Click here to load reader

Genetic between ABA Insensitive Mutant, ABA Mutant, · Abstract Genetic Interactions between the ABA Insensitive Mutant, abil-1, and the ABA Supersensitive Mutant, era14, in Arabidopsis

  • View
    226

  • Download
    3

Embed Size (px)

Text of Genetic between ABA Insensitive Mutant, ABA Mutant, · Abstract Genetic Interactions between the...

  • Genetic Interactions between the

    ABA Insensitive Mutant, abil-i, and the ABA Supersensitive Mutant, ers14,

    in Ambidopsis thaliana.

    Nocha Van Thielen

    A thesis submitted in wnformity with the requirements for the degree of Master of Science

    Graduate Deparnent of Botany in the

    University of Toronto

    O Copyright by Nocha Van Thielen, 1999

  • National Library Bibliothque nationale du Canada

    Acquisitions and Acquisitions et Bibliographie Services services bibliographiques 395 Wellington Street 395, rue Welliigtori OUawaON KlAON4 Oaawa ON K I A N4 canada Canada

    The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or sell copies of this thesis in microform, paper or electronic formats.

    The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts fiom it may be printed or otherwise reproduced without the author's permission.

    L'auteur a accord une licence non exclusive permettant la BibIiothque nationale du Canada de reproduire, prter, distniuer ou vendre des copies de cette thse sous la forme de microfiche/nlm, de reproduction sur papier ou sur format lectronique.

    L'auteur conserve la proprit du droit d'auteur qui protge cette thse. Ni la thse ni des extraits substantiels de celle-ci ne doivent tre imprims ou autrement reproduits sans son autorisation.

  • Abstract

    Genetic Interactions between the

    ABA Insensitive Mutant, abil-1, and the ABA Supersensitive Mutant, era14,

    in Arabidopsis thaliana.

    b

    Nocha Eleonor Van Thielen

    Degree of Master's of Science

    Graduate Department of Botany, University of Toronto

    Abstract

    The mutant, abil-1 (ABA insensitive), is insensitive to exogenous and endogenous ABA

    (abscisic acid) and thus is defective for a number of physiological responses. The

    mutant, era14 (enhanced response to ABA), was isolated in a suppressor screen of

    abil-1. The era7-4 mutant is able ta suppress many of the defective ABA responses of

    abil-1 examined to varying degrees, from not at al1 to cornplete suppression, depending

    on the character. Further study of the abil-1 and the era l4 mutants revealed

    developmental defects previously unreported. When the two mutations are combined,

    there are more severe developmental effects specifically in the stomate and florai organ

    number. This implies AB11 and ERAl may have broader roles in Arabidopsis developrnent

    than previously known.

  • List of Abbreviations

    List of Abbreviations

    ABA AB17

    cm CM CTAB DNA EDTA ERAI FI F2 mase FW Kb Ler LSM M a min(s) rd m MOPS MS Ncol PAGE PCR PPK: ra bAea/de hydrin

    w RNA RT SDS S C SSLP TAE TB 7E UV vol (s) w/v "C E Pg CM Im

    abscisic acid ABA insensitive locus base pairs confidence intewal centimeters centi Morgans cetyl methyi ammonium bromide deoxyribonucleic acid ethlenediaminetetra-acetic acid enhanced response to ABA locus first generation offspring second generation offspring famesyltransferase fresh weight kilobase pairs Landsberg erecta ecotype least squares mean Meyerowitz Columbia ecotype [email protected]) milliliters millimeters 3-[N-morpholino]propanesuI phonic acid Murashige and Skoog enzyme isolated from Nocardia corollina polyacrylamide gel electrophoresis polymerase chain reaction protein phosphatase 2C responsive to ABA/ late embryogenesis abundantldehydration induced restriction fragment length polymorphism ribonucleic acid room temperature sodium dodecyl sulfate sodium chloridelsodium citrate solution short sequence length polymorphisrn tris-acetate1EDTA electrophoresis buffer tris/borate/EDTA electrop horesis buffer Tris HCVEDTA ultraviolet volume(s) weight pet volume degrees centigrade micro Einsteins micrograms mimmolar micrometers

  • Table of Contents

    Table of Contents

    Abstract ii Ab breviations iii List of Figures vi List of Tables vii

    4 1.2.0 ABA Responsive Mutants -,a,-,-,-,,,,-,,,,,,---------,------- 1.2.1 ABA Insensitive Mutants 5 1.2.3 Enhanced Response to ABA Mutants 10

    2.2 Genetic Methods ---II 2.2.1 Polymerase Chain Reaction (PCR) Conditions of AB11 Locus 17 2.2.2 Mapping Studies 19

    2.3 Developmentai Analyses Methods ,----------------------------,---- 2 1 2.3.1 Inflorescence Height, Silique Length and Floral Organ Number 21 2.3.2 Stomatal Measurements 21 2.3.3 Scanning Electron Micrographs 21 2.3.4 Statistical Analyses of Data 22

    2.4 Physiological Methods ----,----,,,-,,-,,,-----d----------------- 2 2 2.4.1 Seed Sensivity to Exogenous and Endogenous ABA 22 2.4.2 New Root Growth on ABA Assay 23 2-4.3 Water Loss Assay 23 2.4.4 Stomatal Aperture Assay 23 2.4.5 RABI8 mRNA Induction 24

    2.5 Molecular Biological Methods ,-,,,,,-,,,,,,--,,-,------------------ 2 4 2.5.1 Plant DNA Isolation 24 2.5.2 DNA Gel Blot Analysis 25 2.5.3 Plant RNA Isolation 25 2.5.4 RNA Gel Blot Analysis 26 2.5.5 Probe Generation 27 2.5.6 Famesylation Assay 27

  • 3.1.2 Complementation of the era1-2 Mutation with the abil-1 Suppressor Mutation 35 3.1 -3 era 1 4 as a Suppressor of abZ-1 40

    3.2 Developmental Characterization of era 1-4, a b i l - 1 and abil-1 eral-4 4 3 3.2.1 Inflorescence Height 43 3.2.2 Silique and Floral Oevelopment 43 3.2.3 Stomate Parameters 52

    3.3 Physiological Characterization of eral-4, abi l -1 and abi l - lera 1-4 --,-,-J 2 3.3.1 Seed Responsiveness to Exogenous and Endogenous ABA 54 3.3.2 Root Growth Sensitivity to ABA 56 3.3.3 Whole Plant and Stomatal Response to ABA 60 3.3.4 RAB18 Induction 63

    6 6 4.2 The abil-1 Mutant as a Response and Developmental Mutant -------

    6 9 4.3 Mutations in ERA1 in the Landsberg erecta Ecotype

    7 3 4.4 The eral-4 Mutant as a Suppressor of the a b i l - l Mutant

    6.1 Statistical Analysis of Developmental Traits and Physiological Responses 8 4

    6.2. Suppressor Screen of Fast Neutron abil-1 Mutagenized Seed 8 5

  • List of Figures Figure Page

    1. Establishing the genotype of SC1 9-6 X Ler F3 family individuals at the AB11

    2. DNA gel blot hybridized with the ERAI genomic probe. 38

    3. ln vifni famesylation activity of Ler and era 14. 39

    4. RNA gel blot hybridized with the ERAI cDNA probe. 41

    5. Gross morphology of ler, abii-7, abii-7 era7-4, and era7-4, 44

    6. Inflorescence height and silique length of Ler, abil-1, eral4, and abil-1 era1-4. 45

    7- Examination of pistil and stamen rnorphology of Ler, eral4, abil-1, and abil-1 eral4. 46

    8. Examination of an aberrant pistil and anther in abil-1 en14 by SEM. 48

    9. Examination of pollen grains of Ler, eral-4, abil-1, and abil-1 eral-4. 49

    10. Number of floral organs of Ler, abil-1, era14, and abil-l eral-4. 50

    1 1. Examination of carpe1 transverse sections of Ler, eral-4, abil-?, and abil-1 era14. 51

    12. Stomate parameters of Ler, abil-1, eral4, and abil-1 era 1 4 . 53

    13. Germination rates on exogenous ABA of Ler, abil-1, eral-4, and abil-1 era74. 55

    14. Dormancy of Ler, abil-1, era14, and abil-1 eral-4- 58

    1 5. New root growth on exogenous ABA of Ler, abil-1, era 1-4, and abil-1 era1-4. 59

    1 6. Rate of water loss in Ler, abi l -1, eral4, and abil-1 eral4. 61

    17. Stomatal aperture response of Ler, abil-1, eral4, and abil-1 eral-4. 62

    18. RNA gel blot hybridized with #e RAB18 probe. 64

    19. Function of AB11 and ERAI in ABA signaling. 74

  • List of Tables

    Table page

    1, Mutants used in this study. 18

    2. SSLP loci examined by PCR used to map the suppressor mutation. 20

    3. RFLP loci on chromosome 5 examined by PCR and enzyme digestion used to map the suppressor mutation. 20

    4. Regimes of PCR of SSLP and RFLP markers. 20

    5. Genotype and phenotype of SC19-6 X Ler F2 classes- 30

    6. Plant gross morphology and establishment of the genotype at the AB11 locus of approximately 20 representatives of 4 F3 families. 32

    7. Mapping results. 36

    8. Germination rates of F2 progeny of era14 X abi2-7. 42

    9. Matemal influence in the seed mat on germination on exogenous ABA 57

    10. Summary of responses by abil-1, eraf-4 and the interaction between the two loci. 67

    vii

  • List of Appendices

    List of Appendices

    Appendix page

    1 . Statistical analysis of developmental traits and physiological responses. 84

    2. Suppressor screen of fast neutron abif-7 mutagenized seed. 85

    3. Suppressor screen of abil-1 era 7-4. 88

  • 1 .O Introduction

    The nature of the plant life cycle dicbtes that plant devetopment is intrinsically tied to

    environmental cues, Because of their sessile habit, changes in light, temperature and moisture,

    for example, rnust be perceived and responded to appropriately. This constant feedback of

    environmental signal to devefopmental responses is perhaps the main reason that plants maintain

    a plastic nature throughout their development, Although many genes have been identified that

    appear to encode important regulators of plant developrnent, Iiffle is known about how these

    gene acvities respond to changes in environmental cues- Hormones present excellent

    candidates to function as modulators of the environmental signals as they respond quickly and

    can initiate many signal cascades within a short period of time- Hormone levels increase and

    decrease in response to environmental changes and therefore can act to modulate plant growth

    and development (Zeevaart & Creelman 1988). Tissue sensitivity to hormones also fluctuates

    throughout the life cycle; thus the sensitivity to environmental cues must be regulated (Zeevaart

    & Creelman 1988).

