of the infectious agent

(Brucella abortus), the polymerase chain reaction (PCR) was conducted following the

protocol of O’ Leary et al., (2006). Retrophyrengeal lymph node biopsy samples from

these brucellosis suspected bovines were collected following the method of Vitale et

al., (1998). The lymph node aspirates were subjected to PCR in the Molecular

Biology Laboratory, Department of Pathology, Faculty of Veterinary Science,

University of Veterinary and Animal Sciences, Lahore, Pakistan.

3.6.2 DNA Extraction

DNA was extracted from tissue samples using a QIAamp™ DNA mini kit

(Qiagen) as described by the manufacturer. Lymph node aspirates (5 mL) were mixed

with 500 µL of PBS. Suitable aliquots (200 μL) were mixed in a lysis buffer (Annex

35) and allowed to stand for five minutes. The mixture was vortexed, incubated at

70°C for 10 min, and 117 µL of was ethanol added. The mixtures were placed onto

QIAamp spin columns and centrifuged at 1500 x g for five minutes. The DNA pellet

was washed with PBS (2X) and then mixed with DNA hydration buffer (200 μL) and

the extracted DNA stored at -80ºC (Sreevatsan et al., 2000).

3.6.3 DNA Amplification

Extracted DNA was amplified using the method of Hinic et al., (2008). The

sequence of forward and reverse primers used in these studies is presented in table 1.


43

Specific primers for genetic element IS711 were used for amplification purposes.

The recipe for the reaction mixture is in Annex (36). The total volume of each

reaction mixture was 25 µL. The following PCR cycling conditions were used: initial

denaturation was performed at 94°C for five minutes. This was followed by 30 cycles

of denaturation at 93°C for 45 seconds. DNA annealing was performed at 48-58°C

for 30 seconds. DNA extension was carried out at 72°C for one minute and the

final extension at 72°C for five minutes. The reaction was stopped at 4°C.

Table 1. Primer Sequences Used for the Detection of Brucella abortus

Primers Primer Sequences* Target Sequence

Expected Size

Forward GCTTGAAGCTTGCGGACAGT

IS711 63 bp

Reverse GGCCTACCGCTGCGAAT

IS711 63 bp


44

3.6.4 Agarose Gel Electrophoresis:

Agarose gel electrophoresis was used for visualization of DNA extracted from

lymph nodes and amplified by PCR. A DNA ladder (100 bp, Invitrogen) was used as

standard. Agarose gel (1.8%) was prepared in 1X TAE buffer (Annex 37). The

mixture was boiled and swirled well to dissolve the agarose. Ethidium bromide was

added to the gel to a concentration of 0.5 μg/mL, to facilitate visualization of DNA

after electrophoresis. Molten agarose mixture was allowed to cool at 45ºC. The gel

tray was prepared by sealing the ends of glass plates with scotch tape. Comb was

placed in the gel tray about one inch from one end of the gel tray and positioned

vertically such that the teeth were about 1-2 mm above surface of tray. The gel

solution was poured into tray to a depth of about 5mm and allowed to solidify.

3.6.6 Preparation of Samples:

The 6X loading dye/tracking dye (5 μL, Annex 38) was spotted onto Parafilm

for each sample to be loaded on gel.

3.6.7 Loading of the Samples

The tape was removed from ends of gel chamber and the gel was placed in a

horizontal electrophoresis chamber with the wells towards the negative electrode.

The gel chamber was filled with sufficient 1X TAE buffer such that the level of liquid

just covered the gel. The DNA ladder and samples were loaded in separate wells.

Electrophoresis was performed under a constant current at 100 volts. The

electrophoresis was stopped when the tracking dye had migrated 3/4 of the way

across the gel. DNA bands were detected with an ultraviolet transilluminator and

photographed using of gel documentation system.

3.7 Injection of LPS in Carrier Animals

Brucella abortus positive bovines (six Friesian cows and six Babalus babalis)

confirmed by PCR from Rukh Dera Chahal were selected for further study. For

control purposes, three animals with no history of brucellosis and that gave a negative

PCR result were selected. Carrier animals identified by PCR were injected (10 mL)


45

with stimulating concentrations of 200 µg/mL of rough (RB51) LPS. Three days post

injection; the animals were tested for elimination of infection by PCR.

Statistical Analysis

Statistical analysis was performed using the Student’s t test. Comparison of

the two-groups was achieved using SPSS software. A P value of <0.05 was

considered statistically significant.

Results

46

Chapter-4

RESULTS

The present project was designed to study the stimulatory response of bovine

macrophages, neutrophils and murine macrophages to LPS fractions extracted from

smooth and rough strains of Brucella abortus, and combinations of the two LPS

fractions. The levels of lysozyme released, oxidative metabolism, nitric oxide

production, and pro-inflammatory and anti-inflammatory cytokines produced were

determined. In addition, the susceptibility of murine and bovine macrophages to a

Brucella LPS stimulus were studied to determine differences in species susceptibility.

Finally, the comparative stimulation of bovine macrophages and bovine neutrophils

were studied in order to determine the major cell types involved in Brucella

elimination.

4.1 Isolation, Identification and Characterization of Brucella Strains

Both rough and smooth B. abortus strains (RB51 and S2308), obtained from

Virginia Tech, USA, were confirmed on the basis of positive crystal violet staining of

colonies, microscopic characteristics and biochemical profiles. Colonies of B. abortus

(smooth strain) were violet on reaction with crystal violet, whereas the rough strain

colonies were colorless. In biochemical tests, each strain of B. abortus was catalase

positive, and urease positive within two hours of inoculation (Fig 2).

Results

47

Fig 2: Rapid Urea Positive Test for Identification of Brucella abortus

Results

48

4.2 Extraction, Characterization and Quantification of Brucella abortus

Lipopolysaccharides

4.2.1 Lipopolysaccharides (LPS) Extraction from Rough and Smooth Strains

of Brucella abortus

Two methods were used: the conventional phenol extraction method and a

commercial kit method. LPS was isolated from smooth and rough strains of Brucella

abortus. The commercial extraction method was rapid, convenient and efficient as

compared to the conventional phenol extraction method. The phenol water extraction

procedure yielded smooth Brucella LPS (S-LPS) in the phenol phase, and rough

Brucella LPS (R-LPS) was found in the aqueous phase. The commercial method

offered the advantage of a high yield of LPS from small volumes of Brucella culture

in about sixty minutes whereas the phenol extraction procedure took two weeks and

gave a lower recovery of LPS. Brucella LPSs were lypholized and desiccated for

further study.

4.2.2 Characterization of Brucella LPS

The degree of LPS purity and integrity was determined by SDS-PAGE. SDS-

PAGE profiles of Brucella rough and smooth LPS are shown in Fig 3a and 3b. Rough

LPS presented a banded pattern whereas smooth LPS showed smear pattern. Log

molecular weights of samples were calculated from their respective Rf values using a

standard curve. In silver staining gels, the Brucella smooth LPS gave one band of

approximately 81.2 kDa, while Brucella rough LPS samples gave three bands. The

first band was approximately 95.4 kDa while the second band (about 72.4 kDa) was

very clear as compared to other bands and may be the actual LPS band. The third or

last band of Brucella rough LPS was nearly 70.7kDa. Protein contamination was

detected by staining with Coomassie Blue. Each LPS preparation was contaminated

with protein even after exhaustive treatment with protease K (Fig 3b). Brucella rough

LPS did not reveal any protein contamination upon staining with Coomassie blue. On

Results

49

other hand, smooth LPS showed two bands for protein contamination, the first band

was approximately 63kDa, and second was 50.1kDa.

Fig 3a: SDS-PAGE of Brucella abortus Smooth and Rough Lipopolysaccharides

by Silver Staining.

Lanes 1-3: Smooth LPS 5µl, 15µl, and 25µl, respectively; lanes 4-5: rough

LPS 5µl and 7µl, respectively. The M lane contains the molecular weight markers.

Fig 3b: SDS-PAGE of Brucella abortus Smooth and Rough Lipopolysaccharides Fractions by Coomassie Blue Staining.

Lanes 1-3 is rough LPS; lanes 4-6: smooth LPS. The M lane contains the molecular

weight markers.

250

100

75

50

37

25

20

15

10

M 1 2 3 4 5

M 1 2 3 4 5 6

kDa

250

100

75

50

37

25

20

15

10

Results

50

Table 2a: Rf Values and Log Molecular Weight of Marker Bands.

Molecular weight of

marker band

Log molecular

weight

Rf Value

250 2.39 0.17

100 2.0 0.49

75 1.8 0.61

50 1.69 0.76

37 1.56 0.86

25 1.39 0.89

20 1.30 0.93

15 1.17 0.95

10 1.0 0.98

Table 2b: Rf Values and Log Molecular Weight of Sample Bands.

Sample Bands Molecular weight of marker band

Log molecular

weight

Rf Value

Silver stained gel Lanes 1-3: Smooth LPS band Lanes 4-5: Rough LPS band 1 Lanes 4-5: Rough LPS band 2 Lanes 4-5: Rough LPS band 3

81.2

95.4

72.4

70.7

1.91

1.98 1.86

1.85

0.59 0.53 0.58 0.67

Coomassie blue stained gel Lanes 1-3 Rough Brucella LPS Lanes 4-6 Smooth Brucella LPS contaminating proteins band 1 Lanes 4-6 Smooth Brucella LPS contaminating proteins band 2

No bands visible for Rough LPS

63.0

50.1

------

1.80

1.70

-------- 0.69 0.75

Results

51

Standard curve for Rf values of Precison protein marker

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

0.45

0.5

0 0.5 1 1.5 2 2.5

Log molecular weight

Rf

valu

es

Rf value

Fig 4: Standard Curve for Rf Values of BioRad Precision Protein Marker.

Results

52

4.2.3 LPS Quantification

The Purpald assay was adapted to quantify the amount of Brucella

smooth and rough LPSs extracted by the phenol extraction, and commercial methods.

A standard curve was constructed using glycine. A linear response was obtained

between 70-420 µg/mL (Fig 5). The amounts of extracted rough and smooth LPSs

extracted by the phenol method were 180µg/mL and 216 µg/mL, respectively. The

amounts of extracted (rough and smooth) LPSs obtained using the commercial

method were 215 µg/mL and 230 µg/mL, respectively.

Standard curve of glycine for LPS quantification

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

0 100 200 300 400 500

Glycine Concentrations ug/mL

Ab

sorb

ance

Absorbance

Figure 5: Purpald standard Curves LPS Quantification

4.3 Isolation of Bovine Neutrophils

A novel method based on the principle of density gradient centrifugation,

using a lymphocyte separating medium was developed for the isolation of neutrophils

from bovine peripheral blood samples. This method yielded preparations of 96.12%

purity based on the identification of the lobulated nuclei of neutrophils (Fig 6a) and

by flow cytometry. The viability of the cells was 95% as determined by trypan blue

exclusion.

Results

53

Figure 6a: Isolated Bovine Neutrophils at Magnification of 10x

Results

54

0 500 1000 1500 2000 2500FSC-A (x 100)

100

101

102

103

104

SS

C-A

R1

( a ) CH138A positive

0 500 1000 1500 2000 2500FSC-A (x 100)

100

101

102

103

104

AP

C-A

R2

(b) CH138A negative

Results

55

0 500 1000 1500 2000 2500FSC-A (x 100)

100

101

102

103

104

SS

C-A

c) CH138A positive

0 500 1000 1500 2000 2500FSC-A (x 100)

100

101

102

103

104

AP

C-A

(d) CH138A negative

Figure 6b: Densogram is Showing the Isolated Bovine Neutrophils (a & c) and Non Neutrophils (b& d).

Results

56

100 101 102 103 104

APC-A

050

010

0015

0020

0025

00

Num

ber

100 101 102 103 104

APC-A

050

010

0015

0020

0025

0030

00

Num

ber

Cell event/number

CH138A APC

Grey shaded IgG control Black dotted line CH138A positives

100 101 102 103 104

APC-A

020

040

060

080

010

00

Num

ber

CH138A positive neutrophils

CH138A negative cells

Figure 6c: Histograms Showing the Separation of CH138A Positive Neutrophils and IgG Negative Control.

100 101 102 103 104

APC-A

050

010

0015

00

Num

ber

Results

57

4.4a Isolation and Culturing of Bovine Macrophages

Matured cultured macrophages were identified by their ability to adhere to the

bottom of cultured flasks (BD Falcon) and their morphological characteristics (Figure

7a & 7b) Greater than 90% of the buffy coatmacrophages isolated by the percoll

method were mononuclear as observed on Wright’s stained slides. The macrophages

were cultured for seven days, harvested and used for subsequent experiments.

Macrophages adhered to plastic surfaces gave better viability than those adhered to

glass surfaces. The morphological and physiological features of the bovine

monocytes were examined during the course of the culture. Cell size, granulation and

cytoplasmic spreading progressively increased. Matured cells developed pseudopods

and or cytoplasmic extensions that increased with time in size and granulation. The

macrophages were detached mechanically from the cultured flasks and counted with a

hemacytometer and used for further experiments.

4.4b Culturing and Subculturing of Murine Macrophages

Murine macrophages were obtained from American Type Culture Collection

ATCC (ATCC # crl-2278) and maintained in DMEM with 10% fetal bovine serum

(FBS) and 1% penicillin/streptomycin (PS). The cells were observed daily for

presence of healthy macrophages and the medium was changed after every two days

(Fig 8).

Results

58

Figure 7a: Isolated Bovine Peripheral Macrophages as Visualized at 10x

magnification.

Figure 7b: Bovine Isolated Macrophages after Seven Days of Culturing are Visualized at 100x. Arrow indicates a Mature Macrophage.

Results

59

Figure 8: Subcultured Murine RAW 264.7 Macrophages Magnified at 10x

magnification

Results

60

The stimulatory activity of Brucella rough and smooth LPS preparations alone

and in combination was determined using bovine cultured macrophages, murine

RAW 264.7 macrophages and bovine neutrophils. Each LPS, or combination thereof

yielded distinct profiles of lysozyme, ROS, RNI and spectrum of cytokines, released

by the challenged cells. These results are described below.

4.5 Induction of Lysozyme from LPS-treated Bovine Macrophages, Neutrophils

and Murine Macrophages

B. abortus rough, smooth and combined (rough + smooth at ratio of 1:1) LPS

contents at concentrations of (0.02, 0.2, 2.0, 20, 200 µg/mL) were used to stimulate

bovine neutrophils, macrophages and murine macrophages. Lysozyme induction by

Brucella rough LPS was not detectable below the LPS concentration of 2.0 µg/mL for

all the LPS treatments. Bovine macrophages treated with rough Brucella LPS at

concentrations of 2.0, 20 and 200 µg/mL yielded lysozyme levels of 1.88, 3.1 and

4.14 µg/mL, respectively, while smooth Brucella LPS at same concentrations of 2.0,

20 and 200 µg/mL yielded lysozyme values 1.0, 1.40 and 2.60 µg/mL for each LPS

concentration respectively. The use of combined rough and smooth Brucella LPS

(1:1) at the same concentrations (2.0, 20, 200 µg/mL) gave lysozyme values of 1.34,

2.20 and 3.13 µg/mL respectively (Figure 9).

Murine macrophages stimulated with the same concentrations of LPS (rough,

smooth and combined LPS) produced lysozyme at levels of 3.70, 5.2, 5.90 µg/mL;

2.60, 3.20, 3.90 µg/mL and 3.0, 3.5, 3.80 µg/mL respectively.

Bovine neutrophils stimulated with rough LPS did not produce detectable

levels of lysozyme at LPS concentrations of 2.0µg/mL and below. The use of higher

concentrations (20 & 200 µg/mL of rough LPS) yielded 0.79 and 2.0 µg/mL of

lysozyme. The use of smooth and combined Brucella LPS concentrations of 200

µg/mL yielded 1.30 and 1.99 µg/mL of lysozyme. Neither smooth nor combined

Brucella LPSs induced lysozyme production at concentrations below 200µg/mL of

LPS. In all instances lysozyme production was significantly higher using rough LPS

Results

61

than smooth and /or combined LPS fractions (p< 0.05). No significant difference in

lysozyme production was observed by using Brucella smooth and combined LPS

fractions (p>0.05).

A comparison among bovine macrophages, bovine neutrophils and murine

macrophages revealed that the highest lysozyme concentration occurred in murine

macrophages (p<0.05) followed by a lower values in bovine macrophages and yet an

even lower amount in bovine neutrophils. A comparison of lysozyme induction in

bovine macrophages and neutrophils revealed that lysozyme induction was higher in

bovine macrophages than bovine neutrophils (p< 0.05). Stimulation was dose

dependent, and increased with increasing concentrations of the LPS fractions used

(Tab 3a, 3b, 3c),

Compared to bovine and murine macrophages, bovine neutrophils produced

negligible amounts of lysozyme. However, the pattern of lysozyme induction was

same, with the highest value by rough LPS, a lesser amount with the combined LPS

mixture, and the lowest amounts with smooth LPS. Only the highest concentrations of

rough Brucella LPS (20 & 200 µg/mL) induced lysozyme release. Smooth and

combined LPS fractions showed induction only at highest concentration of LPS used

(200 µg/mL).

(a) (b) (c)

Figure 9: Visualization of Lysozyme Release using the Agarose Plate Assay. The LPS Samples are (a) Rough RB51 LPS, (b) Smooth S2308, and (c) Combined S2308+RB51 LPSs. The Concentration of LPS Fractions were 200µg/mL per well.

Results

62

Standard Curve of LRT from Egg White Lysozyme

0

1

2

3

4

5

6

7

0 2 4 6 8 10 12 14 16 18

Lysozyme Concentration ug/mL

Rad

ius

of

clea

r zo

ne

(cm

)

Radius of zone

Figure 10: Standard Curve of Lysozyme Release Test

Table 3a: Induction of Lysozyme from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

Brucella

LPSs

Concentrations of Brucella LPSs (µg/mL)

0.00 0.02 0.2 2.0 20 200

Rough LPS ND ND ND 1.9 3.1 4.1

Smooth LPS ND ND ND 1.0 1.4 2.6

Combined smooth and rough LPS

ND ND ND 1.3 2.2 3.1

ND= Not detectable

Results

63

Lysozyme induction in bovine macrophages

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

2µg/mL 20 µg/mL 200 µg/mL

Brucella LPSs concentrations (ug/mL)

Lys

ozy

me

rele

ase

(ug

/mL

)

RB51 LPS

S2308 LPS

RB51+S2308 LPS

Figure 11a: Induction of Lysozyme from Bovine Macrophages Treated with rough, smooth and combined Brucella LPS Fractions.

