PhD thesis

Patrick Reijnst

Functional analysis of Candida albicans genes

encoding SH3-domain containing proteins

Carlsberg Laboratory

and

Department of Biology, University of Copenhagen

i

PREFACE

This thesis ”Functional analysis of Candida albicans genes encoding SH3-domain

containing proteins” presents the results of my Ph. D. project carried out at the

Carlsberg Laboratory under the supervision of Professor Dr. Jürgen Wendland, and

Professor Dr. Steen Holmberg at the Department of Biology, University of

Copenhagen.

Part I

This is a general introduction to the fungal human pathogen Candida albicans, the

endocytosis machinery in Saccharomyces cerevisiae and the known function of the

homologs, in other fungal species, to the genes described in this work. It covers the

literature of the function of several genes coding for SH3 domains from several

organisms.

Part II

This describes the main objective of the Ph. D. project.

Part III

This describes a summary of the results of the Ph. D. project.

Part IV

This is a paper describing the functional analysis of nine genes that code for SH3

domain proteins in C. albicans.

Reijnst, P. Walther, A. and Wendland, J. (2010). Functional analysis of Candida

albicans genes encoding SH3-domain containing proteins. FEMS Yeast Res 10:452-

461.

ii

Part V

This is a paper describing the functional analysis of the genes CYK3, NBP2 and

SLA1 C. albicans.

Reijnst, P. Jorde, S. and Wendland, J. (2010). Candida albicans SH3-domain proteins

involved in hyphal growth, cytokinesis, and vacuolar morphology. Curr Genet 56:309-

319.

Part VI

This is a paper describing the functional analysis of Vrp1 in C. albicans and its

interaction with other genes involved in endocytosis.

Borth, N., Walther, A., Reijnst, P., Jorde, S., Schaub, Y. and Wendland, J. (2010)

Candida albicans Vrp1 is required for polarized morphogenesis and interacts with

Wal1 and Myo5. Microbiology, in press.

Part VII

This is a paper describing the functional analysis of PIL1 and LSP1 in C. albicans

and their localization in comparison to several markers for endocytosis.

Reijnst, P. Walther, A. and Wendland, J. (2010). Actin dependent endocytosis is not

linked to eisosomes. Manuscript, submitted.

Part VIII

This is a final discussion of my work and some comments for future experiments

involving eisosomes.

iii

ACKNOWLEDGEMENTS

This is a list of persons to whom I wish to thank for their help during my Ph.D.

work and during the preparation of this thesis. My warm thanks to:

Jürgen Wendland for giving me the opportunity to work in his lab and for all the

help and support during my stay.

Andrea for helping me in any problems in my practical work, teaching me how to

use the microscope, and always being available for all my questions.

Sidsel for preparing media, plates, buffers, etc. which greatly helped me in my

work, and for some short but valuable lessons in Danish.

Elsebeth, Annette, Bo and Inge for your help in all sorts of issues, both

administrative and personal.

Steen for consultation, advice and helping me fulfill the requirements needed for a

degree.

Jure for letting me teach his students, which was a valuable lesson, and for taking

the time to help me with any issues that I had.

Judita and Uffe for many nice discussions and advice, whether it was on the train,

in the corridor or in the bus during my very first day.

Alex and Janine for introducing me to the lab and for your good advice. You left

pretty soon but we had some great times going out and during our movie nights.

Sia for creating a nice atmosphere in the office and the group. We often fought to

use the microscope but also helped each other during most of our Ph.D. work.

All Ph.D. students, Post Docs and PIs in the Penelope consortium for making

every workshop and meeting interesting and truly enjoyable.

All the people at Carlsberg research center whom I have not mention. You have

all made it a wonderful place to work in.

And last but not least Anke. I have truly enjoyed spending all this time with you

and it’s no understatement that you made my days. Your kindness and knowledge are

inspiring and I wish you the best for the future.

iv

TABLE OF CONTENTS

PREFACE i

ACKNOWLEDGEMENTS iii

TABLE OF CONTENTS iv

ABBREVIATIONS vi

ENGLISH SUMMARY vii

DANISH SUMMARY ix

PART I – A GENERAL INTRODUCTION 1

The fungal kingdom 1

The Candida species 1

Candida albicans 2

Morphogenesis in Candida albicans 2

Genetics of Candida albicans 3

The actin cytoskeleton in fungi 5

Endocytosis 7

Model for actin-mediated endocytosis in Saccharomyces cerevisiae 7

The Src homology 3 domain (SH3 domain) 9

Orthologs of the analyzed genes coding for SH3 domains 12

Proteins involved in polarity 12

Proteins involved in endocytosis 13

Proteins involved in cell wall or plasma membrane 13

Proteins with miscellaneous functions 14

Eisosomes in Saccharomyces cerevisiae 14

v

PART II – MAIN OBJECTIVE OF THE Ph.D. PROJECT 16

PART III – RESULTS 18

PART IV – Functional analysis of Candida albicans genes encoding

SH3-domain containing proteins 22

PART V – Candida albicans SH3-domain proteins involved in hyphal

growth, cytokinesis, and vacuolar morphology 23

PART VI – Candida albicans Vrp1 is required for filamentous growth

and interacts with Sla2 24

PART VII – Actin dependent endocytosis is not linked to eisosomes 45

PART VIII – FINAL DISCUSSION 59

Sla1 and Rvs167 in C. albicans are involved in actin patch morphogenesis 59

Boi2 and Nbp2 in C. albicans are required for vacuolar fusion 60

CaCYK3 is an essential gene required for cytokinesis 62

Eisosomes are not required for actin dependent endocytosis 62

Summary 64

PART IX – REFERENCE LIST 65

vi

ABBREVIATIONS

A. gossypii Ashbya gossypii

BAR domain Bin-Amphiphysin-Rvs

bp Basepairs

C. albicans Candida albicans

CSM Complete supplement medium

E. coli Escherichia coli

GFP Green Fluorescent Protein

HOG High osmolarity glycerol

Lat-A Latrunculin-A

ORF Open Reading Frame

PCR Polymerase Chain Reaction

MT Microtubule

MAP kinase Mitogen-activated protein kinase

RFP Red Fluorescent Protein

S. cerevisiae Saccharomyces cerevisiae

SD Synthetic defined

SH3 domain The Src homology 3

Sp Species

S. pombe Schizosaccharomyces pombe

yEmCherry yeast enhanced monomeric Cherry (RFP)

YPD Yeast Peptone Dextrose

YPM Yeast Peptone Maltose

vii

ENGLISH SUMMARY

Actin dependent endocytosis in fungi is an essential and well studied process

where a set of 20-30 highly conserved proteins coordinate rapid remodeling of the

plasma membrane to internalize extra-cellular material. Studies in Saccharomyces

cerevisiae have shown that many of the proteins involved in endocytosis bear SH3

domains. The human genome codes roughly 300 SH3 domains while fungal genomes

generally code between 25-30 domains. The role of SH3 domains is not fully

understood but they are thought to function as protein-protein interaction domains.

The dimorphic fungus Candida albicans is a model organism and one of the major

fungal human pathogens with increasing occurrence in immune-compromised patients.

An important virulence factor of C. albicans is the ability to switch between different

growth forms, which in turn is affected by endocytosis, membrane traffic and transport

of vesicles. Thus, the involvement of SH3 domains in endocytosis plays a potentially

important role in the virulence of C. albicans. Endocytosis in S. cerevisiae may occur

at distinct locations marked by a protein complex termed eisosomes, rather than

appearing at random locations. Eisosomes have so far only been described in

S. cerevisiae. Due to its dimorphic nature, the involvement of eisosomes in

endocytosis makes them an attractive target to study in C. albicans. The aim of this

project was to elucidate the role of 12 previously uncharacterized genes coding SH3-

domain proteins in C. albicans and to expand the knowledge of eisosomes from

S. cerevisiae to investigate their role in C. albicans, especially during filamentous

growth.

Deletion of both alleles of BBC1, BUD14, FUS1, HSE1, PIN3, RVS167-2, and

SHO1 in the diploid C. albicans reference strain did not affect the morphogenesis and

the strains behaved wild type-like during all growth conditions. Overexpression of the

SH3 domains from the corresponding genes did also not result in altered cell

morphologies.

Deletion of CYK3 was not possible, suggesting it is an essential gene. Promoter

shut-down experiments using a strain with CYK3 regulated by the inducible MET3

promoter showed severe cytokinesis defects and abnormal chitin localization when

viii

grown under repressive conditions. This is supported by the localization of Cyk3 at the

mother-bud neck during cell division.

Deletion of SLA1 and RVS167 resulted in an altered actin cytoskeleton

comparable with deletion mutants of the corresponding orthologs in S. cerevisiae. The

sla1 and rvs167 null mutants exhibit slower filamentous growth which is thought to be

a result of endocytosis defects. The three SH3 domains in Sla1 were found to be

essential for the function of the protein, especially SH3 domain #1 and #2. This is

different from S. cerevisiae where it is instead SH3 domain #3 that is important for

Sla1 function.

Deletion of BOI2 and NBP2 resulted in failure to fuse vesicles and forming a large

vacuole during filamentous growth. This is a novel function that has not been

described in other fungi. The filamentous growth of nbp2 mutants was affected but

boi2 mutants have a wild type phenotype despite lacking a large vacuole. This

indicates that fragmented vacuoles per se are not sufficient to abolish or even affect

hyphal growth.

Two major components of eisosomes are Pil1 and Lsp1. The C. albicans

homologs of these genes were tagged with different fluorescent proteins and

localization studies showed complete colocalization of these two proteins but

surprisingly showed no co-localization with several endocytosis markers. Thus,

contradictory to what has previously been described in S. cerevisiae, eisosomes may

not represent sites of actin-mediated endocytosis. Deletion of PIL1 could not be

achieved which suggests that PIL1 is an essential gene. This opens a new view on

eisosomes whose cellular function therefore needs to be investigated in more detail.

The results of the work presented in this Ph. D. thesis contribute to the general

understanding of how endocytosis is regulated in C. albicans, specifically with regard

to the effect of SH3 domains and eisosomes. The yeast-hyphal switch in C. albicans is

a major factor in its pathogenicity and this work describes several new factors

involved in this process.

ix

DANISH SUMMARY

Actin afhængig endocytose i svampe er en vigtig og grundigt studeret proces,

hvor et sæt på 20-30 stærkt konserverede proteiner koordinerer en hurtig omformering

af plasmamembranen for at internalisere ekstra-cellet materiale. Studier af

Saccharomyces cerevisiae har vist, at mange af de proteiner, som indgår i endocytose,

bærer SH3 domæner. Det menneskelige genom koder for rundt regnet 300 SH3

domæner, mens svampe-genomer generelt koder for mellem 25-30 domæner. SH3

domænens rolle er ikke fuldt klarlagt, men de menes at fungere som protein-protein

interaktion domæner. Den dimorfe svamp Candida albicans er en model organisme og

en af de største patogene human svampe med stigende forekomst hos immun-

kompromitterede patienter. En vigtig virulensfaktor hos C. albicans er evnen til at

skifte mellem forskellige vækstformer, som igen er påvirket af endocytose, membran

trafik og transport af vesikler. Tilstedeværelse af SH3 domæner i endocytose spiller

således en potentiel vigtig rolle i C. albicans virulens. Endocytose i S. cerevisiae kan

forekomme forskellige steder markeret af et proteinkompleks kaldet eisosomer,

snarere end at opstå tilfældige steder. Eisosomer har hidtil kun været beskrevet i

S. cerevisiae. På grund af deres dimorfe karakter, gør tilstedeværelsen af eisosomer i

endocytose dem til et attraktivt emne at studere i C. albicans. Formålet med dette

projekt var at belyse, hvilken rolle 12 ikke tidligere karakteriserede gener, der koder

for SH3-domæne proteiner i C. albicans, spiller samt at udvide kendskabet til

eisosomer fra S. cerevisiae og undersøge deres rolle i C. albicans, især i den

trådformede vækst.

Fjernelse af begge alleler af BBC1, BUD14, FUS1, HSE1, PIN3, RVS167-2 og

SHO1 i diploide C. albicans reference stammer påvirkede ikke morfogenesen, og

stammerne opførte sig vildtype-lignende under alle vækstbetingelser. Overekspression

af SH3 domænerne fra de tilsvarende gener resulterede heller ikke i ændret celle

morfologi.

Fjernelse af CYK3 var ikke mulig, hvilket tyder på, at det er et fundamentalt gen.

Promotor shut-down eksperimenter ved hjælp af en stamme med CYK3, som reguleres

af den inducerbare MET3 promotor, viste alvorlige cytokinese defekter og unormal

kitin lokalisering, når den dyrkes under repressive forhold. Dette underbygges af

x

lokaliseringen af Cyk3 på mother-bud neck ved celledeling. Fjernelse af SLA1 og

RVS167 resulterede i et ændret aktin cytoskelet sammenlignet med fjernelse af

mutanter af de tilsvarende orthologer i S. cerevisiae. Sla1 og rvs167 null mutanterne

udviser langsommere trådformet vækst, hvilket menes at være resultatet af endocytose

defekter. De tre SH3 domæner i Sla1 fandtes at være af afgørende betydning for

proteinets funktion, især SH3 domæne # 1 og # 2. Dette adskiller sig fra S. cerevisiae,

hvor det i stedet er SH3 domænet # 3, der er vigtig for Sla1 funktionen.

Fjernelse af BOI2 og NBP2 resulterede i manglende sammensmeltning af vesikler

og dannelse af en stor vakuole under trådformet vækst. Dette er en ny funktion, der

ikke er beskrevet i andre svampe. Den trådformede vækst af nbp2 mutanter blev

berørt, men boi2 mutanter har en vildtype fænotype trods manglen på en stor vakuole.

Dette indikerer, at fragmenterede vakuoler i sig selv ikke er tilstrækkelige til at

afskaffe eller endda påvirke svampetrådenes vækst.

To vigtige komponenter i eisosomer er Pil1 og Lsp1. C. albicans homologer af

disse gener blev mærket med forskellige fluorescerende proteiner, og undersøgelser af

lokalisering viste en komplet co-lokalisering af disse to proteiner, men viste

overraskende ingen co-lokalisering med flere endocytose markører. Dette er således i

modstrid med, hvad der tidligere har været beskrevet i S. cerevisiae, og eisosomer kan

ikke repræsentere lokaliteter af aktin-medieret endocytose. Fjernelse af PIL1 kunne

ikke udføres, hvilket tyder på, at PIL1 er et fundamentalt gen. Dette åbner et nyt syn

på eisosomer, hvis cellefunktion derfor skal undersøges nærmere.

Resultaterne af arbejdet, som præsenteres i denne Ph.D.-afhandling bidrager til

den generelle forståelse af, hvordan endocytose er reguleret i C. albicans, specielt med

hensyn til effekten af SH3 domæner og eisosomer. Gærsvampetrådenes skift i

C. albicans er en vigtig faktor i patogenicitet, og dette arbejde beskriver en række nye

faktorer, der er indgår i denne proces.

1

PART I - A GENERAL INTRODUCTION

The fungal kingdom

The fungi constitute a highly diverse and successful group of organisms that

include well-known species such as yeasts, molds and mushrooms, and are classified

as a biological kingdom of eukaryotic organisms distinct from animals and plants.

Most fungi are unnoticed because of their small size and growth in soil, where they

play an essential part in decomposing organic material. But there are some fungi that

have made a great impact in human history; yeasts (Saccharomyces sp.) that are used

worldwide in the production of alcoholic beverages and in baking, fungi (e.g.

Penicillium sp., Acremonium sp. and Aspergillus sp.) that are used to produce

antibiotics and enzymes, and some fungi (e.g. Candida sp., Fusarium sp. and Ustilago

sp.) that may cause disease to humans and to crops, the latter with potentially great

economic impacts. Regardless of their classification, fungi proliferate mainly by two

distinct forms; filamentous growth and yeast growth. Filamentous fungi grow as

tubular elongated cells called hyphae. Yeast-like fungi on the other hand grow as

single cells, where new cells separate or bud from the mother cell. Most fungi are

limited to one of these forms of growth, but some fungi are able to switch between

yeast- and filamentous growth - these fungi are termed dimorphic.

The Candida species

The genus Candida belongs to the phylum Ascomycota and contains about 150

species. The best known and most important one by far is Candida albicans, but other

clinically important species include C. glabrata, C. dublienensis, C. parapsilosis and

C. krusei. Many Candida species occur as commensals on the skin, gastro-intestinal

tract and genitor-urinary tract. However, some Candida species have the potential to

cause disease in humans and the increase of immunocompromised patients during the

last decades has seen a raise in infections caused by Candida, again most notably

C. albicans.

2

Candida albicans

C. albicans is the most common fungal pathogen in humans, able to cause various

infections (Candidiasis) that may be severe enough to kill the host if the infection is

systemic. Two important factors that affect the pathogenicity of C. albicans are the

ability to switch between yeast growth and filamentous growth, i.e. the hyphal switch,

and the ability to form biofilms which enables C. albicans to adhere to the surface of

substrates. In biofilms cells show an increased resistance to the immune system and to

antifungal drugs (Naglik et al., 2003; Whiteway and Oberholzer, 2004).

Morphogenesis in Candida albicans

Candida albicans is able to grow in at least three different morphological states:

yeast, hyphal and pseudohyphal growth, depending on its growing conditions (See

figure 1). Furthermore, C. albicans can also exist in an additional form called opaque

cells, which is its mating competent form (Sudbery et al., 2004). When grown at

30 °C, C. albicans grows as unicellular budding yeast similar to diploid

Saccharomyces cerevisiae. It exhibits dipolar budding. Phenotypic switching to hyphal

growth is usually induced by growth at 37 °C and pH ~ 7.0 with the addition of

external stimuli such as serum, N-acetylglucosamine or sugar starvation. Hyphae grow

from yeast cells by extending the apex and form septa along the hyphae to separate the

compartments. The third growth form is called pseudohyphal growth, in which cells

exhibit a variety of forms between the yeast and hyphal growth. In pseudohyphal

growth cells may elongate to such extremes that they may be hard to distinguish from

true hypha, but a crucial difference is the constriction at the site of junction.

Figure 1. Morphogenesis in Candida albicans. The panels show microscopic images of C. albicans

growing as a yeast, pseudohyphae, hyphae and opaque cells. Image of opaque cells is modified from

Srikantha et al., 2006. Scale bars represent 5 μm.

3

Most dimorphic fungi that are human pathogens grow as filamentous fungi in

their external habitat but grow as budding yeast into diseased tissues, e.g.

Cryptococcus neoformans, Histoplasma capsulatum and Blastomyces dermatitidis

(Gow et al., 2002). In contrast, the filamentous growth form of C. albicans is

important for virulence because strains without the ability to undergo hyphal switch

are avirulent (Lo et al., 1997). However, disruption of the hyphal repressors Nrg1 and

Tup1 in C. albicans leads to constitutive filamentous growth, and this results in

reduced virulence (Saville et al., 2003). It may therefore be the ability to switch

between the various growth forms that is essential for the virulence of C. albicans,

rather than a single growth form. Hyphae and pseudohyphae are able to growth

invasively in agar, and one idea suggests this would promote invasive growth into

tissues during the early infection and also colonization of all inner organs. The yeast

growth could instead be more advantageous for rapid spread in the bloodstream (Gow

et al., 2002). C. albicans is also able to form a heterogeneous architecture called

biofilm, which consists of yeast- and filamentous cells enveloped by a matrix of

polysaccharides and proteins. This structure is highly resistant to the immune system

and antifungal agents, and is usually involved in chronic infections of C. albicans

(Hawser et al., 1998).

Genetics of Candida albicans

C. albicans is an obligate diploid (Olaiya and Sogin, 1979). It was long thought

that C. albicans was an asexual fungus, but following the full sequencing of the

genome it was shown that the C. albicans genome contains a Mating Type Like (MTL)

locus MTLa/α. The heterozygous MTL locus in C. albicans contains one MTLa and

one MTLα allele (Hull and Johnson, 1999). In a heterozygous wild type strain, a1 and

α2 form a complex that suppresses the expression of the transcriptional regulator

WOR1 (Zordan et al., 2006; Huang et al., 2006; Srikantha et al., 2006). In order for

C. albicans to undergo mating, cells must complete two steps. The first requirement is

the generation of a homozygous MTLa or MTLα strain (Hull et al., 2000; Magee and

Magee, 2000). This leads to the expression of WOR1 which is the “master regulator“

of the white-opaque phenotype switching. This is necessary because opaque cells are

the mating competent form in C. albicans and are able to mate with a frequency of 106

higher compared to white cells (Miller and Johnson, 2002; Lockhart et al., 2002).

4

Figure 2. A model for the genetic regulation of the white-opaque switch in C. albicans. a1 and α2 form

a complex that inhibit expression of WOR1, the master regulator of white-opaque switching. Red likes

represent the control of Wor1 on each gene. Blue lines represent relationships. Yellow and white boxes

represent gene products enriched in opaque- and white cells, respectively (Zordan et al., 2007).

The parasexual life cycle in C. albicans shares many features with the sexual life

cycle in S. cerevisiae. Opaque cells of different mating type form shmoos and fuse,

thus producing a tetraploid daughter cell (Tzung et al., 2001). While S. cerevisiae

thereafter undergoes meiosis and spore formation, C. albicans differs in that meiosis –

if it occurs at all – has not yet been demonstrated. Instead, tetraploid daughter cells

return to a diploid state by chromosome loss (Forche et al., 2008).

The genetic analysis of C. albicans is complicated by mainly two factors; the lack

of a haploid state and due to the lack of a complete sexual cycle the inability to

perform genetic crosses which is used in other fungi. Furthermore, gene function

analysis may also require more effort than in the model yeast S. cerevisiae due to the

extensive chromosome polymorphism, resulting in deletions, translocations and

amplifications of particular chromosomes in C. albicans. These chromosomal

alterations are largely due to major repeat sequences (MRS) specific for C. albicans

(Iwaguchi et al., 2004, Lephart et al., 2005, Lephart and Magee, 2006). The analysis

of a gene thus requires the subsequent deletion of both alleles as well as the

5

verification of the absence of a third copy. A common strategy for site directed

mutagenesis is to transform C. albicans with a selectable marker flanked by app.

100 bp of sequence homology to the region of interest (Gola et al., 2003). Popular

methods for gene deletion include the “URA3-blaster” (Fonzi and Irwin, 1993),

“URA3-flipper cassette” (Morschhäuser et al., 1999) and PCR based gene targeting

(Walther and Wendland, 2008). It may be important taking into account that several

Candida species including C. albicans translate the CUG codon to Serine rather than

Leucine as by most organisms (Ohama et al., 1993), so genetics tools used in other

fungi must sometimes be codon-optimized for the use in C. albicans. The two most

commonly used laboratory strains are BWP17 (Wilson et al., 1999) and SN148 (Noble

and Johnson, 2005), which are auxotrophs for the synthesis of histidine, arginine and

uracil (BWP17), and leucine, histidine, arginine and uracil (SN148). There are also

dominant markers that can be used for selection of C. albicans mutants: MPAR, a gene

coding for mycophenolic acid resistance (Wirsching et al., 2000), and SAT1, a gene

coding for resistance against nourseothricin/streptothricin (ClonNAT) (Reuss et al.,

2000). All the mutants generated in this study are derived from SN148 using only the

auxotrophic markers.

The actin cytoskeleton in fungi

Critical processes such as endocytosis, cytokinesis, cell polarity and cell

morphogenesis require the coordinated activity of 20-30 highly conserved actin

associated proteins, in addition to many cell-specific actin associated proteins and

numerous upstream signaling molecules. Cells during different stages of the cell cycle

contain three different actin structures (Figure 3): patches, cables and rings, which in

C. albicans can be visualized by staining fixed cells with e.g. Rhodamine phalloidin

(Mosley and Goode, 2006). In S. cerevisiae, actin is expressed from the single and

highly conserved essential gene ACT1 (Shortle et al., 1982).

The distribution of actin patches changes during the cell cycle. Stationary cells

contain several patches located at the cell cortex in a random distribution. When a cell

produces a bud, the majority of the patches will localize to the emerging bud - a

concentration of actin patches in an unbudded cell is a good indicator for the next site

of bud emergence.

6

(A) (B)

Figure 3. Organization of the actin cytoskeleton during different growth stages in C. albicans. (A) In

yeast cells, actin patches and cables can be seen during most growth phases while the actin ring can be

visualized only shortly before and during cytokinesis. Shown from left to right are cells with an

emerging bud, small bud, large bud and bud separation. (B) During filamentous growth, actin patches

accumulate near the tip of the hyphae. Shown from top to bottom are cells after 1h, 2h, and 3h of

growth in hyphae inducing media. All cells were chemically fixed and stained with the dye Rhodamine

phalloidin to visualize filamentous actin structures. Scale bars represent 5 μm.

The distribution of actin patches becomes more homogenous as the bud grows,

eventually containing almost all actin patches in the daughter cell. Prior to cytokinesis,

the actin patch distribution changes to both the mother and daughter cell (Kilmartin

and Adams, 1984; Adams and Pringle, 1984). During the filamentous growth of

C. albicans, actin patches also accumulate at the site of polarized growth, just before

the very tip of the hyphae (Anderson and Soll, 1986). Actin patches are also present

along the hyphae. Studies in S. cerevisiae have shown that actin patches are mediators

of endocytosis and their formation relies on nucleation by the Arp2/3 complex (Winter

et al., 1997; Evangelista et al., 2002).

Fungi use actin-mediated transport to maintain polarity and to separate organelles

during cell division (Bretscher, 2003). During yeast growth of C. albicans, cables are

assembled at the bud tip and neck to serve as polarized tracks for cargo delivery to the

site of polarized growth (Moseley and Goode, 2006). The majority of hyphae during

filamentous growth have actin fibers emanating from the hyphal tip directed to the

apex (Anderson and Soll, 1986). Actin cables are essential for filamentous growth in

C. albicans, as disruption of actin cables in hyphal cells leads to a switch to isotropic

growth (Ushinsky et al., 2002). In contrast to actin patches, actin cables in

S. cerevisiae are assembled by the formins Bni1 and Bnr1 (Evangelista et al., 2002;

Sagot et al., 2002). CaBni1 localizes to the bud tip and hyphal tip (Crampin et al.,

2005; Martin et al., 2005), while CaBnr1 localizes to the bud neck (Dünkler and

Wendland, 2007). The importance of actin cable organization is evident as a

Δbni1/Δbnr1 mutant is lethal in C. albicans (Li et al., 2005). Cables provide active

transport routs to the hyphal tip mediated by myosin, and passive transport of

7

endocytotic vesicles in a retrograde flow, i.e. from bud to mother (Huckaba et al.,

2004).

Almost all animals and fungi use an actin ring to separate the two cells after

cytokinesis (Field et al., 1999). The actin contractile ring is normally only present in a

subset of cells because they only appear very briefly before and during cytokinesis, but

they can be easily visualized by using a synchronized cell population. Cytokinesis in

S. cerevisiae is mediated by two mechanisms. First is the constriction of an actin ring,

which is promoted by Myo1, and second, the formation of a septum which is achieved

by transportation of membrane and cell wall synthesis. The relative position of the

contractile ring is important as it marks the delivery endpoint (Bi et al., 1998;

Lippincott and Li, 1998).

Endocytosis

Endocytosis is the process in which cells internalize molecules from outside the

cell by engulfing them with the cell membrane. There are several pathways for

internalization of extracellular substrates and molecules; phagocytosis,

macropinocytosis, caveolae-mediated endocytosis and clathrin-mediated endocytosis.

Phagocytosis involves the engulfment of particles such as bacteria (Dramsi and

Cossart, 1998). Macropinocytosis involves the engulfment of extracellular fluid

(Swanson and Watts, 1995). Caveolae-mediated endocytosis is not so well understood,

but it appears to be important in the internalization of cholesterol, recycling of

glycosyl-phosphatidylinositol(GPI)-anchored proteins and also uptake of viruses and

certain strains of E. coli (Razani and Lisanti, 2001). The clathrin mediated endocytosis

is a major pathway for endocytosis in animal cells, and it is clear this is also conserved

in fungi (Newpher et al., 2005).

Model for actin mediated endocytosis in Saccharomyces cerevisiae

There are two models describing the early recruiting process of the endocytotic

machinery. First is the activation of membrane receptors, possibly by kinases and

ubiquitin ligases, which then associate with the endocytotic machinery (Tan et al.,

1996; Hicke, 1999; Roth and Davis, 2000; Shih et al., 2000; Howard et al., 2002). The

second theory involves static complexes termed “eisosomes” that already contain

some of the early endocytotic machinery and continue to recruit membrane receptors

8

(Walther et al., 2006). Endocytic internalization begins with the initiation of the

endocytic site, continues with the invagination and scission of the membrane, and ends

with the release of the vesicle (Kaksonen et al., 2006). An overview of the different

steps in endocytosis is shown in figure 4.