    The plant hormone abscisic acid (ABA) has been shown to act as a modulator of

    environmental signals in the seed and in vegetative tissues throughout the life cycle of the plant

    (Zeevaart 8 Creelman 1988, Black 1991, Rock & Quatrano 1995). During early stages of seed

    development, the embryonic body fom is established and seed storage reserves (protein, starch

    and oils) are deposited. Although the seed is not sufficienfly mature to geminate at these

    stages, if the embryo is excised from the seed coat, it will germinate (Zeevaart 8 Creelman 1988,

    Bfack 1991, Rock 8 Quatrano 1995). This suggests that endogenous factors present in the seed

    suppress germination of the embryo- If excised embryos are placed on media supplemented with

    ABA, the embryos will be inhibited from germinating (Zeevaart 8 Creelman 1988, Black 1991,

    Rock 8 Quatrano 1995). It follows that an endogenous factor prevenng germination is ABA.

    ABA has also been shown to stimulate seed storage reserve deposition (Zeevaart 8 Creelman

    1988, Black 1991, Rock 8 Quatrano 1995). These proteins include napin and cruciferin and

    supply the geminating embryo with the energy required for germination.

  • - - --

    As maturation proceeds, the seed acquires desiccation tolerance and begins the process

    of desiccation- A group of genes terrned rabnealdehydrin (responsive to ABN late

    embryogenesis abundanVdehydration induced) are expressed in late embryogenesis and

    coincide with water loss of the embryo (Rock & Quatrano 1995). The LEA and RAB gene

    products have hydrophilic domains and are hypothesized to function in desiccation tolerance

    (Espelund et al. 1992). These gene products are also drought and cold stress indud in both the

    seed and the vegetative tissue (Welin et al, 1994). ABA functions as the regulatory signal for

    drought and cold stress; thus it can induce many, but not ail of the rab/lea/dehydnn genes. Sorne

    rab/iea,dehydrin genes induced by ABA include: RAB18, AtEml, AtEm6, At2S3, and CRC (Ung

    & Palva 1992, Parcy et al, 1994, Parcy & Giraudat ! 997). Both the inhibition of germination and

    the acquisition of desiccation tolerance are preceded by an increase in endogenous ABA levels

    in the seed, providing circumstantial evidence for a causal relationship (Black 1991, Rock &

    Quatrano 1995).

    ABA also has an extensive role in modulating environmental cues in the vegetative tissue,

    For adult plants, drought and cold stress are threatening to survival. These stresses induce

    rab/iea/'dehydrin genes (Le., cor47, lti30, lfi45, and RAB 18) in the vegetative tissue; these may

    function in desiccation tolerance (Lang 8 Palva 1992, Welin et al. 1994). It is hypothesized that

    cold and drought stresses induce these genes directly or by using ABA as a signal. There are

    also other ABA regulated genes in the vegetative tissue. Alcohol dehydrogenase (Adh) is a gene

    induced by ABA, drought and low oxygen (de Bruxelles et al. 1996). It catalyzes the reduction of

    acetaldehyde to ethanol, a process important when hypoxic conditions occur in the root (de

    Bruxelles et al. 1996). The ATHB7 gene is a putative transcription factor whose expression is

    induced by water deficit and exogenous ABA application (Saderman et al. 1996). This gene may

    also play an important role in the drought stress response. ABA also mediates other stress

    responses, such as stomatal closure (Zeevaart 8 Creelman 1988). Stomatal closure is important

    as a drought response that limits the amount of water evaporation thmugh the stomatal pore.

    Although low physiological levels of ABA stimulate root growth, higher physiological levels

  • Introduction 3

    negatively regulate cell division in the plant, thereby inhibiting root growth (Zeevaart & Creelman

    1 988).

    The mechanism by which ABA is able to impinge on these processes is largefy unknown.

    Traditionaliy, ABA has been hypothesized to function in signal transduction cascade, similar to

    the pheromone response in yeast or the mitogenic response in mamrnais (Himmelbach et al.

    1998). Understanding the ABA pathway and the components within it would increase our

    understanding on the role of ABA and assist in its manipulation for agricultural purposes.

    Therefore, genetic screens have been designed to detect molecules in this signal cascade via

    mutagenesis and selecting for mutants with defects in ABA synthesis or sensitivity and

    response (Koomneef et al. 1982, 1984, Nambara et al. 1992, F inkelstein 1994b, Cutler et al.

    1 996).

    1.1 .O ABA biosynthetic mutants Mutants defective within the ABA biosynthetic pathway were identified by two screens

    (Koornneef et al. 1982, Lon-Kloosterziel et al. 1996). These screens produced alleles in three

    loci, designated ABA 1, 2 and 3, al1 of which showed reduced levels of endogenous ABA. The

    enzymatic defect for these mutants have been shown. The gene corresponding to the ABAl has

    been cloned from tobacco (Nicotiana plumbaginifolia) and is found to be involved in the first

    committed step of ABA production, the epoxidation of zeaxanthin to antheraxanthin and

    violaxthin (Marin et al. 1996). The ABA2 and ABA3 gene products of Arabidopsis have also been

    characterized biochemically and are responsible for the two last steps in ABA production

    (Schwartz et al. 1997). A mutation in ABA2 blocks the conversion of xanthoxin to ABA-aldehyde,

    whereas a mutation in ABA3 blocks the conversion of ABA-aldehyde to ABA, suggesting ABAZ

    and ABA3 encode the proteins responsible for the enzymatic activity (Schwartz et al. 1997).

    The reduction in enzymatic activity in these mutants results in endogenous ABA levels

    approximately 4-30% of wildtype levels (Koomneef et al. 1982, Lon-Kloosterziel et al. 1996).

    The reduction in ABA levels results in reduced seed domancy and increased wilting and

    transpiration rates in the vegetative tissue (Koomneef et al. 1982, Karssen et al. 1983, Lon-

  • Introduction 4

    Kloosterziel et al. 1996). A number of genes induced by ABA are also not expressed in

    auxotrophic backgrounds (Le., ATH87 and RABfB), indicating ABA is required as the signal for

    the induction of these genes (LQng 8 Palva 1992, Soderman et al. 1996, Parcy 8 Giraudat 1997).

    Lea gene products, specifically those whose expression is ABA induced, act as markers of

    seed development and are also decreased in aba mutants (Le., A t h 1 and AtEm6) (Parcy et al.

    1994, Parcy & Giraudat 1997). Experimental use of ABA auxotrophic mutants allows for

    dissection of specific gene induction pathways. For example, expression of the Adh gene is

    induced by dehydration, addition of exogenous ABA and iow oxygen (de Bruxelles et al. 1996)-

    In the abal mutant, low oxygen and low temperature induces Adh, whereas dehydration

    treatment does not, indicating that induction of Adh by drought is ABA dependent and that low

    oxygen and low temperature induction is ABA independent (de Bruxelles et al. 1996). In addition,

    expression of the LEA gene, lti30, is induced by drought and low temperatures. Although the

    gene is not induced by direct application of ABA, drought no longer induces this gene in the abal

    mutant, indicating that ASA is required for induction (Welin et al. 1994). As expected, these ABA

    dependent phenotypes can be rescued with application of exogenous ABA, indicating that the

    lesion is not in the sensing or responding pathways, but in ABA biosynthesis. The mutant

    phenotypes of biosynthetic mutants give some insights into the role that ABA plays in wildtype

    plants and suggest that ABA acts to increase dormancy in the seed, to decrease wilting in the

    vegetative tissue, and to induce specific stress response and developmental genes.

    1.2.0 ABA Responsive Mutants The isolation of ABA response mutants has provided systerns for studying A6A signaling

    (Koomneef et al. 1984, Cutler et al. 1996). Biosynthetic mutants can be dmerentiated from

    response mutants because the phenotypes of biosynthetic mutants are rescued by the

    application of exogenous ABA, whereas the phenotypes of response mutants are not.

    Response mutants have been identified by screening mutagenized population of seeds on

    exogenous ABA for hypenensitivity or insensitivity when cornpared to wildtype sensitivity. Two

  • Introduction 5

    classes of response mutants have been isolated to date: 1) ASA insensitive mutants (ab& and

    2) mutants with enhanced response to ABA (era),

    1.2.1 ABA Insensitive Mutants The first class of insensitive mutants includes the AB11 and the AB12 genes (for ABA

    insensitive). Mutations in these genes result in plants that wilt under mild water stress conditions

    and seeds that are nondormant and can geminate on exogenous ABA concentrations which

    inhibit wildtype seeds from germinating (Koomneef et al. 1984)- The abil-1 and abi2-1 mutants

    have levels of ABA in the seeds similar to wildtype, indicating mat the lesion daes not result in

    increased turnover or inactivation of the hormone (Koomneef et al. 1984). In accordance with

    their name, application of ABA also does not induce other responses which occur in the

    wildtype. For exarnple, stomates are induced to close and root growth is inhibited when wildtype

    seedlings are placed on exogenous ABA. Osmotic stress and exogenous ABA also induces the

    accumulation of proline, which functions as an osmolyte (Finkelstein & Sommerville 1990). These

    responses are defective in abil-1 and abi2-1 mutants (Koornneef et al. 1984, Leung et al. 1994,

    Pei et al. 1997). Induction of genes in aba mutants is also defective in abil-1 and abi2-1 mutants

    (i.e., Adh and RAB18) (Lang 8 Palva 1992, Welin et al. 1994, de Bruxelles et al. 1996). That rnany

    ABA responses are affected in abil-1 and abi2-1 mutant plants suggests these gene products

    function in the eariy steps of ABA signaling. Furthemore, the similarity of biosynthetic and

    response mutants (i.e., lack of donnancy, stornatal closure and ABA responsive genes),

    suggests that response mutants do have reduced signal flux through the ABA response

    pathway.

    Physiological, genetic and molecular studies have been used to assign a role to the AB11

    and AB12 gene products. It is difficult to assign a role for AB11 as the abil-1 allele is dominant

    and the catalytic activity of the enzyme has decreased (Bertauche et al. 1996, Armstrong et al.

    1995, Sheen et al. 1998). To further understand the action of AB11 , the gene was cloned and

    shown to encode a protein phosphatase 2C (PP2C) (Leung et al. 1994, Meyer et al. 1994). The

  • - - - . . - - - - -

    PP2C represents a class of highly conserved proteins found in both plants and animals and is

    often associated with negative regulation of protein kinase cascades that are activated as a

    result of stress (Rodiguez 1 998). The AB1 1 protein requires MgZ' for activation (Bertauche et al.