Table 3b: Induction of Lysozyme from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

Brucella LPS Concentrations of Brucella LPS (µg/mL)

0.00 0.02 0.2 2.0 20 200

Rough LPS ND ND ND 3.70 5.2 5.90

Smooth LPS ND ND ND 2.60 3.2 3.90


ND ND ND 3.0 3.5 3.80

ND= Not detectable

Results

64

Lysozyme induction in murine macrophages

0

1

2

3

4

5

6

7

2 µg/mL 20 µg/mL 200 µg/mL


Lys

ozy

me

rele

ase

(ug/m

L)

RB51 LPS

S2308 LPS

RB51+S2308 LPS

Figure 11b: Induction of Lysozyme from Murine Mcrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

Table 3c: Induction of Lysozyme from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.

Brucella LPS Concentrations of Brucella LPS (µg/mL)

0.00 0.02 0.2 2.0 20 200

Rough LPS ND ND ND ND 0.79 2.0

Smooth LPS ND ND ND ND ND 1.30


ND ND ND ND ND 1.99

ND= Not detectable

Results

65

Lysozyme induction in bovine neutrophils

-0.5

0

0.5

1

1.5

2

2.5

2 µg/mL 20µg/mL 200µg/mL

Concentrations of Brucella LPSs ug/mL

Ly

so

zym

e r

ele

as

e(u

g/m

L)

RB51 LPS

S2308 LPS

RB51+S2308 LPS

Figure 11c: Induction of Lysozyme from Bovine Neutrophils Treated with

Rough, Smooth and Combined Brucella LPS Fractions.

4.6 Induction of Reactive Oxygen Species (ROS) from LPS-Treated Bovine


The differences in ROS production and nitroblue tetrazolium (NBT) reduction

in bovine macrophages, neutrophils and murine macrophages treated for 24 hrs with

Brucella rough, smooth and combined LPSs were determined. Since ROS induction

is directly proportional NBT reduction or absorbance, these terms have been

alternatively used in this assay. Bovine macrophages stimulated by various

concentrations of rough Brucella LPS (0.02, 0.2, 2.0, 200 µg/mL) yielded

significantly higher (p<0.05) absorbance values than those values obtained with

Brucella smooth LPS or Brucella combined LPS with the same concentrations of LPS

(Fig 12a, 12b & 12c).

Murine macrophages treated with rough LPS at the same concentrations

described above yielded approximately double the absorbance values of those

obtained with smooth LPS and combined LPS fractions. Bovine neutrophils produced

Results

66

lower amounts of ROS and at the highest concentrations of LPS used (2.0, 20, 200

µg/mL).

A comparison of the ROS levels induced in bovine macrophages and

neutrophils showed that the ROS levels were two times higher in bovine macrophages

than in neutrophils. No significant difference was observed in a production of ROS

between murine macrophages and bovine macrophages (Tables 4a, 4b & 4c).

Table 4a: Induction of Reactive Oxygen Species (ROS; as measured by nitroblue tetrazolium reduction) from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

Concentrations of Brucella LPS µg/mL

Brucella LPSs 0.00 0.0.2 0.2 2 20 200

Rough LPS 0.05

0.049

0.052

0.081

0.077

0.079

0.089

0.092

0.091

0.33

0.32

0.34

0.46

0.46

0.46

0.60

0.61

0.60

Av 0.05 0.079 0.090 0.33 0.46 0.60

SE 0.001 0.001 0.001 0.005 0 0.003

Smooth LPS 0.049

0.051

0.053

0.06

0.07

0.05

0.073

0.073

0.073

0.14

0.14

0.15

0.21

0.20

0.20

0.36

0.35

0.35

Av 0.051 0.06 0.073 0.14 0.20 0.35

SE 0.009 0.005 0 0.004 0.004 0.004

Combined

Rough and

smooth LPSs

0.051

0.052

0.052

0.072

0.072

0.073

0.081

0.078

0.085

0.22

0.21

0.21

0.33

0.31

0.30

0.42

0.45

0.44

Av 0.051 0.072 0.081 0.22 0.31 0.43

SE 0.0004 0.0003 0.001 0.004 0.01 0.01

AV= Average SE= Standard Error

Results

67

NBT reduction in bovine macrophages

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0µg/mL 2µg/mL 20µg/mL 200µg/mL

Brucella LPSs Concentrations (ug/mL)

Ab

sorb

ance RB51 LPS

S2308 LPS

RB51+S2308 LPSs

Figure 12a: Induction of Reactive Oxygen Species (ROS) from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions. NBT= nitroblue tetrazolium

Table 4b: Induction of Reactive Oxygen Species (ROS; as measured by nitroblue tetrazolium reduction) from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

Concentrations of LPS µg/mL

Brucella LPSs 0.00 0.0.2 0.2 2 20 200

Rough LPS 0.077

0.078

0.076

0.11

0.12

0.10

0.029

0.026

0.032

0.43

0.42

0.44

0.55

0.54

0.56

0.78

0.78

0.78

Av 0.077 0.11 0.29 0.43 0.55 0.78

SE 0.005 0 0.002 0.005 0.005 0

Smooth LPS 0.077

0.077

0.077

0.083

0.083

0.082

0.12

0.12

0.11

0.25

0.26

0.24

0.31

0.32

0.29

0.43

0.43

0.43

Av 0.077 0.082 0.11 0.25 0.31 0.43

SE 0 0.004 0.02 0.0066 0.011 0

Combined

Rough and

smooth LPSs

0.078

0.077

0.079

0.090

0.091

0.094

0.14

0.15

0.19

0.31

0.31

0.31

0.42

0.41

0.40

0.53

0.54

0.55

Av 0.078 0.091 0.16 0.31 0.41 0.55

SE 0.006 0.02 0.02 0 0.006 0.006

Results

68

NB T reduc tion in murine mac rophag es

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9


Brucella L P S s C oncentra tions (µg /mL )

Absorbance RB51 LPS

S 2308 LPS

RB51+S 2308 LPS s

Figure 12b: Induction of Reactive Oxygen Species (ROS) from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions. NBT= nitroblue tetrazolium

Table 4c: Induction of Reactive Oxygen Species (ROS; as measured by nitroblue tetrazolium reduction) from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.


Types of LPSs 0.00 0.0.2 0.2 2 20 200 Rough

Brucella RB51 LPS

ND ND ND 0.095 0.096 0.096

0.33 0.34 0.33

0.43 0.42 0.42

Av 0.096 0.33 0.42 SE 0.0003 0.003 0.003

Smooth Brucella S2308

LPS

ND ND ND 0.051 0.052 0.050

0.1 0.11 0.1

0.21 0.19 0.2

Av 0.051 0.1 0.2 SE 0.005 0.004 0.006

Combined Rough and

smooth Brucella LPSs RB51+S2308

ND ND ND 0.072 0.072 0.072

0.22 0.21 0.21

0.29 0.28 0.29

Av 0.072 0.21 0.28 SE 0 0.004 0.004

Results

69

NBT reduction in bovine neutrophils

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

0.45

2µg/mL 20µg/mL 200µg/mL


Ab

sorb

ance RB51 LPS

S2308 LPS

RB51+S2308 LPSs

Figure 12c: Induction of Reactive Oxygen Species (ROS) from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions. NBT= nitroblue tetrazolium reduction)

4.7 Induction of Nitric Oxide from LPS-Treated Bovine Macrophages,


The nitric oxide (NO2) content of culture supernatants of bovine macrophages,

murine macrophages and bovine neutrophils treated with Brucella rough, smooth and

combined (rough and smooth) LPSs was determined by Griess reaction (Fig 13).

Higher levels of NO2 were observed in supernatants of rough LPS-treated cells

compared to smooth or combined LPS-treated cells (Fig 15a, 15b, 15c). In bovine

macrophages, the amounts of nitric oxide production induced by rough Brucella LPS

(at concentrations of 0.02, 0.2, 2.0, 20, 200 µg/mL) were significantly higher while

these values at same concentrations of Brucella smooth and combined LPS-treated

bovine macrophages were lower and least respectively (Table 5a, 5b, 5c).

Although murine macrophages produced higher levels of nitric oxide than

bovine macrophages (p<0.05), the pattern for nitric oxide induction by LPSs was the

same as in bovine macrophages; highest by rough, low by combined and lowest by

Results

70

smooth LPS. Bovine neutrophils also followed the same trend. Murine macrophages

yielded significantly higher levels of nitric oxide than bovine macrophages and

bovine neutrophils (p<0.05), while there was not a significant difference between

nitric oxide values of bovine macrophages and bovine neutrophils (p>0.05).

These results suggest that rough Brucella LPS activates macrophage and

neutrophils. Untreated cells showed negligible NO2 production. For all the LPSs, dose

dependent stimulation was obtained in response to each LPS administered. At the

lowest LPS concentrations, nitrite production was low while at higher concentrations

(200 µg/mL) it was markedly elevated (p<0.05).

Results

71

Figure 13: Nitric Oxide Induction from Bovine Macrophages Treated with

Rough, Smooth and Combined Brucella abortus LPSs Measured by Griess

Reaction

Lanes 1-3: Nitric oxide induction by rough Brucella LPS, Lanes 5-7: Nitric oxide

induction by smooth Brucella LPS, Lanes 9-11 Nitric oxide induction by combined

Brucella LPS.

S tandard C urve for Nitric Oxide Determination

0

5

10

15

20

25

30

35

0 1 2 3 4

Abs orbance

Concentrations of Sodium

Nitrite (ng/m

l)

con

Fig 14: Sodium Nitrite Standard Curve of for Nitric Oxide Determination

Results

72

Table 5a: Induction of Nitric oxide from Bovine Macrophages Treated with

Rough, Smooth and Combined Brucella LPS Fractions.


Brucella LPSs 0.00 0.0.2 0.2 2 20 200

Rough LPS 11

12

10

16

15

15

29

29

29

33

31

33

89

88

88

233

236

238

Av 11 15.3 29 32.3 88.3 235

SE 0.5 0.44 0 0.88 0.44 1.5

Smooth LPS 11

11

11

13

12

11

16

16

16

19

19

18

46

47

46

99

96

94

Av 11 12 16 18.6 46.3 96.3

SE 0 0.66 0 0.44 0.33 1.77

Combined

Rough and

smooth LPSs

10

12

11

14

13

12

20

21

22

29

26

29

62

61

61

166

169

173

Av 11 13 19 28 61.3 169.3

SE 0.66 0.66 0.66 1.33 0.44 2.44

Nitric Oxide Induction in LPS Stimulated Bovine Macrophages

0

50

100

150

200

250


Brucella LPSs Concentrations ug/mL

Nitri

c O

xide

Conce

ntr

atio

ns

(ng/m

L)

RB51 LPS

S2308 LPS

RB51+S2308 LPSs

Figure 15a: Induction of Nitric Oxide from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.

Results

73

Table 5b: Induction of Nitric Oxide from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.


Brucella LPSs 0.00 0.0.2 0.2 2 20 200 Rough LPS 18

18 18

29 31 27

48 52 44

82.4 82.4 82.4

266.6 226.6 226.6

312 313 311

Av 18 29 48 82.4 226.6 312 SE 0 1.33 2.66 0 0 0.66 Smooth LPS 17

17 17

21 21 21

32 30 36

42 43 41

92.1 92.1 92.1

213.3 213.3 213.3

Av 17 21 32.6 42 92.1 213.3 SE 0 0 2.22 0.5 0 2.8E-14 Combined Rough and smooth LPSs

18 17 19

23 24 25

37 37 37

58.6 58.6 58.6

116.3 116.3 116.3

244 245 243

Av 18 24 37 58.6 116.3 244 SE 0.5 0.66 0 0 0 0.66

Nitric Oxide Induction in L PS S timulated Murine

Macrophages

0

50

100

150

200

250

300

350

0 2 20 200

Brucella LPSs Concentrations µg/mL

Nit

ric

Oxi

de

Co

nce

ntr

atio

n

(ng

/mL

)

RB51 LPS

S 2308 LPS

RB51+S 2308 LPS s

Figure 15b: Induction of Nitric Oxide from Murine Macrophages Treated with Rough, Smooth and Combined Brucella lps Fractions.

Results

74

Table 5c: Induction of Nitric Oxide from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPSs Fractions.


Brucella LPS 0.00 0.0.2 0.2 2 20 200 Rough LPS 10

10 10

13 12 13

24 22 21

27.5 28

27.7

41 43 42

89 90 90

Av 10 12.3 23.3 27.7 42 89.6 SE 0 0.5 0.35

Smooth LPS 11 10 10

11 10.6 10

11 12.6 12.9

16.8 16.9 17

29 29 28

53 54 54

Av 10.3 10.53 12.16 16.9 28.6 53.6 SE 0.44 0.35 0.44

Combined Rough and

smooth LPSs

10 11 10

11 11 11

16.6 17.2 17.5

22.9 23.2 23.6

36 34 34

76 76 75

Av 10.3 11 17.1 23.2 36.4 75.6 SE 0.44 0.5 0.44 0 0 0.44

Nitric oxide production in bovine neutrophils

0

10

20

30

40

50

60

70

80

90

100

22ug/ml 20ug/ml 200ug/ml

Brucella LPSs concentrations (ug/ml)

Nit

ric

oxi

de

con

cen

trat

ion

(n

g/m

l)

RB51 LPS

S2308 LPS

RB51+S2308 LPSs

Fig 15c: Induction of Nitric Oxide from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.

Results

75

4.8 Measurement of Pro-inflammatory and Anti-inflammatory Cytokines in

LPS Induced Bovine and Murine Macrophages.

The cytokine contents (TNF-α, IL-1β, IL-6, IL-10 and IL-12) of cell culture

supernatants of bovine and murine RAW 264.7 macrophages (pre-treated with

200µg/mL of Brucella rough, smooth or combined LPSs) were measured to examine

the influence of Brucella LPS on cytokine production in macrophages. Medium and

vehicle control wells lacking LPS produced low to undetectable levels of each

cytokine. Brucella rough LPS induced significantly enhanced levels of pro-

inflammatory cytokines including TNF-α, IL-1β, IL-6 and 1L-12 (Fig 16a, 16b, 17a,

17b, 18a, 18b, 20a, 20b). Smooth Brucella LPS induced elevated levels of anti-

inflammatory cytokine (IL-10) (Fig 19a and 19b). The use of combined Brucella LPS

also enhanced the pro-inflammatory cytokines and decreased the anti-inflammatory

cytokines, but the values obtained were lower than those obtained with rough

Brucella LPS. The cytokine profile of rough Brucella LPS stimulated macrophages

(bovine and murine) released the ability of rough LPS to stimulate immune cells. This

finding strengthens the results of LRT, NBT and NO2 assay. Smooth LPS treated

cells failed to induce sufficient levels of tumor necrosis factor alpha (TNF-α) to allow

the cells to elicit an immune response.

In bovine macrophages, almost twice the amount of TNF-α was induced by

rough Brucella LPS (1049.33 pg/mL) than what was obtained with combined LPS

(633.6 pg/mL) (p<0.05) and three times more than the amount induced by smooth

LPS (341 pg/mL) (p<0.05). Similarly, murine macrophages stimulated with rough

Brucella LPS yielded twice the amount of TNF-α (3950 pg/mL) observed with

combined LPS (1970.6 pg/mL) and three times higher than that induced by smooth

LPS (630 pg/mL). No distinct difference in TNF-α production was found between

smooth LPS stimulated and unstimulated cells (Fig 16a and 16b).

Results

76

TNF-alpha induction in bovine macrophages

0

200

400

600

800

1000

1200

Rough LPS Smooth LPS Rough+Smooth

LPS

Cells PBS

Brucella LPSs treatments (200ug/mL)

TN

F-a

lph

a p

g/m

LRough LPS

Smooth LPS

Rough +Smooth LPS

Cells

PBS

Figure 16a: TNF-α Induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

TNF-alpha induction in murine macrophages

0

500

1000

1500

2000

2500

3000

3500

4000

4500

Rough LPS Smooth LPS Rough+SmoothLPS

Cells PBS


TN

F-a

lpha

pro

duct

ion (pg/m

L)

Rough LPS

Smooth LPS

Rough+Smooth LPS

Cells

PBS

Figure 16b: TNF-α Induction from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

Results

77

Other than TNF-α, IL-1β is the major interleukin involved in cellular defense

against brucellosis (Zhan et al 1991). While overall IL-1β production was low, from

bovine and murine macrophages with all LPS combinations used, the yield was

approximately five times higher with the rough Brucella LPS than with the combined

or smooth LPS in both types of macrophages (p<0.05). No significant difference was

observed in TNF-α induction with smooth or combined LPS (p>0.05). Unlike bovine

macrophages, murine macrophages yielded significantly higher amounts of IL-1β

(p<0.05). The highest level was induced by rough Brucella LPS (2.201 pg/mL), with

the levels of induction for combined LPS (0.521 pg/mL) and smooth LPS (0.329

pg/mL) substantially less (Fig 17a and 17b). Rough LPS induced the production of

four times more IL-1β than that found with combined and/or smooth LPS.

Statistically, no significant differences were found between IL-1β stimulated by

smooth or combined LPS (p>0.05).

IL-1 beta induction in bovine macrophages

0

0.2

0.4

0.6

0.8

1

1.2


Cells PBS

Brucella LPSs treatments (200 ug/mL

IL-1

bet

a p

g/m

L

Rough LPSSmooth LPSRough+Smooth LPSCellsPBS

Figure 17a: IL-β induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

Results

78

IL-1 beta induction in LPS stimulated murine macrophages

‐0.5

0

0.5

1

1.5

2

2.5


LPS

Cells PBS

B rucel la L PS s treatm ents (ug /m L )

IL-1β

(p

g/m

L)

Rough LPS

Smooth LPS

Rough+Smooth LPS

Cells

PBS

Figure 17b : IL-β Production from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

The highest levels of IL-6 release occurred from bovine macrophages when

the cells were treated with rough Brucella LPS (17.78 pg/mL) (p<0.05). This value

approximated three times that induced by smooth LPS (5.58 pg/mL) or combined

LPS (7.83 pg/mL). The use of combined LPS did not produce a significantly higher

level of the cytokine than found with smooth LPS stimulated cells (p>0.05).

Murine macrophages stimulated by rough Brucella LPS produced

approximately twice the amount of IL-6 (53.5 pg/mL) than did macrophages

stimulated with smooth (19.1 pg/mL) and/or combined LPSs (26.8 pg/mL). Murine

macrophages stimulated with Brucella smooth and combined LPSs yielded similar

amounts of IL-6 (Fig 18a and 18b). Marginally higher values were obtained with

combined LPS (p>0.05). Approximately, three times higher levels of IL-6 were

induced in murine macrophages than in bovine macrophages (p<0.05).