Figure 4. Model for actin/clathrin mediated endocytosis in yeast. Endocytosis begins with a clathrin

coat at the endocytic side (blue line), followed by Las17 (yellow dot). This complex recruits Sla1, Pan1,

Sla2, and End3 (green line). Next, after recruiting Bbc1, Myo5 (blue dot) and the actin nucleation

machinery (red line), the cell surface is invaginated (slow movement) by actin polymerization. This is

visualized as an actin patch. Finally, the Amphiphysin orthologs Rvs161 and Rvs167 (brown line)

release the vesicle in a fast process (Modified from Kaksonen et al. 2005).

Through an unknown function, clathrin appears at virtually every endocytic site

before all known components of the endocytotic machinery (Kaksonen et al., 2005).

The role of clathrin however, is not essential, as clathrin mutants show only a ~50%

reduction in uptake of α factor (Chu et al., 1996; Payne et al., 1988). Las17 (Human

WASP homolog) is the earliest protein to arrive at the endocytotic site. It remains

immotile at the cell surface and is joined by Sla1, End3, Pan1 (Human Eps15

homolog) and Sla2 (Human Hip1R homolog) which appear shortly after (Kaksonen et

al., 2003).

As a next step, the actin nucleation machinery consisting of the Arp2/3 complex,

Abp1, Myo3 and Myo5 localizes to the endocytotic site. While Las17 remains

localized to the cell surface the remaining proteins move inwards together (Kaksonen

et al., 2003). This movement likely corresponds with the membrane invagination. The

9

slow motility of the protein complex is thought to be driven by actin polymerization

because filamentous actin can be detected, and also because this movement is sensitive

to latrunculin-A (Lat-A), an actin monomer-sequestering and thus actin

depolymerizing agent (Kaksonen et al., 2003; Martin et al., 2005).

Prior to actin nucleation, Bbc1 is recruited and interacts with Las17, Myo3 and

Myo5. It is thought that Bbc1 has a regulatory function in the internalization of the

membrane (Rodal et al., 2003). The increasing invagination of the membrane is

followed by additional actin filaments attaching to the growing endosome, which can

be visualized as a cortical actin patch. Rvs161 and Rvs167 (Yeast amphiphysin)

colocalize briefly with sites of endocytosis after actin polymerization. Localization

studies of Rvs161 and Rvs167 together with data on deletion mutants indicate that

these proteins are involved in the scission and release of the vesicle (Kaksonen et al.,

2005). Once released, the actin-covered vesicles become attached to actin cables by an

unknown mechanism and move passively in an actin cable retrograde flow (bud to

mother) (Moseley and Goode, 2006).

The Src homology 3 domain (SH3 domain)

The Src homology 3 (SH3) domain is a small protein domain of about 60 amino

acid residues first identified as a conserved sequence in the viral adaptor protein

p47gag-crk

and the non-catalytic part of several cytoplasmic tyrosine kinases, e.g. Lck,

Src and Abl. (Mayer et al., 1988). Src (abbreviation for sarcoma) is a family of proto-

oncogenic tyrosine kinases. Since then, it has also been identified in a great variety of

other protein families such as CDC25, Ras GTPase activating protein and PI3 Kinase

(Mayer and Baltimore, 1993). The SH3 domain has a characteristic beta-barrel fold

which consists of five or six β-strands arranged as two tightly packed anti-parallel

β sheets (figure 5). The linker regions may contain short helices (Kuriyana and

Cowburna, 1993).

10

Figure 5. Ribbon diagram of the SH3 domain, alpha spectrin, from chicken (Gallus gallus) (PDB

accession code 1BK2). SH3 domains have a characteristic fold with 5-6 β-strands that form two anti-

parallel beta sheets (β-strands blue and brown anti-parallel to β-strands yellow, green and cyan). The

function of SH3 domains is not well understood, but they are thought to mediate the assembly of

specific protein complexes by binding proline-rich peptides (Morton and Campbell 1994).

The function of SH3 domains is not well understood. The current consensus is

that SH3 domains bind to proline-rich peptides and thereby mediate the assembly of

specific protein complexes (Morton and Campbell 1994). There are roughly 300 SH3

domains encoded in the human genome (Kärkkäinen et al., 2006). The genome of

C. albicans encodes a total of 29 SH3 domains in 24 genes and the genome of

S. cerevisiae encodes a total of 28 SH3 domains dispersed in 24 genes. SH3 domains

are mostly found in 1 copy in a given protein, but there are many proteins with 2 SH3

domains, and some with 3 or 4 copies. There seems to be a limited evolution of the

SH3 domains in yeast-like ascomycetes. For example, Abp1 in S. cerevisiae contains 1

SH3 domain while Abp1 in C. albicans contains 2 SH3 domains. Yet, deletion of

CaABP1 does not affect yeast and hyphal morphogenesis (Martin et al., 2007). An

alignment of the 14 SH3 domains from the 12 genes that were functionally analyzed in

this work is shown in figure 6, and their relative position is shown in figure 7.

11

Figure 6. Alignment of all SH3 domains. The 14 SH3 domains from the 12 genes that were functionally

analyzed in this work using the MegAlign tool from DNAStar). Identical residues are shaded in black

and consensus sites are shaded in gray.

Figure 7. Position of SH3 domains. The position of the SH3 domain vary within the proteins. For

reference, the complete protein length is drawn to scale. The SH3 domains were found using the

SMART tool at (http://smart.embl.de). Note that Sla1 has several repeats at its C-terminus.

- - - - - S K A K A L Y D Y A A Q E D - - D E L S F K E G D K I Y V I E I - - - V D - D D - - WMajority

- - - - - MK V K A I F D Y K S D Y D - - E D L S F D A G T I I NI I S V - - - E N- D E - - W 35Bbc1- MD G G D T Y I C I K Q F NA R L G - - D E L S L K I G D K I Q V L A D D R E Y N- D G - - W 42Boi2- - - - - D K L Y G L Y D F S G P D P - - S HC T L L V D E P V Y L I ND - - - E D - NY - - W 35Bud14- - - - - F K V K T I V S WA G E E E - - G D L G F ME NE I V Q V F S I - - - V D - E S - - W 35Cyk3- - - E Q S L Y T V I R S Y NK S L G - - D E L NI E V G D K A V I L E K - - - HS - D G - - W 37Fus1T V A T V S K V R A L Y D L V S Y E P - - D E L S F R K G D V I T V I E S - - - V Y - R D - - W 40Hse1- - - - - C K A R A I F D F S A E ND - - NE I S L I E G Q I I WI S Y R - - - HG - Q G - - W 35Nbp2- - - - - G Y C I A T Y D Y K A Q Q A - - G D L D L S K G D K L A V V E H- - - L S - E D - - W 35Pin3- - - - - P T C T A L Y D Y T A Q A Q - - G D L T F P A G A V I E I I Q R - - - T E - D A NG W 37Rvs167- - - - - S Y C Y A L HD F A G Q E E - - L D L R F S K G D K I K I L V G - - - NG - T - - - W 34Rvs167-2- - - - - Y K A K A L Y S Y D A NP D D I NE I S F V K D E I L E V D D I - - - D G - K - - - W 36Sho1- - - - - G V Y K A L Y D Y A A Q A E - - E E L NI K Q ND L L Y L L E K - - - S D I D D - - W 36Sla1 #1- - - - - K T A T A L Y D Y D K Q T E - - E E L S F NE ND K F NV F D L - - - ND - P D - - W 35Sla1 #2- - - - - K I G R L L Y D F E V Q G D - - D E L D C K E G D E V Y I I D Q - - - K K S K D - - W 36Sla1 #3

WK G - - - - - - - - - - K L - - NG - - - - - - - - - K - - - - - I G L V P S NY V E L I -Majority

Y S G - - - - - - - - - - E Y - - D G - - - - - - - - - K - - - - - Q G MF P K NF V E E L K 56Bbc1Y - - - - - - - - - - - - - - - - MG K N- - - - L L T G E - - - - A G L Y P K T F T Q L I T 65Boi2WL I R K L T K L E R L K R MR L NG Q E F Q I D I E S D E E D G K I G F V P A E C L E T H 81Bud14WS G - - - - - - - - - - K L R R NG - - - - - - - - - A - - - - - E G I F P K D Y V T I L E 58Cyk3C K I - - - - - - - - - - R L V R MG K D Y Y NHQ L S L D - - - - I G L V P K MC L Q K I 69Fus1WR G - - - - - - - - - - S L P - S G - - - - - - - - - K - - - - - I G I F P L NY V T P I V 62Hse1L V A - - - - - - - - - E D P - I L G - - - - - - - - - E - - - - - NG L V P E E Y V E I MQ 58Nbp2WK G - - - - - - - - - Y K S - - D S S P - - - - - - E K - - - - - T G V F P S NY V K I I S 60Pin3WT G - - - - - - - - - - K Y - - NG - - - - - - - - - Q - - - - - T G V F P G NY V Q L 56Rvs167WE R - - - - - - - - - - Q L - - NG - - - - - - - - - K - - - - - I G Q F P S NY V Q L I 54Rvs167-2WQ A - - - - - - - - - R R - - A NG - - - - - - - - - Q - - - - - V G I C P S NY V K L L D 58Sho1WK V - - - - - - - - - K K R V V A T G E E - - - I V D E P - - - - S G L V P S T Y I E E A P 67Sla1 #1I L V - - - - - - - - - G D - - L A K - - - - - - - - E K - - - - - F G F V P S NY I Q L D S 58Sla1 #2WMV - - - - - - - - - E N- - I A T - - - - - - - - R R - - - - - Q G V V P S T Y I E I I S 59Sla1 #3

Pin3

Nbp2

Fus1

Rvs167-2

Sho1

Rvs167

Hse1

Bud14

Bbc1

Cyk3

Boi2

Sla1

SH3-domain

12

Orthologs of the genes coding for SH3 domains that have been

analyzed in this work.

The genome of C. albicans contains 24 genes encoding SH3-domain proteins. 12

of these genes were selected for functional analysis both as part of the participation in

the Marie Curie project “Penelope” and because most of the other genes have already

been deleted and analyzed (Table 1). The function of the protein orthologs encoded by

the 12 genes encoding SH3-domain proteins analyzed in this work vary in the cell and

are summarized in figure 8.

Figure 8. Orthologs in S. cerevisiae. SH3-domain encoding proteins mediate protein-protein interactions

and are found in processes where protein complexes are required, such as cytokinesis, endocytosis and

cell polarity. The protein orthologs in S. cerevisiae encoded by the genes analyzed in this work have

been found to play a role in cytokinesis (Cyk3), establishment of cell polarity (Boi2, Bud14 and Fus1),

endocytosis (Sla1, Bbc1 and Rvs167), cell wall or plasma membrane integrity (Sho1 and Nbp2) or have

been described to play a role in other processes such as prion formation and sorting of ubiquitinated

proteins (Hse1 and Pin3).

Proteins involved in polarity

Boi2 is involved in polar growth in S. cerevisiae and A. gossypii. Boi2 localizes to

sites of polar growth and also to the neck in S. cerevisiae and to the hyphal tip and to

13

sites of septation in A. gossypii. Deletion of BOI2 in S. cerevisiae does not cause a

change in morphology while deletion of AgBOI2 results in spherical enlargements at

the hyphal tip (Hallett et al., 2002; Knechtle et al., 2006).

Bud14 in S. cerevisiae is involved in stabilizing microtubule interactions at sites

of polarized growth. Scbud14 null mutants are sensitive to mating factor, have

increased filamentous growth and hyperelongated shmoos. ScBud14 localizes to the

presumptive bud site in unbudded cells, the distal tip in growing buds and the bud

neck in large budded cells (Ni and Snyder, 2001; Cullen and Sprague, 2002; Knaus et

al., 2005).

Fus1 in S. cerevisiae is required for cell fusion. Deletion of FUS1 in S. cerevisiae

has no effect on the vegetative growth. ScFus1 localizes to the schmoo tip (Trueheart

et al., 1987).

Proteins involved in endocytosis

Bbc1 in S. cerevisiae is thought to be involved in regulating the actin

cytoskeleton. Scbbc1 mutants are wild type-like but synthetically lethal with Scsac6

and Scsla2. ScBbc1 localizes to patch-like structures at the bud cortex and cell

division site (Mochida et al., 2002).

Rvs167 in S. cerevisiae is involved in the scission of invaginated plasma

membrane during endocytosis. Deletion of ScRVS167 leads to a delocalization of actin

patches in all cell types (Bauer et al., 1993; Kaksonen et al., 2005).

ScSLA1 is required for actin patch structure and organization. Deletion of SLA1 in

S. cerevisiae leads to few, large depolarized actin patches. Scsla1 is synthetically

lethal with Scabp1. ScSla1 localizes to the cell cortex and co-localizes with a subset of

actin patches (Holtzman et al., 1993; Ayscough et al., 1999).

Proteins involved in cell wall or plasma membrane

ScNbp2 is involved in cell wall integrity. Deletion of NBP2 in S. cerevisiae leads

to sensitivity against calcofluor white. ScNBP2 is essential for mitotic growth at high

temperatures, i.e. 37 °C. ScNbp2 localizes to the cytoplasm (Ohkuni et al., 2003).

SHO1 in S. cerevisiae codes for a transmembrane protein that is part of the HOG

pathway. Scsho1 mutants are sensitive to high osmolarity. (Maeda et al., 1995).

14

Proteins with miscellaneous functions

ScHse1 is involved in sorting ubiquitinated membrane proteins that are destined

for degradation. ScHse1 localizes to dot-like structures across the cytosol. Deletion of

HSE1 in S. cerevisiae leads to failure in localizing Ste3 to the vacuole. ScSte3 is the α-

factor receptor and is rapidly degraded in the vacuole (Bilodeau et al. 2002).

PIN3 in S. cerevisiae encodes for a protein of unknown function. Overexpression

of a sequence containing the ScPIN3 ORF induced the appearance of [PIN+] prion

(Derkatch et al., 2001).

Cyk3 in S. cerevisiae localizes to the mother-bud neck and is involved in

cytokinesis and cell separation. Deletion of CYK3 in S. cerevisiae results in a mild

cytokinesis defect, while deletion of ScCYK3 together with ScHOF1 or ScMYO1 is

lethal (Korinek et al., 2000).

Table 1. Protein comparison of the genes analysed in this work from C. albicans (Ca) and the protein

length of the corresponding genes in S. cerevisiae (Sc).

Systematic name

Gene name

Sc protein length

Ca protein length

Sequence identity* (%)

Position of the SH3 domain in the Ca protein

orf19.2791 BBC1 1157 954 25.8 1-56 orf19.3230 BOI2 1040 1172 32.5 5-65 orf19.3555 BUD14 707 801 20.8 259-340 orf19.13620 CYK3 885 1020 29.4 11-68 orf19.1156 FUS1 512 384 25.1 318-383 orf19.3233 HSE1 452 498 39 215-271 orf19.6588 NBP2 236 342 27.5 127-184 orf19.5956 PIN3 215 285 54.9 104-163 orf19.1220 RVS167 482 440 62.5 419-474 orf19.4742 RVS167-2 354 313-366 orf19.4772 SHO1 367 387 38.9 334-391 orf19.1474 SLA1 1244 1257 36.9 7-73, 76-133, 399-457

*The sequence identity was calculated using the full length proteins.

Eisosomes in Saccharomyces cerevisiae

In S. cerevisiae, sites of endocytosis may be formed randomly or initiated at

specific locations. The second theory is supported by the co-localization of static

protein complexes with protein and lipid endocytosis. These structures are termed

eisosomes (from the Greek „eis‟, meaning “in to” or portal, and „soma‟, meaning

body) and are composed mainly of the two cytoplasmic proteins, Pil1 and Lsp1

(Walther et al., 2006).

15

Pil1 and Lsp1 are very similar, sharing 78.9% identity in C. albicans and 71.6%

identity in S. cerevisiae (MegAlign, DNAStar).

Eisosomes are static protein complexes that localize with Sur7 in a dot-like

manner beneath the plasma membrane. All uptake of FM4-64 occurs at eisosomes, but

not all eisosomes are involved in uptake of FM4-64. Deletion of LSP1 in S. cerevisiae

leads to reduced uptake of FM4-64 while deletion of PIL1 leads to clustering of Lsp1,

and redirection of endocytosis to these clusters (Walther et al., 2006). Deletion of

SUR7 in S. cerevisiae leads to reduced sporulation but otherwise wild type phenotype

(Young et al., 2002) while deletion of SUR7 in C. albicans leads to depolarized actin

patches, mislocalization of septins and intracellular growth of cell wall (Alvarez et al.,

2008). Pil1 is the main regulator of eisosomes, determining their size and localization

(Moreira et al., 2009). Expression of PIL1 and SUR7 in S. cerevisiae is cell cycle

regulated while expression of LSP1 is not (Spellman et al., 1998).

Pil1 and Lsp1 are thought to be negative regulators of heat stress resistance, Pkh1

along with its downstream targets, the Pkc1 MAP kinase cascade and the Ypk1

pathway. Deleting PIL1 or LSP1 was found to increase heat stress resistance and a

pil1/lsp1 double mutant is viable (Zhang et al., 2004). Eisosomes may be involved in

regulating the plasma membrane architecture, localize cell growth and contribute to

the establishment and maintenance of cell polarity. A failure in such regulation of the

plasma membrane may be the reason to why endocytosis is redirected to eisosome

clusters (i.e. Lsp1) in pil1 mutants (Walther et al., 2006). However, overexpression of

PIL1 does not affect cell polarity despite eisosomes present at the bud tip in growing

buds (Moreira et al., 2009). There may be a connection between eisosomes and lipids.

16

PART II - MAIN OBJECTIVE OF THE Ph. D.

PROJECT

C. albicans is a dimorphic fungal human pathogen, which can cause serious and

often lethal systemic infections in immunocompromised patients. There are several

reasons to why C. albicans can cause disease, of which the yeast-to hyphal switch has

long been regarded as one of the most important. Non-filamentous C. albicans mutants

are avirulent (Lo et al., 1997). The Wiskott-Aldrich Syndrome Protein (WASP)

homolog Wal1 is required for endocytosis and biogenesis of vacuoles. Deletion of

WAL1 generates non-filamentous mutant strains that are attenuated in virulence

(Walther and Wendland, 2004; Wendland et al., 2006). This shows that polarized

hyphal growth in C. albicans is not only dependent on secretion and the polarized

delivery of vesicle to the hyphal tip but also requires endocytosis and correct

membrane traffic.

A large number of S. cerevisiae proteins involved in endocytotic processes bear

SH3-domains, which serve as protein-protein interaction domains generating a

network of proteins at specific locations, e.g. at sites of cortical actin patches (Morton

and Campbell 1994). Hence, the previous contribution in functional analyses of

C. albicans genes and the link between endocytosis and polarized hyphal growth

served as an initial basis to elucidate the function of the SH3-domain proteins in

C. albicans. How endocytosis is initiated is not known, but one theory involves the

initiation at specific static receptors termed eisosomes. Eisosomes are large immobile

complexes consisting of the two proteins Pil1 and Lsp1, and have been reported to

mark future sites of endocytosis. The exact function of the eisosomes remains unclear

however, because actin patches (early endocytosis markers) can also form at sites

independent of eisosomes (Walther et al., 2006; Moreira et al., 2009). Eisosomes may

also have a role in lipid domains as sub-compartmentalization has been shown to

occur specifically with lipid rafts (Lingwood and Simons, 2010). By adding the

knowledge gained from our analysis of the SH3-domain coding genes that are

involved in endocytosis I intend to investigate the role of eisosomes in C. albicans.

Eisosomes that have so far only been reported in S. cerevisiae, and C. albicans make

an ideal model for determining the role of eisosomes in filamentous fungi. The

17

dimorphic growth of C. albicans will help us compare the function of eisosomes

during different growth forms.

18

PART III - Results

Generation of C. albicans mutant strains

All deletion strains in this thesis were generated using PCR based gene targeting

(Walther and Wendland, 2008). First I generated a heterozygous and subsequently a

homozygous mutant strain using different marker genes (Figure 9) and the correct

deletion could be demonstrated by PCR (Figure 10). For each of the targeted genes at

least two independent homozygous mutants were generated.

Fig 9. Transformation of C. albicans with functional analysis (FA)-constructs. (A) Design of chimeric

primers S1 and S2 bearing 100 bp of homology regions and annealing sites for marker cassette

amplification. Sequential disruption using these cassettes results in a homozygous mutant strain.

Specific diagnostic PCR primers are positioned outside the homology region (G1 and G4) and within

the marker cassette (H2 and H3 for Marker 1 and U2 and U3 for Marker 2). To verify no additional

copy of the gene is present in the genome, a negative control is done using primers positioned to

amplify an internal part of the gene (I1 and I2). (B) Image of an ethidium bromide-stained gel showing

the result of a diagnostic PCR of a homozygous mutant strain, as described in (A). Lane C: An internal

19

fragment of the gene from a wild type strain. Lane I: An internal fragment of the gene from the deletion

strain, no band ensures that the gene of interest has been deleted. Lanes 5’ and 3’: The 5’ and 3’ flanks

of the marker cassettes that has been integrated at a defined location. The well defined bands in the

ladder are of the size 5000 bp (top band), 1500 bp (middle band) and 500 bp (bottom band).

A

B

C

Figure 10. Verification of all deletion mutants in this thesis. Lane C: Internal band of the corresponding

gene in a wild type strain. Lane I: An internal fragment of the gene from the deletion strain, no band

ensures that the gene of interest has been deleted. Lanes 5’ and 3’: The 5’ and 3’ flanks of the marker

cassettes that have been integrated at the location of the target ORF. The white arrow points to a well

defined band representing 500 bp. (A) Images of ethidium bromide-stained gels showing the result of a

diagnostic PCR of all homozygous deletion mutants in PART IV. (B) Images of ethidium bromide-

stained gels showing the result of a diagnostic PCR of all homozygous deletion mutants in PART V. (C)

Images of an ethidium bromide-stained gel showing the result of a diagnostic PCR of the lsp1

homozygous deletion mutant in PART VII.

20

Functional analysis of the mutant strains

The generated mutant strains were characterized to reveal growth defects under

standard growth conditions, their ability to undergo hyphal switch, actin cytoskeleton

organization and vacuolar morphology (See Part IV, Part V and Part VII). The results

of this study therefore add to the repository of functional analysis information for

genes encoding SH3 domain proteins in C. albicans. A summary of the function of the

proteins encoded by these genes in S. cerevisiae and C. albicans is listed in table 2,

which includes new information that is presented in this work.

Table 2. Comparison of all 24 known SH3 encoding genes from S. cerevisiae and C. albicans.

Described are the systematic names in their respective organisms as well as a summary of the known

function of the proteins. The SH3 domains were identified using the SMART database at

http://smart.embl.de and information of the protein function was obtained from the Saccharomyces

genome database at http://www.yeastgenome.org/ and the Candida genome database at

http://www.candidagenome.org.

Gene S. cerevisiae C. albicans

ABP1 YCR088W

Actin cytoskeleton organization

orf19.2699

Actin cytoskeleton organization BBC1 YJL021C

Assembly of actin patches

orf19.2791

Unknown function §

BEM1 YBR200W

Cell polarity and morphogenesis

orf19.4645

Wild-type budding, hyphal growth BEM1-like orf19.177

Unknown function BOI1 YBL085W

Polar growth

BOI2 YER114C

Polar growth

orf19.3230

Vacuolar fusion §

BUD14 YAR014C

Selection of bud site

orf19.3555

Unknown function §

BZZ1 YHR114W

Regulation of actin polymerization

orf19.1699

Regulation of actin polymerization CDC25 YLR310C

Guanine nucleotide exchange factor

orf19.6926

Guanine nucleotide exchange factor CDC25-

like

orf19.1842

Unknown function CYK3 YDL117W

Cytokinesis

orf19.13620

Cytokinesis * FUS1 YCL027W

Cell fusion

orf19.1156

Unknown function §

HOF1 YMR032W

Cytokinesis

orf19.5664

Unknown function HSE1 YHL002W

Sorting ubiquitinated proteins

orf19.3233

Unknown function §

LSB1 YGR136W

Actin cytoskeleton organization

LSB3 YFR024C-A

Actin cytoskeleton organization

orf19.4127

Unknown function LSB4 YHR016C

Actin cytoskeleton organization

21

MYO3 YKL129C

Actin cytoskeleton organization

MYO5 YMR109W

Actin cytoskeleton organization

orf19.738

Actin cytoskeleton organization NBP2 YDR162C

HOG pathway

orf19.6588

Vacuolar fusion * PEX13 YLR191W

Peroxisomal protein import

orf19.7282

Peroxisomal protein import PIN3 YPR154W

Involved in prion formation

orf19.5956

Unknown function §

RVS167 YDR388W

Actin cytoskeleton organization

orf19.1220

Actin cytoskeleton organization §

RVS167-2 orf19.4742

Unknown function §

SDC25 YLL016W

Guanine nucleotide exchange factor

SHO1 YER118C

HOG pathway

orf19.4772

Unknown function §

SLA1 YBL007C

Actin cytoskeleton organization

orf19.1474

Actin cytoskeleton organization * Q59U90 orf19.1861

Unknown function Q5AAN3 orf19.6277

Unknown function

§ Deletion of the genes in C. albicans is described in Part IV.

* Deletion of the genes in C. albicans is described in Part V.

22

PART IV

R E S E A R C H A R T I C L E

Functional analysis ofCandidaalbicansgenesencodingSH3-domain-containing proteinsPatrick Reijnst, Andrea Walther & Jurgen Wendland

Carlsberg Laboratory, Yeast Biology, Valby, Denmark

Correspondence: Jurgen Wendland,

Carlsberg Laboratory, Yeast Biology, Gamle

Carlsberg Vej 10, DK-2000 Valby,

Copenhagen, Denmark. Tel.: 145 3327

5230; fax: 145 3327 4708; e-mail: jww

@crc.dk

Received 30 November 2009; revised 25

February 2010; accepted 7 March 2010.

Final version published online 12 April 2010.

DOI:10.1111/j.1567-1364.2010.00624.x

Editor: Richard Calderone

Keywords

Candida albicans; human pathogen; PCR; pFA

plasmids; actin cytoskeleton.

Abstract

Postgenomic gene-function analyses with Candida albicans are hindered by its

constitutive diploidy and the lack of a sexual cycle. Rapid generation of mutant

strains can be achieved using PCR-based techniques for directed gene alterations.

Here, we report the analyses of nine C. albicans genes that encode Src Homology

3-domain proteins. Phenotypic analyses included the potential of the mutants to

form hyphal filaments, maintain a polarized actin cytoskeleton or the ability to

generate large vacuoles in the germ cells and in subapical compartments. The

C. albicans homologs of the Saccharomyces cerevisiae BBC1, BOI2, BUD14, FUS1,

HSE1, PIN3, RVS167, RVS167-2 and SHO1 were all found to be nonessential.

Deletion of RVS167 resulted in a strain with a decreased ability to form hyphal

filaments. The number of cortical actin patches was increased in Drvs167 strains

and their distribution was depolarized in both mother and daughter yeast cells and

along the hyphae during filamentous growth stages. Polarization of patches could

be restored upon reintroduction of the wild-type gene. Deletion of BOI2 was

found to generate a defect in vacuolar fusion in hyphae. In contrast to a deletion in

the Dwal1 gene, Dboi2 cells formed abundant hyphae, indicating that fragmented

vacuoles do not inhibit filamentation. Placing BOI2 under control of the MAL2-

promoter allowed the regulation of this phenotype depending on the growth

conditions.

Introduction

Candida albicans is considered to be a normal commensal

organism in the gastrointestinal tract of humans and warm-

blooded animals. Among nosocomial infections, urinary

tract infections are most common, particularly in cases

where indwelling catheters are involved (Jain et al., 2007),

other superficial mucosal infections occur on oral and

vaginal tissues. Life-threatening systemic infections of inner

organs may occur in severely immunocompromised pa-

tients, which makes C. albicans one of the major fungal

pathogens (Eggimann et al., 2003; Gudlaugsson et al., 2003).

Several attributes enable C. albicans to cause disease.

These virulence factors include genes that participate in the

processes of adhesion, colonization and penetration of host

tissues, biofilm formation as well as morphological changes

from yeast to hyphal growth (Sundstrom, 2002; Sudbery

et al., 2004; Whiteway & Oberholzer, 2004; Kumamoto &

Vinces, 2005; Schaller et al., 2005; Nobile et al., 2008).

Recent analysis of the C. albicans WASP, WAL1, indicated

that endocytosis is also required for polarized hyphal growth

because wal1 mutants showed delayed endocytosis, vacuolar

fragmentation and were afilamentous. However, it could not

be clarified whether vacuolar fragmentation itself contribu-

ted to the filamentation defect (Walther & Wendland, 2004).

Other C. albicans mutants with defects in vacuolar function,

for example in vac1 or vps11 strains, are also crippled in their

ability to form filaments (Palmer et al., 2003; Franke et al.,

2006). Characteristically, large vacuoles are found in the

germ cell and in subapical parts of the hyphae, whereas

hyphal tips contain endosomes and small vacuoles. This

pattern of vacuolar distribution influences the branching

frequency during filamentous growth (Barelle et al., 2006;

Veses et al., 2009a). Recently, ABG1 was shown to encode an

essential C. albicans vacuolar protein, which is involved in

branching and endocytosis (Veses et al., 2005, 2009b).