    1996, Sheen 1998). AB11 also contains an ca2+ binding domain, known as an EF hand; however,

    ca2+ regulation of AB11 has not been demonstrated (Bertauche et al. 1996, Sheen 1998). m e

    mutation in abii-1 is a Gly180 to Asp transition due to a one base pair change (Leung et al. 1994,

    Meyer et al. 1994). This mutation likely disrupts the confirmation of neighbouring ~ g ~ '

    coordinating residues, which can expiain the reduced catalytic activity of abil-1 (Sheen 1998).

    To assign a wildtype role, Sheen (1998) designed a deletion AB11 mutant in maize protoplasts.

    Activation or repression of certain ABA responsive gene were examined, These mutants lose

    the a bility to negatively regulate ABA signal transduction for both gene activation and repression

    One expianation for the abil-l mutant phenotype invokes a scenario where abif-? sequesters

    and poisons the target protein, thus preventing it from transducing the ABA signal (Sheen 1998);

    although to date, no known interactors with AB11 have been cloned. These data suggest that

    AB11 may function as a negative regulator of ABA signaling in the seed and vegetative tissue-

    Electrophysiological studies of AB11 have shown this gene product to operate in the

    guard cell (Armstrong et al. 1995, Pei et al. 1997). In wildtype, drought conditions stimulate a nse

    in ABA levels (Zeevaart & Creelman 1988). ABA causes depolarization of guard cell membranes,

    which causes solute effiux (primarily K+) and outward rectifying anions (Cf) from the guard cells

    (Pei et al. 1997, MacRobbie 1998)- Furthemore, ABA has been shown to negatively regulate the

    K' inward channel and stimulate the K' outward channel. ABA can also stimulates a rise in ca2'

    concentration and alkalization of the guard cell, both of which stimulate guard cell closure

    processes. The loss of solutes causes water to exit, resulting in a decrease in turgor in the

    guard cells, and subsequent decrease in the stomataI pore width (MacRobbie 1998).

    The effect of the abil-l mutation appears to be a decrease in the anion channel activity

    and outward K' channel, resulting in ABA insensitivity and increased stomatal aperture

    (Armstrong et al. 1995, Pei et al. 1997). To investigate possible pathways in which AB11

    operates in the guard dl, biochemicai and genetic studies were employed. Stomabl aperture

  • can be increased in wildtype or abi1-l by inhibiting slow anion channels with a phosphatase

    inhibitor which is an ABA independent action (Pei et al. 1997)- Since PP2C's are phosphatase

    inhibitor resistant, this suggesl that an additional protein phosphatase (PP), sensitive to the

    inhibitor, is located at the same level or upstream of AB11 and is involved in an ABA-independent

    pathway of stomate closure. Biochemical suppression of abi1-1 results from treatrnent with a

    kinase inhibitor (Armstrong et al. f995, Pei et al. 1997). When ABA is present, the use of a kinase

    inhibitor can rewver anion activity. This suggests there is also a ABA dependent kinase that

    operates to negatively regulate the ABA signal by inhibiting anion channel activity. AB11

    negatively regulates this kinase, suggesting a positive role for AB1 1 in stomatal closure (Pei et al-

    1998). The use of a kinase inhibitor can also restore ABA control of K* channel activities,

    suggesting phosphorylation/dephosphorylation is involved in contrd in the guard cells

    (Armstrong et al. 1995). Although these protein inhibitor studies contribute new data to AB11

    function in the guard cell, these data must be interpreted with caution. The specificity of the

    inhibitor may not be faittiful, or may have unanticipated secondary effects. The inhibitor results

    rnay reveal the actual pathway in the guard cell through which the AB11 gene product acts, but

    more studies are required to verify this data,

    Recently, the second ABA insensitive mutant in this class of responsive mutants, AB12,

    was cloned and it also appears to enwe a PP2C (Leung et al. 1997). Aside from their molecular

    similanty (81 % nucleotide identity of the genes), there are a number of physiological similarities

    between AB11 and AB12. For example, the abi2-1 mutant has seeds and guard cells which are

    defective in ABA response (Koomneef et al. 1984, Pei et al. 1997). The mode of inheritance also

    is dominant (Leung et al. 1997). Since there are no recessive, loss-of-function mutations for

    either ABIl or AB12 yet isolated, it may suggest the two gene products act in a redundant manner

    (Leung et al. 1997). However, it is becoming increasingly apparent that AB11 and AB12 operate in

    different subsets of the A6A response pathway- For example, in the guard cell, a kinase inhibitor

    which can rescue anion channel activity in abil-1, does not restore channel activity in abi2-1

    (Pei et al. 1997). Also a number of ABA responsive genes (ATHB7, AtDi21, Adh and RAB18) are

    differenally regulated by AB11 and AB12 (Gosti et al. 1995, de Bruxelles et al. 1996, Sodeman et

  • Introduction 8

    al. 1996). ATHB7, AtDi21, and RAB1 8 induction in the abi2-1 mutant is not as defective as the

    abil-1 and more impaired than the abii-1 mutant in Adh expression (Gosti et al. 1995, de

    Bruxelles et al. 1996, Soderman et al. 1996). The use of a gibberellic acid (GA) inhibitor suggests

    that the mechanism through which abi2-1 seed is able to germinate is different from abil-7

    (Nambara et al. 1991). Together, these data suggest that although AB11 and AB12 are stmcturally

    redundant, they appear to have only partially overiapping functions.

    ABA also has other important functions that may not have become apparent without the

    use of genetic manipulation. Mutations in the ABl3, AB14 and AB15 genes were isolated by

    screening mutagenized population of seeds on exogenous ABA for insensitivity when compared

    to wildtype sensitivity (Koomneef et al. 1984, Nambara et al. 1992, 1994, Ooms et al. 1993,

    Finkelstein 1994b). The phenotypes of these mutations are sirnilar to those seen in abil-1 and

    abi2-1 in that they confer resistance to exogenous ABA to the seed; however these mutants

    are also defective in the developmental program of the embryo (Finkelstein 1994b). A613 has

    been cloned and the sequence shows homology to VPl, a seed specific transcription factor

    found in maize (Giraudat et al. 1992). A mutation in VP1 also confers ABA insensitivity to the

    seed (McCarty et al. 1991). These data suggest these transcriptional factors may be a

    conserved hormone response regulators.

    An allelic series has been isolated for the AB13 locus (Koornneef et al. 1984, Nambara et

    al. 1992, 1994, Oorns et al. 1993). Phenotypes of these mutants include desiccation intolerance,

    lack of dorrnancy, absence of chlorophyll degradation, reduction in seed storage proteins (i.e.,

    12s cruciferin and 2s napin) and lipids, and LEA gene products (Le., MIO, M77, AtEm1, PAP38);

    and in the severe alleles, germination is viviparous (Koomneef et al- 1984, Finkelstein 8

    Somerville 1990, Nambara et al. 1992, 1994, Finkelstein 1993, Ooms et al. 1993, Parcy et al.

    1994). The abi3 mutants do not have altered stomatal amtrol and respond to ABA in the

    vegetative tissue similarly to wildtype (Koomneef et al. 1984, Finkelstein 8 Sommerville 1990).

    The mutant phenotypes are confined to the embryonic tissue and AB13 is not found to be

    expressed in the adult vegetative tissue, suggesting a tissue specific role for AB13 (Giraudat et

    al. 1992, Parcy et al. 1994). The abi3-1 mutant also has wildtype levels of ABA in the seed,

  • indicating the lesion is not in ABA turnover or inactivation of the hormone (Kwmneef et al. 1984).

    These data suggest that ABA is required for the normal maturation of the embryo; however. if

    these seeds are potted before they desiccate, they will develop into normal plantlets. It has also

    been reported that mature abi3 embryos have premature initiation of leaf primordia and

    differentiation of xylern tissue, therefore the mutants resernble a developing seedling rather than

    an embryo (Nambara et al, 1995). Gene expression in the embryo also show that these mutants

    bypass the wildtype developmental processes for which expression of LEA gene products are

    markers (Finkelstein 1993, Parcy et al- 1994). It follows that because these seeds are insensitive

    to ABA, ABA has a central role in embryo maturation. However, sin severe ABA auxotrophs

    do not have developmentally altered embryos, a broader role for AB13 may exist Alternative

    hypotheses for AB13 function are: 1) AB13 is responsible for the establishment of a

    developmental pathway in the seed, through which ABA may act; or 2) AB13 acts in both ABA

    signaling and embryo maturation (Bonetta & McCourt 1998). However, studies do support a minor

    role for ABA in embryo development. When crossed to the ABA auxotroph abal, a weak allele

    of abi3 has severe phenotypes (Koomneef et al. 1989). If ABA is applied to the double mutant,

    desiccation tolerance is increased (Kwrnneef et al. 1989). In addition, a srnall subset of the

    genes which have altered expression patterns in abi3 mutants are also reduced in abal mutants

    (Le., AtEm1 and AtEm6) (Parcy et al. 1994). When vegetative tissue with ectopic expression of

    AB13 is exposed to ABA, seed specific genes are induced (Le., AfEml, Af2S3, and CRC) (Parcy

    et al. 1994, Parcy & Giraudat 1997), and ABA sensitivity is partially recovered in the abil-1

    mutant (Parcy & Giraudat 1997). Which ever is the actual process, the data suggest that ABA

    does indeed act through a path in the seed delineated by ABl3.

    Mutations in A514 and AB15 cause a reduction in sensitivity to exogenous ABA and in

    accumulation of a LEA gene product (AfEMG) in the seed (Finkelstein 1994b). These mutants do

    not have altered stomatal wntrol. Although effects of mutations in AB14 and AB15 appear to be

    confined to the seed (thus making them similar to AB13), there are also differences. For example,

    neither mutation causes a reduction in dorrnancy of the mutant seeds (Finkelstein 1994b).

    Furthemore, expression of AB14 has been detected in the shoots and roots, making regulation of

  • Introduction 10

    AB14 spatially d0Vferent from AB13 (Finkelstein et al. 1998). AB14 has been cloned and is a putative

    AP2 transcription factor (Finkelstein et al. 1998). This protein contains a putative WAAEIRD box

    motif which is hypothesized to participate in hormonal andlor stress related signaling (Finkelstein

    et al. 1998). These mutants represent the newest additions to the ABA insensitive mutants, but

    information is lirnited to date, However, further analysis of these mutants may provide fumer

    insight into ASA function not found by the other ABA insensitive mutants descrbed.

