MOLECULAR GENETICS: BI 381 Revised Fall 2011

Class home page: http://cstl-csm.semo.edu/gathman/bi381/

Instructor: Allen Gathman Office: Polytechnic 301F Phone: 651-2189 Email: agathman@semo.eduFacebook: I’m there.

Office hours: 11-12 M & F Grading: Exams (3) 300

Final Exam 100 90-100% AHomework and quizzes 200 80-89% BScientific Papers 100 70-79% C

60-69% D <60% F

------------------------------------------------------Total 700

Course Description: Intermediate-level survey of genetics. Topics covered include enzymology of gene expression; introduction to gene regulation in prokaryotes and eukaryotes; and techniques of DNA manipulation.

Course Goals:

I. Demonstrate the ability to recall, explain, and diagram important concepts about molecular genetics, using relevant terminology appropriately.

A. Demonstrate the ability to recognize relevant terms in problems and writing prompts and use them appropriately in writing about genetics in papers, exams, and the course wiki.

B. Diagram or explain processes in papers, exams, and the course wiki.

II. Demonstrate the ability to read, comprehend, and interpret primary scientific papers from the molecular genetics literature.

A. Read four selected papers.B. Write guided synopses of papers.

III. Demonstrate the ability to apply concepts about molecular genetics to real-world situations.

A. Write answers to problems requiring an understanding of molecular genetics.B. Identify molecular genetics issues in a popular press report and explain the

concepts involved.

Class meetings: This is a blended course. We meet at 10 AM on Monday and Friday. There is no face-to-face class meeting on Wednesday; instead there will be online assignments due during that time each week. The class schedule is on the class wiki. It is subject to change, but I will give adequate notice before changing any assignment due dates.

Text: There is no textbook for this class. You can find information on the topics we cover in a variety of places. Start with Google Scholar, Wikipedia, and our class wiki (see below). In real life, there is no magic book that contains all wisdom about a scientific discipline; scientists use

1

web and published resources to find information about topics they’re interested in. Now is the time for you to start doing this.

Final Exam: The Final Exam will be given as scheduled. Something less than half the points will be from new material (Changes in Chromosome Structure and Number) and something over half will be cumulative, based on material covered on previous exams this semester, but not necessarily the same kinds of questions.

Objectives: The objectives are provided to assist you in learning the material covered by this course. You are responsible for studying the objectives applying to each topic and seeking out information about the topics we cover. If you are in doubt about where we are, ask. Remember that your responsibility is defined by the objectives, the assigned problems, and the material covered in class discussions. Note that many units have some “on your own” objectives – you are responsible for finding information about these, as I won’t lecture about them.

Class Wiki: The class has a wiki located at http://wiki.cstl.semo.edu/agathman. There will be a standing assignment to contribute at least two substantive sentences or corrections/improvements to the wiki each week. I’ll put up the powerpoint images I use, and you can add notes to them. The wiki also contains the schedule for the class, with information on some topics we’ll be covering.

Class behavior: Oh, go ahead and use your cell phone. Try to exercise appropriate judgment about what’s polite and what isn’t. If you have to answer a call because of something really important, step outside so you don’t disturb others. If you’re texting, try to make it look like you’re paying attention to class. If you’re looking up information relevant to the course (except during an exam), good for you.

2

Important Note on PLAGIARISM (and related issues): In any assignment for this class, you are expected to answer questions IN YOUR OWN WORDS!!!!!

No credit will be given for the entire assignment if it contains plagiarized material.

No credit will be given for information contained in a direct quote even when identified as such.

1. Whenever you state an idea that is not common knowledge and not original to you, you must cite a source for it.

2. If you copy directly from a source, this is a quotation. If you are allowed to quote, you must enclose it in quotation marks AND cite the source. As a rule of thumb, if you use more than 5 words in a row right out of a source, you must enclose them in quotes. Otherwise, according to University policy, you're plagiarizing. A case like this is probably unintentional, and I may not enforce the full penalty, but don't do it. You won't get credit for the copied material. If you copy from a source without even citing it, that looks like intentional plagiarism -- passing off someone else's work as your own. Intentional plagiarism will get you a zero on the whole assignment.

3. Furthermore, for this course, you usually can’t quote. Do not copy straight from any source (even with appropriate attribution and quotation marks), because I want your own words. Why? Quotation is used properly when the way that something is expressed is part of what is communicated. You would be right to quote directly from Shakespeare, for instance; the exact language used is essential. I've never read a scientific paper that was anywhere close to Shakespeare. So why do students use direct quotes from scientific papers? Usually because they don't understand what's being said, so they can't put it in their own words. It's absolutely essential for you as a scientist to be able to understand what people are saying in scientific papers. The only way you can demonstrate that understanding to me is to express the ideas in your own words.