With the onset of postgenomics in C. albicans, it has

become an important task to identify gene functions for the

FEMS Yeast Res 10 (2010) 452–461c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

YEA

ST R

ESEA

RC

H

many as yet uncharacterized genes. Several methods have

become available to delete both alleles of a single gene in the

diploid genome of C. albicans, for example using the site-

specific FLP recombinase or the ‘URA3-blaster’ technique

(Morschhauser et al., 1999; Enloe et al., 2000; Berman &

Sudbery, 2002; Reuss et al., 2004). PCR-based methods of

gene disruption similar to those used in Saccharomyces

cerevisiae were also introduced in C. albicans (Walther &

Wendland, 2008).

Src Homology 3 (SH3) domains are small peptide recogni-

tion modules (approximately 80 amino acids) that mediate

protein–protein interaction and thus promote complex for-

mation (Tong et al., 2002; Li, 2005). There is a limited set of

SH3-domain-containing genes in the C. albicans genome.

Most of the genes have homologs in S. cerevisiae. The majority

of these S. cerevisiae homologs are either involved in the

organization of the cortical actin cytoskeleton/endocytosis

(e.g. Myo3/5, Abp1) or signal transduction (e.g. Bem1, Boi1/

2, Cdc25); a few others such as Fus1 or Pex13 are involved in

mating or peroxisome biogenesis, respectively. To contribute

to the functional analysis of these genes in C. albicans, we

undertook a deletion approach of nine SH3-domain-encoding

genes using PCR-based gene targeting technology.

Materials and methods

Strains and media

The Candida albicans strains used and generated in this

study are listed in Table 1. Strains were grown either in rich

yeast extract–peptone–dextrose (YPD; 1% yeast extract, 2%

peptone, 2% dextrose) or in minimal media [complete

supplement mixture (CSM) 6.7 g L�1 yeast–nitrogen base

(YNB) with ammonium sulfate and without amino acids,

0.69 g L�1 CSM; 20 g L�1 glucose] or SD (6.7 g L�1 YNB with

ammonium sulfate and without amino acids, 20 g L�1 glu-

cose) with the addition of the required amino acids and

uridine. Promoter shutdown of MAL2-promoter-controlled

gene expression was performed as follows: cells were grown

overnight in YPD and then diluted in either fresh YPM (1%

yeast extract, 2% peptone, 2% maltose) or YPD. Subse-

quently, 10% serum was added to these cultures, followed by

an incubation of 4 h at 37 1C. Yeast cells were generally

grown at 30 1C; hyphal induction of C. albicans cells was

carried out at 37 1C in the presence of 10% serum in the

growth medium. Escherichia coli strain DH5a was used for

pFA plasmid propagation.

Transformation of C. albicans

Homozygous mutant strains were constructed starting from

C. albicans strain SN148 (Noble & Johnson, 2005). To delete

both alleles of a gene, sequential transformation of SN148 and

the resulting heterozygous strains was required. All the PCR

products used in transformation of C. albicans were amplified

from pFA vectors (Table 2) using S1 and S2 primers as

described (Walther & Wendland, 2008). Primers were ob-

tained from biomers.net GmbH (Ulm, Germany). S1 and S2

primers contain 100 nt of the target homology at their 50 ends.

Shorter primers were used for diagnostic PCR to verify

the integration of the cassettes. The primer sequences are

shown in Table 3. Transformation was carried out either by the

lithium-acetate procedure or by electroporation (Kohler et al.,

Table 1. Candida albicans strains used in this study

Strain� Genotype Source

SC5314 C. albicans wild type Gillum et al.

(1984)

SN148 arg4/arg4, leu2/leu2, his1/his1 Noble &

Johnson

(2005)

ura3<imm434/ura3<imm434, iro1<imm434/

iro1<imm434

CAS002 BBC1/bbc1<CdHIS1, leu2, ura3, arg4 This study

CAP002 bbc1<CdHIS1/bbc<URA3, leu2, arg4 This study

CAP027 boi2<ARG4/boi2<URA3, his1, leu2 This study

CAP034 BOI2/boi2<CdHIS1, leu2, ura3, arg4 This study

CAP003 boi2<CdHIS1/boi2<URA3, leu2, arg4 This study

CAP032 boi2<CdHIS1/MAL2p-BOI2:URA3, leu2, arg4 This study

CAP036 BUD14/bud14<CdHIS1, leu2, ura3, arg4 This study

CAP005 bud14<CdHIS1/bud14<URA3, leu2, arg4 This study

CAP041 FUS1/fus1<CdHIS1, leu2, ura3, arg4 This study

CAP010 fus1<CdHIS1/fus1<URA3, leu2, arg4 This study

CAP043 HSE1/hse1<CdHIS1, leu2, ura3, arg4 This study

CAP012 hse1<CdHIS1/hse1<URA3, leu2, arg4 This study

CAP045 PIN3/pin3<CdHIS1, leu2, ura3, arg4 This study

CAP014 pin3<CdHIS1/pin3<URA3, leu2, arg4 This study

CAP049 RVS167/rvs167<CdHIS1, leu2, ura3, arg4 This study

CAP018 rvs167<CdHIS1/rvs167<URA3, leu2, arg4 This study

CAP194 rvs167<CdHIS1/rvs167<URA3, BUD3/

bud3<RVS167-CmLEU2, arg4

This study

CAP052 RVS167-2/rvs167-2<CdHIS1, leu2, ura3,

arg4

This study

CAP020 rvs167-2<CdHIS1/rvs167-2<URA3, leu2,

arg4

This study

CAP053 SHO1/sho1<CdHIS1, leu2, ura3, arg4 This study

CAP022 sho1<CdHIS1/sho1<URA3, leu2, arg4 This study

�All CAxxxx strains are derivates of SN148.

Table 2. Plasmids used in this study

Plasmid Description Source

200 pFA-URA3 Gola et al. (2003)

230 pFA-URA3-MAL2p Gola et al. (2003)

627 pFA-CdHIS1 Schaub et al. (2006)

873 pRS-CaBUD3-CmLEU2 Wendland

C486 pDrive-CaRVS167 This study

C504 pRS-CaBUD3-CaRVS167-CmLEU2 This study

CAGG402 BOI2-UAU1-cassette Mitchell

FEMS Yeast Res 10 (2010) 452–461 c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

453Candida albicans functional analysis

Table 3. Primers used in this study

Genes� Primer names and sequencesw

CaBBC1 #3593: S1-CaBBC1: CTTTACGTAGTTCTTTTGTTACCCCCAATTGATTGCTCGATTATCCGACACTTCAAAACTCCACAATTATT

AATAATTATCTTTTCCTGTTTTCAAATTACgaagcttcgtacgctgcaggtc

CaBBC1 #3311: S2-CaBBC1: GAAATAATAAATGTGGTGATCTTCTTTCTCTCATCACCCCACACACTCAAAGAGTTTAACAATGATGGTT

ACGTTTAAAACAATACTTCTTCTTCGTTAAtctgatatcatcgatgaattcgag

CaBBC1 #4018: G1-CaBBC1: GTTAGGTTAGGAGGCACGTC

CaBBC1 #3217: G4-CaBBC1: ATGGCGAATACTCTGGAC

CaBBC1 #3259: I1-CaBBC1: GGTAATTGAAGTTGCTTACGACG

CaBBC1 #3260: I2-CaBBC1: CCAACCAACAAATTGTCTTCC

CaBOI1 #3591: S1-CaBOI1: GTTATTATTATTATTATTACTATTATCTAAAGTATAGTATTACATTCATTTAGTTTCATCACGAATACTCCCT

TACTCCCTACTCCCCATTATTCACAGTTGgaagcttcgtacgctgcaggtc

CaBOI1 #3684: S2-CaBOI1: CAATGCTTCTTCACGTCTAACTTAACTAATACACAACAGAAATCTTTTTTATTTTTCAAAATTT

ATAAAGATTAATTATTAGATTTTATTTATAGATACAtctgatatcatcgatgaattcgag

CaBOI1 #4017: S2-MALp-CaBOI1: CGTCAGCCAATACTTGAATTTTGTCGCCAATTTTAAGA

CTCAATTCATCGCCTAATCTGGCATTAAATTGTTTTATACATATATAAGTATCGCCACCATCcattgtagttgattattagttaaaccac

CaBOI1 #3559: G1-CaBOI1: GGTACACGCACTAGCACACAC

CaBOI1 #3741: G2-CaBOI1: AGGATTTAaagcttttaCACGGGAGTAGTGGTGTCCT

CaBOI1 #3219: G4-CaBOI1: GGTGGGAGATATGGCGAC

CaBOI1 #3249: I1-CaBOI1: CGAAGTTTAACAGGGTCGAAG

CaBOI1 #3250: I2-CaBOI1: GCTGAAGTTGCTGCTACTG

CaBUD14 #3548: S1-CaBUD14: CACACACAGACCACTTATTTTTAACAACACACACTTCAACACAGTACACCCTTC

CCCCCTTCCCAATACCAATCTATCCACATCTACCTAATTTGAACAGCgaagcttcgtacgctgcaggtc

CaBUD14 #3549: S2-CaBUD14: ATTTACACAATTTTACACTACCAAATACTTTCCACTATCATTATTAACAGATTCGTATTA

TCCTTTATTATAAAATTTATGAATTATTATTAATACAAATtctgatatcatcgatgaattcgag

CaBUD14 #3553: G1-CaBUD14: CAACCACTACTACCATTAAC

CaBUD14 #3221: G4-CaBUD14: CTTGCGGATCAGGTGTCC

CaBUD14 #3271: I1-CaBUD14: CACAACTGATTGATCAGCACG

CaBUD14 #3272: I2-CaBUD14: GCCAACTTTTCAGCAAGTTCATC

CaFUS1 #3595: S1-CaFUS1: GAATAATGTAGAATTACAGATCGTTGTCTTATAGCTGCAAAATGCAGGTGA

AAAATAACAAACTTAAAACACAACTGCATCACGAATGTTTATAGTTTATTGgaagcttcgtacgctgcaggtc

CaFUS1 #3573: S2-CaFUS1: ATTTTTCCATACAATACCTGAGAAATTTGTGGGTTT

ACTATGTGGTCTATTTGTTCCTATAGTATTAAAGTATATTAAATAAAATATGATTTAGAACAATtctgatatcatcgatgaattcgag

CaFUS1 #3554: G1-CaFUS1: CCGAAACCTTAACTGAACTG

CaFUS1 #3308: G4-CaFUS1: GTGGAGTATGGACTGACC

CaFUS1 #3261: I1-CaFUS1: GCTGATAAAAGAGATGACGGTG

CaFUS1 #3262: I2-CaFUS1: CTGGGCTTGTAGTACTTTTC

CaHSE1 #3596: S1-CaHSE1: GTACAATATTGGTAGATAGATGATTGTATCCTTACGAGTCTCT

TGCCTTACACCTCAACAGACTATCAAAATCCTGCATATACATTTATCGCACCTTTGCCgaagcttcgtacgctgcaggtc

CaHSE1 #3575: S2-CaHSE1: TGTAACTAATCCTGTTTGAATAGAAAAAAAAAAGAAATTAC

CATTTTATATGTTTTTAAAGTTGACTACCTGCAATTTGGCAAAATGACTACAGCTTTATAtctgatatcatcgatgaattcgag

CaHSE1 #3555: G1-CaHSE1: CCTCTGCTTATTCCAATTAG

CaHSE1 #3227: G4-CaHSE1: CGAACGTGATGCTAATGC

CaHSE1 #3265: I1-CaHSE1: CGGATAAGAAATTGCACGCCAC

CaHSE1 #3266: I2-CaHSE1: CCACTAGGTAATGATCCTCTCC

CaPIN3 #3588: S1-CaPIN3: GAAATTGTGGACTAAGGTCAACGCCAGTGTTTAATA

ATCGGAATGTTGTAAATCTTTGCCTTGACAACAATTTACCTCTT

AACACGCAAGAATTACCGCATTGGgaagcttcgtacgctgcaggtc

CaPIN3 #3577: S2-CaPIN3: CTTAGTAAAAAACTCATTTCATCTCAGATAATTGTACACCAAGAAATTCAAATGCCTTTTGGCTATAC

AACATTACTCCCATATATATGTATATTAAATTtctgatatcatcgatgaattcgag

CaPIN3 #3556: G1-CaPIN3: CGGTGTGTGTGGCCACTAATG

CaPIN3 #3229: G4-CaPIN3: CTTGGCTCCGCGTATGTC

CaPIN3 #3253: I1-CaPIN3: GTCAGCTGCCGATGTATTAG

CaPIN3 #3254: I2-CaPIN3: CTACCTATCAGCGCACCAGC

CaRVS167 #3590: S1-CaRVS167: GTGATATTCGCAAGTACTTCTCCTCCAATGAGTAGCAATTT

GAAATTAAAAGATTTAGGTGTTGCTTAAGAGCTACCATGTGTCAGATTGCTTGGTCGTGgaagcttcgtacgctgcaggtc

CaRVS167 #3581: S2-CaRVS167: AATAAGTTATTTGAAATAAAATAAGAAACCATATAAAAGAA

TAGAATACATTGGGTTACGTGGGGCTAAAATATGTATACAGAATTATAACCCAAGCTTTtctgatatcatcgatgaattcgag

CaRVS167 #3558: G1-CaRVS167: CGTATTGTTTAGCCATGGTG

FEMS Yeast Res 10 (2010) 452–461c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

454 P. Reijnst et al.

1997; Walther & Wendland, 2003). Incubation periods after

transformation varied between 3 and 5 days to identify

transformants. For each target gene, at least two independent

homozygous mutants were generated from different hetero-

zygous strains. Reconstitution of the Drvs167 strain was

carried out by reintegration of the wild-type gene at the

BUD3 locus. To this end, the RVS167 gene was amplified

using the primers #3558: G1-CaRVS167 and #3233: G4-

CaRVS167 and ligated in pDrive, generating plasmid #C486.

The insert was cloned into plasmid #873, which provides the

CaBUD3 homology region and the Candida maltosa LEU2

selectable marker, using BamHI and XhoI restriction sites.

This generated plasmid #C504. The Drvs167 homozygous

mutant strain CAP018 was transformed by #C504 linearized

with SpeI, generating strain CAP194.

Replacement of the BOI2 promoter with the MAL2

promoter was carried out by PCR-based gene targeting.

Initially, BOI2 was disrupted using a gene-specific UAU1

cassette kindly provided by Aaron Mitchell. Transformation

with the BOI2 cassette on plasmid CAGG402 required

linearization of the plasmid using NotI, transformation of

Table 3. Continued.

Genes� Primer names and sequencesw

CaRVS167 #3233: G4-CaRVS167: GTGGTCCGTTAGAGACAG

CaRVS167 #4197: A1-CaRVS167: CTTCTCCTCCAATGAGTAGC

CaRVS167 #4198: A4-CaRVS167: CATTGGGTTACGTGGGGC

CaRVS167 #3255: I1-CaRVS167: GCTGTCAATGGGATGTTAG

CaRVS167 #3256: I2-CaRVS167: CGGTTTGTTCCTCAATGTTC

CaRVS167-2 #4022: S1-CaRVS167-2: GGTTTCTGGTTTATTGACCTGTACTGTGTTATCATTAGACATTTG

AAACTGGTTTGGGTAGATTGTTAACT

AAAGTGACTGAGAATACCTGGGTTGCAAAgaagcttcgtacgctgcaggtc

CaRVS167-2 #3321: S2-CaRVS167-2: AGAGAATCAATATACATATTCATTCTATTTTTCACTCCTGTA

GTACTTTTAATGCATTTAACAAACCTGATAAAGAG

TGTAAAACAATGGAATATCCTTGtctgatatcatcgatgaattcgag

CaRVS167-2 #4023: G1-CaRVS167-2: CAACTCACAGGTTTCTGCAG

CaRVS167-2 #3323: G4-CaRVS167-2: GATAGCTGAGTCATTACCACG

CaRVS167-2 #3267: I1-CaRVS167-2: GAATCAAGTATTGTCCAACTCCG

CaRVS167-2 #3268: I2-CaRVS167-2: GATTCTGCTTGGTGTGACG

CaSHO1 #3316: S1-CaSHO1: CAGTGTATCGATCTCCAATAGATTAGTGTTTATTGATAA

ACTTCCCAACACTACTACTACTATAGACAGAGATAAACTGTATTAAAATATTAAAGATTGAGgaagcttcgtacgctgcaggtc

CaSHO1 #3317: S2-CaSHO1: CAAATCAAATTAACTCTTCATTTGGGGAAATATAATAATAGT

GATAATAATAGTGATAATAAACAGTAACAAATAACAAATAACATCAAACCAAAATATACtctgatatcatcgatgaattcgag

CaSHO1 #3318: G1-CaSHO1: CTTCCTTCCTTCTATATCG

CaSHO1 #3319: G4-CaSHO1: GAATTCAATCAAGTGGAGG

CaSHO1 #3651: I1-CaSHO1: GAGGTCAAGGTCATGAAC

CaSHO1 #3677: I2-CaSHO1: GCTGGTCCTCCTCCACTACC

CaURA3 #600: U2: GTGTTACGAATCAATGGCACTACAGC

CaURA3 #599: U3: GGAGTTGGATTAGATGATAAAGGTGATGG

CdHIS1 #1432: H2: TCTAAACTGTATATCGGCACCGCTC

CdHIS1 #1433: H3: GCTGGCGCAACAGATATATTGGTGC

�Ca, C. albicans; Cm, C. maltosa; Cd, C. dubliniensis.wIn long primers upper case sequences correspond to DNA sequences used as homology regions for recombination whereas lower case sequences

correspond to 30-terminal annealing regions for the amplification of pFA cassettes. Short primers were used for verification purposes. All sequences are

written from 50 to 30.

Table 4. Protein comparison

Systematic

name

Gene

name

S. cere-

visiae

protein

length

C. albi-

cans

protein

length

Sequence

identity�

(%)

Position of the

SH3 domain in

the C. albicans

proteinw

orf19.2791 BBC1 1157 954 25.8 1–56

orf19.3230 BOI2 1040 1172 32.5 5–65

BOI1 980 31.5 –

orf19.3555 BUD14 707 801 20.8 259–340

orf19.1156 FUS1 512 384 25.1 318–383

orf19.3233 HSE1 452 498 39 215–271

orf19.5956 PIN3 215 285 54.9 104–163

orf19.1220 RVS167 482 440 62.5

419–474

orf19.4742 RVS167-2 – 354 23.1

313–366

orf19.4772 SHO1 367 387 38.9 334–391

�Amino acid sequence identities across the whole proteins are indicated.wThe SH3 domains were identified using the SMART database at http://

smart.embl.de/

FEMS Yeast Res 10 (2010) 452–461 c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

455Candida albicans functional analysis

C. albicans with a first selection on �Arg media and

restreaking of the primary transformants on �Arg and

�Ura media to select for recombinants in which both alleles

have been disrupted (Nobile & Mitchell, 2009).

Microscopy and staining procedures

Microscopic analyses were performed using an Axio-Imager

microscope (Zeiss, Jena and Gottingen, Germany) with the

aid of METAMORPH software tools (Molecular Devices Corp.,

Downington, PA) and a MicroMax1024 CCD-camera (Prin-

ceton Instruments, Trenton, NJ). Fluorescence microscopy

was performed using the appropriate filter combinations for

FM4-64-imaging and actin staining as described (Martin

et al., 2005). Samples were analyzed by generating either

single images or stacks of 5–20 images that were processed

into single plane projections using METAMORPH software.

Results and discussion

Sequence comparisons

The set of SH3-domain-containing proteins in C. albicans

was identified based on homology to S. cerevisiae. Several of

Fig. 1. Alignment of SH3 domains. The nine genes that were functionally analyzed in this study each have one SH3 domain. For the exact position of

the SH3 domain, see Table 4. The SH3 domains were identified using the SMART tool at http://smart.embl.de/ and the alignment was generated using CLC

Genomics Workbench 3.6.1. A consensus sequence and the degree of conservation are shown at the bottom of the alignment highlighting three

conserved amino acid residues, W at position 45, G at position 81 and P at position 84.

SC5314 Δbbc1 Δboi2 Δbud14 Δfus1 Δhse1 Δpin3 Δrvs167 Δrvs167-2 Δsho1

Fig. 2. Characterization of growth phenotypes of the nine mutant strains. The indicated strains were grown overnight in liquid culture and then

spotted on minimal medium (upper row) or on minimal medium supplemented with 10% serum (middle row) and then incubated for 3 days at 30 or

37 1C, respectively, before photography. Hyphal induction in liquid medium containing 10% serum was carried out for 3 h before microscopy. Scale

bar = 10 mm. Note the short germ tube in the Drvs167 strain and the absence of a central vacuole in the Dboi2 germ cell.

FEMS Yeast Res 10 (2010) 452–461c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

456 P. Reijnst et al.

these genes have been studied already including for example

BEM1, MYO5 and ABP1 (Oberholzer et al., 2002; Bassilana

et al., 2003; Martin et al., 2007). Therefore, we concentrated

on a set of nine genes (Table 4). The amino acid sequence

identity between the C. albicans and the S. cerevisiae full-

length proteins varies between 20% and 62%. The SH3

domains were identified using the SMART tool at http://smart.

embl.de/. In general, SH3 domains can be identified based

on several highly conserved amino acid residues (Fig. 1).

The position of the SH3 domain varies in each gene: it is

found at the N-terminus in Bbc1 and Boi2; in the central

part of the protein in Bud14, Hse1 and Pin3; and at the

C-terminus in Fus1, Rvs167, Rvs167-2 and Sho1. Because

orf19.4742 was most similar to Rvs167, we renamed the

corresponding uncharacterized ORF RVS167-2.

Generation of C. albicans mutant strains

PCR-based gene targeting in C. albicans has become a fast

and reliable tool for the functional analysis of novel genes

(Walther & Wendland, 2008). In this functional analysis

report, we have used two strategies for gene function

analysis relying on different pFA vectors. Initially, we gener-

ated two heterozygous and subsequently two homozygous

mutant strains thereof using the C. albicans URA3 and the

Candida dubliniensis HIS1 marker genes. Secondly, to verify

mutant phenotypes, we used promoter shutdown or reinte-

gration experiments. For BOI2, we also used a single

transformation protocol based on the UAU1 cassette.

Analysis of the growth morphology of mutantstrains

The set of homozygous mutant strains – as well as their

heterozygous predecessors (not shown) – was initially

characterized to reveal any potential defects under standard

growth conditions. Growth of the null mutants on CSM

minimal medium showed no strong defects during the yeast

growth phase. Inducing yeast cells to form hyphae either on

solid media or in liquid culture was performed using serum

as an inducing agent (Fig. 2). All strains showed the ability

to form germ tubes and colonies had wrinkled appearances

in their centers, suggesting that single mutations in these

genes did not abolish filamentation in C. albicans. Two

mutant strains, Drvs167 and Dboi2, showed observable

phenotypes that were studied in more detail.

The Drvs167 strain showed a strong delay in germ tube

formation evident by much shorter germ tubes compared

SC5314 �rvs167

1h

2h

3hFig. 3. Comparison of germ tube formation

between wild type and Drvs167. Both strains were

grown overnight in YPD, diluted in fresh YPD that

contained 10% serum, followed by an incubation

at 37 1C. Samples were taken at the indicated time

points and used for microscopy.

FEMS Yeast Res 10 (2010) 452–461 c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

457Candida albicans functional analysis

with the wild type. This was monitored in a time series of

hyphal induction (Fig. 3). During a 3-h time course, wild-

type cells developed very long germ tubes, whereas the

Drvs167 mutant germ cells had not formed filaments or only

very short germ tubes. The actin cytoskeleton plays a major

role in polarized growth. Therefore, we analyzed the dis-

tribution of the actin cytoskeleton during different growth

stages in the Drvs167 strain and compared it with the wild

type (Fig. 4). In SC5314 cells, actin patches cluster in the

bud and the cortical actin cytoskeleton is highly polarized to

the hyphal tip during filamentous growth stages. In Drvs167

cells, actin patches are apparently randomly localized to

both mother and daughter cells. In Drvs167 filaments, actin

patches are more abundant and their distribution is rather

even both in apical and in subapical compartments. This

increase in actin patch formation and nonpolarized distri-

bution can be restored upon reintegration of the wild-type

RVS167 gene (Fig. 4).

The second observation was with regard to the Dboi2

deletion strain. Initially, we had constructed a strain with a

disrupted Dboi2 based on use of the UAU1 cassette (Enloe

et al., 2000). This strain showed a lack of a large vacuole in

the germ cell after induction of hyphal morphogenesis. The

UAU1 insertion was determined to be in the central part of

the gene downstream of the SH3 domain, but within the

Pleckstrin homology-domain-encoding region. Using a

1h 2h 3h

(a)

(b)

SC5314

Δrvs167

SC5314

Δrvs167

BUD3/bud3::RVS167

Δrvs167

Fig. 4. Deletion of RVS167 leads to the

formation of abundant cortical actin patches.

Strains were grown under yeast- or germ

tube-inducing conditions for 4 h before fixation

and rhodamine–phalloidin staining. Bright-field

and fluorescence images of wild type (SC5314)

and the Drvs167 strain at different stages of

growth as well as the reconstituted strain are

shown. Scale bar = 10 mm.

FEMS Yeast Res 10 (2010) 452–461c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

458 P. Reijnst et al.

PCR-based gene targeting approach, we generated complete

ORF deletion strains of BOI2, which were phenotypically

identical to the UAU1 strain. Analysis of the distribution of

vacuoles in wild type and Dboi2 cells was performed by

fluorescence microscopy using the vacuolar dye FM4-64

(Fig. 5). During yeast growth, vacuolar morphology was

similar to that observed in the wild type. A central large

vacuole was visible after 1 h of incubation, with the dye

indicating uptake and delivery of the dye to the vacuolar

compartment. Staining of germlings revealed fragmented

vacuoles both in the UAU1 strain of Dboi2 and in the

complete ORF deletion strain. To demonstrate that this

phenotype was specific for the Dboi2 deletion, we generated

a MAL2-promoter-controlled BOI2 strain. With this strain,

fragmented vacuoles could only be observed under condi-

tions that turned off the expression of BOI2 (Fig. 5). In

S. cerevisiae, there are two BOI genes. Deletion of BOI1 and

BOI2 results in morphogenesis defects (Bender et al., 1996).

Deletion of the sole BOI1 gene in Ashbya gossypii results in

temperature-sensitive growth and depolarized growth at the

hyphal tip (Knechtle et al., 2006). Defects in vacuolar fusion,

however, have not been reported so far.

Conclusion

In this study, we have generated C. albicans mutant strains

for nine genes using PCR-based methodologies and a UAU1

cassette. We focused on genes that encode SH3-domain-

containing genes because their S. cerevisiae homologs were

shown to be involved in signal transduction or actin

cytoskeleton organization. Initial characterization of the

genes indicated that all except two mutants showed no

discernible phenotype, suggesting some plasticity in the

complexes the corresponding proteins are involved. FUS1

as a probable ortholog of S. cerevisiae Fus1p, which is a

membrane protein required for mating, may actually be

(a)

(b) SC5314 Δboi2/MAL2p-BOI2YPM YPD YPM YPD

SC5314 Δboi2::UAU1 Δboi2

Fig. 5. Deletion of BOI2 leads to a vacuolar fusion

defect. Strains were grown under

yeast- or germ tube-inducing conditions for 4 h,

and then FM4-64 (0.2 mg mL�1) was added and

samples were processed for microscopy after 1 h

to allow uptake of the dye. (a) Bright-field and

fluorescence images of the wild type (SC5314)

and the Dboi2 strains that were generated either

using a UAU1 cassette or by complete ORF dele-

tion using PCR-based gene targeting.

(b) Regulated expression of BOI2 under the

control of the MAL2 promoter led to vacuolar

fragmentation under repressive conditions in YPD,

whereas under inducing conditions in YPM, a wild-

type vacuolar morphology appeared. Scale

bar = 10 mm.

FEMS Yeast Res 10 (2010) 452–461 c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

459Candida albicans functional analysis

important for cell fusion during mating, which we did not

analyze.

The Drvs167 mutant strain showed the increased presence

of cortical actin patches during yeast and filamentous

growth stages. This may implicate Rvs167p in regulating

the distribution of cortical actin patches in C. albicans. In

S. cerevisiae, it was shown that Rvs167p colocalizes with

actin patches and may be important for the correct distribu-

tion of the cortical actin complex (Balguerie et al., 1999).

The S. cerevisiae Drvs167 strain was isolated as being reduced

in viability upon starvation. During the preparation of this

manuscript, another study on the C. albicans Rvs167

and Rvs161 was published that indicated that Drvs167 cells

show some sensitivity to H2O2 and cell wall-disturbing

agents such as calcofluor and Congo red (Douglas et al.,

2009). Our results on Drvs167 focus on the altered abun-

dance and distribution of the cortical actin patches that

were not reported previously. With the ability to switch

between different growth forms, C. albicans may be an ideal

model to study the role of Rvs167 in actin cytoskeleton

organization during highly polarized hyphal growth in more

detail.