    1.2.3 Enhanced Response to ABA Mutants At the opposite end of the spectnim of ABA sensitivity are era mutants, enhanced

    response to ABA- These were isolated by screening rnutagenized seeds on levels of ABA that

    do not inhibit wildtype seeds frorn germinating and selecting seeds that are not able to germinate

    (Cutler et al. 1996). Mutations in three loci were isolated in the original screen, however, only

    one, era7, has been characterized to date. in addition to seeds that are hypenesponsive to

    exogenous and endogenous ABA, the guard cells are also more responsive to exogenous and

    endogenous ABA when compared to wildtype (Culter et al. 1996, Pei et al. 1998)- RA 1 encodes

    the l3 subunit of the enzyme, protein famesyltransferase (FTase) (Cutler et al. 1996). FTases are

    within the same group of enzymes as geranylgeranyltransferases (GGTase), called protein

    prenyltransferases (Schafer 8 Rine 1992). FTase has been shown to consist of two subunits (a

    and 13) which dimerize. 60th subunits are required for activity (Qian et al. 1996). In addition to the

    l3 subunit in Arabidopsis, the genes for the a and B subunits from pea (Yang et al. 1993, Qian et

    al. 1996) and tomato (Schmitt et al. 1996) have been cloned. Prenyftransferases prenylate, or

    covalently attach a lipophilic isoprenyl moiety (wmpounds with a repeating five carbon

    structure), to a protein substrate. FTase attaches famesyl groups (15 carbon groups). The point

    of attachment is at the C terminus of the protein with a C M motif where A is any aliphatic

    amino acid and X is any arnino acid except leucine and phenylalanine. The attachrnent is a

    thioester linkage to the cysteine residue. This process increases the lipophilicity of the target

    protein, and the famesyl group can insert into the plasma membrane (Schafer 8 Rine 1992).

  • From other mode1 organisms, Rases are known to localize to the membrane and activate target

    proteins, such as the Ras superfamily of small GTP-binding proteins, the 6 subunit of the

    heterotrimeric GTP-binding proteins, fungal mating factors, and nuclear lamins (Schafer & Rine

    t992). These targets, in tum, participate in a variety of signal transduction pathways, modulating

    a number of cellular events, including cell division, yeast mating, and stress responses (Schafer

    & Rine 1992). In plants, ANJ1, a homolog of the bacterial chaperone DnaJ, known to function in

    stress responses, is the only characterized target of FTase (Zhu et al. 1993).

    FTases have been Iinked with the cell cycle in marnmals and Randall et al- (1993) showed

    that there are many proteins in cultured tobacco cells which are isoprenylated. Thus, it followed

    that FTase may function in cell cycle wntrol in plants. Therefore, the influence of Rase on the

    cell cycle has been investigated in tobacco suspension cells and in tobacco (Nicotiana tabacum

    cv. Xanthi) transforrned with a promoterGUS fusion with the B subunit of pea FTase (Pisum

    sativum cv Alaska) (Qian et al. 1996, Zhou et al. 1997). Use of a Rase specific inhibitor

    suggests that n a s e acts to positively regulate cell division in tobacxo suspension cell cultures

    and increased FTase expression is associated with increased mitotic activity (Qian et al. 1996).

    In addition, FTase activity has been shown in all tissues of tomato (Lycopersicon esculentum cv

    VFNT cherry), but higher levels of activity were observed in tissues characterized by rapid cell

    division, such as the apical bud and stems from young plants and in developing fruit (Schmitt et

    al. 1996). Control of the cell cycle appear to be regulated by differential expression of FTase

    (Zhou et al 1997). However, there is no clear correlation between meristematic activity and

    nse activity, suggesting a more complex function for n a s e in plants. Activity of Rase was

    not high in rapidly dividing tomato cell culture (Schmitt et al. 1996), furthemore, FTase activity

    was present in stem tissue in which cell division has ceased (Schmitt et al. 1996). In addition,

    expression of pea FTase in transgenic tobacco was also seen in vascular tissue (Zhou et al.

    1 997).

    Regulation of FTase expression is much less characterized. Studies suggest that FTase

    is mainly, but not exclusively, expressed in rapidly dividing tissue such as mature and

    geminating embryos, meristematic tissues, and junctions between organs (Zhou et al. 1997).

  • Introduction 12

    Light has been shown to regulate expression of mase in pea, but FTase expression in tobacco

    transforrned with a promoterGUS fusion with the B subunit of pea FTase was reversibly Iight

    regulated (Yang et al. 1993, Zhou et al, 1997) and not light regulated in tomato (Schmitt et al.

    1996). The hormone, auxin, has also been shown to positively regulate n a s e expression,

    whereas ABA had no effect (Zhou et al. 1997). To fully understand the role of FTase in plants,

    the role and the regulation of Rase must be further studied.

    The eral-2 mutant has enhanced response to ABA in the seed and the guard cell (Cuiter

    et ai. 1996, Pei et al. 1998)- The eral-2 mutation is a deletion mutation and is a recessive, Ioss-of-

    function mutation (Culter et al. 1996). lnterpretation of the eral-2 mutant phenotype suggests that

    the ERAl gene product operates both within the seed and the vegetative tissue. The mutant

    phenotype also suggests in wildtype it acts as a negative regulator of the ABA signal (Cutler et

    al. 1996). Given that the function of ERAl is to farnesylate target proteins, it is more likely that

    ERA1 farnesylates a target protein which negativety regulates the ABA signai (Cutler et al.

    1996).

    Studies involving ABA response mutants have been useful in providing information to

    establish the role of ABA in plants, and the data so far suggest that ABA has a broad range of

    functions, Further study using genetic mutants will expand the knowledge of ABA function.

    1.3. Digenic Studies The use of digenic studies has been valuable in determining the order of genes within

    pathways and relating gene product functions with other gene products (Finkelstein 8

    Sommerville 1990). For example, ABA levels can be altered genetically in a response mutant

    background, thereby elucidating the influence of ABA within a pathway. Also, examining the

    severity of a phenotype within a double mutant background provides insight as to how those

    gene products are ordered with respect to each other. For example, if a double mutant is

    constructed between two nuIl mutations found in genes of products within the same pathway,

    the resulting phenotype of the double will be similar to either of the single mutants. In contrast, if

    the two nuIl mutations are in paralfel pathways, the phenotype will be more severe. In the event

  • ln troduction 13

    the mutations are leaky, two mutations within the same pathway will be result in a phenotype

    which is additive, rather than synergistic as when two mutations are in parallel pathways

    (Finkelstein 8 Somme~lle 1990).

    With this in mind, a cross was designed between an ABA auxotroph and wildtype. The

    result was a matemal plant that produced ABA while housing an embryo within a silique that did

    not produce any ABA (Karsen et al. 1983). These mutant studies showed that of the two

    increases in endogenous ABA characteristic of a developing embryo, the first ABA peak is the

    result of materna1 production and the second is derived tom the embryo- These data also

    suggest that domancy is established almost exclusively by the endogenous ABA of embryonic

    origin, regardless of the genotype of the matemal tissue (Karssen et al. 1983, Koomneef et al.

    1989). Other crosses between an ABA auxotroph and a weak abi3 mutant revealed that the

    matemal tissue does, however, influence embryo maturation and desiccation tolerance as

    normal maturation and desiccation tolerance were established if either the matemal tissue or the

    embryo could produce ABA (Koomneef et al. 1989). Matemal tissue has also been shown to

    influence the sensitivity of seeds to exogenous ABA as seeds with mutated AB11 gene products

    in the seed mat are less sensitive to exogenous ABA than seeds with wild type AB11 gene

    products (fin keistein 1994a).

    When abil-1 or abi2-1 is crossed to abi3-1, the result is increased insensitivity to

    exogenous ABA when compared to the single mutants. These data suggest that these gene

    products operate in parallel and overlapping ABA signaling pathways (Finkelstein & Sommerville

    1990). This is in cornparison to double mutants between abil-1 and abi2-1 where the resulting

    seeds have only slightly increased resistance to exogenous ASA compared to the single

    mutants, suggesting that the gene products operate in the same pathway. But as described

    above, AB11 and AB12 gene products appear to only operate in a subset of the same responses,

    further supporting the notion that ABA operates via a branching web-like path as compared to a

    linear path. Double mutant analysis between abi4-1 and abil-1, abi2-1 and abi3-1 suggest that

    AB14 operates in a parallel pathway to ABII, but in a similar pathway to AB12 and AB13, as the

    sensitivity to exogenous ABA was increased in the abil abi4 double mutant, but oniy slightly

  • Introduction 14

    increased in the abi2-1 abi4-1 or abi3-1 abi4-1 double mutants (Finkelstein 1994b). Double

    mutant analysis between abi5-7 and abil-1, abi2-1 and abi3-1 suggest that AB15 operates in a

    parallel pathway to AB11 and AB12 and in a simiiar pathway to AB13 (Finkelstein 1994b).

    Epistatic studies also assist in ordering gene products within a pathway (McCourt 1999).

    To date, there is only one well characterized mutant that can be used in a epistatic study with

    ABA insensitive mutants; eral mutants. Epistasis is the condition when one mutation replaces

    the phenotype of another mutation with its own (McCourt 1999). For the results to be meaningful

    in an epistatic study, there are two criterion that must be met: 1) both mutations must be nuIl

    mutations; and 2) the two mutations must have clearly distinct phenotypes (McCourt 1999). The

    era mutants have phenotypes which are clearly distinguishable from abi mutant phenotypes.

    Furthemore, erai-2 is a nuIl mutation, thereby fuffilling al1 the criterion for an appropriate

    candidate for an epistatic study.

    The eral-2 mutant was crossed to both abil-1 and abi2-1 (Pei et al. 1998), and these

    studies showed that eral-2 is epistatic to both abil-1 and abi2-1, Le., phenotypes of the double

    mutant more resemble those of era 1-2 than abil-1 or abi2-1 (Cooney 1996. Pei et al. 1998). A

    mutation in eral-2 is able to suppress the lack of ABA sensitivity in the seed and in the guard cell

    (Pei et al. 1998). With respect to the guard ceIl, anion channel activity is recovered, indicating

    successful transmission of the ABA signal. To place these two genes in a pathway, these data

    suggest that downstream of AB11 and AB12, RA 1 localizes a negative regulator of anion

    channels in guard cells to the plasma membrane for proper function (Pei et al. 1998).

    The data from the dQenic studies described above must be interpreted very carefully.

    Although eral-2 is a nuIl mutation. the remaining mutants have leaky mutations, which leads to

    ambiguous results. Also, the signaling state of the AB11 and AB12 gene products are in question,

    due to the dominant negative nature of the mutant alleles. This further complicates interpretation

    of these results. Placing these gene products within pathways can be tentative at best.

    however, until more nuIl mutants are isolated; the mutants described above provide Me only

    framework on which to operate.

  • Introduction 15

    The data collected thus far suggest that a Iinear path may not be an appropriate model to

    represent ABA functioning, There is much "crosstalkn and overlap between "apparent"

    pathways delineated by loci presently characterized, perhaps better presented by a web-

    However, there are interactions within the ABA web still to be characterized.