4. Do not paraphrase closely from the source -- that is, don't just copy successive sentences while using a thesaurus to drop in occasional synonyms, or change the order of clauses, etc. If the overall structure and flow of the sentences is taken from a source, it's plagiarism. There's no way to do this correctly – if you put it in quotation marks, you're claiming it's the author's exact words when it isn't. If you don't put it in quotation marks, you're claiming that the way that is has been expressed is yours, and that's not true either. Just don't paraphrase closely.

Naturally, you can't copy from other students either.

How can you avoid plagiarism and direct quotation? I'd recommend reading the material, then putting it away while you write answers to the questions. Imagine that you're writing for a friend in the class who didn't get a chance to read the paper, and explaining the ideas to that friend. After writing, compare what you have with the original to make sure you didn't copy from memory, and that what you've said is accurate.

5. On rare occasions I may give specific exceptions from these rules. If so, I’ll make it clear.

3

PowerPoints are available via the class web page, in the Drop Box under Resources. It will probably be helpful to print them out and bring them to class to take notes on.

Old tests are available online via the class web page. I am not bound to ask the same kinds of questions this time, and the material covered on a given test varies from semester to semester. The old tests will definitely help you study, though. The best practice is to try writing out answers to the questions as we cover pertinent material, then bring the answers to me in office hours and ask me to look at them and comment. Don't just look at them and say "Yeah, I could answer that." Don't just write out the answers and say "I'm sure that would be okay." Write answers, and then come see me.

Problems are listed with each topic in the objectives. I will assign some of them to be turned in. If you have difficulty understanding the material or problems, ask in class or come to my office hours. For all problems, you must explain how you got the answer in order to receive credit. That is, either show your work (calculations, Punnett squares, etc.) or write a brief explanation of your reasoning. This means a specific explanation, not "I listened in class and read the book."

Scientific papers: Most of the information I learned about genetics as an undergraduate and graduate student is now archaic. A lot of it has been falsified by later research. The information you're learning now is also subject to rapid change. The most important thing you can take from any course is the ability to read the primary scientific literature in the field so that you can keep up with new developments. Therefore, one important objective of this course is for you to gain the skills you need in order to make sense of papers about genetics. I have therefore selected some readings from the primary literature in genetics for a number of the units in the course. I will let you know in advance when you will be required to read them. For some of them, I may give out questions or specific assignments in class; for others, questions are included in these objectives. For some, I may just ask you to write a summary, given a general outline to follow.

In any case, your answers will be written using Microsoft Word and turned in to the appropriate Drop Box. In your papers, please use a 12 point font, double space lines, and left justify text. Even if you are answering my specific questions, write out answers in full, using complete sentences and explaining sufficiently that a classmate who had not read the paper or seen the questions would understand what you were saying.

There will be four paper assignments in total, each one worth 25 points. Together they count the same as an exam, so you should think of each point on a paper as the equivalent of an exam point.

Many of these readings are difficult; that's how the biological literature is. Read it right away, do a draft of the answers, and then ask questions in the preliminary class session for the paper (see schedule). Don't despair! You need to learn to read the literature to be a biologist, so we'll just work at it. See plagiarism note above, by the way.

A tip for using Word in writing about scientific topics; if you have the autocorrect function on, it will screw things up – replace "galactose" with "galaxies," for instance, and you may not even notice it's doing this. What you have to do is click the Windows logo at the top left, choose “Word Options” > “proofing” > “AutoCorrect Options” > and then uncheck the “replace text as you type” box.

If you're using your own computer, you can add scientific terms to the dictionary (making sure you've spelled them right, of course). When you're writing, whenever Word puts a wiggly red 4

underline under a word, check to see if the word is correct. If so, right-click on the word and choose "add to dictionary." This will allow you to build up a custom dictionary of scientific terms, which helps make spell-check more useful to you. If you're using a computer lab computer, there's no point in adding to the dictionary, and you just have to use more judgment about whether words are really wrong or not.

Background information on the process of science:

Hypothesis: A statement (never a question) giving a definitive answer to some problem or question. If there is more than one possible answer, then there is more than one hypothesis, and each should be stated separately. Prediction: A logical consequence of a hypothesis applied to some specific set of circumstances, usually an experiment that is to be performed. If the hypothesis is right, then it logically implies some particular result will occur in the experiment. In other words, the hypothesis predicts what will happen when an experiment is performed. Experiment: A procedure or observation technique that will be performed in order to test a hypothesis. Result: The observed outcome of performing the experiment. Note that the result is not what you think that outcome means; it's what is directly observed.Conclusion: The logical consequence of the results obtained in an experiment. A conclusion is always a statement about one or more hypotheses. If the results agreed with a prediction, the hypothesis that made the prediction is supported. If the results don't agree with the prediction, the hypothesis that made the prediction is falsified. Don't say that the hypothesis was proven, or state the hypothesis again as "fact" -- it's supported or falsified.

