12
ng of riboswitches during RNA transcri Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins Evolution of terminator sequences with Ben Sauerwine (Carnegie Mellon, Physics)

Folding of riboswitches during RNA transcription Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins

  • View
    215

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Folding of riboswitches during RNA transcription Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins

Folding of riboswitches during RNA transcription

•Background information

•What are riboswitches?

•Folding of riboswitch terminatorsEfficient folding of hairpins

Evolution of terminator sequences

withBen Sauerwine (Carnegie Mellon, Physics)

Page 2: Folding of riboswitches during RNA transcription Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins

“Central Dogma” of Molecular Biology

DNA

RNA

5´ untranslated untranslated 3´Coding Region

Transcription

Translation

Transcriptionstart

Transcriptionstop

... ...

Protein

(RNA World hypothesis)

Page 3: Folding of riboswitches during RNA transcription Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins

messenger RNA structure

Primary structure (sequence):UUACAAUAUAAUAGGAACACUCAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUGGGUGAGCAAUGGAACCGCACGUGUACGGUUUUUUGUGAUAUCAGCAUUGCUUGCUCUUUAUUUGAGCGGGCAAUGCUUUUUUUAUUCUCAUAACGGAGGUAGACAGGAUGGAAGCACUGAAACGGAAAAUAGAGGAAGAAGGCGUCGUAUUAUCUGAUCAGGUAUUGAAAGUGGAUUCUUUUUUGAAUCACCAAAUUGAUCCGCUGCUUAUGCAGAGAAUUGGUGAUGAAUUUGCGUCUAGGUUUGCAAAAGACGGUAUUACCAAAAUUGUGACAAUCGAAUCAUCAGGUAUCGCUCCCGCUGUAAUGACGGGCUUGAAGCUGGGUGUGCCAGUUGUCUUCGCGAGAAAGCAUAAAUCGUUAACACUCACCGACAACUUGCUGACAGCGUCUGUUUAUUCCUUUACGAAGCAAACAGAAAGCCAAAUCGCAGUGUCUGGGACCCACCUGUCGGAUCAGGAUCAUGUGCUGAUUAUCGAUGAUUUUUUGGCAAAUGGACAGGCAGCGCACGGGCUUGUGUCGAUUGUGAAGCAAGCGGGAGCUUCUAUUGCGGGAAUCGGCAUUGUUAUUGAAAAGUCAUUUCAGCCGGGAAGAGAUGAACUUGUAAAACUGGGCUACCGAGUGGAAUCUUUGGCAAGAAUUCAGUCUUUAGAAGAAGGAAAAGUGUCCUUCGUACAGGAGGUUCAUUCAUGA

(Bacillus Subtilis XPT gene)

• Folded secondary structure

• Complementary base pairing

• Can this really matter ?!?

Page 4: Folding of riboswitches during RNA transcription Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins

Representations of Secondary Structure

....((((((((.....(((((.......)))))..........((((((.......))))))..))))))))....

Tertiary Structure(XPT “Aptamer”)

AUC=G(GU)

3´5´

5´ 3´

Page 5: Folding of riboswitches during RNA transcription Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins

Riboswitch folding during transcription

Terminatorstem

Aptamerstem

Guanine stabilizes aptamerTerminator stalls transcription“XPT switched off”

G Guanine absentAntiterminator prevents termination“XPT switched on”

GG

Anti-terminator

“Gene Regulation by Riboswitches”Mandal & Breaker Nature Reviews (2004)

5´5´

Page 6: Folding of riboswitches during RNA transcription Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins

Work in progress

1. Antiterminator lifetime

First passage time for escape from metastable state (Ben Sauerwine, short talk)

2. Natural selection of terminator sequences

Evidence that terminators are selected for reliable folding (This talk)

Both simulated by Kinfold (Vienna RNA)

Page 7: Folding of riboswitches during RNA transcription Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins

Sequence length 43 nt Transcription rate 50 nt/second

XPT Terminator Folding Success Rate

Page 8: Folding of riboswitches during RNA transcription Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins

RealSequenceG=23.0 kCal/mol

Typical ShuffledSequenceG=23.8 kCal/mol

Atypical ShuffledSequenceG=25.0 kCal/mol

Real and Shuffled Sequences

Page 9: Folding of riboswitches during RNA transcription Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins

MetastableG=7.9 kCal/mol

StableG=25.0 kCal/mol

MetastableG=3.4 kCal/mol

Atypical shuffled sequence - Alternate folds

Page 10: Folding of riboswitches during RNA transcription Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins

Terminator Folding Success Rates

Bacillus Subtilis whole genome

Page 11: Folding of riboswitches during RNA transcription Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins

How does it work?

1. Placement of specifically-binding nucleotides (e.g. C) promiscuously-binding nucleotides (e.g. G)

2. Poorly-folding sequences removed from population (?)

Page 12: Folding of riboswitches during RNA transcription Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins

Conclusions

• RNA secondary structure does matterSelf-regulation (riboswitches, microRNA, ...)

• Operation of riboswitch successfully modeled with Kinfold (Vienna RNA)

Aptamer/Antiterminator/Terminator competition

• Evidence for natural selection of reliably folding sequences

Probability of no selection P ~ 0.01