    1.4 Interactions Between Hormones There are presentiy seven plant hormones identified, each having specific roles

    rnodulating plant growth and the extemal environment (Kende 8 Zeevaart 1997). Often, clear

    distinctions are not present and there is overlap in function between hormones. For example,

    auxin, cytokinin and GA have al1 been shown to promote cell division. Auxin and GA have also

    been shown to prornote cell elongation. In addition to complementary roles, hormones have also

    been shown to act as antagonists to each other. For example, ABA has been shown to act as

    an antagonist to auxin responses and inhibits shoot and root growth (Himmelbach et al. 1998).

    Also shown, GA promotes germination in the seed and ABA has also been shown to act as an

    antagonist, inducing dormancy (Black 1991). These data also suggest that screening for mutants

    within one hormone pathway may recover mutants in other pathways. For example, Koomneef

    et al. (1 982) screened for revertants of nongenninating GA auxotrophic mutants and isolated an

    ABA auxotrophic mutant (abal). Other ABA auxotroph mutants were isolated by screening for

    seeds with the ability to geminate on paclobutrazol, a GA inhibitor (Lon-Kloosterziel et al.

    1996). In addition, a GA insensitive mutant was isolated by searching for a suppressor of abil-l

    (Steber et al- 1998). Results also indicate that a mutation in AB13 alleviates the need for GA to

    geminate in a GA auxotroph (Narnbara et al. 1992); also ABA insensitive and biosynthetic

    mutants are insensitive to GA biosynthetic inhibitors (Nambara et al. 1991, 1992). These data

    suggest that ABA and GA are antagonists and are perhaps operating via a push-pull mechanisrn

    (Koornneef et al. 1982, Steber et al. 1998). When, for example, the level of ABA is decreased

    genetically, then the amount of GA required to induce germination also decreases (Steber et al,

    1998). Taken together, these data suggest that there are interactions between hormones. In

    addition to a branching pathway for ABA signal transduction, a web-like pathway may also be a

  • ln troduction 16

    more appropriate model to describe plant development and response, where hormones and

    development no longer act through individual pathways, but through overlapping and interfocking

    ones.

    1.5 Thesis Work Screening for mutants supersensitive to ABA presents an interesting challenge to

    recover since these mutants would be hyperdomant, To recover them, it may be necessary to

    genetically alter the endogenous ABA level or the sensitivity to it. This suggests that a

    suppressor screen of ABA auxotrophs or insensitives may be fruitful in finding novel ABA

    supersensitive mutants (Cooney 1996). It has been demonstrated that eral-2 is suppressor of

    abil-1 with respect to ABA sensitivity at the level of seed germination and in guard cell function

    (Cooney 1996, Pei et al. 1998). This suggests that novel alleles of eral or other supersensitive

    mutants could be isolated as suppressors of abil-1. One mutant, SC19-6, along with others,

    was obtained in such a screen (Steber et al. 1998). SC19-6 is a semi dwarf with club-shaped

    siliques and an exaggerated flat floral bud. This mutant was isolated from the abil-1 background

    and was found not to complement eral-2 suggesting it is an new allele of eral; era14. The

    development, genetics, physiology, expression levels of ERAI, and activity of the era14 protein

    are examined in eral-4 and abil-l/abil-1 era 14/eral4-

    The suppression of ABA responses in abil-1 by era14 appears to fall into four

    categories: 1) era14 is epistatic to abil-1 (i.e., phenotype of abil-Ilabil-? era14/era14 is like

    eral-4), 2) partial suppression (i.e., phenotype of double mutant is an intermediate of e ra l4 and

    abil-1), 3) era14 does not suppress (Le., phenotype of double mutant is like abil-1) and 4)

    phenotype of double mutant is more severe than either abil-1 or era1-4. Ail genetic,

    developmental, and physiological data presented in this thesis are examined in this context.

  • Materials and Methods

    2.0 Materials and Methods

    2.1 Growth Conditions Arabidopsis Vlaliana wild type strains used in this study were: Landsberg erecta (Ler)

    and Meyerowitz Columbia (MCol). All seeds were surface stenlized in solution containing 10%

    bleach and 0.001 % sodium dodecyl sulfate (SDS) (wlv) for 5 mins at room temperature (RT). The

    seeds were suhsequently rinsed four times with sterile deionzed water and plated on petri

    plates containing 0.8% agar supplernented with Murashige and Skoog (MS) basal culture salts

    (Sigma Chemicals) buffered at pH 5.7 with 5mM morpholinoeoianesuWonic acid (MES) (Sigma

    Chernicals). Unless stated otherwise, al1 seeds were chdled four days at 4C to synchmnize

    germination. Plants were grown in pots or on plates at W C under continuous light conditions.

    Plants were grown in a standard autoclaved soi1 medium (Premier Pro-mix) containing sphagnum

    peat moss (75%-85%), perlite, vermiculite, dolomitic and calcitic Iimestone.

    Abscisic ad (ABA) was dissolved in methanol to a final concentration of 1 OmM. The

    agar media was sterilized and aflowed to cool to approximately 55C before the hormone was

    added.

    2.2 Genetic Methods A Iist of mutant strains used in this analysis is provided in Table 1.

    2.2.1 Polymerase Chain Reaction (PCR) conditions of AB11 locus Synthetic oligonucleotide prirners for PCR were designed within the coding region of the

    ABII locus (Leung et al, 1994, Meyer et al. 1994)- The primers used were: AB1 1 GEN 1

    S'GGAGCTATCTTATAGATCACAACC3' and A81 1 GEN2

    SGCGTGTGAGATGGCAAGGAAGCGG3' and generated a fragment 830 bp long containing an

    intemal Ncol site in wildtype- The conditions for PCR were: 1 :30 min at 94C followed by thirty

    cycles of O:3O min at 94'C, 1 :O0 min at 56C and 1 :O0 min at 72C. This restriction enzyme site

    17

  • Materials and Methods 18

    Table 1. Mutants used in this study,

    S k i n Ecotype Phenotype & Mutagen Reference heritabi&

    abil-7 Ler 1, EMS (point Koomneef et daminant mutation) al., 1984

    a bi2- 1 Ler 1, EMS (point Koornneef et dominant muta&) al., 1984

    era 1-2 MCd 2, fast neutron Cutter et al., recessive (null) 1996

    1 = ABA insensitive, seeds are nondormant and can germinate on high levels of exogenous ABA, vegetative tissue is witty due to stomatai closure defect 2 = ABA sensitive, seeds are dormant and can not geminate on low levels of M A , vegetative tissue is nonwilty due to enhancement of ABA signal and flowers have protruding carpels and enlarged inflorescence.

  • Materials and Methods 19

    does not exist in abil-1 owing to the point mutation found within the gene. Digestion of the

    wildtype PCR product with Ncol (New England Biolabs) produced two bands: 257 bp and 573

    bp, that were size fractionated by electrophoresis using a 1.5% agarose gel (Sambrook et al.

    1989). The DNA was visualized by staining with ethidium bromide and visualizng under UV Iight

    (BioKan True View Transillurninator).

    2.2.2 Mapping Studies Mapping the mutation to a specific chromosome was perforrned using ecotypespecific

    short sequence length polymorphisms (SSLP) and restriction fragment length polymorphisms

    (RFLP) (Koniecmy & Ausubel 1993, Fabri & SchafTner 1994). The mutant was crossed to MCol,

    and plants homozygous for the mutation were selected from the resulting F2 progeny by

    choosing non-geminators when grown on 0.8pM ABA and moving them to MS media for rescue.

    The DNA was isolated according to Rogers and Bendich (1 994) with modifications.

    Approxirnately 2cm2 leaves were homogenized in CTAB buffer (2% cetyl methyl ammonium

    bromide [CTABj, 1.4M NaCI. 8mM EDTA and 20mM TRIS-HCI [pH 8.O]), 200~1 per leaf and 1 pl B 2-

    mercaptoethanol. The mixture was heated at 65'C for 30 mins. Chloroform (250pl) was added

    and the mixture was vortexed for 3 mins and centrifuged in a microfuge at 13000 rpm for 5 mins.

    The aqueous layer was removed and placed in a microhige tube and isopropanol(150pI) was

    added. The DNA was allowed to precipitate for 15 mins at RT and was recovered by

    centrifugation at 13000 rpm for 1 O mins. The resulting pellet was washed with 70% ethanol and

    dried in a Savant SC 110 Speed Vac. The DNA was resuspended in 50pl TE (10mM Tris HCI pH

    8.0, 1 mM EDTA pH 8.0).

    Synthethic oligonucleotide primers (Research Genetics Map Pairs) were used to amplify

    SSLP's and RFLP's and appear in Tables 2 and 3. PCR regimes for SSLP and RFLP PCR primer

    sets appear in Table 4. RFLP products were digested with restriction enzymes according to

    manufacture's specifications (Pharrnacia). RFLP fragments and SSLP PCR products were

    separated by electrophoresis using 4% agarose gels in 1X TAE buffer and stained with ethidium

    bromide. The PCR fragments were visualized on a Bio/Can True View 300 transilluminator.

  • Materials and Meaiods 20

    Table 2. SSLP ioci examined by PCR used to map the SC194 mutation.

    The SC19-6 mutant was crossed to MCol and homozygous plants for the SC19-6 were selected by choosing nongeminators on MS media supplemented with 0.8pM ABA and subsequently moving them to MS media for rescue. DNA was isolated from 1 O plants and the genotype of the specified loci determined by PCR according to the conditions described. PCR products were size fractionated by electrophoresis on a 4% agarose gel and stained with ethidium bromide and visualized with UV light.

    Chromosome SSLP marker MCol size (bp) Ler size (bp) 1 nga 280 1 O5 85

    3 nga 6 143 123 3 AhGAPablf f 142 150 4 nga8 1 54 1 98 4 nga 1 1 07 150 140 5 nga 225 119 1 89 5 nga 76 231 250

    Table 3. RFLP loci on chromosome 5 examined by PCR and enzyme digestion used to rnap the SC79-6 mutation.

    The SC19-6 mutant was crossed to MCol and plants hornozygous for SCIS-6 were selected by choosing nongeminators on 0BpM ABA and subsequently moving them to MS media for rescue. DNA was isolated from 10 plants and the genotype of the specified loci determined by PCR according to the conditions descnbed. PCR products were digested by the specified enzymes according to manufacture's instructions (NEB, Pharmacia) and size fractionated by electrophoresis on a 2% agarose gef. The gel was stained with ethidium bromide and the DNA visualized with UV light-

    Table 4. Regimes of PCR for SSLP and RFLP markers.