Results

79

IL-6 induction in bovine macrophages

0

2

4

6

8

10

12

14

16

18

20


Cells PBS


IL-6

pg

/mL

Rough LPS

Smooth LPS

Rough+Smooth LPS

Cells

PBS

Figure 18a: IL-6 induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

IL ‐6 induc tion in murine mac rophag es

0

10

20

30

40

50

60

70


LPS

Cells PBS

Brucella L P S s trea tments (200 µg/mL )

IL‐6 (pg/m

L)

Rough LPS

Smooth LPS

Rough+Smooth LPS

Cells

PBS

Figure 18b: IL-6 Induction from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

Higher levels of IL-10 were induced in bovine and murine macrophages when

stimulated by smooth Brucella LPS (Fig 19a & 19b). In bovine macrophages, the

smooth LPS induced approximately three times higher levels of IL-10 in the cells

(95.32 pg/mL) than rough Brucella LPS (31.16 pg/mL) or combined LPS (33.37

Results

80

pg/mL). The induction of IL-10 with smooth or combined LPS was not statistically

different.

As with bovine macrophages and murine macrophages the highest levels of

IL-10 production were induced using smooth Brucella LPS (47.62 pg/mL). Lesser

amounts of IL-10 were induced with combined (16.75 pg/mL) and rough LPS (11.61

pg/mL). The levels of IL-10 detected in smooth LPS treated cells was approximately

four times that found for cells treated with rough LPS (p<0.05). IL-10 production in

macrophages stimulated with combined LPS stimulated macrophages was not

significantly higher than the IL-10 production in cells treated with rough LPS

(p<0.05). Murine macrophages produced approximately half the amount of IL-10

produced by bovine macrophages. This finding supports the concept that bovine

macrophages themselves prevent the pro-inflammation and Brucella elimination

while the murine macrophages are more efficient in this regard.

Results

81

IL-10 induction by LPS stimulation in bovine macrophages

0

20

40

60

80

100

120


Cells PBS

Brucella LPS s treatments (200 ug/mL)

IL-1

0 (p

g/m

L)

Rough LPS

Smooth LPS

Rough+Smooth LPS

Cells

PBS

Fig 19a: IL-10 Induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

IL-10 induction by LPS stimulation in murine macrophages

0

10

20

30

40

50

60


Cells PBS


IL-1

0 p

g/m

L Rough LPS

Smooth LPS

Rough+Smooth LPS

Cells

PBS

Fig 19b: IL-10 Induction from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

Results

82

IL-12 production in bovine macrophages pre-treated with rough Brucella LPS

approximated twice (1133.3 pg/mL) that produced by induction with combined LPS

(678 pg/mL), a value greater than double that produced by smooth LPS (452.2

pg/mL). There was little difference in IL-12 induction using combined and/or smooth

LPSs (p>0.05).

The IL-12 production in murine macrophages was approximately doubled

(2285 pg/mL) that produced when the cells were treated with rough LPS compared to

that obtained with combined (1400 pg/mL) or smooth LPS (978 pg/mL). Smooth and

combined LPSs induced IL-12 in similar amounts; however, murine macrophages

were more efficient in IL-12 induction than where bovine macrophages (p<0.05) (Fig

20a & 20b).

Results

83

IL-12 induction in LPS stimulated bovine macrophages

0

200

400

600

800

1000

1200


Cells PBS


IL-1

2 p

g/m

L

Rough LPS

Smooth LPS

Rough+Smooth LPS

Cells

PBS

Figure 20a : IL-12 Induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

IL ‐12 induc tion in L P S stimula ted in murine macrophages

0

500

1000

1500

2000

2500

3000


LPS

Cells PBS

Brucella L P S s trea tments (200 µg/mL )

1L‐12 (pg/m

L)

Rough LPS

Smooth LPS

Rough+Smooth LPS

Cells

PBS

Figure 20b: IL-12 Induction from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.

Results

84

4.9 Intracellular Survival of Brucella from Bovine and Murine Macrophages

The intracellular survival of Brucella was determined in bovine and murine

macrophages pre-treated with rough, smooth and combined Brucella LPS (1:1)

preparations. A colony forming unit assay (CFU) was used as evidence to support the

concept previously suggested by the results of assays (lysozyme release assay,

nitroblue tetrazolium assay, nitric oxide assay and a cytokine ELISA assay) showing

stimulatory activity of rough Brucella LPS.

At one hour post-infection when bovine and murine macrophages infected

with Brucella were pre-treated with rough LPS, few viable Brucella were found

(5.1x104 from bovine macrophages; 1.7x104 from murine macrophages). After six to

24 hours post infection, no bacteria were retrieved from either type of macrophage,

suggesting that a majority of the bacteria were phagocytosed and killed, and

indirectly suggesting that substantial activation of macrophages has occurred (Figure

21). In contrast, at one hour post infection, macrophages stimulated with smooth

Brucella LPS retained viable Brucella cells (4.7x105 in bovine macrophages, 1.3x105

in murine macrophages), and after six hours post-infection the survival level was

2.8x105 in bovine macrophages and 9.5x104 in murine macrophages. At 24 hrs post-

infection, 1.9x105 viable bacteria retained in bovine macrophages, and 5.5x104 viable

bacteria in murine macrophages. In contrast, pre-treatment of bovine and murine

macrophages with a combination of smooth and rough Brucella LPSs (1:1) resulted in

a decreased number of viable bacteria (2.0x105, 9.5x104 and 6.4x104 in bovine

macrophages and 6.6x104, 2.9x104 and 1.8x104 cells in murine macrophages at one,

six and twenty four hours post-infection, respectively) as compared to the pre-

treatment with Brucella smooth LPS. Among each of the three LPS treatments, rough

LPS stimulated macrophages contained the least number of live Brucella after

infection. In this experiment, unstimulated cells served as a positive control. There

was a slight decrease in viable Brucella obtained during the first hour and then the

number remained stable (Fig 22b and 22b).

Results

85

These results varify the hypothesis that rough and smooth Brucella LPSs act

in a distinictly different manner in terms of their stimulatary activities and the

resulting brucellacidal capabilities of treated macrophages.

Figure 21: CFU Analysis for Determination of Intracllular Survival of Brucella in Bovine Macrophages. The Plate on Top Right Shows No Growth of Brucella in Macrophages After Treatment with Rough Brucella LPS.

Results

86

C FU ana lysis in bovine macrophages

0

1

2

3

4

5

6

7

0 10 20 30Hours

CFU/well RB51

2308

R+S

control

Figure 22a. Intracellular Survival of Brucella in Bovine Macrophages

CFU Analysis in Murine Macrophages

0

1

2

3

4

5

6

0 5 10 15 20 25 30

Hours post-infection

CF

U/w

ell

RB51

2308

R+S

control

Figure 22b. Intracellular Survival of Brucella in Murine Macrophages.

Results

87

These results showed that LPS from Brucella rough strain (RB51) is more

potent than LPS from Brucella smooth strain (S2308) and the combination of LPS

from both strains (RB51LPS + S2308 LPS)in ability to stimulate the killing of

Brucella by macrophages. The combination of both types of LPSs (1:1) did not

generate a better stimulus in cells. This confirms that the idea for combined LPS

vaccine or multi LPS vaccine may not be successful. It would be better to incorporate

rough LPS than smooth LPS in a Brucella vaccine. Murine macrophages were found

to be more active in releasing higher amounts of lysozyme, ROS, nitric oxide and

pro-inflammatory cytokines than bovine macrophages. These findings strengthen the

hypothesis that the reduced level of induction of these products in bovine immune

cells may be the reason for prolong survival of smooth Brucella strains in these

macrophages. The use of LPS at a level higher than 200 µg/mL was not practical as it

did not fall at the upper level sensitivity for the standard curve.

4.10 In Vivo Stimulation of Carrier Bovines by Brucella abortus LPS:

One hundred animals were tested for the presence of Brucella abortus by the

touch down PCR assay at the livestock farm Rukh Dera Chahal, Lahore, Pakistan.

Twenty seven animals (27%) were found positive on the basis of a positive PCR

assay with an amplicon size of 63bp specific for IS711 genetic element of Brucella

abortus. A higher percentage of agarose gel was used (approximately 1.8 %) in order

to separate primer dimers (approximately 40 bp size) from the amplified product

(Figure 23). At the higher percentage of agarose, the resolution of marker bands was

poor. This was attributed to the increased percentage of agarose. When the pore size

of agarose gel was reduced, a lower resolution of the high molecular weight marker

bands resulted. The low molecular weight PCR fragment (63 bp) can only be resolved

from 40 bp primers dimers if a high percentage of agarose gel is used. The results of

the in vitro experiments were confirmed by the in vivo study of the most stimulating

concentration of rough Brucella LPS (200 µg/mL) in carrier bovines. Only positive

testing animals were treated with immunostimulatory doses of Brucella LPS. Three

Results

88

63bp

days after injecting rough LPS, the infected animals were again examined by lymph

node biopsy and subsequent PCR for elimination of infection. The results of PCR

indicated that infection was still there. Attempts were not made to further investigate

the in vivo effect of Brucella LPS.

1 M 2

Figure 23: PCR Amplification Products from Brucella abortus Positive Lymph

Node Samples.

Lane 1: amplified product is merged with primers; M: DNA marker; Lane 2: 63bp

amplified product.

Primers merged with amplified product

Discussion

89

Chapter-5

DISCUSSION

Brucellosis is caused by the intracellular pathogen Brucella abortus. This

bacterium interferes with the normal function of phagocytic cells (neutrophils and

macrophages). Lipopolysaccharides are present in all Gram-negative bacteria;

however, Brucella lipopolysaccharides contents are unique in their structures and

function. The Brucella LPS is considered as an immunodominant component of this

pathogen (Plommet et al., 1987). The present study was conducted to investigate the

interaction of Brucella LPS contents (isolated from smooth and rough strains) with

phagocytic cells (bovine macrophages, neutrophils and murine macrophages). The

results of this study support the hypothesis that the LPS from smooth and rough

strains behave differently on the phagocytic cells. The stimulatory activity effects of

these LPSs were monitored by measuring of the production of lysozyme, reactive

oxygen species (ROS), nitric oxide (NO2) and cytokines.

A higher production of lysozyme, ROS, NO2 and pro-inflammatory cytokines

was observed in the cells stimulated with rough Brucella LPS than with smooth LPS.

When the LPS contents of rough and smooth strains were used in combination for

immunostimulation, the cellular immune response obtained was lower than the

immune response obtained by using rough LPS. The stimulation of immune response

by LPS preparations was confirmed by establishing the killing index of the bacterium.

5.1 Brucella LPS Extraction, Purification and Characterization

Bucella LPS fractions have been isolated by modification of the phenol

extraction method by number of researchers as described in methods and/or

background (Redfearn, 1960; Westphal and Tann, 1965). This procedure is laborious

and time consuming. However, attempts to replace this technique were not successful.

Recently, a commercial LPS extraction kit (Intron biotechnology) has become

Discussion

90

available. The two extraction methods were compared in terms of convenience, LPS

yield, purity and product integrity. The kit method proved more convenient, quicker,

economical and efficient. The yield of LPS was measured by the Purpald assay. The

phenol extraction method yielded 180 µg of smooth LPS/mL of packed cells and 214

µg of rough LPS/mL of packed cells. The kit method yielded 215 µg of smooth LPS

and 230 µg of rough LPS. The higher yields of smooth LPS over those of rough LPS

may be associated with their hydrophilic and hydrophobic properties, respectively,

since rough LPS is isolated in aqueous phase and smooth LPS in phenol phase

(Backer and Wilson, 1965; Diaz et al., 1968; Bowser et al., 1974; Moreno et al.,

1979).

In addition to phenol, published methods for Brucella LPS purification have

utilized enzymes, detergents and chaotropic agents (Zygmunt et al., 1988). In the

present study proteinase K, a potent protease, was used to remove a majority of

proteins associated with the LPS preparations (Phillip et al., 1989). A LPS

purification scheme lacking proteinase treatment was reported by Wu Am et al.,

(1987), however, the LPS contained 16-42% protein. In the present study, proteinase

K treatment reduced the protein content to <1% as determined with Coomassie blue

gel method. These results are in agreement with those of Phillip et al., (1989) who

reported a 1-15% protein contamination after treatment with proteinase K.

Furthermore, there were no detrimental effects on the immunogenic properties of

LPS. The tight binding of protein to Brucella smooth LPS over that observed with

Brucella rough LPS may be attributed to the observation that there exist stronger

charge-charge interacts between the protein and the S-LPS. This hypothesis may

further be confirmed by various experiments such as segregation of S-LPS and its

associated proteins using different digestive enzymes and column chromatography.

Further use of individual components (S-LPS and proteins) for in vitro immune cell

activation may reveal the fact. Moreover, S-LPS and its associated proteins should

also be tried in vivo to determine the inhibitory effect of proteins.

Discussion

91

The use of lysis step in the kit method eliminated the need of using a

ultracentrifuge and French press, in the preparation of LPS. These items lacking in

many laboratories and the kit avoids the use of chemicals and reagents that might be

harmful for the integrity of LPS. Phenol is not suitable for the industrial isolation of

LPS (Alina et al., 2007).

Smooth Brucella LPS appears as a dense and diffuse smear on an SDS-gel as

compared to the clean ladder type appearance of rough Brucella LPS. This

observation correlates with previous reports of Robinson and Badway, (1994); Wen et

al., (2004) who found that smooth LPS migrated as having a large molecular weight

on SDS-PAGE gels. The large molecular weight of smooth LPS is largely associated

with the O-chain and associated proteins which are not removed after treatment with

proteinase K (Phillip et al., 1989; Rittig et al., 2003).

A SDS-PAGE profile of rough Brucella LPS revealed a fast migrating band

that co-migrated with the low molecular weight lipid A and core oligosaccharide.

These findings are in agreement with the studies of Schurig et al., (1991) and

Cloeckaert et al., (2002) who reported the absence of an O-chain in rough LPS

contents by SDS-PAGE analysis.

5.2 Isolation of Bovine Neutrophils

Neutrophils are prominent members of host defense system and have an

innate capacity to release a variety of toxic agents against Brucella including

lysozyme, reactive oxygen species (ROS) and reactive nitrogen intermediates (RNI).

The production of ROS and RNI is triggered by phagocytosis or exposure to certain

biological components such as LPS (Robinsons and Badwey, 1994, Fang, 1997). In

the present study, neutrophils were isolated using a novel method to study the effect

of Brucella LPSs stimulation on the release of the above mentioned brucellicidal

products (lysozyme, ROS and NO2).

Comparative studies were undertaken to examine bovine and human

neutrophils for potential differences in regulatory mechanisms (Gennaro et al., 1978).

Discussion

92

Studies of Forsell et al., (1985), Styrt et al., (1989) and Nakata et al., (2010)

suggested that bovine neutrophils lack a N-formyl-peptide chemotactic receptor,

exhibit large cytoplasmic granules and contain antibacterial peptides. However,

because of these differences in biological responses of bovine neutrophils, the

isolation procedures used for those of human neutrophils may not necessarily be

identical to those used for isolating bovine neutrophils.

Several procedures have been used for the isolation of bovine neutrophils

(Ganz, 1987). The currently available methods for neutrophil isolation are based on

two principles, i.e., taking advantage of specific gravity of cell types using density

gradient methodology (Coxon et al., 1999) and using a neutrophil specific migratory

stimulus (Hartt et al., 1999).

The use of density gradient materials such as ficoll-hypaque does not yield

homogenous neutrophil populations due to differences in buoyancy of within the

leukocyte population. Moreover, hematological variation between animal species

limits the usefulness of this technique (Roussel and Gingras, 1997). In addition,

according to the results of Zahler et al., (1997) the use of improper densities of ficoll

alters the morphology of cells and results in a high level of erythrocyte

contamination. The negative immunomagnetic separation method of Cotter et al.,

(2001) yields highly enriched neutrophil preparations, but it is not economical. In

addition, there exists, a lack of antibodies against specific markers, secondary

antibody coated magnetic beads and magnetic columns making this application more

theoretical than practical. The bulk of the related published literature suggests that

neutrophil isolation methods, including the sedimentation of whole blood through

dextran, centrifugation of leukocyte-rich plasma and lysis of erythrocytes are

imprecise methods that either alter neutrophil function or result in low recovery of

these cells. In short, none of these methods are satisfactory in terms of purity,

viability and numbers of quiescent neutrophils isolated. The development of newer

Discussion

93

and novel techniques for isolation of different species’s neutrophils is important to the

study of characteristics of neutrophils and their usage in applied immunology.

In the current study, a comparatively simple, convenient and economical

method was developed by modification of the method of Robert and Nauseef (2001).

Since the heparin anticoagulant yields inconsistent results, EDTA was preferred as an

anticoagulant (Robert, 1997). This novel method requires only small blood samples

(4 mL) and the neutrophils isolated are less than 3% contaminated with erythrocytes

and greater than 95% neutrophils were viable. The reagents used in this method are

readily available in most laboratories. This method proved very useful for the

isolation of enriched, viable human and bovine neutrophils (Akhtar et al., 2010b).

5.3. Isolation and Cultivation of Bovine Macrophages.

The interaction of Brucella LPS fractions and isolated bovine peripheral

macrophages was studied in vitro. Macrophages are one of the important phagocytic

and antigen presenting cells. They play a critical role in the induction of the immune

response (Rosenthal, 1978). The functional, morphological and metabolic diversity of

macrophages depends on the site of their origin, stage of differentiation, activation

status and as well may be affected by the isolation procedure utilized. For isolation of

peripheral blood derived monocytic cells (PBMC) the percoll method was used. The

purified cells were cultured in vitro using Dulbecco’s Modified Eagle Medium,

DMEM, Invitrogen GIBCO containing 10% FBS. Optimal survival and propagation

of bovine macrophages were observed when the cells were cultured in disposable

polysterene cell culture flasks (BD Falcon) rather than glass borosilicate Roux flasks,

findings in agreement with Johnson et al., (1977). The cells were cultured for a

maximum period of one week, as prolonged culturing causes contraction of cells (Zhu

et al., 2001).

Discussion

94

5.4 Induction of Lysozyme from LPS-Induced Bovine Macrophages, Neutrophils

and Murine Macrophages

Lysozyme is a glycosidase which hydrolyses N-acetylhexosaminicdic

linkages in chitin, a αβ (1-4) linked linear polymer of N-acetyl glucosamine in the

bacterial cell wall (Sharon, 1967). Macrophage lysozymes are secretory enzymes.

The secretion of lysozyme increases upon cell stimulation. Ralston et al., (1961)

described lysozyme penetration in Brucella and ultimate killing of this organism.