Tips for reading scientific papers:

a. Don’t expect to get everything in a single reading. (In fact, unless the paper is about my specific area of expertise, I don’t expect to get everything ever.) First read the abstract (or summary), introduction, discussion, and conclusions, and look at the figures and their captions. Good figures and tables should stand alone -- that is, a fairly well-informed person should be able to understand them without the text. Then, go back and read the whole paper. Often it’s best to read through it quickly once, then to re-read more carefully. Don't get bogged down in detailed materials and methods; try to use judgment to decide what parts are crucial to understand. You aren't repeating the experiment, so you don't really care what the concentrations of all the components in the buffer are, but you do need to know what's different in different treatments. This takes judgment, and understanding of what the paper is about. It's not easy, but that's why we're doing it.

b. You won’t know all the terms used, or have all the background information you need. You should look for it. Try Google, Google Scholar, Wikipedia, and the class wiki. Some terms and ideas you can figure out from context. Some can be skipped over if they don’t appear crucial to understanding the paper. Use your judgment.

English mechanics: I expect you to spell, punctuate, and in general use English correctly on all assignments. I may count off ½ point for each mechanical error in an assignment, up to 10% of the total grade. Note that I don’t take off for every error I see; I reserve the right to use my judgment, as some errors are more serious or obvious than others. I often mark more errors than I count off for; I always mark (-1/2) next to spelling errors I’m counting.

What's much more important than mechanics is the clarity of your writing. There is a fair amount of writing in this class, mostly short answers, paragraphs, and the analysis of scientific papers. In all of this, you have to express yourself clearly in order for me to be able to tell if you

5

understand the ideas. When I ask you to explain something, you should write as if you were trying to help a classmate who missed all the class material on that particular topic. That is, don't assume that I'll be able to fill in gaps in reasoning or background. Read what you've written and see if there's any place that I could ask "Why?" If so, go back and explain more. Not sure if you're explaining fully and clearly? Write stuff out and bring it to my office hours, and I'll tell you.

Anthropomorphism: This is the practice of attributing human-like characteristics to things that aren't human. You'll notice that if I ask in class "What would you want to do if you were E. coli?" I usually follow up with "Nothing, because bacteria don't want things." You may be tempted to talk about what various molecules or nonhuman organisms "want" or "need" or "try" to do. Don't do it. Talk about what these things do, not about their motivations or emotions, since it's pretty doubtful that anything other than a vertebrate has any. I will ALWAYS count off for anthropomorphism in any assignment.

"the scientists" : In high school, many students get in the habit of talking about what "the scientists" did. I hate this expression. You're a scientist now. Saying "the scientists did so and so" as if they were a group of white-robed high priests in a sacrosanct lab on top of Mount Olympus makes no sense. You're in the group. Would you write "These earthlings did so and so…"? Refer to your colleagues, the authors of the paper, as "the authors," "Jones et al." (or whatever their names are), or "they."

et al. : This is an abbreviation for the Latin phrase "et alia," meaning "and others". When there are three or more authors on a paper, you can cite it as "Jones et al." instead of listing all the names. The "al." is an abbreviation, and has a period after it. "et" is a complete word, and has no period after it. There is no comma between the name and "et al."

“involved in”, “helps”, and other vagueness indicators: Phrases like “involved in” are red flags that mean “I’m about to be vague now, because I’m not sure what’s going on”. The sentence “DNA polymerase I is involved in removing RNA primers from newly synthesized DNA” means “I know DNA Pol I has something to do with getting the RNA primers out, but I’m afraid to commit myself to say exactly what”. In most cases, you should just rephrase to take “involved in” out. “DNA polymerase I removes RNA primers from newly synthesized DNA” is more definite and direct, and uses fewer words besides. The same with “helps” – if an enzyme does something, say so. Don’t say it helps to do it, unless you know that other enzymes are required. If other enzymes are required, then you should say what they are and what they do also.

Omit needless words: “Helps” is an example above. When you’re writing about science, you should say what you mean as concisely as possible. Make every word tell something. If a word doesn’t add meaning to the sentence, leave it out. If a sentence doesn’t add meaning to the paragraph, leave it out. I’m not impressed (not favorably, anyway) by writing that uses twice as many words as necessary to get the idea across. (BTW, the title phrase is from Strunk and White’s Elements of Style).

Rough drafts: I will look at ONE rough draft of each scientific paper synopsis for each student. It’s purely voluntary - if you want me to look at your draft and give you feedback, put the paper in the drop box at least 24 hours (this is shorter than usual because it’s presession) before it’s due, and send me an email telling me it’s there. I’ll look at your draft and make comments using “track changes”. These may be in-line insertions, etc., or comments in balloons. Make sure you can see the latter (click on the “review” tab, click on “balloons” in “tracking”, and be sure that “show revisions in balloons” is checked).