Deletion of BOI2 in C. albicans resulted in a defect of

vacuolar fusion, leading to fragmented vacuoles. This phe-

notype is somewhat similar to that observed in Dwal1 cells

(Walther & Wendland, 2004). Yet, Dboi2 cells are able to

form true hyphae, indicating that fragmented vacuoles are

not sufficient to abolish filamentation in C. albicans. There-

fore, defects in filamentation of the Dwal1 strain should be

separable from the vacuolar fragmentation defect. To this

end, we are currently performing functional analyses of the

C. albicans Wal1 domains.

Because of the diploidy of C. albicans, gene function

analyses still require much more effort to produce the

correct deletion strains. Using PCR-based gene targeting

methods, larger scale approaches can also be undertaken in

C. albicans (Noble & Johnson, 2005). A complementary

approach may be the overexpression of genes or domains.

However, use of TEF-promoter-controlled expression of

core SH3 domains of the genes described in this study did

not result in any obvious phenotypes. Our study of nine

C. albicans genes thus adds to the repository of functional

analysis information for this human fungal pathogen.

Acknowledgements

We thank Alexander Johnson, Suzanne Noble and Aaron

Mitchell for generously providing the reagents used in this

study; Sidsel Ehlers for providing technical assistance; and

Sigyn Jorde for generating the CAS002 strain. We are

indebted to the EU-Penelope consortium for providing

assistance with gene nomenclature and SH3-domain identi-

fication. This study was funded by the EU-Marie Curie

Research Training Network ‘Penelope’.

References

Balguerie A, Sivadon P, Bonneu M & Aigle M (1999) Rvs167p, the

budding yeast homolog of amphiphysin, colocalizes with actin

patches. J Cell Sci 112: 2529–2537.

Barelle CJ, Richard ML, Gaillardin C, Gow NA & Brown AJ

(2006) Candida albicans VAC8 is required for vacuolar

inheritance and normal hyphal branching. Eukaryot Cell 5:

359–367.

Bassilana M, Blyth J & Arkowitz RA (2003) Cdc24, the GDP–GTP

exchange factor for Cdc42, is required for invasive hyphal

growth of Candida albicans. Eukaryot Cell 2: 9–18.

Bender L, Lo HS, Lee H, Kokojan V, Peterson V & Bender A

(1996) Associations among PH and SH3 domain-containing

proteins and Rho-type GTPases in yeast. J Cell Biol 133:

879–894.

Berman J & Sudbery PE (2002) Candida albicans: a molecular

revolution built on lessons from budding yeast. Nat Rev Genet

3: 918–930.

Douglas LM, Martin SW & Konopka JB (2009) BAR domain

proteins Rvs161 and Rvs167 contribute to Candida albicans

endocytosis, morphogenesis, and virulence. Infect Immun 77:

4150–4160.

Eggimann P, Garbino J & Pittet D (2003) Management of

Candida species infections in critically ill patients. Lancet Infect

Dis 3: 772–785.

Enloe B, Diamond A & Mitchell AP (2000) A single-

transformation gene function test in diploid Candida albicans.

J Bacteriol 182: 5730–5736.

Franke K, Nguyen M, Hartl A et al. (2006) The vesicle transport

protein Vac1p is required for virulence of Candida albicans.

Microbiology 152: 3111–3121.

Gillum AM, Tsay EY & Kirsch DR (1984) Isolation of the Candida

albicans gene for orotidine-50-phosphate decarboxylase by

complementation of S. cerevisiae ura3 and E. coli pyrF

mutations. Mol Gen Genet 198: 179–182.

Gola S, Martin R, Walther A, Dunkler A & Wendland J (2003)

New modules for PCR-based gene targeting in Candida

albicans: rapid and efficient gene targeting using 100 bp of

flanking homology region. Yeast 20: 1339–1347.

Gudlaugsson O, Gillespie S, Lee K et al. (2003) Attributable

mortality of nosocomial candidemia, revisited. Clin Infect Dis

37: 1172–1177.

Jain N, Kohli R, Cook E, Gialanella P, Chang T & Fries BC (2007)

Biofilm formation by and antifungal susceptibility of Candida

isolates from urine. Appl Environ Microb 73: 1697–1703.

Knechtle P, Wendland J & Philippsen P (2006) The SH3/PH

domain protein AgBoi1/2 collaborates with the Rho-type

GTPase AgRho3 to prevent nonpolar growth at hyphal tips of

Ashbya gossypii. Eukaryot Cell 5: 1635–1647.

Kohler GA, White TC & Agabian N (1997) Overexpression of a

cloned IMP dehydrogenase gene of Candida albicans confers

FEMS Yeast Res 10 (2010) 452–461c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

460 P. Reijnst et al.

resistance to the specific inhibitor mycophenolic acid.

J Bacteriol 179: 2331–2338.

Kumamoto CA & Vinces MD (2005) Contributions of hyphae

and hypha-co-regulated genes to Candida albicans virulence.

Cell Microbiol 7: 1546–1554.

Li SS (2005) Specificity and versatility of SH3 and other proline-

recognition domains: structural basis and implications for

cellular signal transduction. Biochem J 390: 641–653.

Martin R, Walther A & Wendland J (2005) Ras1-induced hyphal

development in Candida albicans requires the Formin Bni1.

Eukaryot Cell 4: 1712–1724.

Martin R, Hellwig D, Schaub Y, Bauer J, Walther A & Wendland J

(2007) Functional analysis of Candida albicans genes whose

Saccharomyces cerevisiae homologues are involved in

endocytosis. Yeast 24: 511–522.

Morschhauser J, Michel S & Staib P (1999) Sequential gene

disruption in Candida albicans by FLP-mediated site-specific

recombination. Mol Microbiol 32: 547–556.

Nobile CJ & Mitchell AP (2009) Large-scale gene disruption

using the UAU1 cassette. Methods Mol Biol 499: 175–194.

Nobile CJ, Schneider HA, Nett JE, Sheppard DC, Filler SG, Andes

DR & Mitchell AP (2008) Complementary adhesin function in

C. albicans biofilm formation. Curr Biol 18: 1017–1024.

Noble SM & Johnson AD (2005) Strains and strategies for large-

scale gene deletion studies of the diploid human fungal

pathogen Candida albicans. Eukaryot Cell 4: 298–309.

Oberholzer U, Marcil A, Leberer E, Thomas DY & Whiteway M

(2002) Myosin I is required for hypha formation in Candida

albicans. Eukaryot Cell 1: 213–228.

Palmer GE, Cashmore A & Sturtevant J (2003) Candida albicans

VPS11 is required for vacuole biogenesis and germ tube

formation. Eukaryot Cell 2: 411–421.

Reuss O, Vik A, Kolter R & Morschhauser J (2004) The SAT1

flipper, an optimized tool for gene disruption in Candida

albicans. Gene 341: 119–127.

Schaller M, Borelli C, Korting HC & Hube B (2005) Hydrolytic

enzymes as virulence factors of Candida albicans. Mycoses 48:

365–377.

Schaub Y, Dunkler A, Walther A & Wendland J (2006) New pFA-

cassettes for PCR-based gene manipulation in Candida

albicans. J Basic Microbiol 46: 417–430.

Sudbery P, Gow N & Berman J (2004) The distinct morphogenic

states of Candida albicans. Trends Microbiol 12: 317–324.

Sundstrom P (2002) Adhesion in Candida spp. Cell Microbiol 4:

461–469.

Tong AH, Drees B, Nardelli G et al. (2002) A combined

experimental and computational strategy to define protein

interaction networks for peptide recognition modules. Science

295: 321–324.

Veses V, Casanova M, Murgui A, Dominguez A, Gow NA &

Martinez JP (2005) ABG1, a novel and essential Candida

albicans gene encoding a vacuolar protein involved in

cytokinesis and hyphal branching. Eukaryot Cell 4: 1088–

1101.

Veses V, Richards A & Gow NA (2009a) Vacuole inheritance

regulates cell size and branching frequency of Candida albicans

hyphae. Mol Microbiol 71: 505–519.

Veses V, Casanova M, Murgui A, Gow NA & Martinez JP (2009b)

Candida albicans ABG1 gene is involved in endocytosis. FEMS

Yeast Res 9: 293–300.

Walther A & Wendland J (2003) An improved transformation

protocol for the human fungal pathogen Candida albicans.

Curr Genet 42: 339–343.

Walther A & Wendland J (2004) Polarized hyphal growth in

Candida albicans requires the Wiskott–Aldrich Syndrome

protein homolog Wal1p. Eukaryot Cell 3: 471–482.

Walther A & Wendland J (2008) PCR-based gene targeting in

Candida albicans. Nat Protoc 3: 1414–1421.

Whiteway M & Oberholzer U (2004) Candida morphogenesis

and host–pathogen interactions. Curr Opin Microbiol 7:

350–357.

FEMS Yeast Res 10 (2010) 452–461 c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

461Candida albicans functional analysis

23

PART V

Curr Genet (2010) 56:309–319

DOI 10.1007/s00294-010-0301-7

RESEARCH ARTICLE

Candida albicans SH3-domain proteins involved in hyphal growth, cytokinesis, and vacuolar morphology

Patrick Reijnst · Sigyn Jorde · Jürgen Wendland

Received: 23 December 2009 / Revised: 22 March 2010 / Accepted: 29 March 2010 / Published online: 11 April 2010© Springer-Verlag 2010

Abstract This report describes the analyses of threeCandida albicans genes that encode Src Homology 3(SH3)-domain proteins. Homologs in Saccharomyces cere-visiae are encoded by the SLA1, NBP2, and CYK3 genes.Deletion of CYK3 in C. albicans was not feasible, suggest-ing it is essential. Promoter shutdown experiments ofCaCYK3 revealed cytokinesis defects, which are in linewith the localization of GFP-tagged Cyk3 at septal sites.Deletion of SLA1 resulted in strains with decreased abilityto form hyphal Wlaments. The number of cortical actinpatches was strongly reduced in �sla1 strains during allgrowth stages. Sla1-GFP localizes in patches that are foundconcentrated at the hyphal tip. Deletion of the Wrst twoSH3-domains of Sla1 still resulted in cortical localizationof the truncated protein. However, the actin cytoskeleton inthis strain was aberrant like in the �sla1 deletion mutantindicating a function of these SH3 domains to recruit actinnucleation to sites of endocytosis. Deletion of NBP2resulted in a defect in vacuolar fusion in hyphae. Germcells of �nbp2 strains lacked a large vacuole but initiatedseveral germ tubes. The mutant phenotypes of �nbp2 and�sla1 could be corrected by reintegration of the wild-typegenes.

Keywords Candida albicans · PCR-based gene targeting · pFA-plasmids · Actin cytoskeleton · FM4-64

Introduction

Candida albicans is one of the most important human fun-gal pathogens. It occurs as a commensal on epithelial sur-faces in oropharyngeal tissue, the gastro-intestinal tract,and in the vagina. Particularly, vaginitis and urinary tractinfections caused by C. albicans are frequent in otherwisehealthy individuals. Immuno-compromised patients mayadditionally develop life-threatening systemic infections ofinner organs (Odds 1994; Calderone and Fonzi 2001).

The morphological transition of C. albicans from yeastto hyphal growth has been recognized as an important viru-lence attribute amongst others (Sudbery et al. 2004;Kumamoto and Vinces 2005). Filamenting germ cellscharacteristically generate large vacuoles. This compart-mentalizes the germ tube in an apical region that containsendosomes and small vacuoles, and subapical regionswhich harbor large vacuoles at the expense of cytoplasm.Septation in hyphal Wlaments further promotes this com-partmentalization. The unequal distribution of vacuolar vol-ume inXuences the branching frequency during Wlamentousgrowth (Barelle et al. 2006; Veses et al. 2009). The actincytoskeleton is polarized at sites of polarized growth andcortical actin patches cluster in the hyphal tips. Defects inthe polarization of the actin cytoskeleton, e.g. interferingwith the function of several Rho-type GTPases generallylead to growth defects (Wendland 2001; Court and Sudbery2007; Zheng et al. 2007). Actin ring formation promotedvia Iqg1 at sites of septation is required for septum forma-tion (Epp and Chant 1997; Wendland and Philippsen 2002).In S. cerevisiae, CYK3 can act as a multicopy suppressor ofan IQG deletion (Korinek et al. 2000). Processes like polar-ized hyphal growth, endocytosis, and cytokinesis requireprotein networks and timely regulation within the cellcycle. SH3-domain encoding proteins are well suited to

Communicated by C. D'Enfert.

P. Reijnst · S. Jorde · J. Wendland (&)Carlsberg Laboratory, Yeast Biology, Gamle Carlsberg Vej 10, 2500 Valby, Copenhagen, Denmarke-mail: jww@crc.dk

123

310 Curr Genet (2010) 56:309–319

play important roles in these processes since they can medi-ate protein–protein interactions via their SH3-domains (amBusch et al. 2009). Several C. albicans SH3-protein encod-ing genes have already been characterized including MYO5,BEM1, and CDC25 (Enloe et al. 2000; Michel et al. 2002;Oberholzer et al. 2002; Bassilana et al. 2003). BEM1 wasfound to be essential, while MYO5 plays an important roleduring endocytosis. Both Myo5 and Cdc25 are required forWlamentation under speciWc conditions. Therefore, otherSH3-domain encoding genes may also play important mor-phogenetic roles.

Establishing the genome sequence of C. albicans hasopened the way for the functional analysis of the C. albi-cans gene set as has been elegantly achieved in S. cerevi-siae (Winzeler et al. 1999). PCR-based gene targetingapproaches similar to those used in S. cerevisiae have beenestablished to generate homozygous mutant strains aftertwo successive rounds of transformation (Berman and Sud-bery 2002; Walther and Wendland 2008).

To contribute further to the functional analysis ofC. albicans genes, we have functionally analyzed theC. albicans homologs of the S. cerevisiae SH3-domainencoding genes SLA1, NBP2, and CYK3.

Materials and methods

Strains and media

The C. albicans strains used and generated in this study arelisted in Table 1. Generally, at least two independent

transformants were generated for each desired geneticmanipulation. Strains were grown either in yeast extract–peptone–dextrose (YPD; 1% yeast extract, 2% peptone,2% dextrose) or in deWned minimal media [CSM; com-plete supplement mixture; 6.7 g/l yeast nitrogen base(YNB) with ammonium sulfate and without amino acids;0.69 g/l CSM; 20 g/l glucose] with the addition ofrequired amino acids and uridine. Promoter shut down ofMET3-promoter or MAL2-promoter controlled geneexpression was done as described previously (Bauer andWendland 2007).

Strains were generally grown at 30°C to keep them inthe yeast phase; hyphal induction of C. albicans cells wasdone at 37°C with the addition of 10% serum to the growthmedium. Escherichia coli strain DH5� was used for pFA-plasmid propagation.

Transformation of C. albicans

Completely independent C. albicans homozygous com-plete ORF-deletion strains were constructed startingfrom C. albicans strain SN148 (Noble and Johnson2005). PCR-generated disruption cassettes were used totarget both alleles of a gene, which were deleted bysequential transformation of Wrst SN148 and then theresulting heterozygous strains. PCR-products for trans-formation of C. albicans were ampliWed from pFA-vec-tors (Table 2) using S1- and S2-primers as described(Walther and Wendland 2008). Primers were purchasedfrom biomers.net GmbH (Ulm, Germany). S1- and S2-prim-ers (see Table 3) harbor 100 nt of target homology at their

Table 1 C. albicans strains used in this study

Straina Genotype Source

SC5314 C. albicans wild type Gillum et al. 1984

SN148 arg4/arg4, leu2/leu2, his1/his1ura3::imm434/ura3::imm434, iro1::imm434/iro1::imm434

Noble and Johnson 2005

CAP046 NBP2/nbp2::CdHIS1, leu2, ura3, arg4 This study

CAP015 nbp2::CdHIS1/nbp2::URA3, leu2, arg4 This study

CAP191 nbp2::CdHIS1/nbp2::URA3, BUD3/bud3::NBP2-CmLEU2, arg4 This study

CAP147 CYK3/cyk3::CdHIS1, leu2, ura3, arg4 This study

CAP007 URA3-MET3p-CYK/cyk3::CdHIS1, arg4, leu2 This study

CAP054 SLA1/sla1::CdHIS1, leu2, ura3, arg4 This study

CAP024 sla1::CdHIS1/sla1::URA3, leu2, arg4 This study

CAP204 sla1::CdHIS1/sla1::URA3, BUD3/bud3::SLA1-CmLEU2, arg4 This study

CAP025 sla1::ARG4isla1::URA3, his1, leu2 This study

CAP026 sla1::ARG4/sla1::URA3, his1, leu2 This study

CAS024 SLA1/sla1::CdHIS1, leu2, ura3, arg4 This study

CAP206 URA3-MAL2p-sla1�SH3#1,2/sla1::CdHIS1, leu2, arg4 This study

CAP221 URA3-MAL2p-sla1�SH3#1,2-GFP-CmLEU2/sla1::CdHIS1, arg4 This study

CAS027 SLA1-GFP-CmLEU2/sla1::CdHIS1 This study

CAS030 CYK3-GFP-CmLEU2/cyk3::CdHIS1, ura3, arg4 This study

Cm C. maltosa, Cd C. dubliniensisa All CAxxxx strains are derivates of SN148

123

Curr Genet (2010) 56:309–319 311

5�-ends. Shorter primers were used for diagnostic PCR toverify the integration of the cassettes and absence of the tar-get gene in homozygous mutants. Transformation was doneas described (Walther and Wendland 2003).

SLA1 was also disrupted using two gene-speciWcUAU1 cassettes kindly provided by Aaron Mitchell.Transformation with the SLA1 cassettes on plasmidsCAGFY04 and CAGO130 required linearization of theplasmid using NotI and transformation of C. albicanswith a Wrst selection on ¡Arg media. Restreaking of theprimary transformants on ¡Arg and ¡Ura media wasdone to select for recombinants in which both alleleshave been disrupted (see Nobile and Mitchell 2009 forfurther details).

Reintegration of SLA1 and NBP2

Reconstitution of the �sla1 and �nbp2 strains was done byreintegration of the wild-type gene at the BUD3 locus. Tothis end, SLA1 was ampliWed using primers #3562 and#3237 and cloned into pDrive (C508). From there SLA1was cloned as an XhoI/BamHI fragment into plasmid #873to yield plasmid C553. The �sla1 strain CAP024 was trans-formed with SpeI-linearized plasmid C553. Similarly,NBP2 was ampliWed using primers #3557 and #4196 andcloned into pDrive generating plasmid C527. NBP2 wasthen cloned as a XhoI/BamHI fragment into #873 generat-

ing plasmid C530. Plasmid C530 was transformed aftercleavage with SpeI to generate strain CAP191.

Construction of SLA1-GFP and CYK3-GFP

To generate chromosomally GFP-tagged strains, the fol-lowing procedure was applied. The 3�-ends of SLA1 andCYK3 were ampliWed using primer pairs #3236/#3237 and#3222/#3223, respectively, and cloned into pDrive (plas-mids C182 and C196). The fragments were recloned intopRS417, which is based on pRS415 but carries a GEN3marker instead of LEU2. This generated plasmids C200 andC201, which were used for in vivo recombination in S.cerevisiae to add the GFP-CmLEU2 cassettes ampliWedusing the primer pairs #3314/#3315 for SLA1 and #3312/#3313 for CYK3, respectively. The resulting plasmids C256and C257 were cleaved by XhoI/BamHI and SacII/XhoI,respectively, to release the targeting cassettes used fortransformation of C. albicans. Correct fusion was veriWedby sequencing and correct integration of the cassettes wasveriWed by diagnostic PCR.

Construction of sla1�SH3#1,2-GFP

To generate a SLA1-allele which is expressed from the reg-ulatable MAL2-promoter and lacks the Wrst two SH3-domains, a PCR-based gene targeting approach was used.The URA3-MAL2p-cassette was ampliWed from a pFAvector using primers #3594 and #4265. This cassette wastransformed into strain CAS023 (SLA1/sla1::CdHIS1).This generated strain CAP206 bearing a deletion of oneSLA1 allele and converting the remaining allele tosla1�SH3#1,2. To be able to record the localization of thetruncated protein in living cells, this SLA1 allele was taggedwith GFP. To this end, the SLA1-GFP-tagging cassette wasused and CAP206 was transformed with SpeI/SacIIdigested C256 (pRS417-3�-SLA1-GFP). This resulted inthe addition of GFP to the C-terminus of sla1�SH3#1,2.

Microscopy and staining procedures

Fluorescence microscopy was done with an Axio-Imagermicroscope (Zeiss, Jena and Göttingen, Germany) usingMetamorph software tools (Molecular Devices Corp.,Downington, PA, USA) and a MicroMax1024 CCD-cam-era (Princeton Instruments, Trenton, NJ, USA). Imagingwas performed using the appropriate Wlter combinations forFM4-64-imaging, GFP-localization, and actin-staining asdescribed (Walther and Wendland 2004a, b). Quinacrinestaining was done according to (Weisman et al. 1987). Tothis end, strains were grown overnight in YPD, and thendiluted in YPD + Serum and grown for an additional 4 h.Quinacrine was added to a Wnal concentration of 200 �M.

Table 2 Plasmids used in this study

Ca C. albicans, Cm C. maltosa, Cd C. dubliniensis

Plasmid Description Source

200 pFA-URA3 Gola et al. 2003

230 pFA-URA3-MAL2p Gola et al. 2003

627 pFA-CdHIS1 Schaub et al. 2006

697 pFA-GFP-CmLEU2 Schaub et al. 2006

873 pRS-CaBUD3-CmLEU2 Wendland

C508 pDrive-SLA1 This study

C553 pRS-BUD3-SLA1-CmLEU2 This study

C527 pDrive-NBP2 This study

C530 pRS-BUD3-NBP2-CmLEU2 This study

C177 pRS417 (GEN3) This study

C196 pDRIVE-3�-CYK3 This study

C200 pRS417-3�-CYK3 This study

C257 pRS417-3�-CYK3-GFP This study

C182 pGEM-3�-SLA1 This study

C201 pRS417-3�-SLA1 This study

C256 pRS417-3�-SLA1-GFP This study

CAGFY04 SLA1-UAU1-cassette Mitchell

CAGO130 SLA1-UAU1-cassette Mitchell

123

312 Curr Genet (2010) 56:309–319

Cells were incubated at 37°C for 5 min, collected by centri-fugation and resuspended in 200 �l YPD + Serum with50 mM NaH2PO4. Visualization was done with the GFPWlter. Samples were analyzed by generating either singleimages or stacks of 5–20 images that were processed intosingle plane projections using Metamorph software.

Results

Sequence comparisons

The C. albicans Sla1, Nbp2, and Cyk3 proteins share onefeature in the possession of SH3-domains, which were

Table 3 Primers used in this study

Ca C. albicans, Cm C. maltosa, Cd C. dubliniensisa Upper case sequences correspond to C. albicans DNA sequences and lower case sequences correspond to 3�-terminal annealing regions for theampliWcation of pFA-cassettes. All sequences are written from 5� to 3�

Genes Primer names and sequencesa

CaCYK3 #4019: S1-CaCYK3: CCTTTCATTAATTACAAAGAAAAAAATAAGAACATCAACTATCTTTTCACTCTTTTT GAACAAATTTGTATCATACTAAAAGAATTAAATAATAAATAATgaagcttcgtacgctgcaggtc

CaCYK3 #3313: S2-CaCYK3: AATGTACAAATGGCAAAAAGAAGTAGTAGCAGAAGAGGTAATCTATAAAGAATTTAAAACTAAATAATACCCACTCTGTTTCCCTCTTTATATATATATAtctgatatcatcgatgaattcgag

CaCYK3 #4020: G1-CaCYK3: GCACACTTGATGATTTCATC

CaCYK3 #3222: G3-CaCYK3: GCTAAGATCAAGGCAGTG

CaCYK3 #3223: G4-CaCYK3: GCAACTGCTGCAGTAGAC

CaCYK3 #3312: S1-GFP-CaCYK3: TATGTTTTCGCTCAGTGGGAGTGCATAGGTAGCACAGTTGCAAATggtgctggcgcaggtgcttc

CaCYK3 #3539: G1-CaCYK3-GFP: GACTGCAAGGGCAACCAC

CaCYK3 #3747: G2-CaCYK3: AGGATTTAaagcttttaCCCAAGTGGGGTTGTTCCAGC

CaNBP2 #3589: S1-CaNBP2: GTCTTGTTTGTCCTGTGTGTGTGTGTGTGTGTGTTGATAAATCACCTGAAACATATACTATTTAATCATTTGTTATTCATCATTATTGTCCATTTTGAATAGgaagcttcgtacgctgcaggtc

CaNBP2 #3579: S2-CaNBP2: CACATACACTCTGTTGGTATGAAAGTATAAAAACATTTGATAAAATTCGTAATCAACATT AATATAACTTAATTGTCCCTATAAGCTGGCTAATATTGGAtctgatatcatcgatgaattcgag

CaNBP2 #3557: G1-CaNBP2: GGTGTTTCACATTATTCTCCG

CaNBP2 #3309: G4-CaNBP2: TGGCCGAACCCTTCCTGG

CaNBP2 #3245: I1-CaNBP2: GACAAGTCATTTCCCACC

CaNBP2 #3246: I2-CaNBP2: CTTCAGCAACTAACCAACCTTG

CaNBP2 #4196: A4-CaNBP2: CACATACACTCTGTTGGTATG

CaSLA1 #3594: S1-CaSLA1: CAACTCCTATGTTAGAGCTAGTCGTGCTCAACACAAAACCTGATGTGAAACAATGAA ACTTTCGACGATTCTACAAAAGTGCGGAAATTGCTTGAAATCAAAGgaagcttcgtacgctgcaggtc

CaSLA1 #3315: S2-CaSLA1: AGCATTACAAACTATGAAAGGAATAAGAAATAATGAATAATATTTTGTTTGATATACAATTA TAAAATAAAAGAGTTAATAAAGGTTCAAAATGCACTTTtctgatatcatcgatgaattcgag

CaSLA1 #3562: G1-CaSLA1: CGGTAGAGATGATGTTGTG

CaSLA1 #3765: G2-SLA1: AGGATTTAaagcttttaAGGTGGTGCAGGGAAATCCG

CaSLA1 #3236: G3-CaSLA1: TGGTGGAGCACCACAGAC

CaSLA1 #3237: G4-CaSLA1: CGGCTTTGCAACATCAAGAC

CaSLA1 #3241: I1-CaSLA1: CATAGGGATAGATCACCAG

CaSLA1 #3242: I2-CaSLA1: CTTCTCTCAAACCATGGGC

CaSLA1 #3243: I3-CaSLA1: CACAACAACAACCGCCACC

CaSLA1 #3244: I4-CaSLA1: CCATACCAGTTGGTTGTGAC

CaSLA1 #3314: S1-GFP-CaSLA1: AGAGCTAATCTACAAGCAGCAACACCAGATAATCCCTTTGGATTCggtgctggcgcaggtgcttc

CaSLA1 #4265: S2-MALp-SLA1�SH3#1-2: GAATCTGAGTCTGTTGCTGTGGAATAGCCTGCTGTTGTTGTGGTGGTGGTTGGAAAACCTGTTGTGGTTGTTGCTGTTGATGCTGTGCTGGCTCTGCTGTcattgtagttgattattagttaaaccac

CaURA3 #600: U2: GTGTTACGAATCAATGGCACTACAGC

CaURA3 #599: U3: GGAGTTGGATTAGATGATAAAGGTGATGG

CdHIS1 #1432: H2: TCTAAACTGTATATCGGCACCGCTC

CdHIS1 #1433: H3: GCTGGCGCAACAGATATATTGGTGC

CmLEU2 #1743: L3: GCTGAAGCTTTAGAAGAAGCCGTG

CaMAL2 #4269: G3-CaMALp: GTACAACTAAACTGGGTGATG

123

Curr Genet (2010) 56:309–319 313

identiWed using the SMART tool at http://smart.embl.de/.An SH3-domain is composed of app. 70 amino acids andseveral conserved residues can be found (Fig. 1a). Theposition of a SH3-domain within a protein may vary andthere are also proteins like Sla1 that contain more than oneSH3-domain (Fig. 1b). Amino acid sequence identitiesbetween the C. albicans and, for example, Saccharomycescerevisiae proteins are overall not very high and rangebetween 27 and 37%. The C. albicans proteins are largerthan the S. cerevisiae homologs: Sla1 by only 13aa, Cyk3by 135aa, and Nbp2 by one-third (342aa compared to236aa). The characterizations of the yeast genes revealedthat SLA1 plays a role in actin cytoskeleton assembly andendocytosis; Nbp2 is required for mitotic growth at hightemperatures and for cell wall integrity and Cyk3 isinvolved in cytokinesis (Korinek et al. 2000; Warren et al.2002; Ohkuni et al. 2003).