Voss, (1964) also reported that Gram-negative bacteria undergo lysis when treated

with lysozyme in the presence of ethylenediaminetetraacetic acid (EDTA) and tris

buffer. However, lysis is not necessarily produced by the formation of spheroblasts as

the cell wall is damaged. This phenomenon was also confirmed by the studies of

Repaske, (1958) who demonstrated that the cell of a number of unrelated species of

Gram-negative bacteria can be lysed by lysozyme in the presence of EDTA with tis

buffer. Virgilio et al., (1966) reported that when lysozyme is added to cell wall

suspensions, some effects are observed within 2 hrs. The edge of cell wall begins to

dissolve and looses its homogenous circular outline. The cell wall develops irregular

projections and there is loss of thickness and rigidity after 16 hrs. It results in the

partial destruction and disintegrated lysis of the cell wall and thus killing the

organism. From a perspective of enhanced killing of Brucella, macrophage

stimulation would be beneficial since lysozyme also has the ability to degrade the

Brucella cell wall (Maria et al., 2003). It has been postulated that the enhanced

chemotactic responses of macrophages at the site of infection may result in an

elevated serum lysozyme content in infected animals and may mediate increased

phagocytosis (Cardoso et al., 2006). With these observations were kept in mind as

the lysozyme release assay was used to measure cell stimulation.

Elevated levels of lysozyme production were observed in rough LPS-

stimulated bovine macrophages, murine RAW264.7 macrophages, and bovine

neutrophils. Lower levels were found in cells induced with smooth, and a

Discussion

95

combination of both rough and smooth LPSs. The lysozyme content found in cells

treated with rough LPS was almost twice that observed to be induced by either

smooth or combined LPS. The lysozyme contents induced by combined LPS (rough +

smooth in ratio of 1:1) were marginally higher than smooth LPS alone.

The results of the present study suggest that several possibilities may exist for

the observed enhanced induction of lysozyme by Brucella rough LPS. For example,

some membrane determinants may be lacking, such as an O-chain in rough Brucella

LPS (Rittig et al., 2003). Additionally, rough Brucella strains and membrane

associated LPS are rapidly internalized and easily eliminated by immune cells. This

rapid entry of rough Brucella is thought to be associated with the stronger adherence

properties of the bacterium to monocytes and neutrophils (Zwerdling et al., 2009),

and the hydrophilic nature of its LPS as well (Keshav et al., 1991). These properties

may also be responsible for the “triggering” of lysosome and their elevated induction

of lysozyme in macrophages and neutrophils. Chen et al., (2009) suggested that

prevention of macrophage apoptosis by Brucella smooth S2308 strains may play a

role in the prolonged survival of these bacteria inside macrophages. Rough Brucella

strain RB51 could promote apoptosis and necrotic cell death, and were killed along

with host cells. It is entirely possible that the increased release of apoptotic enzymes

induced by rough Brucella is associated with an increased release of lysozyme. On

other hand, smooth Brucella LPS did not induce a significant amount of lysozyme in

any cell type tested (bovine macrophages, neutrophils and murine macrophages). This

observation may be explained by the fact that smooth Brucella LPS can induce

enhanced cAMP production and therefore, may inhibit phagosome-lysosome fusion

resulting in lysozyme induction in immune cells (Canning et al., 1986; Fernendez-

Parada et al., 2003). A decrease in the induction of lysozyme may explain prolonged

survival of Brucella smooth strains in phagocytes (Rasool et al., 1992). The authors

showed that myloperoxidase and lactoferrin released from neutrophils infected with

extra-cellular organisms were four and two times respectively, higher than those of

Discussion

96

neutrophils infected with smooth Brucella. The increased production of lysozyme by

rough Brucella LPS may also be due to lack of an O-side chain or O-antigen, as the

O-chain is involved in virulence of Brucella, and protects Brucella from bactericidal

peptides, complement lysis and phagosome-lysosome fusion.

Lysozyme induction in cells stimulated with combined Brucella LPSs (rough

+ smooth) was lower than that obtained with Brucella rough LPS. However, the

values of lysozyme induced by Brucella combined LPS were higher than that

obtained with smooth LPS. It is suggestive that rough LPS has greater stimulatory

activity alone than that when rough and smooth LPSs are administered together.

There is circumstantial evidence from the present study that the outcome of

Brucella infection is related to macrophage/Brucella interactions. Although the

macrophages were activated for antibrucella activity in both species, this activation

was lower in the more susceptible species (bovines). The higher values of lysozyme

induced in murine macrophages, than in bovine macrophages could be due to an

association between macrophages size and lysozyme production, as murine

macrophages are bigger than bovine macrophages. It may depend on the intra-

macrophagic pH, as certain authors have reported an internal pH difference

betweenbovine, and murine macrophages. Porte et al., (1999) established that

acidification of phagosome was essential for replication of Brucella inside the

macrophages. This may explain the differential release of lysozyme in macrophages

of the two species. Moreover, bovines are the main reservoirs of brucellosis;

therefore it is not surprising that they have greater susceptibility, and an infection

rate, than murine. A comparison of lysozyme induction in bovine macrophages and

bovine neutrophils revealed a much lower level of lysozyme in neutrophils that can

be attributed to faulty degranulation of neutrophils by either smooth or rough

Brucella LPS. Riley and Robertson, (1984) found that B. abortus could not

degranulate neutrophils up to an effective level of stimulation as compared to an

extracellular parasite.

Discussion

97

5.5 Induction of Reactive Oxygen Species (ROS) from LPS-Induced Bovine


Stimulated macrophages and neutrophils induce reactive oxygen species as

well as other non-oxygen dependent products when stimulated with LPS. These

constitute an essential mechanism of host defense against infectious agents, including

Brucella (Robinson and Badway., 1994). Therefore, determination of the oxidative

burst is a suitable tool to measure immune cell activation (Lecaroz et al., 2006).

Oxygen and related forms may act as a toxicant. Gerschman (1959) demonstrated that

toxicity of oxygen is due to generation of reactive oxygen species (ROS). The

phagocytic cells upon proper stimulation increase their utilization of oxygen

(respiratory burst) and convert oxygen to ROS (Robinson and Badwey, 1994). ROS

and related toxic products may contribute significantly to the destruction of extra-

cellular as well as intracellular pathogens, including Brucella (Babior 1987). As a

defense mechanism, Brucella decreases the production of ROS by production of

enzymes including catalase, superoxide dismutase and peroxide. These enzymes

detoxify ROS. In addition, DNA repair enzymes and stress response proteins that

repair oxidatively damaged components of Brucella are synthesized (Hornback et al.,

2006).

The present study assessed ROS induction from bovine macrophages,

neutrophils and murine macrophages after stimulation with Brucella rough, smooth

and combined (rough + smooth) LPS. Elevated levels of ROS induction were

observed with rough Brucella LPS, over the levels found with smooth and combined

Brucella LPSs. These findings may be due to different regulatory mechanisms for

ROS induction by smooth and rough LPSs. It may be possible that rough Brucella

LPS induces a lower amount of catalse and superoxide dismutase (SOD) than smooth

LPS required for neutralization of ROS. Further, studies are needed to confirm this

hypothesis. It is also possible that the NADPH oxidase and myeloperoxidase systems

Discussion

98

present in the rough strain are more actively expressed, and induce more ROS than

smooth Brucella LPS (Riley and Robertson, 1984; Gorvel et al., 2002).

The observed lower amounts of ROS induced by smooth Brucella LPS is in

agreement with the previous studies of Iyankan et al., (2002); Bertram et al., (1986)

and Price et al., (1990). These authors reported that smooth Brucella was able to

inhibit respiratory burst and hypothesized that some components of smooth Brucella

other than LPS might be responsible for the low oxidative metabolism. This

hypothesis is consistent with the previous observations of Porte et al., (2003) who

suggested that virulent smooth strains of Brucella inhibit the metabolic burst

accompanying phagocytosis. This idea was supported by demonstrating the

interference of myloperoxidase.

A higher level of ROS induction was observed in murine macrophages when

compared with bovine macrophages. These findings are in agreement with those of

Jiang and Baldwin (1993a) who found in murine macrophages, resistance to Brucella

was mediated by an increase ROS induction, particularly in the levels of superoxide

anion and hydrogen peroxide. As the macrophages, upon proper stimulation, increase

their utilization of oxygen (respiratory burst) and convert oxygen to reactive oxygen

species or ROS (Robinson and Badwey, 1994), the increased ROS induction in

murine macrophages as compare to bovine macrophages could be due to the

increased utilization of oxygen by the murine macrophages as compare to bovine

macrophages.

ROS induction in bovine macrophages was greater than that found in bovine

neutrophils. These results are comparable with the findings of Gallego-Ruiz and

Lapena-Honso, (1989) who reported that low levels of ROS were induced by

Brucella LPS in caprine neutrophils. Differences in the isolation procedure of

neutrophils may explain the differences in ROS induction in neutrophils from that

found in macrophages (Watson et al., 1994). These investigations found that ROS

induction was increased in neutrophils isolated by dextran/ficoll procedure over that

Discussion

99

than found by the one step procedure of mono-poly resolving medium. The findings

of present study are not in agreement with the findings of Iyankan et al., (1998).

These investigations reported complete inhibition of the respiratory burst in bovine

neutrophils after stimulation with Brucella LPS. The present study also opposes the

findings of Kreutzer et al., (1979) and Bertram et al., (1986) who found ROS

induction was inhibited in ovine neutrophils treated with Brucella LPS compared that

found with cytosolic antigens and heat killed Brucella.

5.6 Induction of Nitric Oxide from LPS-Induced Bovine Macrophages,


Nitric oxide (NO2) is one of the most important mediators of immune cells,

with potent antibrucella activity (Gross et al., 1998; Zaki et al., 2005). The nitric

oxide killing of Brucella was described by Jinkyung and Splitter (2003). Nitric oxide

synthase has three isoforms. The isoform iNOS is responsible for high output of NO2

production. The present studies revealed an increased induction of nitric oxide in

bovine macrophages, neutrophils and murine macrophages activated with rough

Brucella LPS. iNOS may be expressed differentially in the presence of smooth or

rough LPS of Brucella. This idea is in agreement with the findings of Jimenez-de-

Baques et al., (2005). These investigators demonstrated that macrophages infected

with attenuated rough Brucella strains induced elevated amounts of nitric oxide

compared to macrophages infected with smooth Brucella strains, the latter strains

neither expressed iNOS nor released nitric oxide. The increased level of nitric oxide

may be due to the fact that all maturation expression markers and co-stimulatory

factors (CCR7, CD83, CD40, CD86) are powerfully induced by the Brucella rough

strain as compared to the Brucella smooth strain (Billard et al., 2007).

These results are in agreement with those of Serafino et al., (2007) who

demonstrated that NO2 production was higher in macrophages infected with rough

strain RB51 than a smooth S2308 or S19 strains. Gangtsetse et al., (2003) extracted

smooth LPS from B. melitensis and found that it did not induce NO2 in RAW264.7

macrophages. The results of the present study are in agreement with these findings.

Discussion

100

The reduced NO2 induction by macrophages and neutrophils mediated through

smooth Brucella LPS may also be an important mechanism for regulating NO2

synthesis and allowing intracellular survival of smooth Brucella as proposed by

Iyankan et al., (2002). Decreased induction of NO2 by smooth Brucella LPS in

immune cells may be due to interaction of superoxide with RNI resulting in the

synthesis of new products (MeCall et al., 1989; Schmidt et al., 1989). The present

study also suggested that Brucella rough and smooth LPSs act in the same manner as

their respective strains.

The present study showed that greater amounts of nitric oxide are

induced in murine macrophages than bovine macrophages. These findings are in

agreement with the previous findings of Gross et al., (1998) who found that more

NO2 mediated killing of Brucella in murine macrophages. These results are also in

agreement with those of Petra et al., (2008) who compared the NO2 levels in

macrophages of different species. They found NO2 was highest in murine

macrophages and lowest in bovine macrophages. However, the results of the present

study are not in agreement with those of Padgett and Pruett, (1992) who found a low

induction of NO2 in mice. The increased nitric oxide induction in murine

macrophages could be related to the enzyme nitric oxide synthase (NOS). NOS has

three isoenzymes of which iNOS is present in activated macrophages. It may be

predicted that murine macrophages express more iNOS as compared to bovine

macrophages. This correlates with the findings of Green et al., (1991) and Moncada

et al., (1991) who expressed iNOS is induced in activated murine macrophages which

lead to high output of nitric oxide. Bovine macrophages could have metabolic

inhibitors of iNOS. Further studies are needed to see iNOS expression comparison in

these two species by using iNOS specific antibodies. These results also suggest the

functional resemblance of bovine macrophages with human macrophages that are

unable to generate detectable amounts of nitric oxide in vitro as described by

Schneemann et al., (1993).

Discussion

101

A comparison of the NO2 content of bovine macrophages and neutrophils revealed

that the NO2 levels produced by neutrophils is less than that found in macrophages

and correlates with the findings of Goff et al., (1996).

5.7 Determination of Cytokines in LPS-Induced Bovine and Murine

Macrophages

Cytokines produced by bovine and murine macrophages stimulated with

rough, smooth and combined (rough and smooth) Brucella LPS were monitored by

using an ELISA assay procedure (BioLegend) for the determination of TNF-γ, IL-1β,

IL-6, IL-10 and IL-12. Elevated levels of the pro-inflammatory cytokines (TNF-α, IL-

1β, IL-6, IL-12) were present in macrophages stimulated with rough Brucella LPS.

Anti-inflammatory cytokines (IL-10) were present, but at a lower level. Macrophages

stimulated with smooth LPS exhibited higher levels of anti-inflammatory cytokine

(IL-10) than pro-inflammatory cytokines. Similar results were reported by Jimenez-de

Baques et al., (2003) who observed elevated levels of pro-inflammatory cytokines

(TNF-α, IL-1β, IL-6, IL-12) induced by rough the Brucella strain in J774 A1

macrophages. However, the results of present study do not correlate with the findings

of Goldstein et al., (1992) and Jarvis et al., (2002) who reported that rough and

smooth Brucella LPSs are at best weak inducers of inflammatory cytokines in

macrophages. This weak induction could be due to the involvement of TLR4 as

opposed to that of TLR2, by lipoprotein stimulation as described by Huang et al.,

(2003).

Cytokine production is dependent on the presence of receptors on

macrophages involved in response to rough and smooth strains of Brucella (Porte et

al., 2003; Rittig et al., 2003). The Brucella rough and smooth strains interact with

different types and numbers of cell receptors and more receptors are involved in

internalization of rough strains with more reactivity. This may explain the greater

reactivity of rough LPS with macrophages and its more potent ability to induce

cytokine release.

Discussion

102

TNF-α is a multifunctional cytokine and is involved in immunity against

Brucella infection. Previous reports suggest that the addition of exogenous TNF-α to

DCs increase immunity and Brucella killing. In this study, rough Brucella LPS

resulted in an increased production of TNF-α. This may be explained by the elevated

level of LPS mediated immunity provided by rough LPS. Furthermore, the results of

the presently described studies correspond to the findings of Pei et al., (2008). These

investigators described the synthesis of elevated levels of TNF-α and IL-1β by the

rough Brucella mutant CA180 over those found with smooth strain S2308, indicating

that macrophages were activated after rough Brucella infection, but not after smooth

Brucella infection. One interpretation of these results might be that O- polysaccharide

(OPS) in smooth Brucella LPS covers the bacterial membrane proteins and thus

blocks the interaction between the Brucella and the macrophages (Bowden et al.,

1995). In contrast, studies of Pei et al., (2004) and Pei et al., (2006) suggested that

Brucella rough mutants invade macrophages via different pathways that smooth

strain, activating macrophages and leading to bacterial destruction.

IL-6 is pro-inflammatory cytokine secreted by T cells and macrophages. IL-6

stimulates immune responses against many chronic inflammatory diseases such as

brucellosis (Volpato et al., 2001). This cytokine is secreted by macrophages in

response to specific microbial molecules referred to as pathogen associated molecular

patterns (PAMPs), including LPSs (Berbaum et al., 2008). Elevated levels of IL-6

induction by rough Brucella LPS stimulated macrophages was found in the present

study. This may be attributed to the same factors responsible for an increase of other

pro-inflammatory cytokines as well. Decreased IL-6 induction by smooth Brucella

LPS demonstrated in the present study correlates with findings of Khatami and

Ardestani, (2005) who found that smooth Brucella LPS induced lower amounts of IL-

6 in J774 murine macrophages.

IL-10, an anti-inflammatory cytokine with ability to block the synthesis of

other pro-inflammatory cytokines (Rajasingh et al., 2006) has been reported to be

Discussion

103

neutralized by anti-IL-10 Ab. This could increase the phagocytic activity of

macrophages (Denis and Ghadirian, 2005) and as such, endogenous IL-10 could

diminish macrophage activity against infection and ultimately result in the down

regulation of immunity (Feng et al., 2002). Rough LPS may serve as a better pro-

inflammatory stimulus for macrophages than smooth or combined LPS, since only

small amounts of IL-10 are induced by rough Brucella LPS.

The increased induction of IL-12 by Brucella rough LPS may be due to an

increase of Th1 immunity by rough LPS. The studies of Sathiyaseelan et al., (2006)

showed that Th1 immunity is more useful against Brucella, and Billard et al., (2007)

explained that cells infected with rough Brucella induced Th1 immunity by producing

elevated levels of IL-12 and stimulated CD4 T-lymphocytes. Additionally, rough

Brucella abortus strains lead to both phenotypic and functional maturation of infected

cells as compared to smooth Brucella abortus strains (Billard et al., 2007). It may be

possible that increased maturation of infected cells is involved in more release of all

anti-brucella components, including pro-inflammatory cytokines.

Our findings are in agreement with those of Dornand et al., (2002) who

demonstrated that Th1 cytokines such as IL-12 and TNF-α stimulated murine cells

and helping in the clearance of a Brucella infection. They found that IL-1β and IL-6

were increased in mice, while in human macrophages IL-10 was increased in addition

to IL-1β and IL-6, and could be responsible for retention of viable Brucella. These

investigators showed that smooth Brucella LPS was a potent inducer of IL-10

synthesis, but did could not induce IL-12, an important participant in Brucella

elimination from cells.

Increased levels of all the pro-inflammatory cytokines were determined in

murine macrophages as compared to bovine macrophages. While the elevated release

of anti-infammatory cytokine (IL-10) by bovine macrophages may explain the

proportional decrease of pro-inflammatory cytokines in the same species, generally it

is considered that if there are more T cell cytokines, there is an increased clearance of

Brucella, as there are more T cells in the spleen of mice. Therefore, this could be the

reason for more cytokine production in murine macrophages. Moreover, mice could

Discussion

104

have more cytotoxic T cells that lyse Brucella- infected macrophages than do

bovines.

In the present studies, bovine macrophages yielded enhanced production of

pro-inflammatory cytokines as compared to bovine neutrophils that are generally

considered as the first line of defense against many infections. Furthermore,

macrophages release a substantial amount of pro-inflammatory cytokines such TNF-

α, IL-1β, while neutrophils and DCs release 5-10 fold smaller quantities of these

cytokines. Data derived from the present study suggests a complementary role for

macrophages with regard to brucellicidal activity, and for induction of an efficient

immune response.