    Each set of cycles were preceded by an initial denaturation of 1 :30 at 94C.

    Denature Reanneal Extension Marker "C nn "C h "C n h cycles SSLPes 94 0:30 55 0:25 72 0:30 40

    DFR 94 0:30 55 0:25 72 1:lO 40 lfyiii 94 0:30 55 O:= 72 0:40 30

    RBCSB 94 0:30 58 0:30 72 0:30 40

  • Materials and Methods 21

    2.3 Developmental Analyses Methods

    2.3.1 Inflorescence Height, Silique Length and Floral Organ Nurnber Inflorescence height was measured with a ruler frorn soit level just below the rosette

    leaves to the top of the tallest inflorescence. Mature plants grown under continuous tight

    conditions were measured (n=10-14). Silique length was measured using a dissecting

    microscope and induded the abscission zone to the tip of the stigmatic tissue- Five mature

    siliques from five plants for each genotype grown under continuous light conditions were

    chosen for the analysis (n=25). Floral organ number was counted using the dissecting

    microscope.

    2.3.2 Stomatal Measurements Mature rosette leaves were cleared according to Berleth and Jurgens (1993). Tissue

    was fixed in solution a containing ethanokacetic acd (6:l) at RT ovemight, washed four times in

    100% ethanol, and placed in dearing solution (8g chforohydrate in 2ml water and 1 ml glyceral)

    ovemight. The abaxial side of the Ieaves were examined with Nornarski optics on Reichert

    Polyvar microscope. To obtain stomate density, stomates were counted and divided by the area.

    Measurements of stomate length included the guard cells. Stomatal aperture invoived measunng

    the widest point of the stomatal pore delineated by the guard cells. Twenty stomates from four

    leaves from each genotype were examined (n=78-80).

    2.3.3 Scanning Electron Micrographs Floral tissue was fixed in FAA (35% fomaldehyde: glacial acetic acid: 70% ethanol

    [1 : 1 :18]). The fixed tissue was dehydrated through a graded ethanol series, then critical point

    dried with CO2 (Autosamdri 814 critical point drier). The dehydrated samples were mounted on

    metal stubs, sputter coated with gold (Polaron SP3 sputter mater) and observed with a Hitachi

    S-2500 SEM at 10 and 15 kV. Examination and charactenzation of the morphological changes

  • Materials and Methods 22

    found in the mutant and double mutant were perfomied- This induded an examination of the pistil,

    anthers, pollen grains and a transverse cross section of the carpel.

    2.3.4 Statistical Analyses of Data Chi-squared (x2) tests were perfomed aaxrding to (McClave 8 Dietrich 1991). Data was analyzed using a model II nested ANOVA, where genotype (n=4-5) and

    treatrnent were treated as f ~ e d effects and plants within genotype were treated as random

    effects. Least Squared Mean (LSM's) accounted for the variation among plants and replicates

    within a genotype; thus these means were used for graphing unless otherwise stated- Error

    bacs represent 95% confidence intervals (C.1,). Normal distribution was unattainable for any trait

    except inflorescence height, but results for the ANOVAs were robust (Le., similar trends

    following In, logit and other transformations). Analysis was perfomed on the statisticaf prograrn

    JMP 3.1. (SAS lnstitute 1 994). Descriptions of the models appear in Appendix 1.

    2.4 Physiological Methods

    2.4.1 Seed Sensivity to Exogenous and Endogenous ABA Seed sensitivity to exogenous ABA was assayed by plating surface sterilized seeds of

    equivalent age on petri plates with MS media supplemented with 0,0.3, 0.6, 12, or 3pM ABA.

    Plated seeds were chilled for 4 days to syrichronize germination, Germination rates were scored

    5 days after transfer to 22-C. Expanded cotyledons was the criterion for germination.

    Sensivity to endogenous ABA was assayed by measuring dormancy. Seeds of

    equivalent age were plated on petn plates with MS media. Without chilling, the germination rates

    were scored each day for 5 days. Radicle emergence from the seed mat was the criterion for

    germination.

  • Materials and Methods 23

    2.4.2 New Root Growth on ABA Assay New root growth on ABA was perforrned as descnbed by Leung et al. (1997) with slight

    modifications. Seeds were surfaced sterilized and plated on 0.8% phytagel (Sigma Chemicals)

    plates. Plates were placed vertically to prevent the roots from penetrating the agar. When Me

    roots were approximately 2cm long (after one week), the seedlings were moved to MS media

    agar petri plates supplemented with 0, 10.50. or 100pM ABA. The length of Me roots was

    marked and three days later, the new root growth was measured. Data from three independent

    expen'ments are shown (n=22-50)- Each data point represents the LSM of al1 three experiments-

    2.4.3 Water Loss Assay Water loss assay was performed as described by Koornneef et al. (1984). Plants of

    approximately the same size, just prior to senescence, were sprayed wth 1 pM ABA and placed

    in the dark for one hour to induce stomatal closure. The plants were patted dry and excised just

    below the rosette leaves and placed in preweighed buckets. The plants and buckets were

    weighed every 20 mins over a three hour period. Subsequently, to establish the dry weight and

    the total amount of water in the plants, they were placed at 37C for approximately three days.

    Percent water loss over time was calculated. Five plants per genotype per bucket were used.

    The data points represent the average of three replicates (n=15). The experiment was

    perfomed once.

    2.4.4 Stomatal Aperture Assay Stomatal aperture in response to ABA exposure was tested as descnbed by Pei et al.

    (1 997) with slight modifications. Rosette leaves were floated (adaxial side up) with petioles

    submerged for two hours on a stomate opening solution (20mM KCI. ImM CaCI, and 5mM MES

    KOH [pH 6.1 51) under 300pE illumination. Leaves were subsequently floated on the stomatal

    opening solution supplemented with O or 30pM ABA for 24 hours under 300pE illumination.

    Leaves were patted dry and clear nail polish was applied to the adaxial side and peeled off

    when dry. These nail polish impressions were examined on a Reichert Polyvar microscope at

  • Materials and Methods 24

    40X magnification and the stomatal aperture measured (n=204). Two leaves for each genotype

    were examined for each condition. The experiment was repeated twice with similar results-

    2.4.5 RAB18 mRNA Induction Seeds were surfaced sterilized and plated on 0-8% phytagel (Sigma Chemicals) plates.

    Plates were placed verb'cally to prevent the rwts from penetrating the agar- When the seedlings

    were approximately two weeks old, they were moved to petn plates with MS media

    supplemented with 0, 10 or 50pM ABA, 48 hours later, RNA was isolated and analyzed for

    RAB78 expression as descnbed in sections 2-5.3 and 2.5.4.

    2.5 Molecular Biological Methods

    2.5.1 Plant DNA Isolation Plant DNA was isolated according to Rogers and Bendich (1994). Several grams of plant

    tissue were hawested and ground to a fine powder with Iiquid nitrogen in a mortal and pestle-

    The powder was placed in a Corex tube and 1 mUgFW 2X CTAB buffer (2% CTAB, 100mM Tris-

    HCI [pH 8.01, 20mM EDTA [pH 8.01, 1.6 M NaCl and 1 % polyvinylpyrrolidone [PVP]) was added to

    remove polysaccharides and chlorophyll. Proteins were extracted with 1 rnlIgRN

    chloroforrn:isoamyialcohol(24:1) and mixed thoroughly. The mixture was centrifuged at 10000

    rpm for 10 mins in a Sorval SS-34 rotor at RT. The supematant was transferred to a clean

    centrifuge tube. 0.1 vols of 10% CTAB buffer (10% CTAB and 0-7M NaCI) heated to 65C. was

    added to the supematant Proteins were further extracted with 1 rnllgFW

    chloroform:isoamylalcohol(24:1) followed by centrifugation as described above. The

    supematant was transferred to centrifuge tube and 1 vol of CTAB precipitation buffer (1 %

    CTAB, 50mM Tris-HCI pH 8.0, lOmM EDTA [pH 8.03) was added- The solution was mixed gently

    and DNA was allowed to precipibte at 4C ovemight The DNA was collected by centrifugation

    at 10000 rpm for 10 mins in a Sorval SS-34 rotor. The pellet was dried and resuspended in

  • Materials and Methods 25

    200pVgMI high salt TE buffer (10 mM Tris-HCI @H 8.0],1 mM EDTA and 1 M NaCI). RNAase

    (1 00pg/ml) was added to eliminate RNA contamination. The mixture was incubated at 37C for 1-

    2 hours and the RNAase was extracted with 0-5 vols chloroform:isoamylalcohol(24:1) followed

    by centrifugation. The supematant was transferred to new tube and 2 vols of cold 100%

    ethanol was added and the DNA was allowed ta precipitate for 15 mins at -20C. The DNA was

    collected by centrifugation at 10000 rpm for I O mins in a Sorval SS-34 rotor- The pellet was

    washed with 70% ethanol and dn'ed using a speed vac (Savant SC 110). The pellet was

    rehydrated in 0.1X TE buffer 40 pVgFW (1mM Tris-HCI [pH 8-01, OAmM EDTA).

    2.5.2 DNA Gel Blot Analysis Arabidopsis genomic DNA was digested using restricon enzymes according to the

    manufacturer's instructions (Phannacia, New England Biolabs, Stfatagene) and separated by

    electrophoresis using 0.8% agarose gels in 0.5X TBE buffer (Tris boric acid EDTA) (Sambrook et

    al. 1989). Gels were soaked in 0.25N HCI to fragment the DNA. The DNA was transferred ont0

    Hybond-N+ nylon membrane (Amersham) by capillary transfer ovemight in 10X standard saline

    citrate (SSC) (Sambrook et al. 1989) and the DNA was immobilized by irradiating the membrane

    (12000kJ of UV Iight in a Stratagene Stratalinker). The membrane was prehybridized and

    hybridized in a buffer (6X SSC, 5X Denhardt's 0.5% reagent and 100pglml sheared calf thymus

    DNA) at 65C. The biots were washed for 15 mins in 2X SSC and 0.1% SDS (wlv) at RT,

    followed by a 30 mins wash at 37C in O.iX SSC and 0.5% SDS (w/v), and a wash in 0-1X SSC

    and 0.5% SDS (wlv) at 50C for 15 mins and completed with a rinse at RT with O.1X SSC. The

    DNA blot was exposed to Hyperfilm MP autoradiograph (Amersham) ovemight at -70C to

    visualize [*PI hybridizati on.