Generation of C. albicans mutant strains

In this report, we have employed several strategies forgene function analysis relying on diVerent pFA-vectorsand also used a single transformation approach relyingon UAU1-cassettes as described below. Initially, we usedthe pFA-series to generate complete ORF-deletion strainsin the three genes. From two heterozygous mutantstrains, we went onto obtain two independent homozy-gous mutant strains thereof using the C. albicans URA3and the Candida dubliniensis HIS1 marker genes. In

order to characterize SLA1 in more detail, we used inser-tional disruption cassettes based on SLA1-UAU1-cas-settes. Since deletion of CYK3 was not feasible, we useda promoter shutdown approach to analyze the conse-quences of Cyk3 depletion. Mutant phenotypes could beobtained with the homozygous mutants of sla1 and nbp2,which in both cases could be complemented by the rein-tegration of the wild-type gene at the BUD3 locus. Local-ization of Sla1 and Cyk3 was done by Xuorescencemicroscopy of GFP-tagged strains. Using this array oftools, we were able to achieve an initial characterizationof gene function for these genes, which will be describedin the following sections.

Deletion of SLA1 and NBP2 results in hyphal growth phenotypes

Homozygous mutant strains of sla1 and nbp2 were charac-terized to reveal their growth potential under diVerentgrowth conditions. When grown on minimal media, nostrong defects during yeast growth were observable.Hyphal growth was monitored by inducing yeast cellseither on solid media or in liquid culture (Fig. 2). The wildtype strongly Wlaments after addition of serum or in spidermedium. Mutants in sla1 or nbp2 were also able to induceWlament formation. Hyphae of these mutant strains, how-ever, were shorter than the wild type after several hours ofinduction. Interestingly, the nbp2 mutant showed frequentreinitiating of germ tube formation from the germ cell.

Fig. 1 Alignment and position of SH3-domains. a The Wve SH3-do-mains of the three genes that were functionally analyzed in this studywere aligned using the MegAlign tool of the DNASTAR software (ht-tp://www.dnastar.com). Consensus sites are shaded in gray while iden-tical sites in all Wve domains are shaded in black. b The positions of theSH3-domain vary within the proteins and are for Nbp2 at amino acids

127–184, for Cyk3 at position 11–68 and for Sla1 at positions 7–73,76–133, and 399–457. For reference, the complete protein length isdrawn to scale. No other domains were found using the SMART toolat (http://smart.embl.de/) also Sla1 has several repeats at its C-termi-nus. Deletion of the N-terminal SH3-domains results in a sla1 alleletermed Sla1�SH3#1,2

A

Cyk3

Nbp2B

CAP026CAP025

Sla1

Sla1 SH3#1-2 MAL2-prom

SH3-domain

123

314 Curr Genet (2010) 56:309–319

Thus, after 3 h, most of the germ cells had formed two orthree germ tubes (Fig. 2).

SLA1-deletion leads to defects in actin patch assembly and distribution

The actin cytoskeleton plays a major role in polarizedgrowth. During hyphal growth, actin cables in C. albicansare formed by the tip-localized polarisome and actinpatches localize to the hyphal tip at sites of endocytosis (forreview see Pruyne and Bretscher 2000a, b). To analyze thegrowth defects of sla1 in detail, we used Xuorescencemicroscopy of rhodamine stained germ tubes. We analyzedthree diVerent sla1 mutant strains: two bearing UAU1 cas-settes, CAP025 and CAP026, and a complete ORF-deletionstrain. In this way, we could analyze the eVect of truncatingSLA1 at positions that potentially leave all three SH3-domainsintact, truncate the protein after the Wrst two SH3-domainsor entirely delete SLA1 (see also Fig. 1). The two UAU1insertions in SLA1 already showed diVerent phenotypes.The CAP026 strain basically showed no defect, grew likewild type and accumulated actin patches in the hyphal tips.The CAP025 strain in which the UAU1 insertion truncatesSLA1 downstream of the region coding for the second SH3-domain, shows decreased hyphal lengths when comparedwith the wild type. The number of actin patches in thismutant is decreased and the patches do not accumulate inthe tips of hyphae (Fig. 3a). This phenotype is even morepronounced in the complete ORF-deletion strain. Thisstrain has a more drastic growth defect and even fewer cor-tical actin patches. This demonstrates that Sla1 is involvedin the assembly and polarization of cortical actin patches inC. albicans. The assembly of actin cables in the hyphal Wla-ments was not impaired (Fig. 3b). The growth defect of thenull mutant could be complemented by reintegration of thewild-type SLA1 gene at the BUD3 locus. The assembly ofcortical actin patches and their polarized localization wasalso restored in both yeast and hyphal cells (Fig. 3b).

To visualize the localization of Sla1 in vivo, a chromo-somally tagged SLA1-GFP strain was constructed based ona heterozygous mutant. Sla1 shows a patch-like localizationin yeast cells and hyphae (Fig. 3b). An increased number ofSla1-GFP patches can be found at sites of polarized growth,

Fig. 2 Characterization of growth phenotypes of the sla1 and nbp2mutants. The strains were grown overnight in liquid culture and theninoculated on minimal medium (a), on serum containing plates or inliquid medium supplemented with 10% serum (b), or on spider platesand in spider liquid medium (c). Plates were incubated for 3 days at

30°C (a) or 37°C (b, c) prior to photography. Hyphal induction in liq-uid media was done for 3 h prior to microscopy. Bar 10 �m. Note theshort germ tube in the sla1 strain (middle row) and the multiple germtubes in the nbp2 mutant (bottom row)

sla1

nbp2

A B C

WT

Fig. 3 Deletion of SLA1 leads to defects in cortical actin patch assem-bly. Strains were grown overnight in YPD, diluted in new medium andgrown for 4 h at 30°C for yeast cell growth or at 37°C in the presenceof 10% serum to induce Wlament formation. Cells were then Wxed andstained with rhodamine-phalloidin. Bright-Weld and Xuorescence im-ages showing the actin cytoskeleton of the indicated strains are shown.a DiVerential eVect on cortical actin patch assembly of SLA1-UAU1insertions compared to the wild type. b Reintegration of SLA1 comple-ments the actin patch defect of the sla1 complete ORF-deletion mutant.In vivo localization of Sla1-GFP was done without Wxation. Bars 5 �m

SC5314 sla1::UAU1-CAP025 sla1::UAU1-CAP026 A

B SC5314 sla1 sla1,

BUD3/bud3::SLA1 SLA1-GFP/sla1

123

Curr Genet (2010) 56:309–319 315

e.g. the hyphal tip. This localization pattern resembles, forexample, that of C. albicans Abp1 and other proteinsinvolved in actin patch assembly or endocytosis (Martinet al. 2007).

The N-terminal SH3-domains of Sla1 are important for actin cytoskeleton assembly but not for localization of Sla1

To demonstrate that the two N-terminally located SH3-domains of Sla1 contribute to the function of Sla1, we gen-erated a truncated allele, sla1�SH3#1,2. This allele was placedunder control of the regulatable MAL2-promoter using aPCR-based gene targeting approach, which at the sametime eliminated the Wrst two SH3-domains. Furthermore, tobe able to localize the truncated protein, a C-terminal tagwas added to sla1�SH3#1,2. This strain was then used to visu-alize both the localization of Sla1�SH3#1,2-GFP and the orga-nization of actin cytoskeleton in yeast and hyphal cells(Fig. 4). When grown in glucose, sla1�SH3#1,2 expressionwas turned down and the protein could not be detected.Actin organization resembled that of a sla1 mutant strain(compare Figs. 3, 4). Growth in maltose medium inducedthe expression of sla1�SH3#1,2-GFP. Hence Sla1�SH3#1,2-GFP could be detected as cortical patches in yeast andhyphal cells. Sla1�SH3#1,2-GFP was also found enriched inthe hyphal tips. Thus, Sla1�SH3#1,2-GFP localizes in a similarmanner as full length Sla1-GFP indicating that the N-terminalSH3 domains do not play a role in Sla1-targeting to thecortex. However, under inducing conditions the actin cyto-skeleton assembly in the strain expressing Sla1�SH3#1,2-GFPwas still aberrant. Cortical actin patches that did not

localize to the hyphal tip were reduced in number and thusresembled the situation in the sla1 deletion strain. Thisindicates that the N-terminal SH3 domains of Sla1 do playan important role in organization of the actin cytoskeletonat sites of endocytosis (Fig. 4).

NBP2-deletion leads to multiple germ tube formation

Deletion of NBP2 did not reveal any defects during theyeast growth phase. Yet, under hyphal inducing conditions,we observed that all germ cells developed multiple germtubes after 4 h and the length of the primary germ tube wasdecreased in nbp2 compared to that of the wild type(Figs. 2, 5). Previously, it was shown in C. albicans andAshbya gossypii that in hyphae large vacuoles are formed insubapical compartments (Walther and Wendland 2004a;Veses and Gow 2008). This inXuences the ratio of cyto-plasm versus vacuole and inXuences the branching fre-quency (Veses et al. 2009). Therefore, we analyzed thevacuolar compartments in FM4-64 stained yeast cells andhyphae of the wild type and the nbp2 mutant (Fig. 5). Dur-ing yeast growth, both strains accumulated a larger vacuolein mother cells and showed no observable diVerence. How-ever, staining of germlings revealed the inability of nbp2germ cells to generate large vacuolar compartments. Frag-mented vacuoles were found throughout nbp2 hyphae.Thus, the altered ratio of cytoplasm versus vacuolar spacemay be the causal link to increased branching of germ cellsin the nbp2 mutant. To corroborate that the defect in vacuo-lar fusion was speciWc for the nbp2 deletion strain, we rein-tegrated the NBP2 gene at the BUD3-locus. As expected,

Fig. 4 The two amino terminal SH3-domains of Sla1 are re-quired for the organization of the actin cytoskeleton. CAP221 was grown overnight in YPD for a full SLA1 shut-down. Then cells were diluted in either YPD (re-pressed) or YPM (induced) with or without serum and grown for 4 h. Afterwards, cells were Wxed and stained with rhodamine-phalloidin prior to GFP and actin Xuorescence microscopy. Bar 5 �m

DIC DIC DIC DICGFP actin GFP actin

MAL2p-sla1 SH3#1,2-GFP repressed MAL2p-sla1 SH3#1,2-GFP induced

123

316 Curr Genet (2010) 56:309–319

the reintegrant showed wild type vacuolar phenotype. Wealso generated a chromosomally encoded NBP2-GFP,which, however, did not yield a Xuorescent signal. To ana-lyze vacuolar acidiWcation in the nbp2 strain, we used quin-acrine staining and Xuorescence microscopy (Fig. 6).Quinacrine diVuses through membranes and accumulates inacidic compartments like the vacuole (Weisman et al.1987). The accumulation of the dye and staining of vacu-oles of nbp2 hyphae indicated that vacuolar fusion but notthe function of the vacuoles was aVected in the nbp2 strain(Fig. 6, 7).

Depletion of Cyk3 results in cytokinesis defects

We were unable to generate homozygous cyk3 strains frominitial heterozygous mutants, without also generating sometriplication event that left a wild-type copy of the gene inthe genome. Thus, we conclude that CYK3 is an essentialgene. In S. cerevisiae, CYK3 is involved in cytokinesis andlocalizes to the bud neck in large budded cells (Korineket al. 2000). Cyk3 localization in C. albicans was deter-mined by producing a fusion between the chromosomalCYK3 gene with GFP in a heterozygous mutant. In C. albi-cans, CYK3 was found to localize at the bud neck in largebudded cells similar to Cyk3 in S. cerevisiae (Fig. 5a).

In S. cerevisiae, deletion of CYK3 results in only mildcytokinesis defects, which contrasts the situation inC. albicans. To assess a phenotype upon depletion of CYK3transcript, we produced a strain which expressed CYK3 from

the regulatable C. albicans MET3 promoter (Care et al.1999). Shutdown of CYK3 expression resulted in a severecytokinesis defect. CYK3-depleted cells were elongated ormisshapen and showed abnormal chitin deposition (Fig. 5b).

Discussion

In this study, we have generated C. albicans mutant strainsfor three SH3-domain encoding genes using PCR-basedgene targeting methodologies and a single-step transforma-tion protocol with UAU1 cassettes (Walther and Wendland2008; Nobile and Mitchell 2009). SH3-domains are smallprotein domains that promote protein–protein interactions,particularly by binding to proline-rich ligands with a PxxPmotif (Mayer 2001). The binding aYnity and binding spec-iWcity are inherently rather low. This may pose some diY-culties when trying to establish protein interactions usingthe yeast two-hybrid system. Sla1, on the other hand, con-tains three SH3 domains, which may help to increase spe-ciWc binding of target proteins.

Given the strong potential of SH3-domains to promotesignaling and morphogenesis, a large variety of SH3-domain

Fig. 5 Deletion of NBP2 results in vacuolar fragmentation in hyphae.Strains were grown under yeast or germ tube inducing conditions for4 h. FM4-64 (0.2 �g/ml) was added and samples were processed forbrightWeld and Xuorescence microscopy after 1 h to allow uptake of thedye. Bars 5 �m

SC5314 nbp2

nbp2,BUD3/bud3::NBP2

Fig. 6 Vacuoles of an nbp2 mutant strain are acidic. Strains weregrown under yeast or germ tube inducing conditions for 4 h. Quina-crine staining reveals acidiWed and functional vacuoles

123

Curr Genet (2010) 56:309–319 317

proteins can be found in eukaryotic genomes ranging from20–30 in yeast-like ascomycetes to over 300 in humans(Karkkainen et al. 2006). In yeast-like ascomycetes, thereseems to be limited evolution of SH3-domain encodinggenes. For example, in S. cerevisiae, Abp1 contains oneSH3-domain, while in C. albicans, the Abp1 homolog hastwo adjacent SH3-domains, yet deletion of CaABP1showed no discernible phenotype (Martin et al. 2007).

Deletion of the C. albicans SLA1 resulted in similar actinassembly defects compared to a SLA1 deletion in S. cerevi-siae. The severe reduction in actin patches, however, didnot abolish the ability to generate germ tubes in the C. albi-cans sla1 mutants although a decreased polarized growthrate could be observed. A similar phenotype was observedin a Camyo5(S366D) allele, which mimics a phosphory-lated serine. A strain bearing this allele was found to Wla-ment, yet shows a largely delocalized actin cytoskeleton(Oberholzer et al. 2002). In this paper, we identiWed theN-terminal region of C. albicans Sla1 containing two SH3-domains to be required for correct organization of the actincytoskeleton. In S. cerevisiae, Sla1 localizes to the cortexvia an interaction of the Sla1 C-terminal repeat region withEnd3 (Tang et al. 2000; Warren et al. 2002). Furthermore,Sla1 interacts with Las17 and Abp1 as shown by immuno-precipitation (Warren et al. 2002). The elimination of twoSH3 domains from Sla1 resulted in profound disorganizationof the actin cytoskeleton indentifying Sla1 as a major

player linking early events of endocytosis with the actincytoskeleton. Nevertheless, sla1 mutants were able to gen-erate, albeit short, hyphae.

Surprisingly, sla1 did not show a defect in the formationof large subapical vacuoles (see also Fig. 2). This, on theother hand, was observed for the nbp2 mutant. In S. cerevi-siae, nbp2 mutants are temperature sensitive and also sensi-tive to cell wall stress (Ohkuni et al. 2003). Our C. albicansnbp2 mutants were not temperature sensitive and grew wellat 40°C even with the addition of 1 M sorbitol or 1.5 MNaCl (data not shown). The transformation frequency,which requires a heat shock, was also not aVected in nbp2cells. Thus, our results indicate some novel vacuolar func-tions for NBP2 which are more pronounced during hyphalgrowth stages and not apparent in yeast cells. Germ tubeformation in the nbp2 strain was altered in a way that germcells quickly generated multiple hyphae rather than onedominant germ tube as in the wild type. Thus, such a phe-notype could be useful in larger scale screenings of aC. albicans mutant collection once available.

SH3-domain proteins in C. albicans are taking part in avariety of processes. In this study, we identiWed a key roleof the Wrst two Sla1 SH3-domains for the polarized assem-bly of the actin cytoskeleton, which had not previouslybeen identiWed in other studies. We also revealed theinvolvement of Nbp2 in vacuolar fusion, and of Cyk3 incytokinesis. The promoter shutdown experiment using

Fig. 7 CYK3 localization and depletion after promoter shut-down. a Cyk3-GFP Xuorescence in large budded yeast cells was observed at the bud neck. b Cells in which CYK3 expression is controlled by the regulatable MET3-promoter were grown overnight in YPD at 30°C with (repressed) or without (induced) the addition of 3.5 mM methio-nine and cysteine. Prior to microscopy, calcoXuor was add-ed to the medium to stain chitin rich regions. Bar 10 �m

A

BMET3p-CYK3

inducedMET3p-CYK3

repressed

123

318 Curr Genet (2010) 56:309–319

MET-promoter controlled CYK3 did not result in growtharrest. This may be due to the leakiness of the promoter.However, cells were found to be deWcient in cell separationproviding evidence that also in C. albicans Cyk3 isinvolved in this process. Our GFP-localization data ofCyk3-GFP provide further evidence for that. Similar toS. cerevisiae, C. albicans Cyk3 may, therefore, act at thelevel of actin ring formation or constriction.

Due to the diploidy of C. albicans, gene function analy-ses still require much more eVort to produce the correctdeletion strains. Using PCR-based gene targeting methods,detailed structure–function analyses are possible andreduce the time required to construct the desired strains.Thus, larger scale approaches can be undertaken also inC. albicans (Noble and Johnson 2005). Our study of threepreviously uncharacterized C. albicans genes, therefore,adds to the repository of functional analysis information forthis human fungal pathogen.

Acknowledgments We thank Alexander Johnson, Suzanne Noble,and Aaron Mitchell for generously providing reagents used in thisstudy; Sidsel Ehlers for providing technical assistance and AndreaWalther for support on microscopy. This study was funded by the EU-Marie Curie Research Training Network “Penelope” and we thankmembers of this consortium for discussions.

References

am Busch MS, Mignon D, Simonson T (2009) Computational proteindesign as a tool for fold recognition. Proteins 77:139–158

Barelle CJ, Richard ML, Gaillardin C, Gow NA, Brown AJ (2006)Candida albicans VAC8 is required for vacuolar inheritance andnormal hyphal branching. Eukaryot Cell 5:359–367

Bassilana M, Blyth J, Arkowitz RA (2003) Cdc24, the GDP-GTP ex-change factor for Cdc42, is required for invasive hyphal growthof Candida albicans. Eukaryot Cell 2:9–18

Bauer J, Wendland J (2007) Candida albicans SX1 suppresses Xoccu-lation and Wlamentation. Eukaryot Cell 6:1736–1744

Berman J, Sudbery PE (2002) Candida albicans: a molecular revolutionbuilt on lessons from budding yeast. Nat Rev Genet 3:918–930

Calderone RA, Fonzi WA (2001) Virulence factors of Candida albi-cans. Trends Microbiol 9:327–335

Care RS, Trevethick J, Binley KM, Sudbery PE (1999) The MET3 pro-moter: a new tool for Candida albicans molecular genetics. MolMicrobiol 34:792–798

Court H, Sudbery P (2007) Regulation of Cdc42 GTPase activity in theformation of hyphae in Candida albicans. Mol Biol Cell 18:265–281

Enloe B, Diamond A, Mitchell AP (2000) A single-transformationgene function test in diploid Candida albicans. J Bacteriol182:5730–5736

Epp JA, Chant J (1997) An IQGAP-related protein controls actin-ringformation and cytokinesis in yeast. Curr Biol 7:921–929

Gillum AM, Tsay EY, Kirsch DR (1984) Isolation of the Candida albi-cans gene for orotidine-5�-phosphate decarboxylase by comple-mentation of S. cerevisiae ura3 and E. coli pyrF mutations. MolGen Genet 198:179–182

Gola S, Martin R, Walther A, Dunkler A, Wendland J (2003) Newmodules for PCR-based gene targeting in Candida albicans: rapid

and eYcient gene targeting using 100 bp of Xanking homology re-gion. Yeast 20:1339–1347

Karkkainen S, Hiipakka M, Wang JH, Kleino I, Vaha-Jaakkola M,Renkema GH, Liss M, Wagner R, Saksela K (2006) IdentiWcationof preferred protein interactions by phage-display of the humanSrc homology-3 proteome. EMBO Rep 7:186–191

Korinek WS, Bi E, Epp JA, Wang L, Ho J, Chant J (2000) Cyk3, a nov-el SH3-domain protein, aVects cytokinesis in yeast. Curr Biol10:947–950

Kumamoto CA, Vinces MD (2005) Contributions of hyphae and hy-pha-co-regulated genes to Candida albicans virulence. CellMicrobiol 7:1546–1554

Martin R, Hellwig D, Schaub Y, Bauer J, Walther A, Wendland J(2007) Functional analysis of Candida albicans genes whose Sac-charomyces cerevisiae homologues are involved in endocytosis.Yeast 24:511–522

Mayer BJ (2001) SH3 domains: complexity in moderation. J Cell Sci114:1253–1263

Michel S, Ushinsky S, Klebl B, Leberer E, Thomas D, Whiteway M,Morschhauser J (2002) Generation of conditional lethal Candidaalbicans mutants by inducible deletion of essential genes. MolMicrobiol 46:269–280

Nobile CJ, Mitchell AP (2009) Large-scale gene disruption using theUAU1 cassette. Methods Mol Biol 499:175–194

Noble SM, Johnson AD (2005) Strains and strategies for large-scalegene deletion studies of the diploid human fungal pathogen Can-dida albicans. Eukaryot Cell 4:298–309

Oberholzer U, Marcil A, Leberer E, Thomas DY, Whiteway M (2002)Myosin I is required for hypha formation in Candida albicans.Eukaryot Cell 1:213–228

Odds FC (1994) Pathogenesis of Candida infections. J Am Acad Der-matol 31:S2–S5

Ohkuni K, Okuda A, Kikuchi A (2003) Yeast Nap1-binding proteinNbp2p is required for mitotic growth at high temperatures and forcell wall integrity. Genetics 165:517–529

Pruyne D, Bretscher A (2000a) Polarization of cell growth in yeast.J Cell Sci 113:571–585

Pruyne D, Bretscher A (2000b) Polarization of cell growth in yeast. I.Establishment and maintenance of polarity states. J Cell Sci113:365–375

Schaub Y, Dunkler A, Walther A, Wendland J (2006) New pFA-cas-settes for PCR-based gene manipulation in Candida albicans.J Basic Microbiol 46:416–429

Sudbery P, Gow N, Berman J (2004) The distinct morphogenic statesof Candida albicans. Trends Microbiol 12:317–324

Tang HY, Xu J, Cai M (2000) Pan1p, End3p, and S1a1p, three yeastproteins required for normal cortical actin cytoskeleton organiza-tion, associate with each other and play essential roles in cell wallmorphogenesis. Mol Cell Biol 20:12–25

Veses V, Gow NA (2008) Vacuolar dynamics during the morphoge-netic transition in Candida albicans. FEMS Yeast Res 8:1339–1348

Veses V, Richards A, Gow NA (2009) Vacuole inheritance regulatescell size and branching frequency of Candida albicans hyphae.Mol Microbiol 71:505–519

Walther A, Wendland J (2003) An improved transformation protocolfor the human fungal pathogen Candida albicans. Curr Genet42:339–343

Walther A, Wendland J (2004a) Apical localization of actin patchesand vacuolar dynamics in Ashbya gossypii depend on the WASPhomolog Wal1p. J Cell Sci 117:4947–4958

Walther A, Wendland J (2004b) Polarized hyphal growth in Candidaalbicans requires the Wiskott–Aldrich Syndrome protein homo-log Wal1p. Eukaryot Cell 3:471–482

Walther A, Wendland J (2008) PCR-based gene targeting in Candidaalbicans. Nat Protoc 3:1414–1421

123

Curr Genet (2010) 56:309–319 319

Warren DT, Andrews PD, Gourlay CW, Ayscough KR (2002) Sla1pcouples the yeast endocytic machinery to proteins regulating actindynamics. J Cell Sci 115:1703–1715

Weisman LS, Bacallao R, Wickner W (1987) Multiple methods ofvisualizing the yeast vacuole permit evaluation of its morphologyand inheritance during the cell cycle. J Cell Biol 105:1539–1547

Wendland J (2001) Comparison of morphogenetic networks of Wla-mentous fungi and yeast. Fungal Genet Biol 34:63–82

Wendland J, Philippsen P (2002) An IQGAP-related protein, encodedby AgCYK1, is required for septation in the Wlamentous fungusAshbya gossypii. Fungal Genet Biol 37:81–88

Winzeler EA, Shoemaker DD, AstromoV A, Liang H, Anderson K,Andre B, Bangham R, Benito R, Boeke JD, Bussey H, Chu AM,

Connelly C, Davis K, Dietrich F, Dow SW, El Bakkoury M,Foury F, Friend SH, Gentalen E, Giaever G, Hegemann JH, JonesT, Laub M, Liao H, Liebundguth N, Lockhart DJ, Lucau-Danila A,Lussier M, M’Rabet N, Menard P, Mittmann M, Pai C,Rebischung C, Revuelta JL, Riles L, Roberts CJ, Ross-MacDonald P,Scherens B, Snyder M, Sookhai-Mahadeo S, Storms RK, VeronneauS, Voet M, Volckaert G, Ward TR, Wysocki R, Yen GS, Yu K,Zimmermann K, Philippsen P, Johnston M, Davis RW (1999)Functional characterization of the S. cerevisiae genome by genedeletion and parallel analysis. Science 285:901–906

Zheng XD, Lee RT, Wang YM, Lin QS, Wang Y (2007) Phosphoryla-tion of Rga2, a Cdc42 GAP, by CDK/Hgc1 is crucial for Candidaalbicans hyphal growth. EMBO J 26:3760–3769

123

24

PART VI

25

PART VI –

Candida albicans Vrp1 is required for polarized

morphogenesis and interacts with Wal1 and Myo5

Nicole Borth1, 2, §

, Andrea Walther1, 2

, Patrick Reijnst1; Sigyn Jorde

1,

Yvonne Schaub2, $

, and Jürgen Wendland1, 2, *

1Carlsberg Laboratory, Yeast Biology, Gamle Carlsberg Vej 10, DK-2500 Valby, Denmark

2Junior Research Group: Growth Control of Fungal Pathogens, Leibniz Institute for Natural Product

Research and Infection Biology - Hans-Knöll Institute and Department of Microbiology, Friedrich-

Schiller University, D-07745 Jena, Germany *Corresponding author: Jürgen Wendland, Carlsberg Laboratory, Yeast Biology, Gamle Carlsberg Vej

10, DK-2000 Valby, Copenhagen, Denmark

Email: jww@crc.dk ; Phone: +45/3327 5230; Fax: +45/3327 4708 § present address: Cell and Molecular Biology; Leibniz Institute for Natural Product Research and

Infection Biology - Hans-Knöll Institute, D-07745 Jena, Germany $ present address: Leibniz Institute for Age Research - Fritz Lipmann Institute; D-07745 Jena, Germany

Running title: C. albicans VRP1

Key words: endocytosis, polarized hyphal growth, PCR, pFA-plasmids, actin

cytoskeleton

Abstract

Recently, a link between endocytosis and hyphal morphogenesis has been

established in C. albicans via the Wiskott-Aldrich Syndrome homolog WAL1. To get a

more detailed mechanistic understanding of this link we have investigated a

potentially conserved interaction between Wal1 and the C. albicans WASP-interacting

protein (WIP)-homolog encoded by VRP1. Deletion of both alleles of VRP1 results in

strong hyphal growth defects under serum inducing conditions but filamentation can

be observed on spider medium. Mutant vrp1 cells show a delay in endocytosis -

measured as the uptake and delivery of the lipophilic dye FM4-64 to the vacuole -

compared to the wild type. Vacuolar morphology was found to be fragmented in

subset of cells and the cortical actin cytoskeleton was depolarized in vrp1 daughter

cells. The morphology of the vrp1 null mutant could be complemented by

reintegration of the wild type VRP1 gene at the BUD3-locus. Using the yeast two-

hybrid system we could demonstrate an interaction of the C-terminal part of Vrp1 with

the N- terminal part of Wal1, which contains the WH1-domain. Furthermore, we

26

found that Myo5 has several potential interaction sites on Vrp1. This establishes an

important role of the Wal1-Vrp1-Myo5 complex in endocytosis and polarized

localization of the cortical actin cytoskeleton to promote polarized hyphal growth in

C. albicans.

Introduction

Candida albicans is a pathogenic yeast that can respond to environmental cues by

forming hyphal filaments. This morphogenetic switch is regarded as one of several

attributes, which enable C. albicans to cause disease (Sudbery et al., 2004; Whiteway

and Oberholzer, 2004; Whiteway and Bachewich, 2007). Hyphal growth is an extreme

form of polarized morphogenesis that requires constant delivery of vesicles to support

tip growth and remodelling of the cell wall at the tip. The actin cytoskeleton plays an

important role both by providing tracks for delivery of vesicles to the tip along actin

cables and via actin patches at sites of endocytosis (Pruyne and Bretscher, 2000;

Kaksonen et al., 2005). Balanced secretion and endocytosis are also important for the

maintenance of polarized morphogenesis, although a mechanistic link has not been

established so far (Aghamohammadzadeh and Ayscough, 2009). Two genes that play

a crucial role for endocytosis in C. albicans are the myosin I, encoded by CaMYO5,

and the Wiskott-Aldrich syndrome homolog, CaWAL1 (Oberholzer et al., 2004;

Walther and Wendland, 2004). In S. cerevisiae their corresponding homologs,

ScMYO3/5 and LAS17 have been shown to activate the Arp2/3-complex to promote

actin polarization at sites of endocytosis (Evangelista et al., 2000; Machesky, 2000;

D‟Agostino and Goode, 2005). Deletion of CaMYO5 leads to viable mutant strains

that cannot undergo hyphal development. Yeast cells of Camyo5 show depolarization

of the actin cytoskeleton, which also affects budding pattern (Oberholzer et al., 2002,

2004). Similarly, deletion of CaWAL1 results in mutant strains that are unable to

generate hyphal filaments. During yeast growth depolarization of the actin

cytoskeleton leads to the formation of round cells that show an increase in random

budding. Additionally, loss of CaWAL1 leads to defects in the endocytosis of the

lipophilic dye FM4-64 as well as defects in vacuolar fusion. Fragmented vacuoles

have been observed in other mutant strains, e.g. in vac1 or vps11. These strains were

also shown to be defective in hyphal morphogenesis (Palmer et al., 2003, Franke et al.,

2006). Characteristically, during hyphal growth large vacuoles are formed in the germ

27

cell and in the rear parts of hyphal filaments. The unequal distribution of vacuoles was

also shown to influence the timing of branch-emergence (Veses et al., 2008).