5.8 Determination of Intracellular Survival of Brucella in Bovine and Murine

Macrophages

The enhanced stimulatory activities of rough Brucella LPS were demonstrated

by increased induction of lysozyme, ROS, nitric oxide and pro-inflammatory

cytokines. These findings were affirmed by the lower number of viable Brucella

surviving inside bovine and murine macrophages as established with the colony

forming unit (CFU) assay. The highest positive numbers of CFU units were obtained

with bovine and murine macrophages treated with rough Brucella LPS. Jimenez-de-

Baques et al., (2003) reported that rough Brucella strains showed rapid internalization

and increased killing as compared to smooth Brucella LPS. Our results demonstrated

that the lower stimulatory response induced by smooth Brucella LPS was attributable

to the differential macrophagic stimulatory activities of smooth and rough Brucella

LPSs. These findings are not in agreement with findings of Rittig et al., (2003). These

investigators conducted studies using human monocytes. Administration of smooth

and rough Brucella LPSs reduced the number of intracellular viable bacteria to

similar levels with similar kinetics. The difference in results obtained in these two

studies is probably due to species differences in cell stimulation. Our results are

similar to the findings of Caron et al., (1994) who demonstrated that increased

Discussion

105

stimulation of macrophages by rough Brucella LPS enhanced the phagocytosis of

Brucella suis. Our results are further supported by the experiments of Freevert et al.,

(1998) who observed increased phagocytosis of Brucella in alveaolar macrophages of

rats when stimulated with rough LPS.

In contrast to most previous studies that compared cell stimulations with intact

rough and smooth strains of Brucella, the experiments described in this dissertation

focus on analysis of the differential roles of smooth and rough Brucella LPSs. Our

results suggest consideration of Brucella LPS as a probe to study the process of

phagocytosis and intracellular pathogenesis of smooth vs rough strains of Brucella in

terms of macrophage activation. The low levels of stimulation of macrophages are

thought to be a key factor for the enhanced survival of smooth Brucella strains in

macrophages as compared to rough strains. These findings correlate with the findings

of Price et al., (1990). Riley and Robertson (1984) reported that the increased survival

of smooth strains of Brucella in neutrophils was due to the ability of the smooth

strains of the bacterium to resist killing in phagolysosomes, rather than decreased

granulation as has been established for rough strains.

The host defense and pathogenic mechanisms found in Brucella are

continuously interacting. Brucella uses a wide variety of cellular components

(external and internal) to modulate the host cell environment in order to ensure their

survival. The low level of stimulation by smooth LPS may also explain why these

strains are more virulent and resistant to removal (Tanyel et al., 2009) and as such

provide the basis for the lack, or minimal stimulation of macrophages. The low level

of stimulation by smooth Brucella LPS is consistent with the proposition of non

activation of P38 and ERK1/2MAP kinases pathways during macrophage infection

with Brucella smooth strain (Pei et al., 2008). In addition, a low production of

lysozyme and ROS could favor survival of smooth Brucella strains in phagocytes as

suggested by Rasool et al., (1992). Fernandez-Perada et al., (2003) found that

Brucella with a rough LPS phenotype infects human macrophages more efficiently

than smooth LPS phenotypes, but replication occurs only in the latter instances. The

Th2 immune response has been detected in chronic Brucella infections (Refiei et al.,

Discussion

106

2006) and more of the chronic infections are associated with smooth Brucella strains

that reside inside immune cells for longer periods of time. Therefore, the induction of

the Th2 immune response by smooth Brucella is not very useful for elimination of

infection. However, in all of the previous studies, whole Brucella rough and smooth

strains were used to stimulate the cells. In this study for the first time, Brucella rough

and smooth LPSs were used to stimulate macrophages and to study the exact role of

LPS in intracellular survival of Brucella inside the macrophages.

Since activated macrophages successfully deal with intracellular Brucella, it

may be possible that rough LPS-mediated activation of macrophages can participate

in increasing host defense. These differences in rough, smooth and combinational

Brucella LPSs in their ability to stimulate macrophages are manifestations of stealthy

strategy of virulent smooth Brucella to avoid active immune responses in infected

macrophages (Barquero-Calvo et al., 2007).

5.9 PCR Detection of Carrier Animals and In Vivo Effects of Brucella LPS

The in vitro results of previous experiments demonstrated the potent activity

of rough Brucella LPS in a dose dependent manner. In order to further investigate the

stimulatory role of LPS, in vivo experiments were performed with maximum

concentrations (200 µg/mL) of rough Brucella LPS in carrier bovines. Although a

long list of serological tests was available for diagnosis of bovine brucellosis, the

PCR assay was preferred since it is sensitive, specific, rapid, inexpensive to perform,

simple to design and carry out and can be automated with minimal effort and has the

potential of high output. The highly sensitive and specific polymerase chain reaction

(PCR) permits accurate and fast detection of Brucella species (Lavaroni et al., 2004).

The reaction is based on antigenic detection and consequently there is less risk for

cross reactions with other antibodies (Marianelli et al., 2008). In view of the

important economic and health related impacts of brucellosis and the questionable

reliability of earlier studies, the investigation of brucellosis incidence in Pakistan

remains warranted, specially in Punjab with its major share of Pakistani livestock, of

Discussion

107

49% cattle and 65% buffaloes. O’Leary et al., (2006) suggested that lymph node

aspirates served as a better source for Brucella detection by PCR assay than did milk

or blood; therefore the lymph node aspirates were preferred in this study to screen for

brucellosis employing the touch down PCR assay.

“Touch down” PCR is a simple PCR assay except that the annealing

temperature is used over a broad range. The first five cycles were run at 48ºC, the

next five cycles at 50ºC and so on up to 58ºC. The use of a wide range of annealing

temperatures yielded clear bands with less effort required for standardizing the

annealing temperature (s). The genetic element IS711 was targeted for B. abortus

detection. This element is a commonly used target for PCR-based diagnosis (also

known as IS6501) (Ouahrani et al., 1993). The advantage of using IS711/IS6501

target sequence lies in the natural amplification of the target sequence since all

Brucella species contain at least five, and can carry as many as 35 copies of this

element distributed throughout their genomes (Bricker and Halling, 1994; Bricker et

al., 2000).

After PCR detection of carrier bovines, ten milliliters of the potent in vitro

stimulating agent rough Brucella LPS (200 µg/mL) was injected into the animals and

the animals were again screened by PCR as a test for the elimination of the infection.

While rough Brucella LPS stimulated macrophages and neutrophils, the results of in

vivo studies demonstrated that Brucella LPS alone could not account for elimination

of the infection. The results of in vitro and in vivo experiments demonstrated that

while LPS plays a pivotal role in stimulation of macrophages, it also can act as an

antigen to stimulate immune cells in vitro. However, LPS alone cannot act as an

antigen sufficient to eliminate infection in vivo. This phenomenon may be explained

by the fact that Brucella LPS lacks biological properties of the classical LPS from

other microorganism that cause phagocyte activation in vivo (Freer et al., 1995).

Discussion

108

Conclusions

1. This study provides experimentally supported data that explains how Brucella

LPS acts as an immunogenic agent. This was achieved by measurement of

lysozyme, reactive oxygen species, nitric oxide, pro-inflammatory and anti-

inflammatory cytokines products essential for brucellicidal activity.

2. Smooth, rough and combined Brucella LPSs each exhibited distinct properties

and behaved differently in stimulating phagocytic activity in bovine

macrophages, neutrophils and murine macrophages.

3. These experiments demonstrated that rough Brucella LPS was a more potent

stimulator of lysozyme release, oxidative stress and nitric oxide production

when compared to smooth LPS, or the combination of both smooth and rough

LPSs. The stimulation was dose dependent. This observation may be a key

factor in revealing how different Brucella strains survive within the

macrophages and supports the hypothesis that a link exists between

macrophages activation and Brucella killing.

4. Since activated macrophages deal successfully with intracellular Brucella it is

tempting to hypothesis that LPS-mediated activation of macrophages may

prevent infection by stimulating macrophages and other immune cells thereby

increasing phagocytosis and ultimately host defense.

5. The less effective stimulation of macrophages by smooth LPS may explain

why different Brucella strains are more virulent and resistant to infection due

to improper or minimal stimulation of macrophages. This different stimulatory

activity of different Brucella LPSs may be attributed to different pathogenic

pathways for smooth and rough strains.

6. The use of combined Brucella LPSs had no significant effect on immune cell

stimulation and the use of multiple LPSs for vaccine may not be a fruitful

effort to pursue as has been suggested by others.

Discussion

109

7. The detection of carrier animals provides useful information that can be used

for herd protection and eradication programs, for improved productivity and

reproductivity of animals. This finding has important economic implications

as well.

Recommendations

1. The potential use of Brucella abortus rough LPS is recommended as a

carrier/adjuvant in future Brucella vaccines studies.

2. The use of combined Brucella LPSs had no dramatic effect on immune cell

stimulation. It is therefore suggested that the use of multiple LPS vaccinations

will not be effective.

3. More detailed in vivo studies are required. Chemical conjunction of Brucella

cytoplasmic and/or periplasmic proteins with Brucella rough LPS may offer a

fruitful approach for vaccine preparations for enhancement of immunity.

4. The use of combined LPSs the (smooth and rough LPS) minimized the effect

of each type of LPS. Therefore, the infectious organism type of Brucella

(smooth or rough) present in infected animals should be identified. Animals

infected with rough strains should be treated with rough LPS and the animals

infected with smooth strains should be treated with smooth LPS.

5. Local strains of Brucella in native animals should be isolated for extraction of

LPS. The LPS from other strains may not be effective against local strains.

Summary

110

Chapter-6


(LIPOPOLYSACCHARIDES) ON IMMUNE STIMULATION OF

BOVINES

SUMMARY

Brucella lipopolysaccharide (LPS), a non-classical endotoxin and outer

membrane component, plays an important role in host–Brucella interactions. The

survival of Brucella inside the macrophages is critical for Brucella pathogenesis. The

differential effects of smooth and rough B. abortus LPSs on bovine macrophages,

neutrophils and murine macrophages were studied and compared. B. abortus LPSs

were isolated from rough (RB51) and smooth (2308) strains and were purified. Both

rough and smooth LPSs were used separately and in combination to activate bovine

macrophages, neutrophils and murine RAW264.7 macrophages. The lysozyme

release test (LRT), nitroblue tetrazolium test (NBT), nitric oxide (NO2) assay and

cytokine ELISA assay were used to measure LPS-mediated induction of lysozyme,

reactive oxygen species, nitric oxide, pro-inflammatory and anti-inflammatory

cytokines in LPS treated cells. Rough Brucella LPS from strain RB51 induced

significantly higher levels of lysozyme, oxidative stress, nitric oxide and

inflammatory cytokines in treated cells than did LPS from smooth Brucella strain

2308, or a combination of smooth and rough LPSs. These responses were found to be

dose-dependent. The colony forming unit assay verified these results by indicating

that bovine and murine macrophages stimulated with Brucella rough LPS killed

significantly more Brucella than those macrophages stimulated with Brucella smooth

Summary

111

LPS. These findings demonstrated that Brucella rough LPS could induce cell-

mediated immunity. Further in vivo experiments were performed bovines that

detected on Brucella carriers by PCR assay. These Brucella carrier animals were

injected with stimulatory doses of rough LPS (injected at the dose rate of 200 µg/mL;

10 mL dose per animal). These animals were observed for the presence of Brucella

infection again by lymph node biopsy and PCR after three days of injection. The

animals were still found to be infected for Brucella, which may reflect in vivo failure

of Brucella LPS to stimulate cells for elimination of infection. It could possibly be

explained by the factors associated with in vivo inhibition of Brucella LPS activity or

the different LPSs suppressing the effect of LPS from opposite strain (rough or

smooth). This research may provide an impetus for immunologists to incorporate

rough Brucella LPS in future Brucella vaccines.

Literature Cited

112

LITERATURE CITED

Ahmad, R. and M. A. Munir (1995). Epidemiological investigation of brucellosis in

buffaloes. Pakistan Vet J 15(4): 169-172.

Akhtar, S., M. Afzal., S. Ali., and M. I. Khan (1990). Effect of reactor retention on

the spread of brucellosis in jersey cattle and buffalo herds. Rev-Off Int

Epizoot 9(1990 ): 1179-1185.

Akhtar, R., Z. I. Chaudhary., A. R. Shakoori., M. D. Ahmad and A. Aslam (2010a).

Comparative efficacy of conventional diagnostic methods and evaluation of

polymerase chain reaction for the diagnosis of bovine brucellosis. Vet World.

3(2): 53-56.

Akhtar, R., Z. I. Chaudhary., and Y.O. He (2010b). Modified method for isolation of

peripheral blood neutrophils from bovines and humans. IJAVMS. 4(2010): 8-

14.

Akhtar, R., Z. I. Chaudhary., N. Mehmood., G. Mustafa., and M. F. Raja (2010c).

Molecular epidemiology and associated risks of bovine brucellosis in Punjab

Pakistan: An updated look. World Acad Sci, Eng Tech. 69 (2010): 1507-1531.

Alina, T., A. Novikov., M. A. Conquy., C. Werts., C. Fitting., J. Marc. Cavaillon.,

and M. Caroff (2007). Simple method for repurification of endotoxins for

biological use. Appl Environ Microbiol. 73 (6): 1803-1808.

Apuurba, K. B., L. V. De-Verg., M. J. Izadjoo., L. Yuan., T. L. Hadfield., W. D.

Zollinger., and D. L. Hoover (2002). Protection of mice against brucellosis by

intranasal immunization with Brucella melitensis lipopolysaccharides as a non

covalent complex with Neisseria meningitides Group B outer membrane

protein. Infect Immun 3324-3329.

Aragon, V., R. Diaz, E. Moreno., and I. Moriyon (1996). Characterization of Brucella

abortus and Brucella melitensis native heptans as outer membrane O

Literature Cited

113

Polysaccharide independent from the smooth lipopolysaccharide. J Bacteriol

178 (4): 1070-1079.

Ayman, A. M., A. Tibbor., P. Mertens., X. De-Bolle., P. Michel., J. Godefroid., K.

Walravens., and J. J. Letesson (2001). Protection of BALB/c mice against

Brucella abortus 544 challenge by vaccination with bacterioferritin or p39

recombinant proteins with CpG oligodeoxynucleotides as adjuvant. Infect

Immun 69(8): 4816-4822.

Babior, B. M., and J. T. Curnutte (1987). Chronic granulomatous disease in pieces of

a cellular and molecular puzzle. Blood Rev 1(4): 215-218.

Baker, P.J., and J. B. Wilson (1965). Chemical composition and biological properties

of the endotoxin of Brucella abortus J Bacteriol 90(4): 895-902.

Baldwin, C.L., and M. Parent (2002). Fundamentals of host immune response against

Brucella abortus: what the mouse model has revealed about control of

infection. Vet Microbiol 90 (1-4): 367-382.

Bandara, A. B., S. A. Poff-Reichow., M. Nikolich., D. L. Hoover., N.

Sriranganathan., G.G. Schurig., V. Dobrean., and S.M. Boyle. (2009).

Simultaneous expression of homologus and heterologus antigens in rough,

attenuated Brucella melitensis Microbes Infect 11(3): 424-428.

Barquero-Calvo, E., E. Chaves-Olarte., Weiss Ds., C. Guzman-Verri., C. Chacon-

Diaz., A. Rucavado., I. Moriyon., and E. Moreno (2007). Brucella abortus

uses a stealthy strategy to avoid activation of the innate immune system

during the onset of infection. PLoS ONE 2 (7): 631.

Becker, A.J., S. Uckert., D. Tsikas., H. Noack., G. C. Stief., J. C. Frolich., G. Wolf.,

and U. Jonas (2000). Determination of nitric oxide metabolites by means of

the Griess assay and gas chromatography-mass spectrometry in the cavernous

and systemic blood of healthy males and patients with erectile dysfunction

during different functional conditions of penis. Urol Res 28(6): 364-369.

Literature Cited

114

Benninatic, C., M. Garibaldi., C. Lo-Passo., G. Mancuso., S. Papasergi., G. Garufi., I.

Pernice., G. Teti., and F. Felichi (2009). Immunogenic mimics of Brucella

lipopolysaccharide epitopes. Peptides 30 (10): 1936-1939.

Berbaum, K., K. Shanmugam., G. Stuchbury., F. Weide., H. Korner., and G. Munich

(2008). Induction of novel cytokines and chemokines by advanced glycation

endproducts determined with a cytometric bead assay. Cytokine 41(3): 198-

203.

Bertram, T. A., P. C. Canning., and J. A. Roth (1986). Preferential inhibition of

primary granule release from bovine neutrophils by a Brucella abortus

extract. Infect Immun. 52(1986): 285-292.

Billard, E., J. Dornand., and A. Gross (2007). Interaction of Brucella suis and

Brucella abortus rough strains with human dendritic cells. Infect Immun. 75:

(12 )5916-5923.

Bobo, R. A., and J. W. Foster (1964). The effect of enzyme treatments on Brucella

abortus cell walls. J. Gen Microbiol. 34: (1964) 1-8.

Bounous, D. I., F. M. Enright., K. A. Gossett., and C. M. Berry (1993). Phagocytosis,

killing and oxidant production by bovine monocyte-derived macrophages

upon exposure to Brucella abortus strain 2308. Vet Immunol Immunopathol.

37 (3-4): 243-256.

Bovin, A., and L. M. Mesrobeanu (1935). Recherches sur les antigens somatiques et

sur les endotoxins des bacteries. 1 considerations generales et expose des

techniques utilisees. Rev Immunol 1(1935) :553-569.

Bowden, R. A., A. Clocekaert., M. S. Zygmunt., S. Bernard., and G. Durbay (1995).

Surface exposure of outer membrane protein and lipopolysaccharide epitopes

in Brucella species studied by enzyme-linked immunosorbent assay and flow

cytometry. Infect Immun. 63(10): 3945-3952.

Formatted: French (France)

Literature Cited

115

Bowser, D. V., N. W. Wheat., J. W. Foster., and D. Leong (1974). Occurrence of

quinovosamine in lipopolysaccharides of Brucella species. Infect. Immun.

9(1974): 772-774.

Brade, H., C. Galanos., and O. Luderitz (1983). Isolation of a 3-deoxy-D

mannooctulosomic acid disaccharide from Salmonella minnesota rough form

lipopolysaccharide. Eur J Biochem 131( 1983): 195-200.

Bricker B. J., and S. M. Halling (1994). Differentiation of Brucella. abortus bv 1,2,

and 4, Brucella melitensis, Brucella ovis and Brucella suis bv 1 by PCR. J.