    2.5.3 Plant RNA Isolation Al! glassware was baked ovemight at 350F (Sambrook et al. 1989). All solutions were

    prepared with 1 % diethypyrocarbonate (DEPC) and autodaved. Plant RNA was isolated

  • Materials and Meaiods 26

    according to Verwoerd et al. (1 989) with slight modifications. Tissue (200mg) was frozen with

    Iiquid nitrogen and ground to a fine powder with a morbr and pestle. The powder was placed in

    a microfuge tube and the RNA was extracted with 500pl of hot extraction buffer (phenol : 0.1 M

    LiCI, 100mM Tris-HCI IpH 8.0],10mM EDTA, 1 % SDS (wk) [M l ) preheated to 90C. The mixture

    was heated further for 1 min at 90C and then vortexed for 5 mins. Proteins were extracted by

    adding 250pI of chloroform: isoamy alcohol(24:l) and the mixture was vortexed for 5 mins and

    centrifuged for 15 mins at 13000 rprn in an Eppendorf centrifuge 5414 at 4C. The aqueous Iayer

    was removed and the protein extraction was repeated twice more, One vol of 4mM LiCl was

    added and the RNA was allowed to precipitate ovemight at 4C. To c=oHect the RNA, the mixture

    was centrifuged for 15 mins at 4C at 13000 rprn in an Eppendorf centrifuge 5414. The pellet

    was resuspended in 250~~1 sterile, deionized water. To precipitate the RNA, 0.1 vols of 3M

    sodium acetate (pH 5.2) and 2 vols 100% ethanol were added. An aliquot was taken and

    centrifuged for 20 mins at 4C at 13000 rprn in an Eppendorf centrifuge 5414. The pellet was

    washed with 70% ethanol to remove salts from the pellet and dned using a speed vac (Savant

    SC1 1 O). The pellet was resuspended in 25pl DEPC H20 and analyzed for integrity via

    electrophoresis.

    2.5.4 RNA Gel Blot Analysis Plant RNA (5pg) was denatured by heating to 65C for 15 mins in denaturing buffer (10~1

    formamide, 1 pl 10X MOPS butfer, and 3.5~1 formafdehyde). RNA was separated by

    electrophoresis using 1.1% agarose gel containing formaldehyde (6.6%) in 1X MOPS buffer [pH

    7-01 (0.2M MOPS, SOmM sodium acetate (pH 7.01, 10mM EDTA). The RNA was stained with

    ethidium bromide and visualized with a UV transilluminator (Bio/Can True View 300). The gel was

    equilibrated with 1OX SSC for 30 rnins, luith a solution change after 15 mins. The RNA was

    transferred ont0 Hybond-N+ nylon membrane (Arnersham) by capillary transfer in 20X SSC

    (Sambrook et al. 1989) and immobilized using UV light (12000k.J of UV Iight in a Stratagene

    Stratalinker). The membranes were prehybridize and hybridized in a buffer (1 M NaCI, 10%

    Dextran Sulfate. 1 % SDS (wlv) and denatured fragmented salrnon spem DNA [100~iglml]) at

  • Materials and Methods 27

    65C. The blots were washed twice at RT for 15 mins in 2X SSC and 0.5% SOS (w/v) followed

    by two washes at 60C for 15 mins 0.2X SSC and 0.5% SDS (wfv). Blots were exposed to

    Hyperfilm MP autoradiograph (Arnersham) ovemight at -70C to visualize [=PI hybridkation. Sizes

    for transcripts were compared to five ribosomal bands previously sized (Chang & Meyerowitz

    1 986).

    2.5.5 Probe Generation Radioactive probes were synthesized by random prirning as suggested by Sambrook et

    al. (1989). The RAB18 (Ung & Palva 1992) probe was a 1300bp fragment that was generated

    using PCR from Ler wildtype genornic DNA. The PCR regime used was: 1 :O0 min denature at

    94C. forty cycles of 0:30 min at W C , 0:25 min at 55'C and 1:10 min at 72C. The final extension

    was 3:00 at 72C.

    The ERA1 cDNA and genomic probes were a 1300bp and a 5kb fragment respectively

    that were generated using PCR. The cDNA probe was generated from the pZLS1 plasmid

    containhg the ERA 1 cDNA (Cutler et al. 1996). The prirners used were T7 and M l 3 forward

    Universal pnmers. The conditions for PCR were: 1 :30 min at 94C by followed by forty cycles of

    0:30 min at 94C. 0:30 min at 55C and 1 :O0 min at 72C. The genomic probe was generated from

    the pBK-CMV plasmid (Cutler et al. 1996). The prirners used were T3 and 77 Universal pnmers.

    The conditions for PCR were: 1 :O0 min at 94C by followed by twenty-five cycles of 0:30 min at

    94C. 0:30 min at 51 OC and 500 mins at 72C.

    2.5.6 Farnesylation Assay The famesylation assay was performed according to Cutler et al. (1996) with slight

    modification. Floral bud tissue from plants grown under continuous iight conditions was

    harvested. Protein was extracted in 1 ml of extraction buffer (50mM Hepes [pH 7.51, ImM MgCl,,

    1 rnM EGTA, 5mM dithiotfireitol (OTT), leupeptin (Zpgfrnl), aprotinin (2Cig/ml) and 1mM

    phenylmethylsulfonyl fluoride). Extracts were clarified by centrifugation at 1OOOOg for 10 mins

  • Materials and hlethods 28

    and then at 100000g for 30 mins. Soluble protein extract (100pg) was incubated at 30C for 40

    mins in 25pI of reacon buffer (SOmM Hepes [pH 5.71,SmM MgCI2, 5mM DlT, 5ug nudeosorne

    assem bl y pmtein (NAP). and OSpM tmarnesyl diphosphate (FPP) [17.O Cmrnol: AmershamD.

    Reactions were teminated with EDTA (50mM) and the mixture was analyzed by SDS PAGE,

    NAP was used as the target for prenylation for the endogenous farnesytransferase (nase).

    Gels were stained with Coornassie Brillant Blue R (Sigma) and incubated for 3040 mins in

    Amplify (Amersharn) before drying using a BioRad 6583 gel drier. The dehydrated gel was

    exposed to Hyperfilm MP autoradiograph (Arnersham) for one week at -70C to visualize the

    incorporation of PHIFPP. This experiment was perfomed once.

  • Results 29

    3.0 Results

    3.1 Genetic Analysis

    3.1.1 Isolation of Suppressor Mutation from abil- 1 The strain, SC1 9-6, was isolated by screening mutagenized abil-1 seeds for

    suppression of ABA insensitivity in the seed (Steber et al. 1998). When grown, the double

    mutant is a semi-dwarf with short, club-shaped siliques and flat floral buds. To isolate the

    suppressor mutation from the abii-1 background, SC1 9-6 was crossed to Ler- An resulting F i

    plant was allowed to self pollinate and the F2 seeds were collected. Since the vegetative and

    ABA sensitivity phenotypes of the suppressor mutation were unknown, the strategy to isolate

    the plant containing the suppressor mutation was to eliminate those classes for which the

    phenotype was known and readily identifiable (Le., ab i l - l and wildtype respectively). The first

    round of seledion included plating F2 seeds on MS media supplemented with 3pM ABA to allow

    the abil-l/abil-1 homozygotes and abil/+ heterozygotes to genninate. In this selection, 27%

    (54: 143) of seeds geminated on 3pM ABA, representing subset#l (Table 5). This percentage

    suggested 5 out of 16 possible classes germinated (XL 0.61, p>O.OS), perhaps including the

    abil/abil sc79-6/+ class, but excluding the double heterozygote (Table 5). These data

    suggested that plant homozygous for the suppressor mutation is not insensitive to ABA and must

    be homozygous to suppress homozygous abil-1. It also appeared that a heterozygous

    suppressor mutation can suppress heterozygous abil-1, or at least alter the sensitivity of the

    seed to ABA. The possibility of a matemal effect also remained, Le., the seed mat may influence

    the sensitivity to exogenous ABA, altering the germination ratios from the expected ratios

    (Finkelstein 1994a). However, since the concentration of A6A also prevents wildtype seeds

    from germinating, these data did not ailow determination of the mode of inheritance of

    suppressor mutation. The remaining classes (1 111 6) are represented by subset#;! (Table 5). This

  • Table 5. Genotype and phenotype of SC19-6 X Ler F2 classes.

    The SC19-6 mutant was crossed to Ler. The resulting FI plant was allowed to self pollinate. The F2 seeds were plated on 3pM ABA and classes in subset#l gemrinated and thus couid be eliminated from the analysis. Seeds from subseW were rnoved to MS media for rescue. Within subset##2, F2 plants were selected based on phenotype. Those looking like wild type (wt) were excluded and those resernbling the suppressor mutant ('sc19-6") were placed in subset#2B- Selection within subseWB included examining the gemination rate on MS media and establishing the genotype of representatives of F3 families at the AB11 locus, seeking the plant which resembled the suppressor mutant and was wildtype at the AB11 locus. - Subset Genotype Proportion out of Germination Vegetative

    16 classes phenotype on phenotype

    3pM ABA

    SC 1 9 - 6 / ~ ~ 19-6

    abi1-V abil-1 1 - "scl 9-6" SC 1 9 - 6 / ~ ~ 19-6

    * +/+ 1 - SC^ 9-6" SC 79-6 /~~19-6

    "desired ciass; + = germination, - = nongermination For simplicity, the strain name is used as the gene name of the suppressor mutation and %cl 9-6" is used to describe the phenotype of the homozygous suppressor mutation isolated from abil- Ilabil-1.

  • Resul ts 31

    includes the desired class, +/+ scl9-Wsc19-6. The seeds from subseW were moved from 3pM

    ABA to MS media to geminate.

    Selection from within subset#2 involved eliminating those plants which did not display the

    "sc19-6" vegetative phenotypes when grown in pots. The F2 seedlings (107) were potted and

    the vegetative phenotypes were scored. Of these, 28% (30:77) were scored as having a "sc19-

    6"-like phenotype, with a semidwarf stature, an exaggerated flat floral bud, and club-shaped

    siliques. With the data collected thus far, it was not possible to predict which classes from within

    subseH2 were selected, as the mode of inheritance had not yet been determined. SubseWB

    (Table 5) represents 4 classes of 11 likely having "sc19-6" vegetative phenotypes (30:77,

    x2=1 -27. p>0.05).

    Selection from within subseWB included an examination of the germination phenotypes

    of the F3 families. The thirty plants selected from subset#2 were allowed to self pollinate and the

    F3 seeds were collected- Due to the nature of this screen, the possibility existed that this mutant

    was not recoverable in an ABII+/ABIl+ background (Steber et al. q998). To test this possibility,

    F3 families were plated on MS media and the germination rates were scored. In the F3 family

    analysis, four families (3, 16,23,28) showed germination rates that suggested only one mutation

    was segregating as nongerminating seeds. If the segregating mutation responsible for the

    nongerminating seeds was the suppressor mutation of abil-1, this mlght suggest that the

    suppressor mutation was not recoverable in a witdtype background. I t was also possible that

    background mutations were preventing the seeds from germinating. Four F3 families were

    further analyzed to distinguish between these two possibilities.