Fragmented vacuoles, per se, however, do not abolish polarized morphogenesis, which

was recently also shown in a Caboi2 mutant (Reijnst et al.,2010).

The functional overlap of C. albicans Myo5 and Wal1 and their rather similar

mutant phenotypes suggest that both proteins can function in a complex in C. albicans.

In mammalian cells WASP was shown to interact with the Wasp-interacting protein,

WIP (Ramesh et al., 1997; Thrasher and Burns, 2010). WIP suppresses growth defects

of the S. cerevisiae end5/vrp1 mutant (Vaduva et al., 1999). ScEnd5/Vrp1 is a very

proline-rich protein which is involved in cytoskeletal organization and can interact

with both Las17 and Myo5 (Anderson et al., 1998; Evangelista et al., 2000; Munn and

Thanabalu, 2009). The temperature sensitivity and loss of viability of an end5-1/vrp1

mutant can be suppressed by overexpression of ScLAS17 (Naqvi et al., 1998). Loss of

End5/Vrp1 results in severe defects in cytokinesis and Hof1 cannot be recruited to the

bud neck (Ren et al., 2005).

Here we describe the analysis of the C. albicans VRP1 homolog. The mutant

strain shows defects in hyphal growth, endocytosis, organization of the actin

cytoskeleton, and budding pattern similarly to - but less pronounced than – the wal1

and myo5 mutant strains. Using two-hybrid studies in S. cerevisiae we could show that

Vrp1 interacts strongly with the N-terminal domain of Wal1 and provides multiple

docking sites for Myo5. This data provides evidence for a Wal1-Vrp1-Myo5 complex

required for endocytosis and polarized morphogenesis in C. albicans.

Material and methods

Strains and media

C. albicans strain SN148 (Noble and Johnson, 2005) was used to generate the

vrp1 heterozygous and homozygous mutant strains. For the yeast two-hybrid

experiment the following strains were used: PJ69-4a: trp1-901; leu2-3,112; ura3-52;

his3-200; gal4 ; gal80 ; lys2::GAL1-HIS3; GAL2p-ADE2; met2::GAL7-lacZ and

PJ69-4alpha: trp1-901; leu2-3,112; ura3-52; his3-200; gal4 ; gal80 ; lys2::GAL1-

HIS3; GAL2p-ADE2; met2::GAL7-lacZ. Strains were grown either in yeast

extract/peptone/dextrose (YPD; 1 % yeast extract, 2 % peptone, 2 % dextrose) or in

28

minimal media (CSM; complete supplement mixture; 6.7 g/l yeast nitrogen base

(YNB) with ammonium sulphate and without amino acids, 0.69 g/l CSM; 20 g/l

glucose) or SD (6.7 g/l YNB with ammonium sulphate and without amino acids, 20 g/l

glucose) with the addition of required amino acids and uridine. Hyphal formation was

induced with 10 % serum at 37°C or upon incubation on Spider medium. Escherichia

coli strain DH5 served as a host for plasmid propagation.

Transformation and strain construction

S. cerevisiae and C. albicans were transformed using the lithium acetate

procedure (Walther and Wendland, 2003; Gietz and Schiestl, 2007). Independent

homozygous mutant strains were constructed using the PCR-based gene targeting

method (Walther and Wendland, 2008). To delete both ORFs of VRP1 by sequential

transformation of SN148 resulted in the heterozygous strains CAB9

(VRP1/vrp1::ARG4) and CAB10 (VRP1/vrp1::URA3) and then in the homozygous

strains CAB12 (vrp1::ARG4/vrp1::CdHIS1) and CAB13

(vrp1::URA3/vrp1::CdHIS1). To complement the Δvrp1 phenotype, VRP1 was

amplified from genomic DNA and ligated in pDrive, generating #C597. The insert was

cloned in #C873, which contains the BUD3 locus for integration and CmLEU2 as

selectable marker using SalI and BamHI restriction sites. This generated #C598. The

Δvrp1 homozygous mutant strain CAB13 was transformed with SpeI linearized

#C598, generating CAP225.

Strain CAT41 was generated by targeting a GFP-HIS1 cassette to the C. albicans

TEF1-locus. Standard PCR-based gene targeting and verification procedures as well as

pFA-plasmids for cassette generation were used as described (Walther and Wendland,

2008). Primers were obtained from biomers.net GmbH (Ulm, Germany) and

sequences will be made available upon request.

Plasmid constructs

For the yeast two-hybrid experiments freely replicating plasmids were generated

using pGAD424 and pGBT9 (Clontech) as backbones. These plasmids contain the

Gal4 transcription factor activation domain or the Gal4-DNA-binding domain,

respectively. Restriction fragments of WAL1, VRP1, and the region encompassing

29

SH3-domain of MYO5 were amplified from genomic DNA or plasmid clones and

cloned into the corresponding restriction sites of pGAD424/pGBT9. Primers used for

amplification and cloning will be made available upon request. Correct cloning was

verified by sequencing (Eurofins MWG Operon, Ebersberg, Germany).

Microscopy and staining procedures

Microscopic analyses were done with an Axio-Imager microscope (Zeiss, Jena

and Göttingen, Germany) using Metamorph 7 software tools (Molecular Devices

Corp., Downington, PA, USA) to drive the automated image acquisition procedures.

Images were acquired on a MicroMax1024 CCD-camera (Princeton Instruments,

Trenton NJ, USA). Fluorescence microscopy was performed using the appropriate

filter combinations for FM4-64-imaging and actin-staining as described previously

(Walther and Wendland, 2004; Martin et al., 2005). Samples were analyzed by

generating either single images or Z-stacks of up to 20 images that were processed into

single plane projections using Metamorph software.

Yeast two-hybrid analysis

S. cerevisiae was transformed with two plasmids expressing constructs fused to

either the Gal4-DNA-binding domain based on plasmid pGBT9 or the Gal4-activation

domain based on plasmid pGAD424. Transformants were grown on media selecting

for the maintenance of both plasmids (-Trp; -Leu). White colonies reveal an

interaction of the two expressed fusion proteins, which results in the expression of the

ADE2 reporter gene, whereas red colonies appear when the ADE2-reporter could not

be activated. For quantitative analysis liquid culture ß-galactosidase assays were

performed. To this end, strains were incubated over night at 30°C. Cells were

harvested by centrifugation, protein extracts were prepared using a liquid nitrogen-

glass-bead method and the conversion of ONPG (ortho-nitrophenyl-β-D-

galactopyranoside) was measured photometrically (Rose and Botstein, 1983).

30

Results

Sequence comparisons

The C. albicans homolog of S. cerevisiae END5/VRP1 has been identified as

orf19.2190. C. albicans VRP1 encodes a very proline-rich protein of 664 amino acids,

of which 154 residues are proline. Sequence comparisons with other fungal homologs

were done using the clustal W alignment tools (Fig. 1). The N-terminal region of

CaVrp1p contains a proline stretch present in most fungi, only annotated to be absent

in Ashbya gossypii. Reinspection of the VRP1-locus in A. gossypii, however, indicates

that there is a polyproline region upstream of the annotated start codon. Furthermore, a

Vrp1 homolog in the closely related Eremothecium cymbalariae also contains this

polyproline region at the N-terminus of EcVrp1 (our unpublished results).

Downstream of the polyproline region in Vrp1 two putative Wasp Homology 2

(WH2)-domains are located. Here, the filamentous ascomycete Neurospora crassa

lacks the second putative WH2-domain. In S. cerevisiae a short region after the second

WH2-domain has been characterized as a docking site for Hof1 (Ren et al., 2005).

This Hof1-trap (HOT)-domain seems to be rather specific for S. cerevisiae as it is not

found in the other fungal species analyzed (Fig. 1A). The central part of Vrp1

orthologs exhibits only a low degree of amino acid sequence conservation not

regarding the many proline-rich stretches. Whereas the C-terminal regions in fungal

Vrp1 proteins show better conservation. This domain has been characterized as the

Las17p-binding domain (Naqvi et al., 1998; Madania et al., 1999; Fig. 1B).

Generation of C. albicans vrp1 mutant strains

To delete both alleles of C. albicans VRP1 a PCR-based gene targeting approach

was applied (Walther and Wendland, 2008). Initially, independent heterozygous

mutant strains were generated in which the ORF of one allele of VRP1 was deleted by

either the C. albicans ARG4 or URA3 marker gene. To generate homozygous mutant

strains based on these heterozygous strains, the remaining copy of VRP1 was deleted

using the Candida dubliniensis HIS1 gene. Verification of correct gene targeting and

the absence of the VRP1-ORF in the homozygous mutant strains CAB11 and CAB13

was done by diagnostic PCR (Fig. 2).

31

Phenotypic assay of growth morphology of mutant strains

The heterozygous and homozygous VRP1-deletion strains were compared to the

SC5314 wild type, the SN148 strain used as a host for transformation, and a wal1

mutant strain deleted for the C. albicans homolog of the human Wiskott-Aldrich

Syndrome protein, described previously (Walther and Wendland, 2004). Hyphal

induction was tested on Spider medium, which uses mannitol as the primary carbon

source. The wild type showed strong filamentation at the edge of the colony, whereas

the wal1 strain was afilamentous. The SN148 precursor strain also showed a strong

increase in colony wrinkling, which was also found in the heterozygous VRP1/vrp1

strain. The homozygous vrp1 strain did not show this colony wrinkling phenotype.

Yet, the colony edges of the mutant vrp1 strain showed invasive filamentous growth

(Fig. 3A). Hyphal induction in liquid media was done using serum as an inducing cue.

Here the wild type showed abundant filamentation. SN148 was slightly weaker in

filamentation (due to the ura3 deletion) and wal1 again showed no hyphal formation.

The VRP1/vrp1 strain filamented basically like the wild type, whereas the vrp1 mutant

strain did not filament well and produced instead a large number of pseudohyphal cells

and yeast cells (Fig. 3A). The distribution of cell types after hyphal induction in the

various strains used was quantified counting >100 cells for each strain (Fig. 3B).

These analyses indicated a strong defect in hyphal formation of the vrp1 mutant,

which was however, slightly less severe than in the wal1 mutant. This is in line with

the filamentation assay on Spider medium. To demonstrate that these filamentation

defects are solely due to the deletion of the VRP1 gene, we reintegrated the VRP1 gene

at the BUD3-locus in a vrp1/vrp1 mutant strain (see Materials and methods). This

reintegrant was phenotypically like wild type, e.g. when assayed for germ tube

production (Fig. 3C).

Analysis of the actin cytoskeleton in the vrp1 mutant

Hyphal growth defects may be associated with an altered organization of the actin

cytoskeleton. Therefore we used rhodamine-phalloidin staining of fixed cells to

analyze the distribution and polarization of the cortical actin cytoskeleton. Wild type

cells show a polarization of cortical actin in the emerging bud and at the hyphal tip.

The actin cytoskeleton of the wal1 mutant has been shown to be largely depolarized

during all growth stages. In the vrp1 mutant such a depolarization could also be

32

observed in yeast and pseudohyphal cells. Remarkably, in both yeast and hyphal

stages the apical growth region showed more intense staining indicating an

accumulation of actin at sites of polarized growth (Fig. 4A). Analysis of the budding

pattern via fluorescence microscopy of the bud scars showed that the vrp1 mutant is

able to generate a bipolar budding pattern as found in the wild type (Fig. 4B).

Vrp1 mutants show defects in vacuolar fusion and endocytosis

Altered polarization of the actin cytoskeleton may also impact endocytosis. To

study vacuolar morphology and endocytosis we employed the lipophilic dye FM4-64.

In a time-lapse movie we compared at the same time uptake of FM4-64 between the

vrp1 mutant and a wild-type strain expressing a GFP, which localizes to the

cytoplasm. Within 20min the dye had been taken up via endocytosis and delivered to

the vacuole in the wild type. This staining of wild type vacuoles further increased over

time. Compared to that the vrp1 mutant showed a delayed uptake and only after more

than an hour smaller vacuoles became stained (Fig. 5). A quantitative analysis on the

number of vacuoles in vrp1 and wild type cells showed a slight increase in the number

of vacuoles in the vrp1 mutant compared to the wild type. This vrp1 phenotype is thus

somewhat intermediate between the wal1 mutant and the wild type (Fig. 6).

Two hybrid analyses reveal a myosin I- Vrp1-Wal1 complex

In S. cerevisiae Vrp1 was shown to interact with the Src homology domain 3

(SH3) of the yeast type I myosin, Myo5p, and the WASP homlog Las17 (Evangelista

et al., 2000). To analyze if such a Las17-Vrp1-Myo5 complex also exists in

C. albicans we performed yeast two-hybrid analyses (Fig. 7). In this assay we found

that the C-terminal part of Vrp1 interacts strongly with the N-terminal part of Wal1

containing the WH1-B domains. Interaction of Vrp1 with full-length Wal1 protein was

somewhat weaker. Highest ß-galactosidase activity was obtained with a Wal1

fragment in which the central part of WAL1 encoding several proline-rich regions was

removed for the assay. To assay the interaction of the myosin I SH3 domain with Vrp1

we used two fragments containing the N- and C-termini of Vrp1, respectively, and a

fragment containing only the SH3-domain of Myo5. Here, the Myo5 SH3-domain

interacted strongly with at least the C-terminal part of Vrp1 (Fig. 7).

33

Discussion

In this report we have characterized the function of the C. albicans VRP1 gene for

polarized morphogenesis and endocytosis in this dimorphic human pathogen. Cell

polarization in C. albicans is important for budding, filamentation and mating. Cell

polarity establishment occurs either based on intrinsic factors (during budding) or in

response to environmental stimuli (during filamentation and mating) (Whiteway and

Bachewich, 2007). One output of polarity establishment is the polarized organization

of the actin cytoskeleton, which results in the apical positioning of cortical actin

patches and the generation of actin cables emanating from the cell apex (Smith et al.,

2001). Generation of actin cables from the emerging bud or the tip of the hypha has

been fairly well characterized. A cascade from locally activated Rho-type GTPases,

most notably Cdc42, triggers downstream effector genes, e.g. the formin Bni1, which

nucleates actin filaments (Evangelista et al., 2002; Sagot et al., 2002). Bni1 is part of a

complex termed polarisome, which in S. cerevisiae also contains Pea2, Spa2 and Bud6

(Sheu et al., 1998).

Clustered assembly of actin patches occurs at sites of polarized growth. Mutants

in S. cerevisiae and C. albicans that affect the position of actin patches, e.g. in the

LAS17/WAL1 or MYO3/5 genes, show defects in polarized growth (Li, 1997; Lechler

et al., 2000; Oberholzer et al., 2002, Walther and Wendland, 2004). Las17 and Myo3/5

have been shown to stimulate actin filament formation via the Arp2/3 complex

(Lechler et al., 2000). Mutants in these genes show defects in the assembly and

organization of the actin cytoskeleton and since the actin cytoskeleton is essential for

endocytosis in S. cerevisiae these mutants also show defects in clathrin-mediated

endocytosis (Munn, 2001; Kaksonen et al., 2003). Most of the proteins known to be

involved in endocytosis colocalize with actin patches. Thus actin patches are sites of

endocytosis (Kaksonen et al., 2005).

Deletion of S. cerevisiae VRP1 results in temperature sensitivity and

depolarization of actin patches. Specifically, actin patches do not cluster in emerging

buds (Lambert et al., 2007). We also have observed a depolarization of actin patches

to both mother and daughter cells in the C. albicans vrp1 mutant. Particularly, hyphal

morphogenesis in the vrp1 strains was inhibited - although not abolished as in wal1

cells.

34

Our two-hybrid analysis reveals that a Wal1-Vrp1-Myo5 complex may be formed in

C. albicans similarly to that identified in S. cerevisiae (Evangelista et al., 2000). This

provides a mechanistic explanation for the similar phenotypes of the wal1 and myo5

mutants observed previously. Both of these genes are activators of the Arp2/3

complex, and loss of either of these genes may be more detrimental to cells than loss

of VRP1. Consequently, the observed defects in endocytosis and vacuole formation

were less severe in the vrp1 strains compared to wal1. Interestingly, S. cerevisiae Vrp1

contains a region characterized as Hof1-trap domain, which is essential for binding the

Hof1-SH3-domain (Ren et al., 2005). A Hof1-trap domain could not be identified in

C. albicans Vrp1. Our attempts to identify a two-hybrid interaction of the C. albicans

SH3-domain of Hof1 with Vrp1 were unsuccessful, which may suggest that this

interaction is occurring either with low affinity or not at all (our unpublished results).

On the other hand, it was shown that the SH3-domain of S. cerevisiae Hof1 also

interacts with formins Bnr1 and Bni1, which could provide an alternative route for

localization of Vrp1 to sites of polarized growth and septation (Evangelista et al.,

2003). Formins and Vrp1 may share another feature: binding of profilin. Bni1 binds

via its FH1 domain to profilin. This domain includes a poly-proline stretch similar to

that found at the very N-terminus of Vrp1 homologs, which may explain

mechanistically how Vrp1 contributes to F-actin formation.

Thus our analysis contributes to our understanding of the mechanistic link of

Wal1 and Myo5 in C. albicans. With the defects in hyphal morphogenesis and

endocytosis of the vrp1 mutant strain we have identified another player partaking in

the yeast-to-hyphal switch in C. albicans.

Acknowledgement

We thank Alexander Johnson and Suzanne Noble for generously providing

reagents used in this study. This study was funded by the EU-Marie Curie Research

Training Network “Penelope”.

35

References

Aghamohammadzadeh, S. & Ayscough, K. R. (2009). Differential requirements for

actinduring yeast and mammalian endocytosis. Nat Cell Biol 11, 1039-1042.

Anderson, B. L., Boldogh, I., Evangelista, M., Boone, C., Greene, L. A. & Pon, L.

A. (1998). The Src homology domain 3 (SH3) of a yeast type I myosin, Myo5p, binds

to verprolin and is required for targeting to sites of actin polarization. J Cell Biol 141,

1357-1370.

D'Agostino, J. L. & Goode, B. L. (2005). Dissection of Arp2/3 complex actin

nucleation mechanism and distinct roles for its nucleation-promoting factors in

Saccharomyces cerevisiae. Genetics 171, 35-47.

Evangelista, M., Klebl, B. M., Tong, A. H., Webb, B. A., Leeuw, T., Leberer, E.,

Whiteway, M., Thomas, D. Y. & Boone, C. (2000). A role for myosin-I in actin

assembly through interactions with Vrp1p, Bee1p, and the Arp2/3 complex. J Cell

Biol 148, 353-362.

Evangelista, M., Pruyne, D., Amberg, D. C., Boone, C. & Bretscher, A. (2002). Formins direct Arp2/3-independent actin filament assembly to polarize cell growth in

yeast. Nat Cell Biol 4, 32-41.

Evangelista, M., Zigmond, S. & Boone, C. (2003). Formins: signaling effectors for

assembly and polarization of actin filaments. J Cell Sci 116, 2603-2611.

Franke, K., Nguyen, M., Hartl, A., Dahse, H. M., Vogl, G., Wurzner, R., Zipfel, P.

F., Kunkel, W. & Eck, R. (2006). The vesicle transport protein Vac1p is required for

virulence of Candida albicans. Microbiology 152, 3111-3121.

Gietz, R. D. & Schiestl, R. H. (2007). High-efficiency yeast transformation using the

LiAc/SS carrier DNA/PEG method. Nat Protoc 2, 31-34.

Kaksonen, M., Sun, Y. & Drubin, D. G. (2003). A pathway for association of

receptors, adaptors, and actin during endocytic internalization. Cell 115, 475-487.

Kaksonen, M., Toret, C. P. & Drubin, D. G. (2005). A modular design for the

clathrin- and actin-mediated endocytosis machinery. Cell 123, 305-320.

Lambert, A. A., Perron, M. P., Lavoie, E. & Pallotta, D. (2007). The

Saccharomyces cerevisiae Arf3 protein is involved in actin cable and cortical patch

formation. FEMS Yeast Res 7, 782-795.

Lechler, T., Shevchenko, A. & Li, R. (2000). Direct involvement of yeast type I

myosins in Cdc42-dependent actin polymerization. J Cell Biol 148, 363-373.

Li, R. (1997). Bee1, a yeast protein with homology to Wiscott-Aldrich syndrome

protein, is critical for the assembly of cortical actin cytoskeleton. J Cell Biol 136, 649-

658.

36

Machesky, L. M. (2000). The tails of two myosins. J Cell Biol 148, 219-221.

Madania, A., Dumoulin, P., Grava, S., Kitamoto, H., Scharer-Brodbeck, C.,

Soulard, A., Moreau, V. & Winsor, B. (1999). The Saccharomyces cerevisiae

homologue of human Wiskott-Aldrich syndrome protein Las17p interacts with the

Arp2/3 complex. Mol Biol Cell 10, 3521-3538.

Martin, R., Walther, A. & Wendland, J. (2005). Ras1-induced hyphal development

in Candida albicans requires the formin Bni1. Eukaryot Cell 4, 1712-1724.

Munn, A. L. (2001). Molecular requirements for the internalisation step of

endocytosis: insights from yeast. Biochim Biophys Acta 1535, 236-257.

Munn, A. L. & Thanabalu, T. (2009). Verprolin: a cool set of actin-binding sites and

some very HOT prolines. IUBMB Life 61, 707-712.

Naqvi, S. N., Zahn, R., Mitchell, D. A., Stevenson, B. J. & Munn, A. L. (1998). The

WASp homologue Las17p functions with the WIP homologue End5p/verprolin and is

essential for endocytosis in yeast. Curr Biol 8, 959-962.

Noble, S. M. & Johnson, A. D. (2005). Strains and strategies for large-scale gene

deletion studies of the diploid human fungal pathogen Candida albicans. Eukaryot Cell

4, 298-309.

Oberholzer, U., Marcil, A., Leberer, E., Thomas, D. Y. & Whiteway, M. (2002). Myosin I is required for hypha formation in Candida albicans. Eukaryot Cell 1, 213-

228.

Oberholzer, U., Iouk, T. L., Thomas, D. Y. & Whiteway, M. (2004). Functional

characterization of myosin I tail regions in Candida albicans. Eukaryot Cell 3, 1272-

1286.

Palmer, G. E., Cashmore, A. & Sturtevant, J. (2003). Candida albicans VPS11 is

required for vacuole biogenesis and germ tube formation. Eukaryot Cell 2, 411-421.

Pruyne, D. & Bretscher, A. (2000). Polarization of cell growth in yeast. J Cell Sci

113 ( Pt 4), 571-585.

Ramesh, N., Anton, I. M., Hartwig, J. H. & Geha, R. S. (1997). WIP, a protein

associated with wiskott-aldrich syndrome protein, induces actin polymerization and

redistribution in lymphoid cells. Proc Natl Acad Sci U S A 94, 14671-14676.

Reijnst, P., Jorde, S. & Wendland, J. (2010). Candida albicans SH3-domain proteins

involved in hyphal growth, cytokinesis, and vacuolar morphology. Curr Genet. in

press PMID: 20383711.

37

Ren, G., Wang, J., Brinkworth, R., Winsor, B., Kobe, B. & Munn, A. L. (2005). Verprolin cytokinesis function mediated by the Hof one trap domain. Traffic 6, 575-

593.

Rose, M. & Botstein, D. (1983). Construction and use of gene fusions to lacZ (beta-

galactosidase) that are expressed in yeast. Methods Enzymol 101, 167-180.

Sagot, I., Rodal, A. A., Moseley, J., Goode, B. L. & Pellman, D. (2002). An actin

nucleation mechanism mediated by Bni1 and profilin. Nat Cell Biol 4, 626-631.

Sheu, Y. J., Santos, B., Fortin, N., Costigan, C. & Snyder, M. (1998). Spa2p

interacts with cell polarity proteins and signaling components involved in yeast cell

morphogenesis. Mol Cell Biol 18, 4053-4069.

Smith, M. G., Swamy, S. R. & Pon, L. A. (2001). The life cycle of actin patches in

mating yeast. J Cell Sci 114, 1505-1513.

Sudbery, P., Gow, N. & Berman, J. (2004). The distinct morphogenic states of

Candida albicans. Trends Microbiol 12, 317-324.

Thrasher, A. J. & Burns S. O. (2010). WASP: a key immunological multitasker. Nat

Rev Immunol 10, 182-192.

Vaduva, G., Martinez-Quiles, N., Anton, I. M., Martin, N. C., Geha, R. S.,

Hopper, A. K. & Ramesh, N. (1999). The human WASP-interacting protein, WIP,

activates the cell polarity pathway in yeast. J Biol Chem 274, 17103-17108.

Veses, V., Richards, A. & Gow, N. A. (2008). Vacuoles and fungal biology. Curr

Opin Microbiol 11, 503-510.

Walther, A. & Wendland, J. (2003). An improved transformation protocol for the

human fungal pathogen Candida albicans. Curr Genet 42, 339-343.

Walther, A. & Wendland, J. (2004). Polarized hyphal growth in Candida albicans

requires the Wiskott-Aldrich Syndrome protein homolog Wal1p. Eukaryot Cell 3, 471-

482.

Walther, A. & Wendland, J. (2008). PCR-based gene targeting in Candida albicans.

Nat Protoc 3, 1414-1421.

Whiteway, M. & Oberholzer, U. (2004). Candida morphogenesis and host-pathogen

interactions. Curr Opin Microbiol 7, 350-357.

Whiteway, M. & Bachewich, C. (2007). Morphogenesis in Candida albicans. Annu

Rev Microbiol 61, 529-553.

38

Figure legends

Fig. 1. Alignment of fungal Vrp1-homologs. Amino acid residues corresponding to

the majority of analysed sequences are shaded. (A) The N-terminal actin-binding

sequences are boxed in all Vrp1 proteins. S. cerevisiae Vrp1 harbors non-conserved

regions with the consensus sequence „PxPSS‟ (boxed) that were shown to interact with

ScHof1.(B) Alignment of the Vrp1 C-terminal regions harbouring the conserved

Las17-binding domain. Protein information was obtained from: the Ashbya Genome

Database (http://agd.vital-it.ch/index.html); C. albicans (http://www-

sequence.stanford.edu/group/candida/index.html); Kluyveromyces lactis Vrp1 -

XP_451805; Neurospora crassa Vrp1 - XP_963859; and S. cerevisiae - AAB67263.

Fig. 2. Generation and verification of C. albicans vrp1 mutant strains. (A)

Schematic overview on the use of PCR-based gene targeting. Selectable marker genes

were amplified using primers which carry 100 bases of homology region to the VRP1

target gene. Via homologous recombination a complete ORF deletion was generated.

Diagnostic PCR was done with gene specific (G1 and G4) and marker specific (X2

and X3) primers. (B; C) Result of verification PCR on strain CAB11

(vrp1::ARG4/vrp1::HIS1) and CAB13 (vrp1::URA3/vrp1::HIS1). Ethidium-bromide

stained gel images indicate the expected bands.