Clin Microbiol 32 (11): 2660-2666.

Bricker, B. J (2000). Characterization of the three ribosomal RNA operons rrnA, and

rrnC from Brucella melitensis. Gene 5: 255 (1): 117-126.

Bricker, B. J., D. R. Ewalt., S. C. Olsen., and A. E. Jensen (2003). Evaluation of

Brucella abortus species-specific polymerase chain reaction assay, an

improved version of the Brucella AMOS polymerase chain reaction assay for

cattle. J Vet Dign Invest 15( 2003):374-378.

Bruce, W. J., T. H. Haris., N. Qureshi., and G. A. Splitter (2002). Rough and

Escherichia coli differentially activates the same mitogen activated protein

kinase signaling pathway for tumor necrosis factor alpha in RAW 264.7

macrophages like cells. Infect Immun 70 (12): 7165-7168.

Canning, P. C., J. A. Roth., L. B. Tabatbai., and B. L. Deyoe (1985). Isolation of

components of Brucella abortus responsible for inhibition of function in

bovine neutrophils. J Infect Dis 152(5): 913-921

Canning, P. C., J. A. Roth., and B. L. Deyoe (1986). Release of 5’ guanosine

monophosphate and adenine by Brucella abortus and their role in the

intracellular survival of the bacteria. J Infect Dis 154(3): 464-470.

Canning, P. C., B. L. Deyoe., and J. A. Roth (1988). Opsonin dependent stimulation

of bovine neutrophils oxidative metabolism by Brucella abortus. Am J Vet

Res 49 (2): 160-163.

Literature Cited

116

Capasso, L (2002). Bacteria in two-millennia-old cheese and related epizoonosis in

Roman population. J Infect 45(2002): 122-127.

Cardoso, P. G., G. C. Macedo., V. Azevedo., and S. C. Oliveira (2006). Brucella spp

noncanonical LPS: Structure, biosynthesis, and interaction with host immune

system. Microb Cell Fact 5(2006):13-24.

Caroff, M., D. R. Bundle., M. B. Perry., J. W. Cherwonogrodzkiy., and J. R. Duncan

(1984). Antigenic S-type lipopolysaccharide of Brucella abortus 1119-3

Infect Immun 46 (2):384-388.

Caron, E., T. Peyend., S. Koher., S. Cabane., J. P. Liautard., and J. Dornand (1994).

Live Brucella spp. fail to induce tumor necrosis factor alpha excretion upon

infection of U937-derived phagocytes. Infect Immun 62( 1994): 5267-5274.

Chen, F., and Y. He (2009). Caspase-2 mediated apoptotic and necrotic murine

macrophages cell death induced by rough Brucella abortus. PloS 4(8): e6830.

Cloeckaert, A., M. S. Zygmunt., and L. A. Guilloteau (2002). Brucella abortus

vaccine strain RB51 produces low levels of M-like O-antigen. Vaccine 20

(13-14): 1820-1822.

Connelly, L., A. T. Jacobs., M. Palacioscallender., S. Moncada., and A. J. Hobbs

(2003). Macrophage endothelial nitric oxide synthase autoregulates cellular

activation and pro-inf. J Biol Chem 278( 2003): 26480-26487.

Corbel, M. J (1997). Brucellosis: an overview. Emerg. Infect. Dis. 3( 2): 213-221.

Cotter, M. J., K. E. Norman., P. G. Hellewell., and V. C. Ridger (2001). A novel

method for isolation of neutrophils from murine blood using negative

immunomagenetic separation. Am J Pathol 159 (2): 473-480.

Coxon, A., T. Tang., and T. N. Mayadas (1999). Cytokine activated endothelial cells

delay neutrophils apoptosis in vitro and in vivo. A role for granulocyte

macrophage colony stimulating factor. J Exp Med 190( 7): 923-934.

Literature Cited

117

Darveau, R. P., and R. E. Hancock (1983). Procedure for isolation of bacterial

lipopolysaccharides from both smooth and rough Pseudomonas aeruginosa

and Salmonella typhimurium strains. J Bacteriol 155 (2): 831-838.

Denis, M., and E. Ghadirian (2005). Dysregulation of interleukin 8, interleukin 10

and interleukin 12 release by alveolar macrophages from HIV type 1 infected

subjects. AIDS Res Hum Retrovir 10(12): 1619-1627.

Department of the Army, US Army activity in the US biological warfare programs,

vols 1 and 2. Washington, D.C: HQ, DA; 24 February 1977. Unclassified.

Diaz, R., L. M. Tones., D. Leong., and J. B. Wilson (1968). Surface antigens of

smooth Brucellae. J Bacteriol 96(1968): 893-901.

Dodek, P. M., M. Ohgami., D. K. Minshall., and A. R. Burns (1991). One step

isolation of neutrophils using an elutriator. In Vitro Cell Dev Biol 27A: 211-

214.

Dornand, J., A. Gross., V. Lafont., J. Liautard., J. Oiaro., and J. P. Liautard (2002).

The innate immune response against Brucella in humans. Vet Microbiol.

90(1-4): 383-394.

Dubray, G., and C. Charriaut (1983). Evidence of three major polypeptide species and

two major polysaccharide species in the Brucella outer membrane. Ann Rech

Vet 14(3): 311-318.

Dubray, G., and J. Limet (1987). Evidence of heterogeity of lipopolysaccharides

among Brucella biovars in relation to A and M specificities. Ann Inst Pasteur

Microbiol 138(1): 27-37.

Duenas, A., A. Orduna., M. S. Crespo., and C. Garcia-Rodriguez (2004). Interaction

of endotoxins with toll like receptor 4 correlates with their endotoxic potential

and may explain the pro-inflammatory effect of Brucella spp. LPS. Int

Immunol 16(10): 1467-1475.

Economy survey (2008-09). Govt. of Pakistan, 2008. Islamabad: Ministry of Finance,

Islamabad, Pakistan.

Literature Cited

118

Fang, F. C (1997). Perspectives series: Host pathogens interactions. Mechanisms of

nitric oxide related antimicrobial activity. J Clin Invest 99(12): 2818-2825.

Feng, Y. H., W. L. Zhou., Q. L. Wu., W. M. Zhao., and J. P. Zou (2002). Low dose of

reveratol enhanced immune response of mice. Acta Pharmacol Sin 23(10):

893-897.

Fernandez-Parada, C. M., E. B. Zelazowska., M. Nikolich., T. L. Hadfield., R. M.

Roop., and G. L. Robertson (2003). Interactions between Brucella melitensis

and human phagocytes: Bacterial surface O-polysaccharide inhibits

phagocytosis, bacterial killing and subsequent host cell apoptosis. Infect

Immun 71( 4): 2110-2119.

Fiori, P. L., S. Mastrandrea., P. Rappelli., and P. Cappuccinelli (2000). Brucella

abortus infection acquired in microbiology laboratories. J Clin Microbiol

38(5): 2005-2006.

Forsell, J. H., J. R. Kateley., and C. W. Smith (1985). Bovine neutrophils treated with

chemoteactic agents: morphologic changes. Am J Vet Res 46(9): 1971-1974.

Freer, E., N. Rojas., A. Weintrab., A. A. Lindberg., and E. Moreno (1995).

Heterogeneity of Brucella abortus lipopolysaccharides. Res Microbiol 146(7):

569-578.

Freevert, C. W., A. E. Warner., E. Weller., and J. D. Brain (1998). The effect of

endotoxin on in vivo rat alveolar macrophage phagocytosis. Exp Lung Res

24(1998): 745-758.

Freitas, M., G. Porto., J. L. F. C. Lima., and E. Fernandes (2008). Isolation and

activation of human neutrophils in vitro. The importance of the anticoagulant

used during blood collection. ClinBiochem 41(7-8): 570-575.

Gaines, P., J. Chi., and N. Berliner (2005). Heterogeneity of functional responses in

differential myeloid cell lines reveals EPRO cells as a valid model of murine

neutrophils functional activation. J Leukocyte Biol 77(2005): 669-679.

Literature Cited

119

Galanos, C., O. Luderitz., and O. Westphal (1969). A new method for the extraction

of R lipopolysaccharides. Eur J Biochem 9: (1969) 245-249.

Gallego-Ruiz, M. C., and M. A. Lopena-Alonso (1989). Stimulation du metabolism

oxydatif des granulocytes caprines par Brucella melitensis by goat’s

polymorphnuclear phagocytes. Comp. Immunol Microbiol Infect Dis

12(1989): 9-15.

Gangtsetse, T., N. Koide., K. Takahashi., F. Hassan., S. Islam., H. Ito., I. Mori., T.

Yoshida., and T. Yokochi (2003). Characterization of Biological activities of

Brucella melitensis lipopolysaccharide. Microbiol Immunol 50(1): 421-427.

Ganz, T (1987). Extracellular release of antimicrobial defensins by human

polymorphnuclear leukocytes. Infect. Immunol. 55(3): 568-571.

Garin-Bastuji, B. B., R. A. Bowden., G. Dubray., and J. N. Limet (1990). Sodium

dodecyl sulfate polyacrylamide gel electrophoresis and immunoblotting

analysis of smooth lipopolysaccharide heterogeneity among Brucella biovars

related to A and M specificities. J Clin Microbiol 28(10): 2167-2174.

Gennaro, R., C. Schneider., G. deNicola., F. Cian., and D. Romeo (1978).

Biochemical properties of bovine granulocytes. Proc Soc Exp Biol Med

157(3): 342-347.

Gerschman, R., D. L. Gilbert., S. W. Nye., P. Dwyer., and W. O. Fenn (1954).

Oxygen poisoning and x-irradiation, A mechanism in common. Science

119(3097): 623-626.

Godfroid, J., A. Cloeeeckaert., J. P. Liautard., S. Kohler, D. Fretin., K. Walravens., B.

Garin-Bastuji., and J. J. Letesson (2005). From the discovery of the Malta

fever’s agent to the discovery of a marine mammal reservoir, brucellosis has

continuously been a re-emerging zoonosis. Vet Res 36(2005): 313-326.

Goff, W. L., W. C. Johnson., C. R. Wyatt., and C. W. Cluff (1996). Assessment of

bovine mononuclear phagocytes and neutrophils for induced L-arginine-

Literature Cited

120

dependent nitric oxide production. Vet Immunol Immunopathol 55(1-3):45–

62.

Goldstein, J., T. Hoffman., C. Frasch., E. F. Lizzio., P. R. Beinning., D. Hochstein.,

Y.L. Lee., R. D. Angus., and B. Golding (1992). Lipopolysaccharide (LPS)

from Brucella abortus is less toxic than that from Escherichia coli, suggesting

the possible use of Brucella abortus or LPS from Brucella abortus as a carrier

in vaccines. Infect Immun 60(4): 1385-1389.

Gordon, S., J. Todd., and Z. A. Cohn (1974). In vitro synthesis and secretion of

lysozyme by mononuclear phagocytes. J Exp Med 139(1974): 1228-1248.

Gorvel, J. P., and E. Moreno (2002). Brucella intracellular life: from invasion to

intracellular replication, Vet Microbiol. 90 (1-4): 281-297.

Green, S.J., C.A. Nacy., and M.S. Meltzer (1991). Cytokine induced synthesis of

nitrogen oxides in macrophages: a protective host response to Leishmania and

other intracellular pathogen. J. Leukocyte Biol. 50( ): 93-103.

Greiner, M., D. Verloo., and F. Massis (2009). Meta-analitical equivalence of studies

on diagnostic tests for bovine brucellosis allowing assessment of a test against

a group of comparative test. Prev Vet Med 92: ( 4) 373-381.

Gross, A., S. Spiesser., A. Terraza., B. Rouot., E. Caron., and J. Dornand (1998).

Expression and bactericidal activity of nitric oxide synthase in Brucella suis

infected murine macrophages. Infect Immun 66(4): 1309-1316.

Gross, A., S. Bertholet., J. Mauel., and J. Dornand (2003). Impairment of Brucella

growth in human macrophagic cells that produce nitric oxide. Microb

Pathogenesis 36(2): 75-82.

Hartt, J. K., G. Barish., P. M. Murphy., and J. L. Gao (1999). N-formylpeptides

induce two distinct concentration optima for mouse neutrophils chemotaxis by

differential interaction with two N-formylpeptide receptor (FPR) subtypes.

Molecular characterization of FPR2, Second mouse neutrophils FPR. J Exp

Med 190(5):741-747.

Literature Cited

121

He, Y., S. Reichow., S. Ramamoorthy., X. Ding., R. Lathigra., J. C. Craig., B. W. S.

Sorbel., G. G. Schurig., N. Sriranganathan., and S.M. Boyle (2006). Brucella

melitensis triggers time-dependent modulation of apoptosis and down-

regulation of mitochondrion-associated gene expression in mouse

macrophages. Infect Immun 74(9): 5035-5046.

Hinic, V., I. Brodard., A. Thomann., Z.C. Vetnic., P. V. Makaya., J. Frey., and C.

Abril (2008). Novel identification and differentiation of Brucella melitensis,

B. abortus, B. suis, B. ovis, B. canis and B. neotomae suitable for both

conventional and real time PCR systems. J Microbiol Meth 75(2): 375-378.

Hornback, M. L., and R. M. II Roop (2006). Brucella abortus xthA-1 gene product

participates in base excision repair and resistance to oxidative killing but is

not required for wild type virulence in mouse model. J Bactreriol 188(2006):

1295-1300.

Hotchkiss, R. D (1946). The nature of the bactericidal action of surface active agents.

Ann N Y Acad Sci 46( 1946) : 479-493.

Huang, L.Y., J. Aliberti., C. A. Leifer., D. M. Segal., A. Sher., D.T. Golenbock., and

B. Golding (2003). Heat Killed Brucella abortus induces TNF and IL-12p40

by distinct My88-dependent pathways: TNF, unlike IL-12p40 secretion is toll-

like receptor 2 dependent. J Immunol 171(3): 1441-1446.

Hussain, I., M. I. Arshad., M. S. Mahmood., and M. Akhtar (2008). Seroprevalence of

brucellosis in human, cattle and buffalo populations in Pakistan. Turk J Vet

Anim Sci 32(4): 315-318.

Introduction to Flow Cytometery, First paperback edition. James V. Watson.

Caambridge University Press. 2004.

Iyankan, L (1998). Studies on the mechanism of cellular host defense in brucellosis.

M.VSc. Thesis submitted to I.V.R.I. Deemed University, India.

Literature Cited

122

Iyankan, L., and D. K. Singh (2002). The effect of Brucella abortus on hydrogen

peroxide and nitric oxide production by bovine polymorphnuclear cells. Vet

Res Commun 26(2): 93-102.

Jarvis, B. W., T. H. Harris., N. Qureshi., and G. A. Splitter (2002). Rough

lipopolysacharide from Brucella abortus and Escherichia coli differentially

activates the same mitogen-activated protein kinase signalintg pathways for

tumor necrosis factor alpha in RAW 264.7 macrophage-like cells. Infect

Immun 70(12): 7165-7168.

Jean, C (2005). Surviving inside macrophages: The many ways of Brucella. Res

Microbiol 157(2006): 93-98.

Jiang, X., and C. L. Baldwin (1993a). Effects of cytokines on intracellular growth of

Brucella abortus. Infect Immun 61(1): 124-134.

Jiang, X., B. Leonard., R. Bensond., and C. L. Baldwin (1993b). Macrophages control

of Brucella abortus: Role of reactive oxygen intermediates and nitric oxide.

Cell Immunol 151(2): 309-319.

Jimenez-de-Baques, M. P., A. Tenaza., A. Gross., and J. Dornand (2003). Different

responses of macrophages to smooth and rough Brucella spp.: Relationship to

virulence. Infect Immun 72(4): 2429-2433.

Jimenez-de-Baques, M. P., S. Dudal., J. Dornand., and A. Gross (2005). Cellular

bioterrorism. How Brucella corrupts macrophages physiology to promote

invasion and proliferation. Clin Immunol 114(3): 227-238.

Jinkyung, K., and G. A. Splitter (2003). Molecular host-pathogen interaction in

brucellosis: Current understanding and future approaches to vaccine

development foor mice and humans. Clin Microbiol Rev 16(1): 65-78.

Johnson, W. D., B. Mei., and Z. A. Cohn (1977). The separation, long term

cultivation and maturation of the human monocytes. J Exp Med. 146(6):

1613-1626.

Literature Cited

123

Jones, L. M., and D. T. Berman (1976a). Studies of Brucella lipopolysaccharide. Dev

Biol Stand 31(1): 62-67.

Jones, L. M., R. Diaz., and D. T. Berman (1976b). Endotoxic activity of rough

organisms of Brucella species. Infect Immun 13(6): 1638-1641.

Kabbur, M. B., N. C. Jain., and T. B. Farver (1995). Modulation of phagocytic and

oxidative burst activities of bovine neutrophils by human recombinant TNF-α,

IL-1α, IFN-γ, G-CSF, GM-CSF. Comp Hematol Int 5 (1995): 47-55.

Kariminia, A., G. Kavoossy., S. Khatami., E. Zowghi., and S. K. Ardestani (2002).

Study of interleukin-10 and interleukin-12 productions in response to

lipopolysaccharides extracted from two different Brucella strains. Comap

Immunol Microbiol 25(2): 85-93.

Keshav, S., P. Chung., G. Milon., and S. Gordon (1991). Lysozyme is an inducible

marker of macrophages activation in murine tissues as demonstrated by in situ

hybridization. J Exp Med 174(5): 1049-1058.

Khatammi, M., and S. Ardestani (2005). Biological and biochemical study of lipid A

extracted from Brucella abortus vaccine (S19) in Brucella Melitensis

virulence and Brucella melitensis vaccine (Rev1). FEBS 1: 53.

Khatun, M. M., M. A. Islam., B. K. Baek., and S. I. Lee (2009). Cellular and Humoral

immune responses and antigen recognition in sprague-Dawley rats

experimentally infected with Brucella abortus biotype 1. Asian J Anim Vet

Adv 4(6): 267-277.

Kreutzer, D. L., C. S. Buller., and D. C. Robertson (1979a). Chemical

characterization and biological properties of lipopolysaccharides isolated from

smooth and rough strains of Brucella abortus. Infect Immun 23(3): 811-818.

Kreutzer, D. L., and D. C. Robertson (1979b). Surface macromolecules and virulence

in intracellular parasitism: Comparison of cell envelope components of

smooth and rough strains of Brucella abortus. Infect Immun. 23(3): 819-828.

Literature Cited

124

Laemmli, U. K (1970). Cleavage of structural proteins during the assembly of the

head of bacteriophage T4. Nature (London) 227( ): 680-685.

Latimer, E., J. Simmers., N. Sriranganathan., R.M. Roopi II., G.G. Shurig., and S.M.