    Approximately 20 representatives from each F3 family were potted and the vegetative

    phenotype scored. In addition, the genotype of representatives from each of the F3 families at

    the AB1 locus was determined using PCR and Ncol restriction analysis, as described in section

    2.2.1. Representatives from each of the families were genotyped in this manner (Table 6, Fig. 1).

    These data allowed detemination whether the suppressor mutation was recoverable in an

    ABIl+/ABIl+ background and whether the 'sc19-6" phenotype was dependent on the presence

    of the mutation in ABIl. lndividuals within one F3 family (#28), were found to display the 'sc19-6"

  • Table 6. Plant gross morphology and establishment of the genotype at the AB11 locus of approximately 20 representatives of 4 F3 families.

    F3 families from the cross SC19-6 X Ler were selected from other F2 plants baseci on vegetative phenotypes. Plants were either scored as wildtype (wt) or with semi-dwarfed stature and club- shaped siliques ('sc19-6"). The genotype for each plant at the AB11 locus was established as described (2.2.1). The plant sought was that one possessing 'sc19-6" phenotypes and wildtype at the AB11 locus.

    F3 family plants in family: phenotype genotype at AB17 locus

    For simplicity, the strain name is used as ?he gene name of the suppressor mutation and "sc19-6" is used to describe the phenotype of the homozygous suppressor mutation isolated from abil- ?/abil -1.

  • Results 33

    Fig 1. Establishing the genotype of SC1 9-6 X Ler F3 family individuals at the A811 locus.

    The PCR product is 830 bp long. The point mutation in abil-1 within the PCR product eliminates an Ncol site. Ncol digestion in wildtype produces two products, 257 and 573 bp. Arrows indicate 300 and 600 bp in the 100 bp ladder.

    Lane 1.100 base pair ladder Lane 2. Ler Lane 3. abil-1 Lane 4. wild type cDNA Lane 5. F3 family #16.1 Lane 6. F3 family #23.1 Lane 7. F3 family #3.1 Lane 8. F3 family #28.1 Lane 9. F3 family #28.8 Lane 10. F3 family #28.2

  • Results 34

    phenotype and were genotyped to have the wildtype allele at the AB11 locus. These data

    suggest that suppressor mutation does have a vegetative phenotype independent of abil-l and

    that the homozygous plant is recoverable in the wildtype background. However, since wild type

    plants were also segregating, indicating the parent plant was a heterozygote at the suppressor

    mutation locus, it was necessary to select the progeny homozygous for the suppressor

    mutation.

    F4 seed was collected from individual plants in F3 family (#28). Preliminary data

    suggested suppressor mutant seeds were more sensitive to exogenous ABA than wildtype

    seeds. Therefore, progeny from individual lines with 0% germination on 0.3pM ABA would

    represent a Iine homozygous for suppressor mutation. Two families (28.8 and 28.9), showed 0%

    germination on 0.3pM M A . These seeds were moved to MS media for rescue and assumed to

    be mutant lines homozygous for the suppressor mutation. The mutant plant was not a semi-

    dwarf; however it was supersensitive to ABA at the level of the seed and had club-shaped

    siliques, resembling SC1 9-6. The combination of ABA supersensitivity with the vegetative

    phenotypes does not resemble the phenotype of any mutant previously described-

    3.1.2 Confirmation of the abil-1 Suppressor Mutation Since the suppressor mutant was isolated from an EMS mutagenized population, the

    possibility existed that the vegetative phenotype is due to background mutations and is unlinked

    to the germination defect that was used to select the mutant. Therefore, it was necessary to

    show that the mutation in the suppressor mutation was the same mutation in the double mutant,

    SC1 9-6, and to show tight linkage between the distinctive suppressor mutation vegetative

    phenotype and the ABA supersensitivity germination defect.

    To ensure the recovered single mutant contained the mutation responsible for the

    phenotype observed in the original double mutant, the homozygous suppressor muation was

    crossed to abil-Vabil-1. An F1 plant was allowed to self pollinate and the resulting F2 progeny

    were plated on a MS media supplemented with 0.6 or 3 pM ABA. The expected ratio of 9:7

    germination: nongermination on a MS media supplemented with 3pM ABA was observed (59:40,

  • Results 35

    x2 = 0.53). On 0.6pM ABA, the expected ratio 133 germination: nongermination was also

    observed (70:10, X' = 2.20). These data suggest the suppressor mutation isolated was the

    mutation observed in SC1 9-6.

    To establish tight lin kage between the vegetative phenotype and the ABA su persensitivity

    germination defect, the suppressor mutant was crossed to Ler. An F1 plant was allowed to self

    pollinate and the resulting F2 progeny were plated on a MS petri plate supplemented with 0.6pM

    ABA. The germination rate of the F2 progeny (135:59, 3:l x2=3.03) suggests suppressor

    muation is a recessive mutation in one gene- A portion of the non-germinating seeds (24) were

    moved to MS for rescue. Both classes of seeds (genninating and non-germinating on a MS petri

    plate supplemented with 0.6pM ABA) were potted and the vegetative phenotypes were scored.

    AU42 plants scored as having wildtype sensitivity to ABA at the level of the seed also had

    wildtype vegetative tissue. Al124 plants scored as ABA supersensitive had 'sc19-6"

    phenotypes, including shorter, club-shaped siliques and exaggerated flat-topped flowers. The

    data suggested suppressor mutation is a homozygous mutant line and the obsewed vegetative

    and germination phenotypes are caused by a single recessive mutation.

    3.1.2 Complementation of the eral-2 Mutation with the abil-1 Suppressor Mutation

    The suppressor mutation causes the seeds to be supersensitive to the application of

    exogenous ABA. Three other mutants (era) have previously been described as ABA

    supersensitive at the level of seed germination (Cutler et al. 1996). To detemine if the

    suppressor mutation was located at the same locus as any of these genes, it was mapped as

    described in section 2.2.2 using 10 SSLP and RFLP markers. Two markers on the bottom of

    chromosome five (nga 76 and DFR) were found to CO-segregate with the ABA sensitivity

    phenotype of suppressor mutation (Table 7). suggesting suppressor mutation is found on the

    bottom of chromosome five. ERAI has been cloned and located on BAC MNS9, containing a

    IOkB fragment of the bottom of chromosome five, the same position as suppressor mutation.

    Consequently, suppressor mutant was crossed to eral-2. The reciprocal cross was also done.

  • Table 7. Mapping results.

    The eral-4 mutant was crossed to wildtype MCol. Plants hornozygous for eral-4 were selected by choosing nongerminators on MS media supplemented with 0.8pM ABA. DNA was isolated from each plant and PCR analysis performed. Markers linked to eml-4 segregated with eral-4; thus markers with high numbers of Ler alleles will indicate the chromosome on which m l - 4 is found.

    Plant Totals Marer 1 2 3 4 5 6 7 8 9 10

    y g a 280 H L H C H H C H H H . nga 168 C C L L C - C L C C

    nga 6 H L C H H H C L H C . nga 8 H C H H L H L C L C AthGAB H - - - H H H L L C

    L C H 1 2 7 3 6 O 1 3 5 3 3 4 2 1 4

  • Results 37

    The F i plants were extremely faciated and resembled the eral-2 phenotype. The F i plants were

    allowed to self pollinate and the resulting F2 progeny were plated on a MS petri plate

    supplemented with 0.8pM ABA- None of the F2 seeds (0:100 for each cross) gerrninated. These

    data suggest that the suppressor mutation does not camplement the en1 mutation and thus is an

    alleIe of ERAI. The suppressor mutant was thus renamed era1-4-

    To confinn that e n 1 4 was not a contamination of eral-2 in the seed stock of the original

    screen, a DNA blot analysis of genomic DNA from Ler, era14, MCol, and eral-2 probing with

    ERAI was performed (Fig- 2)- The erai-2 mutation is a deletion allele and does not produce a

    signal on a autoradiogram when probed with ERAI (Cutler et al, 1996). The era1-4 mutation was

    produced by EMS mutagenesis, which commonly causes point mutations (Feldmann et al. 1994)

    suggesting the ERAI gene should be intact in the era1-4 mutant- Genomic DNA was isolated

    from Ler, eral-4, MCol, and eral-2. The DNA was digested with Eco RI and DNA gel blot

    analysis was performed. The blots were hybridized with the ERAI probe. Ler, MCol, and eral-4

    had expected 4.3 and 1.5kb hybridization bands whereas eral-2 had no corresponding

    detectable signal. This suggest the ERAI gene is intact in both Ler and eral-4.

    ERA 7 encodes the l3 su bunit of famesyltransferase (FTase) and prenylates famesyl

    groups on to target proteins. The farnesylation activity of eral-2 is completely eliminated as

    measured by the assay (Cutler et al. 1996). Although era14 is likely a point mutation and the

    gene is still intact, en14 displays many phenotypes similar to eral-2, suggesting that

    farnesylation activity may also be eliminated in era14. A famesylation assay (Fig. 3) shows Ler

    possesses a band at approximately 86kD corresponding to the predicted size of the NAP-GST

    fusion protein, which acts as the substrate for prenylation by FTase. No such band was seen in

    the corresponding era 1-4 lane, suggesting e n 7 4 has reduced, if any, famesylation activity.

    Together, the complementation. mapping. DNA gel blot analysis and the famesylation assay

    indicate that era14 is a novel allele of ERAI.

    fo ensure that the loss of famesylation activity was due to a mutation within the gene as

    opposed to a mutation within a regulatory region preventing transcription or translation of the

  • Fig. 2 DNA gel blot hybridized w i h he ERAI gaiornic probe.

    Genornic DNA from Ler (lane l), etal4 (lane 2), MCoi (lane 3). and era7-2 (lane 4) were digesed wi(h Eco RI a d size fradionated using agarose gel eiedropharesis.The predded 4.3 and 1.5 kb fragments (indicaded by the arrw s) were producad in Ler, MCd and ma f -4. The m l 2 mutaon is a deie(ion and does not have ne predcted bmds

  • era14 Ler

    Fig. 3. In vitro farnesyiation activity of Ler and

    Soluable protein was extracted and incubated

    era 1-4.

    with NAP-GST and (3HlFPP. NAP-GST fusion protein acted as the subsrate and [3H]FPP was covalently attached if endogenous famesyiation advity existed. Protein was equally loaded and size Cadionated by SDS PAGE. Show in the autoradiagram is a band at approxmately 86 kD (indicatd by the arrow) corresponding to th