Fig. 3. Characterization of vrp1 growth defects. (A) The indicated strains were

grown on Spider plates for 5d at 37°C prior to photography (top row). Microscopic

images of the colony edges show the degree of filamentation (middle row). Hyphal

formation in liquid medium was induced by using 10% serum. Images were taken after

6h of induction (bottom row). (B) Cells induced by serum were counted after 6h and

classified according to their morphology. (C) Complementation of the vrp1

filamentation defect by reintegration of VRP1.

Fig. 4. Analysis of the actin cytoskeleton and budding pattern. (A) Strains were

grown in yeast and hyphal stages, fixed by formaldehyde and stained using

rhodamine-phalloidine. Bar, 10 µm. (B) Representative images of calcoflour stained

cells.

Fig. 5. Time-lapse analysis of endocytosis of the lipophilic dye FM4-64. Wild type

cells carrying a cytoplasmic GFP-label (on the right side of each panel) were mixed

with vrp1/vrp1 cells (on the left side of each panel). Microscopy slides with wells

were filled with 0.75 ml of 0.5x YPD and 0.75 ml of 3.4% agarose. To this mixture

1µl FM4-64 (200µg/ml in DMSO) was added. Image acquisition started 10 min after

preparation of the slide for the duration of 3h with 1 image/min. Selected frames are

shown at the indicated time points. Starting with a GFP image identifying the wild

type cells followed by a brightfield image of all cells. Bar, 10 µm.

Fig. 6. Analysis of vacuolar morphology. Strains were grown overnight and then

stained with FM4-64 for 2h prior to photography.

39

Fig. 7. Two hybrid analysis. PCR-fragments carrying different domains were

combined with the DNA-binding domain or the DNA-activation domain as indicated

in the upper panel. For CaMYO5 only the core SH3-domain was used (for details see

Materials and methods section). Plasmids carrying the BD/AD pairs were transformed

in S. cerevisae and selected on –Trp/-Leu plates (lower panel). Transformant colonies

were tested by X-gal overlay and the ß-galactosidase activity was tested in triplicate.

Figure 1

Figure 2

40

Figure 3

41

42

Figure 4

43

Figure 5

Figure 6

44

Figure 7

45

PART VII

46

PART VII –

Actin dependent endocytosis is not linked to eisosomes

Patrick Reijnst, Andrea Walther, and Jürgen Wendland,*

Carlsberg Laboratory, Yeast Biology, Gamle Carlsberg Vej 10, DK-2500 Valby,

Denmark

* Corresponding author: Jürgen Wendland, Carlsberg Laboratory, Yeast Biology,

Gamle Carlsberg Vej 10, DK-2000 Valby, Copenhagen, Denmark

Email: jww @crc.dk ;

Phone: +45/3327 5230;

Fax: +45/3327 4708

running title: C. albicans eisosomes

key words: endocytosis, polarized hyphal growth, PCR, pFA-plasmids, actin cytoskeleton

Abstract

Endocytosis is a highly dynamic essential process in all eukaroytic cells and is

linked to the actin cytoskeleton. Eisosomes are immobile protein complexes,

containing Pil1 and Lsp1. We analyzed the distribution and co-localization of the

actin cytoskeleton and eisosomes in Candida albicans. Pil1 and Lsp1, tagged with

GFP/yEmCherry, strictly co-localize during all growth stages. Eisosomes,

however, localized at distinct positions, not overlapping with either cortical actin

patches or the endocytosis marker protein Abp1 in yeast or the Spitzenkörper in

hyphal cells. This suggests that eisosome may only have specialized functions, yet

not a general role for clathrin-mediated actin-dependent endocytosis.

Endocytosis is required for cell surface remodelling, uptake of nutrients, and cell-

signalling (Munn, 2001). Early genetic screens have identified a link between the actin

cytoskeleton and endocytosis. Using the actin-depolymerising drug Latrunculin-A

showed that loss of filamentous actin prevents endocytosis (Aghamohammadzadeh

and Ayscough, 2009). Live cell imaging of fluorescently labelled proteins revealed the

dynamics and the timing of events at sites of endocytosis (Kaksonen et al., 2005). It

thus has been established that actin, the Arp2/3 complex and its regulators as well as

several endocytic proteins co-localize at sites of clathrin-coated pits (Merrifield 2004;

47

Yarar et al., 2005). Therefore, cortical actin patches mark sites of endocytosis

(Engqvist-Goldstein and Drubin, 2003). The plasma membrane shows a complex

organisation of proteins and lipids. Sub-compartmentalization has been shown to

occur specifically with lipid rafts and eisosomes (Lingwood and Simons, 2010;

Walther et al., 2006). Eisosomes are mainly composed of the proteins Pil1 and Lsp1.

They were reported to mark static sites of endocytosis (Walther et al., 2006).

The highly dynamic nature of endocytosis is seemingly posing a discrepancy with the

static nature of eisosomes. We, therefore, used life-cell imaging to follow the

localization of eisosomes and endocytosis markers in C. albicans making use of both

yeast and hyphal stages in this human fungal pathogen. First we identified the PIL1

(orf19.778) and LSP1 (orf19.3149) genes in C. albicans. They encode highly similar

proteins of 308 and 317 amino acids, respectively that share 79% amino acids identity

(see Supplementary Information, Fig. S1 online). We tagged PIL1 with the red

fluorescent protein Cherry and LSP1 with GFP and monitored their distribution. Both

proteins completely co-localized in yeast and hyphal cells at punctate cortical spots

marking the eisosomes in C. albicans (Fig. 1). Using time-lapse fluorescence

microscopy we could show that the cortical localisation of eisosomes was very static

in C. albicans as has been observed in S. cerevisiae (see Supplementary Information,

Fig. S2 online). Deletion of LSP1 showed no phenotype, while deletion of PIL1 could

not be achieved, indicating that PIL1 is an essential gene.

During growth, eisosomes were not found at the tip of emerging buds or at the

hyphal tip in C. albicans and using time-lapse microscopy we could show that

eisosome-free membranes are populated in a rear-to-front manner as was also

described for S. cerevisiae (Moreira et al., 2009) (see Supplementary Information,

Fig. S2 online).

The hyphal tip is a growth region of a fungal hypha. Secretion is directed to the

tip using either the actin or the microtubule cytoskeleton. A vesicle supply center,

termed Spitzenkörper, acts as a hub integrating secretory vesicles and endocytic

recycling of early endosomes (Harris, 2009). We stained the Spitzenkörper in

C. albicans hyphae and found that it does not co-localize with eisosomes (Fig. 2A).

Next we stained the cortical actin cytoskeleton in a PIL1-GFP strain to determine the

degree of overlap of eisosomes with sites of endocytosis. As observed previously, the

hyphal tip harbors a cluster of actin patches corresponding with the large amount of

48

secretion/endocytosis found in this region. Eisosomes were not present in the growing

hyphal tip. Surprisingly, we did not find any co-localization of Pil1-GFP patches with

actin patches throughout the entire hyphae (Fig. 2B). During yeast growth, actin

patches accumulate in the emerging bud. At this stage the bud is free of eisosomes.

Thus, also during yeast growth eisosomes are separated from cortical actin patches

(Fig. 2B). Since actin staining requires cell fixation we used yEmCherry-tagged Abp1

as an in vivo marker of endocytic sites. Using a strain carrying both PIL1-GFP and

ABP1-Cherry we were then able to monitor the localization of sites of endocytosis and

eisosomes in living cells at the same time. Again, we could not observe any co-

localization of eisosomes with sites of endocytosis marked by Abp1 (Fig. 2C). During

our recent functional analyses of genes involved in endocytosis in C. albicans we

characterized RVS167 and found a role in restricting actin patches to sites of polarized

growth (Reijnst et al., 2010). Deletion of rvs167 increases and depolarizes the number

of cortical actin patches in yeast and hyphal cells. Yet, even when overpopulating the

cell membrane with actin patches localization of actin and eisosomes remained distinct

(Fig. 2D). Identical results and differential localization of eisosomes from

Spitzenkörper, actin and Abp1 were obtained using a LSP1-GFP strain (see

Supplementary Information, Fig. S3 online).

Filamentous fungi share the feature of polarized hyphal growth. Both secretion

and endocytosis are strongly polarized to the hyphal tip and these processes have been

intensely studied in a number of fungal model organisms. Mutants affecting

components in either one of these processes reduce the speed of polarized growth or

result in non-polarized morphogenesis. Our studies in C. albicans have shown,

however, that the hyphal tip and the emerging bud in yeast cells are devoid of

eisosomes. Similar results of a wave-like incorporation of eisosomes in new

membrane areas were reported from S. cerevisiae (Moreira et al., 2009). Thus our

observations strongly suggests that eisosomes may have distinct roles in organizing

the cell membrane or cell wall but may not provide a major contribution for actin-

dependent endocytosis. In line with these observations are previous studies that

suggested clathrin-coated pits initiate randomly but need to be stabilized to form a site

of endocytosis (Ehrlich et al., 2004). In this respect, static sites marked by eisosomes

may not match the highly dynamic process of endocytosis or polarized morphogenesis

as a response to environmental stimuli. Nevertheless, eisosomes do have a conserved

49

essential function since PIL1 is not only an essential gene in C. albicans but also in the

filamentous fungus A. gossypii (our unpublished results). Recent studies showed that

eisosome assembly is regulated by the protein kinases Pkh1 and Pkh2, which respond

to sphingolipid signalling. Furthermore, deletion of either PIL1 or LSP1 resulted in

strains that were more resistant to heat stress suggesting a function of eisosomes in cell

wall integrity (Walther et al., 2007; Luo et al., 2008).

Material and methods

Strains and media

The C. albicans strains used and generated in this study are listed in Table S1.

(see Supplementary Information, Tab. S1 online). Generally, at least two independent

transformants were generated for each desired genetic manipulation. Strains were

grown either in yeast extract–peptone–dextrose (YPD; 1% yeast extract, 2% peptone,

2% dextrose) or in defined minimal media [CSM; complete supplement mixture;

6.7g/l yeast nitrogen base (YNB) with ammonium sulphate and without amino acids;

0.69g/l CSM; 20g/l glucose] with the addition of required amino acids and uridine.

Strains were generally grown at 30°C to keep them in the yeast phase; hyphal

induction of C. albicans cells was done at 37°C with the addition of 10% serum to the

growth medium. Escherichia coli strain DH5α was used for pFA-plasmid propagation.

Transformation and strain construction

C. albicans was transformed by the lithium acetate procedure using standard

PCR-based gene targeting tools and pFA-plasmids (Walther and Wendland, 2003;

Gietz and Schiestl, 2007, Walther and Wendland, 2008). Primers were obtained from

biomers.net GmbH (Ulm, Germany) and primer sequences are listed in Table S2 (see

Supplementary Information, Tab. S2 online). For strains tagged with GFP or

yEmCherry the same results were observed whether the second untagged allele was

deleted or not (in otherwise wild-type strains).

50

Plasmid constructs

Plasmid pFA-yEmCherry-CaHIS1 was constructed by amplifying yEmCherry

from pRS316 GAP-yEmCherry (Keppler-Ross et al., 2008) using primers #4266 and

#4267 and replacing GFP by cloning the restricted yEMCherry PCR-fragment into the

BsiWI/AscI sites of pFA-GFP-CaHIS1.

Microscopy and staining procedures

Brightfield and epifluorescence microscopy was done as described previously

(Reijnst et al., 2010). Imaging of yEmCherry-localization was done using the same

filter as for FM4-64.

Acknowledgement

We thank Alexander Johnson and Suzanne Noble for generously providing

reagents used in this study. This study was funded by the EU-Marie Curie Research

Training Network “Penelope”.

References 1. Munn, A.L. Biochim Biophys Acta 1535, 236-257 (2001).

2. Aghamohammadzadeh, S. & Ayscough, K.R. Nat Cell Biol 11, 1039-1042 (2009).

3. Ehrlich, M. et al. Cell 118, 591-605 (2004).

4. Engqvist-Goldstein, A.E. & Drubin, D.G. Annu Rev Cell Dev Biol 19, 287-332 (2003).

5. Gietz, R.D. & Schiestl, R.H. Nat Protoc 2, 31-34 (2007).

6. Harris, S.D. Mol Microbiol 73, 733-736 (2009).

7. Kaksonen, M., Toret, C.P. & Drubin, D.G. Cell 123, 305-320 (2005).

8. Keppler-Ross, S., Noffz, C. & Dean, N. Genetics 179, 705-710 (2008).

9. Lingwood, D. & Simons, K. Science 327, 46-50 (2010).

10. Luo, G., Gruhler, A., Liu, Y., Jensen, O.N. & Dickson, R.C. J Biol Chem 283, 10433-

10444 (2008).

11. Merrifield, C.J. Trends Cell Biol 14, 352-358 (2004).

12. Moreira, K.E., Walther, T.C., Aguilar, P.S. & Walter, P. Mol Biol Cell 20, 809-818

(2009).

13. Noble, S.M. & Johnson, A.D. Eukaryot Cell 4, 298-309 (2005).

14. Reijnst, P., Walther, A. & Wendland, J. FEMS Yeast Res (2010).

15. Walther, A. & Wendland, J. Nat Protoc 3, 1414-1421 (2008).

16. Walther, A. & Wendland, J. Curr Genet 42, 339-343 (2003).

17. Walther, T.C. et al. EMBO J 26, 4946-4955 (2007).

18. Walther, T.C. et al. Nature 439, 998-1003 (2006).

19. Yarar, D., Waterman-Storer, C.M. & Schmid, S.L. Mol Biol Cell 16, 964-975 (2005).

51

Supplementary Information, Table 1: C. albicans strains used in this study

Strain a Genotype Source

SN148 arg4/arg4, leu2/leu2, his1/his1 ura3/ura3 Noble and

Johnson, 2005

CAP018 rvs167-1::CdHIS1/rvs167-1::URA3, arg4, leu2 Reijnst et al.,

2010

CAP169 PIL1/pil1::CdHIS1, leu2, ura3, arg4 This study

CAP170 PIL1/pil1::URA3, his1, leu2, arg4 This study

CAP171 LSP1/lsp1::CdHIS1, leu2, ura3, arg4 This study

CAP172 LSP1/lsp1::URA3, his1, leu2, arg4 This study

CAP174 PIL1-GFP-URA3/PIL1, his1, leu2, arg4 This study

CAP175 PIL1-GFP-HIS1/pil1::URA3, leu2, arg4 This study

CAP177 LSP1-GFP-URA3/LSP1, his1, leu2, arg4 This study

CAP178 LSP1-GFP-URA3, lsp1::CdHIS1, leu2, arg4 This study

CAP179 lsp1::CdHIS1/lsp1::URA3, leu2, arg4 This study

CAP180 lsp1::URA3/lsp1::CdHIS1, leu2, arg4 This study

CAP186 PIL1-GFP-HIS1/pil1::URA3,LSP1/lsp1::ARG4, leu2 This study

CAP197 PIL1-GFP-HIS1/pil1::URA3,

lsp1::ARG4/lsp1::CmLEU2

This study

CAP215 PIL1/PIL1-GFP-URA3,ABP1/ABP1-yEmCherry-HIS1,

leu2, arg4 This study

CAP216 LSP1/LSP1-GFP-URA3,

ABP1/ABP1-yEmCherry-HIS1, leu2, arg4

This study

CAP217 rvs167::CdHIS1/rvs167::URA3, LSP1/LSP1-MoGFP-

CmLEU2, arg4 This study

CAP219 PIL1-GFP-URA3/PIL1,LSP1-yEmCherry-HIS1/LSP1,

leu2, arg4 This study

CAP220 LSP1-GFP-URA3/LSP1, PIL1-yEmCherry-HIS1/PIL1,

leu2, arg4 This study

a All CAxxxx strains are derivates of SN148.

52

Supplementary Information, Table 2 Primers used in this study

Gene a Primer name and sequence

b

CaPIL1 #4145: S1-CaPIL1:

CCTTTTAGATGGAAAAAAAATAGCAATGATTAATTGAGATAA

TGGAGGAAAAATTTATTGATCAATCACAAAGTACACAACAGA

AAATAGCAACAGATTTgaagcttcgtacgctgcaggtc

CaPIL1 #4146: S2-CaPIL1:

GAAATTGAACGAAGACGAGGAGGATGGATGAATGAATCCACG

TAACTGGAATTAAAACAAAATCATACTAATGACAAAAATGAA

CAATCGAATAGAATCTtctgatatcatcgatgaattcgag

CaPIL1 #4147: G1-CaPIL1: CGGAAAGACTGGCCACATTTGC

CaPIL1 #4148: G4-CaPIL1: GTCCTTTCTTTCTTTCTTTCG

CaPIL1 #4149: I1-CaPIL1: GCCACTGGCCCAGAATTGTC

CaPIL1 #4150: I2-CaPIL1: GGCTTTACAGTAACCAGCAATC

CaPIL1 #4151: S1-CaPIL1-GFP:

TCAAGAATATGATGAAGATGAACTTGAACACGAACACGGTGA

AATTGATGATGCTGCTCAAGAAGAATTCAACAAACACGATGA

AAATGTTGAACACCAAggtgctggcgcaggtgcttc

CaPIL1 #4152: G1-CaPIL1-GFP: GATTGCTGGTTACTGTAAAGCC

CaLSP1 #4153: S1-CaLSP1:

GAGAGAGATTGGACGCCCCAATCAACCACTCCTGTTTCCTTCT

TCTTCTTCCCCCTCCTTCCTTCCTTTTTTTTTTTCTTTCTTTCTTC

TTCTTCTTCTTgaagcttcgtacgctgcaggtc

CaLSP1 #4154: S2-CaLSP1:

GCTATTAATGTTGCTGCTATCAACTGTTAAATATATATATATA

AAAAAAGGATAGACAAGTTAAGATAAGATAAGATAGATATGT

AAGAAAGCAAAAGATtctgatatcatcgatgaattcgag

CaLSP1 #4155: G1-CaLSP1: CGGGAACCACCCACTCTCAC

CaLSP1 #4156: G4-CaLSP1: GGCACTAACCAAAACCTCAG

CaLSP1 #4157: I1-CaLSP1: GATCAATTGAAATCACTTCTCG

CaLSP1 #4158: I2-CaLSP1: GCTTCATAACCGTCATAAGCTG

CaLSP1 #4159: S1-CaLSP1-GFP:

TTTAGAAGGTGCTTATGAAGATGATGAATTGGCTAATGAAGCT

53

GAAAATTTAAGAATTGCTGAAAAAGATTTTGATGAAGTTGAA

GCTAAAATTGCTGCTggtgctggcgcaggtgcttc

CaLSP1 #4160: G1-CaLSP1-GFP: CAGCTTATGACGGTTATGAAGC

CaABP1 #778: S2-CaABP1:

AAAACAGTAATCCCTGAAAGCTGGCTATAGCACCAATTTATCT

TTTCTTTGTATTTATATTATAGATTCATATAAAAAAAAAACGA

ATATTGTTTATACTAAATtctgatatcatcgatgaattcgag

CaABP1 #780: G4-CaABP1: GACAACATTGGTGTAGAGATCG

CaABP1 #835: S1-GFP-CaABP1:

TGTTGAAATCGAATTTGTTGACGATGATTGGTGGCAAGGAAA

ACATTCCAAGACAGGAGAAGTCGGATTGTTCCCTGCTAACTAT

GTTGTCTTGAATGAGggtgctggcgcaggtgcttc

yEmCherry #4266: 5' yEmCherry:

GATTACCAcgtacgctgcagGGTGCTGGCGCAGGTGCTTCTGTTTCA

AAAGGTGAAGAAG

yEmCherry #4267: 3' yEmCherry:

AGGATTTAggcgcgccTTATTTATATAATTCATCCA

CaURA3 #600: U2: GTGTTACGAATCAATGGCACTACAGC

CaURA3 #599: U3: GGAGTTGGATTAGATGATAAAGGTGATGG

CdHIS1 #1432: H2: TCTAAACTGTATATCGGCACCGCTC

CdHIS1 #1433: H3: GCTGGCGCAACAGATATATTGGTGC

CmLEU2 #1742: L2: GGTAAGGAGTGGCAGCTTCAATTGC

CmLEU2 #1743: L3: GCTGAAGCTTTAGAAGAAGCCGTG

CaARG4 #710: R2: AATGGATCAGTGGCACCGGTG

CaARG4 #874: R3: GGATATGTTGGCTACTGATTTAGC

54

Figure legends

Fig. 1. Co-localization of Pil1 and Lsp1 mark eisosomes in C. albicans. Cells of a

strain carrying yEmCherry-tagged Pil1 and GFP-tagged Lsp1 were grown in yeast and

hyphal stages. Fluorescent microscopy using distinct filter combinations to discern

either red or green fluorescence were used. In the overlay yellow colour indicates

overlapping signals from both proteins. DIC, brightfield image; bars represent 5µm.

Fig. 2. Eisosomes do not colocalize with the Spitzenkörper or markers for

endocytosis. Cells of a PIL1-GFP tagged strain were grown in yeast and hyphal

stages. Localization of Pil1-GFP was compared with the Spitzenkörper (A), the actin

cytoskeleton (B), Abp1-yEmCherry (C), and with the actin cytoskeleton in the rvs167

mutant background (D).

Fig. S1. Sequence comparison of eisosome proteins. (A) Alignment of fungal Pil1

and Lsp1 proteins. Pil1 and Lsp1 proteins (also using their systematic name as

identifier) were retrieved from public databases. Alignment was done using

DNASTAR Clustal W. Amino acids matching the majority of aligned sequences are

shaded. (B) Comparison of amino acids sequence identity of Pil1 and Lsp1 proteins.

Abbreviations used: Ca: Candida albicans; Sc: Saccharomyces cerevisiae; Ag:

Ashbya gossypii; Kl: Kluyveromyces lactis; Sp: Schizosaccharomyces pombe.

Fig. S2. In vivo analysis of eisosome distribution during budding growth . Cells of

strain CAP178 (LSP1-GFP-URA3/lsp1::CdHIS1) were used time lapse microscopy. A

series of images is shown capturing bud emergence and bud growth of C. albicans

yeast cells and the localization of eisosomes.

Fig. S3. Eisosomes do not colocalize with the Spitzenkörper or markers for

endocytosis. Cells of a LSP1-GFP tagged strain were grown in yeast and hyphal

stages. Localization of Lsp1-GFP was compared with the Spitzenkörper (A), the actin

cytoskeleton (B), and with the endocytosis marker protein Abp1-yEmCherry (C). For

actin-staining cells were fixed using formaldehyde.

55

Figure 1

Figure 2

56

57

Figure S1

Figure S2

58

Figure S3

59

PART VIII – Final Discussion

Sla1 and Rvs167 in C. albicans are involved in actin patch

morphogenesis

I chose to analyze 12 genes coding for SH3 domain-proteins in C. albicans that

were uncharacterized for their involvement in endocytosis. The function of many of

these proteins has been established in S. cerevisiae, but due to its lack of a true

filamentous growth form, studying these genes in filamentous fungi might reveal new

functions and interactions that are hard or impossible to see in S. cerevisiae. Sla1 and

Rvs167 are two proteins that have been described to be involved in actin-mediated

endocytosis. Sla1 is one of the first proteins to appear at sites of endocytosis and

recruits several other members of the complex that begins to internalize the future

endosome. Rvs167 on the other hand is one of the late acting components during the

internalization of the membrane, acting as a scissor protein which releases the actin-

coated vesicle for further transport along actin cables (Kaksonen et al., 2005).

Deletion of these two genes in S. cerevisiae results in two opposite phenotypes; Scsla1

mutants have only a few and large actin patches (Holtzman et al., 1993) while

Scrvs167 mutants show abundant and depolarized actin patches (Bauer et al., 1993).

Since actin patches are faithful markers of endocytosis, deleting these genes in

C. albicans could potentially result in reduced or abolished hyphal growth. Deleting

SLA1 and RVS167 in C. albicans resulted in similar defects in actin patch

morphogenesis compared to the deletion of SLA1 and RVS167 in S. cerevisiae. The

ability to form hyphae was not abolished by deleting either one of the genes, but the

ability to filament was reduced as seen by slower elongation of the germ tube. The

reduced growth was obvious when comparing the mutant strains with the wild type

after different time points during similar growth conditions.

CaSla1 contains 3 SH3 domains located at the N-terminus and CaRvs167 contains

one SH3 domain located at the C-terminus of the respective proteins. The SH3

domains of Sla1 in S. cerevisiae are essential for its function in organizing the actin

cytoskeleton, in particular domain #3. By reinserting different truncated versions of

ScSLA1 in the Scsla1 mutant, it could be shown that the third SH3 domain, together

with the region separating the first two SH3 domains from the third SH3 domain, are

60

essential for correct function of ScSla1 (Ayscough et al., 1999). Intriguingly, the

situation is reversed in C. albicans. A mutant with truncated CaSla1 lacking only the

first two SH3 domains (CaSla1ΔSH3#1-2

) shows a null mutant phenotype, while a

truncated CaSla1 containing only the first two SH3 domains is still able to retain

partial function.

The C-terminus of Sla1 in S. cerevisiae interacts with ScEnd3 and ScPan1 (Tang

et al., 2000) and is required for cortical localization of ScSla1 (Warren et al., 2002).

CaSla1ΔSH3#1-2

has a localization similar to wild type CaSla1, suggesting that the

C-terminus of CaSla1 interacts in the same manner as ScSla1. The role of the SH3

domain in CaRvs167 was not investigated. However, it is known that the SH3 domain

of ScRsv167 interacts with the proline rich region of ScLAS17 (Drees et al., 2001).

Furthermore, Rvs167 in S. cerevisiae likely binds to actin through its BAR domain

(Peter et al., 2004). Given the high similarity between CaRvs167 and ScRvs167

(62.5% identity, ClustalW) and the similar phenotype displayed by the deletion

mutants in each species, it is likely the BAR and SH3 domains in Rvs167 have a

conserved function in C. albicans. The SH3 domain in RVS167 is located at the

C terminus and one way to investigate the role of the SH3 domain would be to

generate a mutant expressing a truncated RVS167 lacking the SH3 domain. A

collaborating group is currently performing two-hybrid assays to determine the

binding partners of all SH3 domains in C. albicans, and this could then confirm an

interaction between RVS167 and the ScLAS17 homolog WAL1 in C. albicans.

Boi2 and Nbp2 in C. albicans are required for vacuolar fusion

Analysis in S. cerevisiae, A. gossypii and S. pombe has shown that Boi2 is

involved in cell polarity. Deleting BOI2 in A. gossypii shows the most severe

phenotype, with occasional swelling at the region of polarized growth, but the

importance of BOI2 is more evident in S. pombe where it is an essential gene (Bender

et al., 1996; Matsui et al., 1996; Knechtle et al., 2006; Toya et al., 1999). Intriguingly,

Boi2 appears to have a very different function in C. albicans. Caboi2 mutants are wild

type-like when grown at 30 °C, and show no altered filamentous growth when induced

at 37 °C with the addition of serum. However, staining the mutants with the lipophilic

dye FM4-64 reveals that no large vacuoles are present in the germ cell or in the

hyphae. In a wild type strain, a large vacuole is usually formed after 1 h during both

61

yeast and hyphal growth. It has been shown that mutants unable to form large vacuoles

are not able to form mature hyphae and that a correct vacuolar morphogenesis

pathway may be required for filamentous growth (Palmer et al., 2003; 2005).

C. albicans mutants with defects in vacuole inheritance have also been shown to have

defects in hyphal growth and branching (Veses et al., 2009). It is therefore very

interesting that hyphal formation in Caboi2 remains unaffected. What is more

fascinating is that this phenotype is only visible during filamentous growth as Caboi2

during yeast growth is wild type-like and is able to form a large vacuole. By using a

MAL2p-controlled BOI2 strain, fragmented vacuoles appear only when grown under

repressive conditions. These results show that BOI2 appears to have a novel function

in C. albicans different from its function in cell polarity as has been described in other

fungi. Equally surprising is that deleting NBP2 in C. albicans also resulted in

fragmented vacuoles. Similarly to Caboi2, Canbp2 mutants only show fragmented

vacuoles during filamentous growth. Thus, loss of BOI2 and NBP2 shows an apparent

phenotype only during filamentous growth and may be involved in the transport or

fusion of vacuoles. However, while Caboi2 forms hyphae indistinguishably from the

wild type, Canbp2 mutants clearly have a filamentous growth defect. Canbp2 mutants

exhibit a delayed germ tube formation compared to the wild type, and most cells will

have additionally 2 or more germ tubes emanating from the germ cell after 3 hours of

incubation. The elongation delay in the initial germ tube could thus be a result of

redirection of resources to 2-3 germ tubes instead of only one.

Based on the phenotype of the corresponding deletion strains, NBP2 and BOI2 in

C. albicans clearly have different functions coupled to vacuolar fusion and defects in

vacuolar morphology are not enough to abolish or retard filamentous growth as has

been previously suggested. Finally, Nbp2 in S. cerevisiae is involved in the HOG

pathway and Scnbp2 mutants are sensitive to growth at high temperatures and

sensitive to calcofluor white, but growth of Canbp2 mutants was unaffected when

tested for sensitivity against high temperature, salt- and sorbitol concentrations.