Boyle (1992). Brucella abortus deficient in copper/zinc superoxide dismutase

is virulent in BAL/c mice. Microb Pathogenesis 12(1970):105-113.

Lavaroni, O., N. Aguirre., V. Vanzini., C. Lugaresi., and S. Torioni-de-Echaide

(2004). Assessment of polymerase chain reaction. (PCR) to diagnose

brucellosis in a Brucella infected herd. Rev Argent Amicrobiol 36(3): 337-

338.

Leal-Klevezas, D. S., O. I. Martinez-Vazquez., A. Lopez-Merino., and J. P. Martinez-

Soriano (1995). Single-step PCR for detection of Brucella spp. from blood

and milk of infected animals. J Clin Microbiol 33(12): 3087-3090.

Lecaroz, C., M. J. Blanco-Prieto., M. A. Burrell., and C. Gamazo (2006). Intracellular

killing of Brucella melitensis in human macrophages with microsphere

encapsulated gentamycin. J Antimicrob Chemother 58(3): 549-556.

Lee, C.H., and C. M. Tsai (1999). Quantification of bacterial lipopolysaccharides by

the purpald assay: Measuring formaldehyde generated from 2-keto-3-

deoxyoctonate and heptose at the inner core by periodate oxidation. Anal

Biochem 267(1): 161-168.

Leyva-cobian, F., I. M. Outschoorn., E. C. Marin., and C. A. Dominguez (1997). The

consequences of intracellular retention of pathogen derived T-cells

independent antigens on protein presentation to T cells. Clin Immunol

Immunol 85(1): 1-15.

Liautard, J. P., A. Gross., J. Dornand., and S. Kohler (1996). Interaction between

professional phagocytes and Brucella spp. Microbiologia. 12(2): 197-206.

Limet, J., N. Bosseray., B. Garin-Bastuji., G. Dubray., and M. Plommet (1989).

Humoral immunity in mice mediated by monoclonal antibodies against the A

and M antigens of Brucella. J Med Microbiol 30(1989): 37-43.

Literature Cited

125

Lowery, O. H., N. J. Rosebrough., A. L. Farr., and R. J. Randall (1951). Protein

measurement by the Folin phenol reagent. J Biol Chem 193( 1951): 265-275.

Lupis-Urrutia L. U., A. Alonso., M. Luisa., Nieto., Y. Bayon., A. Orunda., and M. S.

Crespo (2000). Lipopolysaccharide of Brucella abortus and Brucella

melitensis induced nitric oxide synthesis in rat peritoneal macrophages. Infect

Immun 68(3): 1740-1745.

Macher, B. A., and J. C. Klock (1981). Isolation and structural characterization of

human lymphocyte and neutrophils gangliosides. J Biochem 256(4): 1968-

1974.

Malikov, V. E., D. Vskaia., and V. V. Vysotski (1989). Immunochemical

characterization and serological properties of lipopolysaccharides isolated

from various Brucella species using various extraction methods. Zh Mikrobiol

Epidemiol Immunobiol (2):22-27.

Margaret, W., N. Qureshi., N. Soeurt., and G. Splitter (2002). High levels of nitric

oxide production decrease early but increase late survival of Brucella abortus

in macrophages. Microb Pathogenesis 31(5): 221-230.

Maria, A. B., Y. Saez., and J. Balsinde (2003). Calcium-independent phospholipase

A2 is required for lysozyme secretion in U937 promonocytes. J Immunol

170(2003): 5276-5280.

Marianelli, C., A. Martucciello., M. Tarantino., I. G. Vecchio., and G. Galiero (2008).

Evaluation of molecular methods for the detection of Brucella species in

water buffalo milk. J Dairy Sci 91(10): 3779-3786.

Matthew, J. C., K. E. Norman., P. G. Hellewell., and V. C. Ridger (2001). A novel

method for isolation of neutrophils from murine blood using negative

immunomagnetic separation. Am J Pathol 159(1): 473-481.

Maurin, V. J., R. A. Biogegrain., A. Cloeckaert., A. Gross., M. T. A. Martinez., A.

Terraza., J. Liautard., S. Kohler., B. Rouot., J. Dornand., and J. P. Liautard

(2001). Major outer membrane protein OMP 25 of Brucella suis is involved in

Literature Cited

126

inhibition of tumor necrosis factor alpha production during infection of human

macrophages. Infect Immun 69(8): 4823-4830.

McGhee, J. R., and B. A. Freeman (1970). Effect of lysosomal enzymes on Brucella.

J Reticuloendothel 8(1970): 208-219.

Mc Nicholas, P.A., M. Batley., and J. W. Redmond (1987). Synthesis of methyl

pyranosides and furanosides of 3- deoxy-D-manno oct-2-ulosonic acid (kdo)

by acid catalysed solvolysin of the actylated derivatives. Carbohdr Res

165(1987): 17-22.

MeCall, T. B., N. K. Boughton., and R. M. T. Palmer (1989). Synthesis of nitric

oxide from L-arginine by neutrophils. Biochem J 261(1989): 293-296.

Milteny, S., W. Muller., W. Weichel., and A. Redbruch (1990). High gradient

magnetic cell separation with MACS. Cytometry 11(2): 231-238.

Moncada, S., R. M. J. Palmer., and E.A. Higgs (1991). Nitric oxide: physiology,

pathophysiology and pharmacology. Pharmacol Rev 43(2): 109-142.

Moreno, E., M. W. Pitt., L. M. Jones., G. G. Schurig., and D. T. Berman (1979).

Purification and characterization of smooth and rough lipopolysaccharides

from Brucella abortus. Infect Immun 138 (2): 361-369.

Moreno, E., S. L. Septh., L. M. Jones., and D. T. Berman (1981). Immunochemical

characterization of Brucella lipopolysaccharides and polysaccharides. Infect

Immun 31(1): 214-222.

Moreno, E., L. M. Jones., and D. T. Berman (1984). Immunochemical

characterization of rough Brucella lipopolysaccharide Infect Immun 43(3):

779-782.

Moreno, E., E. M. Stackebrandt., J. Dorsch., M. Wolters., Busch and H. Mayer

(1990). Brucella abortus 16S rRNA and lipid A reveal a phylogenetic

relationship with members of the alpha-2 subdivision of the class

protobacteria. J Bacteriol 172 (7): 3569-3576.

Literature Cited

127

Moriyon, I., and M. A. Montanes (1985). In vitro interactions between

lipopolysaccharides and heterologous outer membrane porin proteins. Curr

Microbiol 12 (1985): 229-234.

Nagahata, H., H. Higuchi., H. Teraoka., K. Takahashi., O. Inanami., and M.

Kuwabara (2004). Decreased apoptosis of β2- integrin deficient bovine

neutrophils. Immunol Cell Biol 82(2004): 32-37.

Nakata, M., K. Otsubo., T. Kikuchi., T. Itou., and T. Sakai (2010). Chemotechtic

properties and absence of the formyl peptide receptor in ferret (Mustela

putorius furo) neutrophils. Res Vet Sci 88(1): 56-60.

Nasir, A. A., Z. Parveen., M. A. Shah., and M. Rashid (2004). Seroprevalence of

brucellosis in animals at government and private livestock farms in Punjab.

Pakistan Vet J 24(2004): 144-146.

Nasir, A. A., Z. Parveen., and M. Ikram-ul-Haq (2005). Comparative study of

standard and modified serum agglutination tests for the diagnosis of

brucellosis in animals. Pakistan Vet J 25(2005): 33-34.

Neta, A. V., J. P. Mol., M. N. Xavier., T. A. Paixao., A. P. Lage., and R. L. Santos

(2009). Pathogenesis of bovine brucellosis. Vet J 184(2):146-155.

Nicolas, L., F. Forquet., C. de-Chastellier., Z. Mishal., G. Jolly., E. Moreno., I.

Moriyon., J. E. Heuser., H. T. He., and J. P. Gorvel (2006). Characterization

of Brucella abortus lipopolysaccharides macrodomains as mega rafts. Cell

Microbiol 8(10): 197-206.

Oh, H., B. Siano., S. Diamond (2005). Neutrophils isolation protocol. J Vis Exp

23(17): pii: 745. doi. 103791/745.

OIE (World Organization for Animal Health) (2000). Bovine brucellosis, section 2.2.

In OIE manual of standards for diagnostic tests and vaccines, 4th Ed. OIE.

Paris. 328-345.

Literature Cited

128

O’Leary, S., M. Sheahan., and T. Sweeney (2006). Brucella abortus detection by

PCR assay in blood, milk and lymph tissue of serologically positive cows. Res

Vet Sci 81(2): 170–176.

Omar, A. S., J. I. Velasquez., J. E. Ossa., and M. T. Rugels (2003). Standardization of

bovine macrophage monolayers and isolation and culture of trypnosome.

Mem Inst Oswald Cruz 98(2): 269-271.

Ouahrani, S., J. Michaux., G. Sri-Wadada., G. Bourg., R. Tournebize., M. Ramuz.,

and J. P. Liautard (1993). Identification and sequence analysis of IS6501, an

insertion sequence in Brucella spp.: relationship between genomic structure

and the number of IS6501 copies. J Gen Microbiol 139(1993): 3265-3273.

Padgett, E. L., and S. B. Pruett (1992). Evaluation of nitrite production by human

monocytes derived macrophages. Biophys Res Commun 186(2): 775-781.

Pappas, G., and Z. A. Memish (2007). Brucellosis in the Middle East: A persistent

medical, socioeconomic and political issue. J chemother 19(2007): 243-248.

Pei, J., and T. A. Ficht (2004). Brucella abortus rough mutants are cytopathic for

macrophages in culture. Infect Immun 72(1): 440-450.

Pei, J., J. E. Turse., Q. Wu., and T. A. Ficht (2006). Brucella abortus rough mutants

induce macrophages oncosis that requires bacterial protein synthesis and

direct interaction with the macrophages. Infect Immun 74(5): 2667-2675.

Pei, J., J. E. Turse., and T. A. Ficht (2008). Evidence of Brucella abortus OPS

dictating uptake and restricting NF-KB activation in murine macrophages.

Microbes Infect 10(6): 582-590.

Petra, Z., J. Matiasovic., B. Palova., H. Kudlackova., F. Kovaru., and M. Faleyna

(2008). Quantitative nitric oxide production by rat, bovine and porcine

macrophages. Sci Direct 19(1): 36-41.

Phillip, M., G. W. Pugh., and B. L. Deyoe (1989) Chemical and protective properties

of Brucella lipopolysaccharide obtain by butanol extraction Am J Vet Res

50(3): 311-317.

Literature Cited

129

Piepers, S., S. De. Vliegher., K. Demeyere., B. N. Lambrecht., A. de Kruif., E.

Meyer., and G. Opsomer (2009). Technical note: Flow cytometric

identification of bovine milk neutrophils and simultaneous quantification of

their viability. J Dairy Sci 92(2009): 626-631.

Plommet, M., A. Serre., and R. Fensterbank (1987). Vaccines, vaccination in

brucellosis. Ann Inst Pasteur Microbiol 138(1): 117-121.

Porte, F., J. P. Liautard., and S. Kohler (1999). Early acidification of phagosomes

containing Brucella suis is essential for intracellular survival in murine

macrophages. Infect Immun. 67 (8): 4041-4047.

Porte, F., A. Naroeni., S. Ouahrani-Bettache., and J. P. Liautard (2003). Role of the

Brucella suis lipopolysaccharide O-antigen in phagosomal genesis and in

inhibition of phagosome-lysosome fusion in murine macrophages. Infect

Immun 71(3):1481–1490.

Poussin, C., M. Foti., J. L. Carpentier., and J. Pugin (1998). CD14-dependent

endotoxin internalization via a macropinocytic pathway. J Biol Chem

273(1998): 20285-20291.

Price, R. E., J. W. Templeton., and L. G. Adams (1990). Survival of smooth and

rough transposon mutant strains of Brucella abortus in bovine mammary

macrophages. Vet Immunol Immunop 26(4): 353-365.

Quesenberry, M. S., and Y. C. Lee (1996). Anal Biochem 234(1996): 50-55.

Qureshi, T., J. W. Templeton., and L. G. Adams (1996). Intracellular survival of

Brucella abortus, Mycobacterium bovis BCG, Salmonella dublin and

Salmonella typhimurium in macrophages from cattle genetically resistant to

Brucella abortus. Vet Immunol Immunopathol 50(1-2): 55-65.

Rajasingh, J., E. Bord., C. Luedemann., J. Asai., H. Hamada., T. Throne., G. Quin.,

D. Goukassian., Y. Zhu., D. W. Losordo., and R. Kishore (2006). IL-10

induced TNF-α mRNA destabilized is mediated via IL-10 suppression of P38

Literature Cited

130

MAP kinase activation and inhibition of HuR expression. FASEB 20(2006):

2112-2114.

Ralston, D. J., B. S. Baer., and S. S Elberg (1961). Lysis of Brucellae by the

combined action of glycine and a lysozyme-like agent from rabbit monocytes.

J Bacteriol 82(3): 342-353.

Ramazan, M. (1996). Incidence of brucellosis in farm animals based on serology.

M.Phil Thesis Deptt Biol Sci, Quid-e-Azam Univ, Islamabad. 52 p.

Rasool, O. E., E. Freer., E. Moreno., and Jarstrand (1992). Effect of Brucella abortus

lipopolysaccharide on oxidative metabolism and lysozyme release by human

neutrophils. Infect Immun. 60(4): 1699-1702.

Redbruch, A., and D. R. Recktenwald. (1995). Detection and Isolation of rare cells.

Curr Opin Immunol 7(1995): 270-273.

Redfearn, M. S. (1960). An immunochemical study of antigens of Brucella extracted

by the westphal technique. PhD Thesis. University of Wisconsin-Madison,

WI.

Rafiei, A., S. K. Ardestani., A. Kariminia., A. Keyhani., M. Mohraz., and A.

Amirkhani (2006). Dominant Th1 cytokine production in early onset of

human brucellosis followed by switching towards Th2 along prolongation of

disease. J Infect 53(5): 315-324

Repaske, R (1958). Lysis of Gram-negative organism and the role of versene.

Biochem Biophys Acta 30(1958): 225.

Rezapour, A., and J. Majidi (2009). An improved method of neutrophils isolation in

peripheral blood of sheep. J Anim Vet Adv 8(1): 11-15.

Riley, L. K., and D. C. Robertson (1984). Ingestion and intracellular survival of

Brucella abortus in human and bovine polymorphonulclear leukocytes. Infect

Immun 46(1): 224-230.

Rittig, G., A. Kaufmann., A. Robins., B. Shaw., H. Sprenger., D. Gemsa., V.

Foulongne., B. Rouot., and J. Dornand (2003). Smooth and rough

Literature Cited

131

lipopolysaccharide phenotypes of Brucella induce different intracellular

trafficking and cytokine/chemokine release in human monocytes. J Leukov

Biol 74(2003): 1045-105.

Robert, A. C., and W. M. Nauseef (2001). Isolation and functional analysis of

neutrophils. Curr protocol Immunol Unit Number: UNIT 7.23. DOI.

10:1002/0471142735.im 0723519.

Robert, F. P (1997). Methods in Inhalation Toxicology, Ist edition Vol 1 P.136.

Robinson, J. M., and J. A. Badwey (1994). Production of active oxygen species by

phagocytic leukocytes. Immunol Ser 60(1994): 159-178.

Rodolfo, R. Z., and A. G. Mendoza (1986) Metabolic activity of phagocytes in

experimental sporotichosis. Mycopathologia 93(1986): 109-112.

Rosenthal, A. S (1978) Determinant selection and macrophage function in genetic

control of the immune response. Immunol Rev 40(1978 ): 136.

Roussel E., and M. C. Gingras (1997). Transendothelial migration induces rapid

expression on neutrophils of granule-release VLA6 used for tissue

infilteration. J Leukoc Biol 62(1997): 356-362.

Saeed, F., and E. C. Georgina (1998). Neutrophil chemiluminescence during

phagocytosis is inhibited by abnormally elevated levels of acetoacetate:

Implications for diabetic susceptibility to infections. Clin Dign Lab Immunol.

5(5): 740-743.

Sathiyaseelan, J., R. Goenka., M. Parent., R. M. Benson., E. A. Murphy., D.

Fernandesa., A. S. Foulkes., and C. L. Baldwin (2006). Treatment of Brucella-

susceptible mice with IL-12 increases primary and secondary immunity. Cell

Immunol 243(1) :1-9.

Sauret, J. M., and N. Vilissova (2002). Human brucellosis review. JABFP 15 (2002):

401-406.

Literature Cited

132

Schneemann, M., G. Schoedon., S. Hofer., N. Blau., l. Guerrero., and A. Schaffner

(1993). Nitric oxide synthase is not a constituent of the antimicrobial armature

of human mononuclear monocytes. J Infect Dis 167(1993): 1358-1363.

Schmidt, H. H., R. Seifert., and E. Bohme (1989). Formation and release of nitric

oxide from human neutrophils and HL-60 cells induced by a chemotactic

peptide, platelet activating factor and keukotriene B4. FEBS Lett 244(1989):

357-360.

Schultz, R. M., M. A. Chirigos., N. A. Pavlidis., and J. S. Youngner (1978).

Macrophage activation and antitumor activity of Brucella abortus ether

extract, Bru-pel. Cancer Treat Rep. 62(1978): 1937-1941.

Schurig, G. G., R. M. Roop II., T. Bagchi., S. Boyle., D. Buhraman., and N.

Sriranganathan (1991). Biological properties of RB51; a stable rough strain of

Brucella abortus. Vet Micriobiol 28(1991): 171-188.

Serafino, J., S. Conde., O. Zabal., and L. Samartino (2007). Multiplication of

Brucella abortus and production of nitric oxide in two macrophage cell lines

of different origin. Rev Argent Microbiol 39(4): 193-198.

Sharon. (1967). The chemical structure of lysozyme substrates and their cleavage by

the lysozyme. Vol 167. No. 1009. A discussion on the structure and function

of lysozyme (Apr, 18, 1967). pp: 402-415. Published by The Royal Society.

Sheikh, S. A., M. A. Shah., and S.A. Khan (1967). A survey to find out the incidence

of brucellosis in Pakistan. Pak J Sci 19 (1967): 189-192.

Sowa, B. A., R. P. Crawford., F. C. Heck., J. D. Williams., K. A. Kelly., and L. G.

Adams (1986). Size, charge and structural heterogeneity of Brucella abortus

lipopolysaccharides demonstrated by two dimensional gel electrophoresis.

Electrophoresis 7(1): 283-288.

Sreevatsan, S., J. B. Bookout., F. Ringpis., V. S. Perumaulla., T. A. Ficht., L. G.

Adams., S. D. Hagius., P. H. Elza., B. J. Bricker., G. K. Kumar., M.