Localization studies of Boi2 and Nbp2 in C. albicans may help in further

understanding the function of these proteins.

62

CaCYK3 is an essential gene required for cytokinesis

Cytokinesis in S. cerevisiae is preceded by a ring of type II myosin (Myo1)

located at the budding site in late G1 phase, followed by recruitment of actin. Among

the last proteins to be recruited to the bud site before cytokinesis is Cyk3. The function

of Cyk3 in S. cerevisiae remains unknown. Deletion of CYK3 in S. cerevisiae only

causes a mild defect in cytokinesis. ScCYK3 is synthetically lethal with ScMYO1 and

ScHOF1. ScCYK3 may therefore promote cytokinesis through an actin-myosin-ring

independent pathway (Korinek et al., 2000). In contrast, CYK3 is an essential gene in

C. albicans. Similarly to ScCyk3, CaCyk3 localizes to the bud neck in large budding

cells prior to cytokinesis. To investigate the result of Cyk3 depletion in C. albicans,

CaCYK3 was put under the inducible promoter MET3p. When grown under repressive

conditions, MET3p-CYK3/cyk3 mutants showed severe defects in cytokinesis

terminating with large elongated cells, abnormal chitin deposition and possibly the

loss of cell wall integrity. It is not known whether HOF1 and MYO1 are essential

genes in C. albicans. Insertional mutagenesis using UAU1-cassettes in C. albicans

revealed that such a Cahof1 strain is viable. The two CaSLA1 insertion mutants

generated in this study showed different phenotypes depending on the site of

integration of the UAU1-cassette. Thus a complete deletion of the CaHOF1 ORF is

necessary to prove it is not essential. Perhaps C. albicans is less versatile than

S. cerevisiae by lacking a suggested actin-myosin-ring independent pathway.

Alternatively, deletion of CYK3 in C. albicans may not be readily complemented by

other genes as it appears to be the case in S. cerevisiae. Overall, the different genes

involved in cytokinesis have been much less well studied in C. albicans compared to

S. cerevisiae, and future research will probably unfold the key differences between

these organisms.

Eisosomes are not required for actin dependent endocytosis

Eisosomes have so far only been reported in S. cerevisiae and are described as

large immobile complexes that mark future sites of endocytosis (from the Greek „eis‟,

meaning into or portal, and „soma‟, meaning body). They mainly consist of Pil1 and

Lsp1 and co-localize with the membrane-bound protein Sur7 in a dot-like manner with

a ubiquitous distribution. Deletion of LSP1 in S. cerevisiae does not lead to a different

phenotype compared to the wild type, while deletion of PIL1 leads to clustering of

63

eisosome remnants and an aberrant cell membrane. Eisosomes were found to co-

localize with all FM4-64 uptake (Walther et al., 2006).

It is generally agreed on that the main site of endocytosis in growing hyphae is

located at the hyphal tip. A majority of the actin patches localize to the tip, just below

the Spitzenkörper, a structure which drives the hyphal extension. I originally intended

to investigate the role of eisosomes in C. albicans and how deletion strains of PIL1

and LSP1 would affect the localization and function of known proteins involved in

endocytosis, e. g. Abp1 and Sla1. Deletion of LSP1 in C. albicans did not result in a

phenotype different from the wild type during all growth stages; actin patch

distribution, vacuolar morphology and filamentous growth remained normal. Despite

several attempts to delete PIL1 in C. albicans a deletion mutant could not be generated

without also generating a triplication of the PIL1 gene. Thus CaPIL1 is likely

essential, and therefore Pil1 is probably also the main regulator of eisosomes in

C. albicans. The reason why CaPil1 is essential but not CaLsp1 is unknown. Pil1 and

Lsp1 share a high similarity (72% identity in S. cerevisiae and 79% identity in

C. albicans, ClustalW) where the C-terminus contains the most variation. To

investigate how a shut-down of PIL1 expression would affect the cell, mutants were

generated with one copy of PIL1 deleted and the remaining copy under the regulation

of the inducible promoters MET3p or MAL2p. Unfortunately none of the strains

generated were affected when grown under repressive conditions. Why none of the

promoter constructs worked was not investigated any further. It is possible that using

the TET (tetracycline) promoter to regulate the expression of CaPIL1 will give better

results. The TET promoter is highly specific to tetracycline and can be used to

efficiently shut-down gene expression, compared to the possible leakiness that can

occur when using the MAL2 promoter and MET3 promoter (Nakayama et al., 2000).

To further investigate the role of CaPil1 and CaLsp1, GFP and yEmCherry (a

form of RFP) were fused to the C-termini of both genes. To show that Pil1 and Lsp1 in

C. albicans together form the eisosome, Pil1-GFP and Lsp1- yEmCherry, and vice

versa, were visualized in the same strain and shown to fully co-localize in both yeast-

and hyphal growth. Pil1 and Lsp1 in C. albicans localize in a static dot-like pattern

across the cell membrane. The only two regions where eisosomes are not found are at

areas of growth, i.e. the bud tip/hyphal tip, and the septa in hyphae. Localization

studies showed that eisosomes do not co-localize with actin patches, Abp1 or the

64

Spitzenkörper in C. albicans. This discovery is very interesting because it contradicts

the current theory regarding the function of eisosomes. Eisosomes in S. cerevisiae co-

localize with all FM4-64 uptake yet in C. albicans they do not co-localize with three

well documented markers for endocytosis. Therefore, if eisosomes indeed are

endocytic portals they must mediate another type of endocytosis different from actin-

mediated endocytosis. Alternatively, eisosomes have a different unreported function.

Eisosomes are static complexes, so it is unlikely they are involved in the transport of

vesicles. The presence of eisosomes could inhibit actin-mediated endocytosis, thereby

directing it to the hyphal tip. If eisosomes block actin-mediated endocytosis, a hypha

devoid of eisosomes could potentially initiate endocytosis at random locations along

the hypha. Studies using a C. albicans mutant strain with eisosome clusters show that

actin is polarized to the hyphal tip, yet FM4-64 uptake occurs nearby the eisosome

clusters in the yeast growth (see section below). Though the role of eisosomes remains

unclear, its importance is obvious since PIL1 is essential in C. albicans.

The final conclusion is that the term “eisosome” is misleading as they are clearly

not portals for endocytosis. However, the phenotypes observed when the eisosomes

are disrupted indicate that they do have a role in endocytosis which is yet to be

revealed.

Summary

My analysis of genes coding for SH3 domain proteins support the current

evidence that the general processes during endocytosis are conserved between

C. albicans and S. cerevisiae and that SH3 domains are important for some of the

stages. CaBoi2 and CaNbp2 are involved in vacuolar fusion and thus have a novel

function. CaCyk3 was found to have a similar function compare to the ortholog in

S. cerevisiae but it essential. The function and interaction of CaSla1 and CaRvs167 are

likely conserved but the SH3 domains of CaSla1 show evolutionary divergence.

I have shown that Pil1 and Lsp1 form the eisosome in C. albicans. While CaLsp1

is dispensable for the function of eisosomes, CaPil1 in contrast is essential. Eisosomes

in C. albicans do not co-localize with several markers for endocytosis and this

contradicts published data claiming that eisosomes mark the site of endocytosis.

65

PART IX – REFERENCE LIST

Adams, A.E. and Pringle, J.R. (1984) Relationship of actin and tubulin distribution to bud growth in

wild-type and morphogenetic-mutant Saccharomyces cerevisiae. J Cell Biol 98:934-45.

Alvarez, F.J., Douglas, L.M., Rosebrock, A. and Konopka, J.B. (2008) The Sur7 protein regulates

plasma membrane organization and prevents intracellular cell wall growth in Candida albicans. Mol

Biol Cell 19:5214-25.

Anderson, J.M. and Soll D.R. (1986) Differences in Actin Localization during Bud and Hypha

Formation in the Yeast Candida albicans. J Gen Microbiol 132:2035-47.

Ayscough, K., Eby, J., Lila, T., Dewar, H., Kozminski, K. and Drubin, D. (1999) Sla1p is a functionally

modular component of the yeast cortical actin cytoskeleton required for correct localization of both

Rho1p-GTPase and Sla2p, a protein with talin homology. Mol Biol Cell 10:1061-1075.

Bauer, F., Urdaci, M., Aigle, M. and Crouzet, M. (1993) Alteration of a yeast SH3 protein leads to

conditional viability with defects in cytoskeletal and budding patterns Mol Cell Biol 13:5070-84.

Bi, E., Maddox, P., Lew, D.J., Salmon, E.D., McMillan, J.N., Yeh, E., Pringle, J.R. (1998) Involvement

of an Actomyosin Contractile Ring in Saccharomyces cerevisiae Cytokinesis. J Cell Biol 142:1301-12.

Bilodeau, P.S., Urbanowski, J.L., Winistorfer, S.C. and Piper, R.C. (2002) The Vps27p Hse1p complex

binds ubiquitin and mediates endosomal protein sorting. Nat Cell Biol 4:534-9.

Bretscher, A. (2003) Polarized growth and organelle segregation in yeast: the tracks, motors, and

receptors. J Cell Biol 160:811-6.

Chu, D.S., Pishvaee, B. and Payne, G.S. (1996) The light chain subunit is required for clathrin function

in Saccharomyces cerevisiae. J Biol Chem 271:33123-30.

Crampin, H., Finley, K., Gerami-Nejad, M., Court, H., Gale, C., Berman, J. and Sudbery, P. (2005)

Candida albicans hyphae have a Spitzenkörper that is distinct from the polarisome found in yeast and

pseudohyphae. J Cell Sci 118:2935-47.

Cullen,P.J. and Sprague, G.F. Jr. (2002) The Glc7p-interacting protein Bud14p attenuates polarized

growth, pheromone response, and filamentous growth in Saccharomyces cerevisiae. Eukaryot Cell

1:884-94.

Derkatch, I.L., Bradley, M.E., Hong, J.Y. and Liebman, S.W. (2001) Prions affect the appearance of

other prions: the story of [PIN(+)]. Cell 106:171-82

Dramsi, S. and Cossart, P. (1998) Intracellular pathogens and the actin cytoskeleton. Annu Rev Cell Dev

Biol 14:137-66.

Drees, B.L., Sundin, B., Brazeau, E., Caviston, J.P., Chen, G.C., Guo, W., Kozminski, K.G., Lau,

M.W., Moskow, J.J., Tong, A., Schenkman, L.R., McKenzie, A, 3rd, Brennwald, P., Longtine, M., Bi,

E., Chan, C., Novick, P., Boone, C., Pringle, J.R., Davis, T.N., Fields, S. and Drubin, D.G. (2001) A

protein interaction map for cell polarity development. J Cell Biol 154:549-71.

Dünkler, A. and Wendland, J. (2007) Candida albicans Rho-type GTPase-encoding genes required for

polarized cell growth and cell separation. Eukaryot Cell 6:844-54.

Evangelista, M., Pruyne, D., Amberg, D.C., Boone, C. and Bretscher, A. (2002) Formins direct Arp2/3-

independent actin filament assembly to polarize cell growth in yeast. Nat Cell Biol 4:32-41.

66

Field, C., Li, R. and Oegema, K. (1999) Cytokinesis in eukaryotes: a mechanistic comparison. Curr

Opin Cell Biol 11:68-80.

Forche, A., Alby, K., Schaefer, D., Johnson, A.D., Berman, J. and Bennett, R.J. (2008) The parasexual

cycle in Candida albicans provides an alternative pathway to meiosis for the formation of recombinant

strains. PLoS Biol 6:e110.

Fonzi, W.A. and Irwin, M.Y. (1993) Isogenic strain construction and gene mapping in Candida

albicans. Genetics 134:717-28.

Giardini, P.A., Fletcher, D.A. and Theriot, J.A. (2003) Compression forces generated by actin comet

tails on lipid vesicles. Proc Natl Acad Sci U S A 100:6493-8

Gola, S., Martin, R., Walther, A., Dünkler, A. and Wendland, J. (2003) New modules for PCR-based

gene targeting in Candida albicans: rapid and efficient gene targeting using 100 bp of flanking

homology region. Yeast 20:1339-47.

Gow, N.A., Brown, A.J. and Odds, F.C. (2002) Fungal morphogenesis and host invasion. Curr Opin

Microbiol 5:366-71.

Hallett, M.A., Lo, H.S. and Bender, A. (2002) Probing the importance and potential roles of the binding

of the PH-domain proteinBoi1 to acidic phospholipids. BMC Cell Biol 3:16.

Hawser, S.P., Baillie, G.S. and Douglas, L.J. (1998) Production of extracellular matrix by Candida

albicans biofilms. J Med Microbiol 47: 253-256.

Hicke, L. (1999) Gettin' down with ubiquitin: turning off cell-surface receptors, transporters and

channels. Trends Cell Biol 9:107-12.

Holtzman, D. A., Yang, S. and Drubin, D. G. (1993) Synthetic-lethal interactions identify two novel

genes, SLA1 and SLA2, that control membrane cytoskeleton assembly in Saccharomyces cerevisiae.

J Cell Biol 122: 635-644.

Howard, J.P., Hutton, J.L., Olson, J.M. and Payne, G.S. (2002) Sla1p serves as the targeting signal

recognition factor for NPFX(1,2)D-mediated endocytosis. J Cell Biol 157:315-26

Huang, G., Wang, H., Chou, S., Nie, X., Chen, J. and Liu, H. (2006) Bistable expression of WOR1, a

master regulator of white-opaque switching in Candida albicans. Proc Natl Acad Sci U S A. 103:12813-

8.

Huckaba, T.M., Gay, A.C., Pantalena, L.F., Yang, H.C. and Pon, L.A. (2004) Live cell imaging of the

assembly, disassembly, and actin cable-dependent movement of endosomes and actin patches in the

budding yeast, Saccharomyces cerevisiae. J Cell Biol 167:519-30.

Hull, C.M. and Johnson, A.D. (1999) Identification of a mating type-like locus in the asexual

pathogenic yeast Candida albicans. Science 20:1271-5.

Hull, C.M., Raisner, R.M. and Johnson, A.D. (2000) Evidence for mating of the "asexual" yeast

Candida albicans in a mammalian host. Science 14:307-10.

Iwaguchi, S., Suzuki, M., Sakai, N., Nakagawa, Y., Magee, P.T. and Suzuki, T. (2004) Chromosome

translocation induced by the insertion of the URA blaster into the major repeat sequence (MRS) in

Candida albicans. Yeast 21:619-34.

Kaksonen, M., Sun, Y. and Drubin, D.G. (2003) A pathway for association of receptors, adaptors, and

actin during endocytic internalization. Cell 115:475-87.

Kaksonen, M., Toret, C.P. and Drubin, D.G. (2005) A Modular Design for the Clathrin- and Actin-

Mediated Endocytosis Machinery. Cell 123:305-20.

67

Kaksonen, M., Toret, C.P. and Drubin, D.G. (2006) Harnessing actin dynamics for clathrin-mediated

endocytosis. Nat Rev Mol Cell Biol 7:404-14.

Kilmartin, J.V. and Adams, A.E. (1984) Structural rearrangements of tubulin and actin during the cell

cycle of the yeast Saccharomyces. J Cell Biol 98:922-33.

Knaus, M., Cameroni, E., Pedruzzi, I., Tatchell, K., De Virgilio, C. and Peter, M. (2005) The Bud14p-

Glc7p complex functions as a cortical regulator of dynein in budding yeast. EMBO J 24:3000-11.

Knechtle, P., Wendland, J. and Philippsen, P. (2006) The SH3-PH domain protein AgBoi1-2

collaborates with the Rho-type GTPase AgRho3 to prevent nonpolar growth at hyphal tips of Ashbya

gossypii. Eukaryot Cell 5, 1635-47.

Korinek, W.S., Bi, E., Epp, J.A., Wang, L., Ho, J. and Chant, J. (2000) Cyk3, a novel SH3-domain

protein, affects cytokinesis in yeast. Curr Biol 10:947-50.

Kuriyana, J. and Cowburna, D. (1993) Structures of SH2 and SH3 domains. Curr Opin Struct Biol

3:828-837.

Kärkkäinen, S., Hiipakka, M., Wang, J.H., Kleino, I., Vähä-Jaakkola, M., Renkema, G.H., Liss, M.,

Wagner, R. and Saksela, K. (2006) Identification of preferred protein interactions by phage-display of

the human Src homology-3 proteome. EMBO Rep 7:186-91.

Lephart, P.R. and Magee, P.T. (2006) Effect of the major repeat sequence on mitotic recombination in

Candida albicans. Genetics 174:1737-44.

Lephart, P.R., Chibana, H. and Magee, P.T. (2005) Effect of the major repeat sequence on chromosome

loss in Candida albicans. Eukaryot Cell 4:733-41.

Li, C.R., Wang, Y.M., De Zheng, X., Liang, H.Y., Tang, J.C. and Wang, Y. (2005) The formin family

protein CaBni1p has a role in cell polarity control during both yeast and hyphal growth in Candida

albicans. J Cell Sci 118:2637-48

Lingwood, D. and Simons, K. (2010) Lipid rafts as a membrane-organizing principle. Science 327:46-

50.

Lippincott, J. and Li, R. (1998) Sequential Assembly of Myosin II, an IQGAP-like Protein, and

Filamentous Actin to a Ring Structure Involved in Budding Yeast Cytokinesis. J Cell Biol 140:355-66.

Lo, H.J., Köhler, J.R., DiDomenico, B., Loebenberg, D., Cacciapuoti, A. and Fink, G.R. (1997)

Nonfilamentous C. albicans mutants are avirulent. Cell 90:939-49

Lockhart, S. R., Pujol, C., Daniels, K. J., Miller, M. G., Johnson, A. D., Pfaller, M. A. & Soll, D. R.

(2002) In Candida albicans, white-opaque switchers are homozygous for mating type. Genetics 162:

737-745.

Maeda, T., Takekawa, M. and Saito, H. (1995) Activation of yeast PBS2 MAPKK by MAPKKKs or by

binding of an SH3-containing osmosensor. Science 269:554-8.

Magee, B.B. and Magee, P.T. (2000) Induction of mating in Candida albicans by construction of MTLa

and MTLalpha strains. Science 14:310-3.

Martin, A.C., Xu, X.P., Rouiller, I., Kaksonen, M., Sun, Y., Belmont, L., Volkmann, N., Hanein, D.,

Welch, M. and Drubin, D.G. (2005) Effects of Arp2 and Arp3 nucleotide-binding pocket mutations on

Arp2/3 complex function. J Cell Biol 168:315-28.

Martin R, Walther A, Wendland J. (2005) Ras1-induced hyphal development in Candida albicans

requires the formin Bni1. Eukaryot Cell 4:1712-24.

68

Martin, R., Hellwig, D., Schaub, Y., Bauer, J., Walther, A. and Wendland, J. (2007) Functional analysis

of Candida albicans genes whose Saccharomyces cerevisiae homologues are involved in endocytosis.

Yeast 24:511-22.

Mayer, B.J., Hamaguchi, M. and Hanafusa, H. (1988) A novel viral oncogene with structural similarity

to phospholipase C. Nature 332:272-5.

Mayer, B.J. and Baltimore, D. (1993) Signalling through SH2 and SH3 domains. Trends Cell Biol 3:8-

13.

Miller, M.G. and Johnson, A.D. (2002) White-opaque switching in Candida albicans is controlled by

mating-type locus homeodomain proteins and allows efficient mating. Cell 110:293-302.

Mochida, J., Yamamoto, T., Fujimura-Kamada, K. and Tanaka, K. (2002) The novel adaptor protein,

Mti1p, and Vrp1p, a homolog of Wiskott-Aldrich syndrome protein-interacting protein (WIP), may

antagonistically regulate type I myosins in Saccharomyces cerevisiae. Genetics 160:923-34.

Moreira, K.E., Walther, T.C., Aguilar, P.S. and Walter, P. (2009) Pil1 controls eisosome biogenesis.

Mol Biol Cell 20:809-18.

Morschhäuser, J., Michel, S. and Staib, P. (1999) Sequential gene disruption in Candida albicans by

FLP-mediated site-specific recombination. Mol Microbiol 32:547-56.

Morton, C.J. and Campbell, I.D. (1994) SH3 domains. Molecular 'Velcro'. Curr Biol 4:615-7.

Moseley, J.B., Goode, B.L. (2006) The yeast actin cytoskeleton: from cellular function to biochemical

mechanism. Microbiol Mol Biol Rev 70:605-45.

Naglik, J.R., Challacombe, S.J. and Hube, B. (2003) Candida albicans secreted aspartyl proteinases in

virulence and pathogenesis. Microbiol Mol Biol Rev 67:400-428.

Nakayama, H., Mio, T., Nagahashi, S., Kokado, M., Arisawa, M. and Aoki, Y. (2000) Tetracycline-

regulatable system to tightly control gene expression in the pathogenic fungus Candida albicans. Infect

Immun 68:6712-9.

Ni, L. and Snyder, M. (2001) A genomic study of the bipolar bud site selection pattern in

Saccharomyces cerevisiae. Mol Biol Cell 12:2147-70.

Nobile, C.J., Bruno, V.M., Richard, M.L., Davis, D.A. and Mitchell, A.P. (2003) Genetic control of

chlamydospore formation in Candida albicans. Microbiology 149:3629-37.

Noble, S.M. and Johnson, A.D. (2005) Strains and strategies for large-scale gene deletion studies of the

diploid human fungal pathogen Candida albicans. Eukaryot Cell 4:298–309.

Ohama, T., Suzuki, T., Mori, M., Osawa, S., Ueda, T., Watanabe, K. and Nakase, T. (1993) Non-

universal decoding of the leucine codon CUG in several Candida species. Nucleic Acids Res 21: 4039-

4045.

Ohkuni, K., Okuda, A. and Kikuchi, A. (2003) Yeast Nap1-binding protein Nbp2p is required for

mitotic growth at high temperatures and for cell wall integrity. Genetics 165:517-29.

Olaiya, A.F. and Sogin, S.J. (1979) Ploidy determination of Canadida albicans. J Bacteriol 140:1043-9.

Palmer, G.E., Cashmore, A. and Sturtevant, J. (2003) Candida albicans VPS11 is required for vacuole

biogenesis and germ tube formation. Eukaryot Cell 2:411-21.

Palmer, G.E., Kelly, M.N. and Sturtevant, J.E. (2005) The Candida albicans vacuole is required for

differentiation and efficient macrophage killing. Eukaryot Cell 4:1677-86.

69

Payne, G.S., Baker, D., van Tuinen, E. and Schekman, R. (1988) Protein transport to the vacuole and

receptor-mediated endocytosis by clathrin heavy chain-deficient yeast. J Cell Biol 106:1453-61.

Razani, B. and Lisanti, M.P. (2001) Caveolins and caveolae: molecular and functional relationships.

Exp Cell Res 271:36-44.

Reuss, O., Vik, A., Kolter, R. and Morschhäuser, J. (2004) The SAT1 flipper, an optimized tool for

gene disruption in Candida albicans. Gene 341:119-27.

Rodal, A.A., Manning, A.L., Goode, B.L. and Drubin, D.G. (2003) Negative regulation of yeast WASp

by two SH3 domain-containing proteins. Curr Biol 13:1000-8.

Roth, A.F. and Davis, N.G. (2000) Ubiquitination of the PEST-like endocytosis signal of the yeast a-

factor receptor. J Biol Chem 275:8143-53.

Sagot, I., Klee, S.K. and Pellman, D. (2002) Yeast formins regulate cell polarity by controlling the

assembly of actin cables. Nat Cell Biol 4:42-50.

Saville, S.P., Lazzell, A.L., Monteagudo, C. and Lopez-Ribot, J.L. (2003) Engineered control of cell

morphology in vivo reveals distinct roles for yeast and filamentous forms of Candida albicans during

infection. Eukaryot Cell 2:1053-60.

Schaub, Y., Dünkler, A., Walther, A. and Wendland, J. (2006) New pFA-cassettes for PCR-based gene

manipulation in Candida albicans. J Basic Microbiol 46:416-29.

Shih, S.C., Sloper-Mould, K.E. and Hicke, L. (2000) Monoubiquitin carries a novel internalization

signal that is appended to activated receptors. EMBO J 19:187-98.

Shortle, D., Haber, J.E. and Botstein, D. (1982) Lethal disruption of the yeast actin gene by integrative

DNA transformation. Science 217:371-3.

Spellman, P.T., Sherlock, G., Zhang, M.Q., Iyer, V.R., Anders, K., Eisen, M.B., Brown, P.O., Botstein,

D. and Futcher, B. (1998) Comprehensive identification of cell cycle-regulated genes of the yeast

Saccharomyces cerevisiae by microarray hybridization. Mol Biol Cell 9:3273-97.

Srikantha, T., Borneman, A.R., Daniels, K.J., Pujol, C., Wu, W., Seringhaus, M.R., Gerstein, M., Yi, S.,

Snyder, M. and Soll D.R. (2006) TOS9 regulates white-opaque switching in Candida albicans. Eukaryot

Cell 5:1674-87.

Sudbery, P., Gow, N. and Berman, J. (2004) The distinct morphogenic states of Candida albicans.

Trends Microbiol 12:317–324.

Swanson, J.A. and Watts, C. (1995) Macropinocytosis. Trends Cell Biol 5:424-8.

Tan, P.K., Howard, J.P. and Payne, G.S. (1996) The sequence NPFXD defines a new class of

endocytosis signal in Saccharomyces cerevisiae. J Cell Biol 135:1789-800.

Trueheart, J., Boeke, J.D. and Fink, G.R. Two genes required for cell fusion during yeast conjugation:

evidence for a pheromone-induced surface protein. Mol Cell Biol 7:2316-28.

Tzung, K.W., Williams, R.M., Scherer, S., Federspiel, N., Jones, T., Hansen, N., Bivolarevic, V.,

Huizar, L., Komp, C., Surzycki, R., Tamse, R., Davis, R.W. and Agabian, N. (2001) Genomic evidence

for a complete sexual cycle in Candida albicans. Proc Natl Acad Sci U S A 98:3249-53.

Ushinsky, S.C., Harcus, D., Ash, J., Dignard, D., Marcil, A., Morchhauser, J., Thomas, D.Y.,

Whiteway, M. and Leberer, E. (2002) CDC42 is required for polarized growth in human pathogen

Candida albicans. Eukaryot Cell 1:95-104

70

Veses, V., Richards, A. and Gow, N.A. (2009) Vacuole inheritance regulates cell size and branching

frequency of Candida albicans hyphae. Mol Microbiol 71:505-19.

Whiteway, M. and Oberholzer, U. (2004) Candida morphogenesis and host-pathogen interactions. Curr

Opin Microbiol 7:350-7.

Wilson, R.B., Davis, D. and Mitchell, A.P. (1999) Rapid hypothesis testing with Candida albicans

through gene disruption with short homology regions. J Bacteriol 181:1868–1874.

Winter, D., Podtelejnikov, A.V., Mann, M., Li, R. (1997) The complex containing actin-related proteins

Arp2 and Arp3 is required for the motility and integrity of yeast actin patches. Curr Biol 7:519-29.

Wirsching, S., Michel, S. and Morschhäuser, J. (2000) Targeted gene disruption in Candida albicans

wild-type strains: the role of the MDR1 gene in fluconazole resistance of clinical Candida albicans

isolates. Mol Microbiol. 36:856-65.

Walther, A. and Wendland, J. (2004) Polarized hyphal growth in Candida albicans requires the Wiskott-

Aldrich Syndrome protein homolog Wal1p. Eukaryot Cell 3:471-82.

Walther, A. and Wendland, J. (2008) PCR-based gene targeting in Candida albicans. Nat Protoc

3:1414-21.

Walther, T.C., Brickner, J.H., Aguilar, P.S., Bernales, S., Pantoja, C. and Walter, P. (2006) Eisosomes

mark static sites of endocytosis. Nature 439:998-1003.

Wendland, J., Hellwig, D., Walther, A., Sickinger, S., Shadkchan, Y., Martin, R., Bauer, J., Osherov,

N., Tretiakov, A. and Saluz, H.P. (2006) Use of the Porcine Intestinal Epithelium (PIE)-Assay to

analyze early stages of colonization by the human fungal pathogen Candida albicans. J Basic Microbiol

46:513-23.

Young, M.E., Karpova, T.S., Brügger, B., Moschenross, D.M., Wang, G.K., Schneiter, R., Wieland,

F.T. and Cooper, J.A. (2002) The Sur7p family defines novel cortical domains in Saccharomyces

cerevisiae, affects sphingolipid metabolism, and is involved in sporulation. Mol Cell Biol 22:927-34.

Zordan, R.E., Galgoczy, D.J. and Johnson, A.D. (2006) Epigenetic properties of white-opaque

switching in Candida albicans are based on a self-sustaining transcriptional feedback loop. Proc Natl

Acad Sci U S A. 103:12807-12.

Zordan, R.E., Miller, M.G., Galgoczy, D.J., Tuch, B.B. and Johnson, A.D. (2007) Interlocking

transcriptional feedback loops control white-opaque switching in Candida albicans. PLoS Biol 5:e256.