Literature Cited

133

Rajasekhar., S. Isloor., and R. R. Barathur (2000). A multiplex approach to

molecular detection of Brucella abortus and / or Mycobacterium bovis in

cattle. J Clin Microbial 38(7): 2602-2610.

Stabili, L., R. Schnosi., M. Licciano., and A. Giangrande (2009). The mucus of

Sabella spallanzanii (Annelida, polychaeta): Its involvement in chemical

defence and fertilization success. J Exp Mar Biol Ecol 374(2): 144-149.

Stickle, J. E (1996). The neutrophils function, disorders and testing. Vet Clin North

Am Small Anim Pract 26(5): 1013-1021.

Stie, J., and A. J. Jesaitis (2007). Reorganization of the human neutrophils plasma

membrane is associated with functional priming: implications for neutrophils

preparations. J Leukocyte Biol 81(2007): 672-685.

Styrt, B., R. D. Walker., and J. C. White (1989). Neutrophil oxidative metabolism

after exposure to bacterial phospholipase C J Lab Clin Med 114 (1): 51-57.

Suarez, C. E., G. A. Pacheco., and A. M. Vigliocco (1988). Characterization of

Brucella ovis surface antigens. Vet Microbiol 18(3-4): 349-356.

Sun., Y. H., A. B. Hartigh., R. M. Tsolis., and T. A. Ficht (2006). Laboratory

maintenance of Brucella abortus. Curr Protocol Microbiol Unit No.

UNITBB.1. DOI. 10.1002/9780471729259.

Tanyel, E., A. Y. Coban., F. N. Tasdelen., N. Tulek., and B. Durupinar (2009). In

vitro effect of reactive nitrogen and oxygen intermediates alone and in

combination with some antibiotics against Brucella melitensis clinical

isolates. Mikrobiyol Bul 43(2009): 19-26.

Tsai, C. M., and C. E. Frasch (1982). A sensitive silver stain for detecting

lipopolysaccharides in polyacrylamide gels. Anal Biochem119(1): 115-119.

Ugalde, J. E., D. J. Comerci., M. S. Leguizamon., and R. A. Ugalde (2003).

Evaluation of Brucella abortus phosphoglucomutase (pgm) mutant as a new

live rough-phenotype vaccine, Infect Immun 71(11): 6264-6269.

Literature Cited

134

Velacso, J. A. Bengoechea., K. Brandenburg., B. Lindner., U. Seydel., D. Gonzalez.,

U. Zahringer., E. Moreno., and I. Moriyon. (2000). Brucella abortus and its

closest phylogenetic relative, Ochrabacterium spp., Differ in outer membrane

permeability and cationic peptide resistance. Infect Immun 68(6 ): 3210-3218.

Virgilio, R., C. Gonzalez., N. Munro., and S. Mendoza (1966). Electron microscopy

of staphylococcus aureus cell wall lysis. J Bacteriol 91(5): 2018-2024.

Vitale, F., G. Capra., L. Maxia., S. Reale., G. Vesco., and S. Caracappa (1998).

Detection of mycobacterium tuberclosis complex in cattle by PCR using milk,

lymph node aspirates and nasal swabs. J Clin Microbiol 36(4): 1050-1055.

Volko, E. I (1946). Surface active agents in biology and medicine. Ann N Y Acad Sci

46(1946): 451-478.

Volpato, S., S. G. Leveille., M. C. Corti., T. B. Harris., and J. M. Guralnik (2001).

The value of serum albumin and high-density lipoprotein cholesterol in

defining mortality risk in older persons with low serum cholesterol. J Am

Geriatr Soc 49(9): 1142–1147.

Voss, J. G (1964). Lysozyme lysis of Gram-negative bacteria without production of

spheroblasts. J Gen Microbiolo 35(1964): 313-317.

Waters, W. R., M. V. Palmer., R. E. Sacco., and D. L. Whipple (2002). Nitric oxide

production as an indication of mycobacterium bovis infection in white-tailed

deer. J Wildlife Dis 38(2): 338-343.

Watson, F., E. Freer., A. Weintraub., M. Ranirez., S. Lind., and E. Moreno (1994).

Immunochemical identification of Brucella abortus epitopes. Clin Diagn Lab

Immun 1(2): 206-213.

Wen, Li., A. C. Chan., J. W. Lau., D. W. Lee., E. K. Ng., J. J. Sung., and S. S. Ching

(2004). Superoxide and nitric oxide production by kupffer cells in rats with

obstructive jaundice: Effect of internal and external drainage. J Gastroenterol

Hapatol. 19(2004): 160-165.

Literature Cited

135

Westphal, O., and K. Tann (1965). Bacterial lipopolysaccharide extraction with

phenol water and further application of the procedure. Meth Carb Chem

5(1965):83-91.

Wu, A.M., L. G. Amdams., and R. Pugh (1987).Immunochemical and partial

chemical characterization of fractions of membrane bond smooth

lipopolysaccharide in protein complex from Brucella abortus. Mol Cell

Biochem 75(2): 93-102.

Wu, A. M., N. E. Mackenzie., G. Adams., and R. Pugh (1988). Structural and

immunochemical aspects of Brucella abortus endotoxins Adv Exp Med Biol

228(1988): 551-576.

Wuorela, M., S. Jalkanen., P. Toivanen., and K. Granfors (1993). Yersinia

lipopolysaccharide is modified by human monocytes. Infect Immun 61(12):

5261-5270.

Yi, E.C and M. Hackett (2000). Rapid isolation method for lipopolysaccharide and

lipid A from gram negative bacteria. Analyst 125 (4): 651-656.

Young, E. J (1983). Human brucellosis. Rev Infect Dis 5 (1983): 821-842.

Young E. J (1996). An overview of human brucellosis. Clin Infect Dis 21(1): 283-

289.

Zahler, S., C. Kowalski., A. Brosig., C. Kupatt., B. F. Becker., and E. Gerlach (1997).

The function of neutrophils isolated by a magnetic antibody cell separation

technique is not altered in comparison to a density gradient centrifugation

method. J Immunol Methods 200(1-2):173-179.

Zaitseva, M., H. Golding., J. Manischewitz., D. Webb., and B. Golding (1996).

Brucella abortus as a potential vaccine candidate: Induction of interleukin-12

secretion and enhanced B. 1. 1 and B7.2 and interleukin adhesion molecule I

surface expression in elutriated human monocytes stimulated by heat

inactivated B. abortus. Infect Immun 64(8): 3109-3117.

Literature Cited

136

Zaki, M. H., T. Akuta., and T. Akaike (2005). Nitric oxide-induced nitrative stress

involved in microbial pathogenesis. J Pahrmacol Sci 98(2): 117-129.

Zembala, M., E. M. Lemmel., and W. Uracz (1980). Activation of human monocytes

for nitroblue tetrazolium reduction and the suppression of lymphocyte

response to mitogens. Clin Exp Immunol 41(1): 309-314.

Zhan, Y. F., E. R. Stanley., and C. Cheers (1991). Prophylaxis or treatment of

experimental brucellosis with interleukin-1. Infect Immun 59(5): 1790-1794.

Zhan, Y., and C. Cheers (1998). Control of IL-12 and IFN-gamma production in

response to live or dead bacteria by TNF and other factors. J Immunol

161(3):1447-1453.

Zhu, Y. C., M. Skold., X. Liu., H. Wang., T. Kohyama., Fu. Wen., R. F. Ertl., and S.

I. Rennard (2001). Fibroblasts and monocytes macrophages contract and

degrade three-dimensional collagen gels in extended co-culture. Resp Res

2(2001): 295-299.

Zwerdling, A., M. V. Delpino., K.A. Pasquevich., P. Barrionuevo., J. Cassataro., C.

G. Samartino., and G. H. Giambartolomei (2009). Brucella abortus activates

human neutrophils. Microb Infect 11(6-7): 689-697.

Zygmunt, M. S., G. Dubray., D. R. Bundle., and M. P. Perry (1988). Purified native

haptens of Brucella abortus B19 and B. melitensis 16M reveal the

lipopolysaccharide origin of the antigens. Ann Inst Pasteur Microbiol 139(4):

421-433.

Zygmunt, M. S., J. M. Blasco., J. J. Letesson., A. Cloeckaert., and I. Moriyon (2009).

DNA polymorphism analysis of Brucella lipopolysaccharides genes reveals

marked differences in O-polysaccharide biosynthetic genes between smooth

and rough Brucella species and novel species-specific markers. BMC

Microbiol 9(2009): 92-105.

Annexure

137

Annexure

Annex 01

Tryptic Soy Broth (TSB)

Dissolve the following in one liter H2O:

17.0 g pancreatic digest of casein

3.0 g Bacto Soytone (Difco)

5.0 g NaCl

2.5 g K2HPO4

2.5 g glucose

Aliquot into bottles that can withstand autoclaving. Autoclave for 20 min to sterilize.

Store up to one month at 4ºC.

It is easier and relatively inexpensive to order powdered TSA from a commercial

supplier such as Difco or Oxoid.

Annex 02

Tryptic soy agar (TSA)

Dissolve the following in a two liter Erlenmeyer flask containing one liter H2O:

15 g pancreatic digest of casein

5 g Bacto Soytone (Difco)

5 g NaCl

15 g agar

Leave the stir bar in the flask and autoclave 20 min at 121ºC to sterilize. Prepare and

preincubate the plates as described above for PIA (see recipe). Store up to one month

at 4ºC.

TSA is widely used in microbiology, and it may prove more economical to purchase

the powdered prepared TSA from Difco or Oxoid than to prepare this medium from

scratch.

Annexure

138

Annex 03

Crystal violet stock solution

Dissolve 0.8 g ammonium oxalate in 90 mL water. Dissolve 2 g crystal violet in

20 mL absolute ethanol. Add the ammonium oxalate solution to the crystal violet

solution and pass through a sterile filter. Store indefinitely at room temperature.

Annex 04

Urea agar

Components g/liter

Gelatine peptone 1.0

D – glucose 1.0

Potassium dihydrogen phosphate 2.0

Sodium chloride 5.0

Phenol red 0.012

Agar 12.0

Final pH 6.8 and stored below 8ºC.

Annex 05

Extraction buffer

0.05 M Tris HCl, 1% NaCl, 2% (wt/vol) phenol. Ph= 7.2.

Annex 06

Extraction Mixture

Liquid Phenol Chloroform: Petroleum ether (b.p 40-60ºC) (in volume ratio

of) 2 : 5 : 8

Liquid phenol is made by adding 90 g dry phenol in 11 mL D.W.

This mixture is monophasic system if dry phenol is used and if water in phenol the

mixture will be cloudy that can be clear by adding solid phenol

Annexure

139

Annex 07

Resolving Gel Buffer

Tris base 36.3g adjust to Ph 8.8 with HCl

D. W. up to 200 mL

Annex 08

Stacking Gel Buffer

Tris base 3.0 g adjust pH 6.8 with HCl

D.W. up to 50 mL

Annex 09

Laemmli-Sample Buffer

Sample buffer was made by mixing 50 µL of 2-mercaptoethanol and 950 µL of

Laemmli sample buffer. This is stock sample buffer.

Annex 10

Resolving gel

Resolving gel was prepared in a necked flask by adding 15% resolving gel solution

(2.4g urea, 1.25 ml resolving gel buffer, 5ml 30% acrylamide solution, and 2 ml of

distilled water). 2- The solution was de-gassed using a lypholizer’s vacuum and then

15µl of 10% ammonium persulfate (APS) and 5 µl of TEMED was added.

Annex 11

Stacking gel

Stacking gel solution 4.9% (1.25 mL of stacking gel buffer, 0.8 mL of 30%

acrylamide solution, and 2.9 mL of distilled water) was prepared and degassed in a

necked flask. 50 µL of APS solution and 5µL TEMED were added subsequently in

this mixture.

Annex 12

Tank Buffer (0.025M Tris pH 8.3, 0.192 m Glycine, 0.1% SDS)

Tris base 12 g

Glycine 57.6 g

SDS 10% 40 m solution

Annexure

140

D.W up to 4 liters

Because the pH of this solution need not be checked, it can be made up directly in

large reagent bottles marked at 4.0 liters. 12-16 liters can be made at a time.

Annx 13:

Gel fixation solution.

10% glacial acetic acid, 2.5% glycerol, 40% methanol and 47.5% distilled water were

mixed properly in a glass container.

Annex 14

Sodium Periodate

To make 32 mM sodium periodate dissolve 0.0342 g sodium periodate was dissolved

in 5 mL of distilled water. While to make 64 mM sodium periodate 0.0684 mM

sodium periodate was dissolved in 5 mL distilled water.

Annex 15

136 mM Purpald Reagent

Purpald reagent was prepared in 2N NaOH. To make 2N NaOH solution, 0.8 mL of

50% NaOH was mixed with 4.2 mL of distilled water. Dissolve 0.0994 g purpald

reagent in 2N NaOH.

Annex 16

Lymphocyte separating media (LSM)

LSM (Cat # 50494, MP Biochemicals, LSM is a sterile filtered solution which

contains 6.2 g Ficoll and 9.4 g sodium diatrizoate per 100 mL. The density is

1.07700.1-1.0800 g/mL at 20oC ).

Annex 17

Composition of One Liter ACK Lysis Buffer

NH4Cl 8.024 mg/mL

KHCO3 1.001 mg/mL

EDTA. Na2.2H2O 3.722 mg/mL

Annexure

141

Annex 18

Flow buffer

10 mL of 10% sodium azide

10 mL of FBS from Invitrogen

480 mL of 1X PBS.

The total volume of flow buffer was 500 mL.

Annex 19

Anticoagulant citrate dextrose (ACD) solution for blood collection:

Trisodium citrate 22.0 g

Citric acid 8.0 g

Dextrose 24.5 g

Water 1000 mL

Volume/ 50 mL blood 7.5 mL

Initial pH 5.0

The ACD solution is prepared and filter sterilized. Blood (50 mL) is collected in 7.5

mL sterile ACD and kept at room temperature (for less than 4 hours) until purification

procedures commence.

Annex 20

Percoll stock suspension

8 mL of sodium chloride (NaCl) with sodium phosphate (NaH2PO4) and 92 mL

sterile percoll (Pharmacia LKB). The resultant solution should have a specific gravity

of about 1.1245 g/cm, osmolality of 290 mOsm/kg H2O and a pH of about 7.45 at

25ºC.

Annexure

142

Annex 21

5 % BSA:

5 g crystallized bovine serum albumin/100 mL sterile distilled water.

Filter sterilized. (RI approx= 1.345)

Annex 22

13mM Trisodium Citrate:

It is 13 mM trisodium citrate in sterile distilled water and filter sterilized. That

is 38.23 g/liter, but usually make 500 mL so:

19.11 g trisodium citrate.

500 mL Gibco water

(RI approx= 1.3388)

1.5 M NaCl with NaH2PO4:

8.77 g NaCl

1.20 g NaH2PO4

Qs to 100 mL with Gibco water and filter sterilize.

Annex 23

One liter working percoll

1000X= mL of PBS

1000 (0.8 –X)= mL of 5% BSA

100= mL of 130 mM Citrate

1X PBS was used with no citrate for the adjustment.

Working percoll solution of specific gravity 1.0770 (RI= 1.3460) had a pH of

7.2- 7.4 and osmolality of 290 – 295 /kg H2O, which was stored at 4ºC.

Annex 24

PBS- Citrate:

(use baked cylinders)

200 mL 10X stock PBS

7.44 g trisodium citrate

Annexure

143

Qs to 2000 mL with Gibco water and adjust pH to 7.4

Final pH 7.39 Osm 315 (should be 285-305)

Refractive index should be about 1.3349

Annex 25

Complete RPMI

Bottle of RPMI (about 500 mL)

5.5 mL of L glutamine

5.5 mL of MEM nonessential aminoacids

5.5 mL of sodium pyruvate

12 mL of 7.5% sodium bicarbonate (7.5 g/ 100 mL)

Filter sterilize

Annex 26

DMEM

D-glucose 4500 mg/mL

Sodium Pyruvate 110 mg/mL

No L-glutamine

Annex 27

1% Agarose gel

To make 1% agarose gel, dissolve one gram of agarose in 100 mL of distilled water.

It ias heated at low temperature for five minutes to dissolve the agarose particles

properly.

Annex 28

0.1 M Phosphate citrate Buffer

To prepare 0.1M phosphate citrate buffer mix 0.1M sodium citrate 294.12g/litre

(MW: 294.120) with 0.1M citric acid 21.01g/litre (MW: 210.14).

Annexure

144

Annex 29

0.1% NBT solution

Dissolve 0.1g NBT in 100 mL 0.15M NaCl. To make 0.1M NaCl dissolve 0.0877g

NaCl in 100 mL distilled water.

Annex 30

0.1N HCl

We usually use 36-38% HCl as stock. 36% HCl shows a density of 1.19g/ml. Hence

1000 mL weights 1190 g or contains 0.38 x 1190= 452.2 g HCl (12.39 moles/liter).

As we know, the equation M1V1=M2V2

0.1x1000/12.39= 8.1 mL (for 36% HCl).

=V1= 8.6 mL.

Hence, to make, 0.1N HCl, take 8.6 mL HCl and take the volume up to one liter by

adding distilled water

Annex 31 Griess reagent

One part 0.1% naphthylethylenediamine dihydrochloride and one part 1%

sulfanilamide contained in 5% phosphoric acid)

Annex 32

Coating Buffer

Composition of Coating Buffer

8.4 g NAHCO3

3.56 g Na2CO3

Add ddH2O up to one liter and adjust pH at 9.5

Annex 33

PBS/Tween 20 0.5% Tween-20 in PBS

Put 0.5 mL Tween 20 in 99.5 mL PBS.

Filter Sterilize.

Annexure

145

Annex 34

Blocking Solution 10% fetal bovine serum or 1% BSAin PBS. Filter before use to remove particulates.

Annex 35

DNA Lysis buffer 25 μL of proteinase K (20 mg/mL)

Annex 36 Reaction mixture for PCR The PCR reaction was performed in a 50 μL reaction mixture with following

composition:

10X Taq Polymerase buffer 5 µL, 50 mM MgCl2 5 µL, 2mM DNTPs 5 µL, 100 pm

Forward primer 2 µL, 100 pm Reverse primer 2 µL, 0.2-0.5 µg/µl DNA 4 µL,

Autoclaved deionized dH2O 27 µL.

Annex 37

1X TAE buffer

Tris base 242 g/L

Glacial Acetic Acid 57.1 mL/L

0.5M EDTA 100 mL/L

The pH of solution was adjusted up to 8.0 and stored at 4C

Annex 38

6X Gel Loading Dye

Bromophenol blue 0.25%

Xylene Cyanol FF 0.25%

Sucrose 40.0% (w/v)

Documents

EFFECT OF SMOOTH AND ROUGH STRAIN BRUCELLA ABORTUS …