6

I won’t proofread – that is, don’t expect me to correct all your mechanical errors, etc. I may note some and make general suggestions, but it’s up to you to proofread your own work. I also don’t guarantee that I’ll note every problem with your paper when I give feedback.

7

A. DNA Structure and Replication

Meselson and Stahl 1958 (Proc. Nat. Acad. Sci. 44:671-682) orAvery, MacLeod, and McCarty 1944 (J. Exp. Med. 79:137-158) or Okazaki et al. 1969 (Cold Springs Harbor Symposia on Quantitative Biology v. 33) or Hershey and Chase 1952 (J. Gen. Physiol. 36:39-56).

Objectives:

Diagram and explain the process of DNA replication, using appropriate terms from the vocabulary above.

Describe the roles of all enzymes and other proteins involved in DNA replication in E. coli.

Tell what direction DNA is synthesized in and why.

On your own:

Identify the complementary bases in DNA, diagram the mechanism of base pairing, and explain how these relate to Chargaff's data.

Diagram the structure of DNA. (not like this pic, like the one on the next page)

8

Problems:

1. Diagram a short DNA molecule, one strand of which has the sequence A-C. Show all bonds and atoms, except hydrogen atoms not involved in hydrogen bonding. Carbon atoms in rings may be represented as corners. Here’s an example, but it has the sequences T-C and G-A. Use figures 7-5 and 7-8 for information, but note that neither of these has all the information I want in it.

2. a. Search for videos showing DNA replication. Paste the URL for such a video into a post on the Forum. Make sure that clicking on that URL actually takes you to the video, and make sure that the video you have chosen hasn’t already been posted to the forum by another student.

b. Form a group of four students and review the videos you posted. Compare and critique the videos. How do they differ? What are the strengths of each one? What are the weaknesses of each? Is anything factually wrong in any of the videos or narrations? Explain. Which video or videos would you recommend, and for what purposes or audiences? Explain.

9

Meselson and Stahl (READ plagiarism note, and "scientific papers" notes in these objectives) The paper is available as a PDF at http://www.ncbi.nlm.nih.gov/pmc/articles/PMC528642/pdf/pnas00686-0041.pdf. This link can also be found in the course wiki and on the “handouts” page in the web site.

Format: For this paper, I want you to write answers to the following questions. Please DO include the question before each answer (note that these objectives are available online as a Word document, so you can just cut and paste the questions.) This is not a continuous narrative, but rather answers to the specific questions, numbered as shown below. The questions and answers are to be submitted as a Microsoft Word document to the appropriate drop box on the course web site. Set the spacing at "double", use either Arial or Times New Roman font at 12 point size, and use the default margins. The length of your responses should be dictated by the questions. Some may be answered in as little as a single sentence. Others (particularly those that say "explain") will take longer.

Assignment: Answer these questions:

1. What journal was this paper published in? The paper says it was “communicated by” Max Delbrück. Read this editorial (http://www.pnas.org/content/106/37/15518.full?sid=9194da78-25b5-4c82-9cee-e41583426a3f) and tell what it means that Delbrück “communicated” this paper.

2. The authors state in the first paragraph that different hypotheses make different predictions about where the “old” DNA will wind up after replication. Where can we find these hypotheses?

3. How did the authors label the “old” DNA, and how did they make the “new” DNA different? Explain their procedure.

4. How did they determine the proportions of “old” and “new” DNA in a given DNA molecule? Explain the technique they used (What did they do? How does a gradient form? What does DNA do in the gradient? Etc.), and tell what is happening in figure 1 as time passes.

5. a. In the photographs and the graphs next to them in figure 4, what is measured on the X-axis? Does it increase or decrease as you move to the right?

b. As you may know, the three hypotheses the authors tested were conservative, semiconservative, and dispersive replication. Explain what each of these hypotheses says (how it says replication works), where it predicts the “old” DNA will be distributed after 1 replication and 2 replications, and what bands, in what locations, each one predicts we should see in figure 4 after 1 and 2 generations.

c. What bands, in what locations, can you see in their results (in Figure 4) after one generation (one DNA replication as well, in E. coli)? After two generations (ok, really 1.9)?

d. What can you conclude about each of the three hypotheses based on the results shown in figure 4? Explain.

e. Why did they mix some generations and run them in CsCl gradients, as in the last two photos and graphs in figure 4? Explain what specific information this provided them.

6. The authors refer to "the scheme of DNA duplication proposed by Delbrück." Delbrück had proposed in 1954 (PNAS 40:783-788) that during DNA replication, each template strand broke 10

after every 5 nucleotides and was joined to the end of the new strand complementary to the other template. What problem do you suppose he was trying to solve with this hypothesis, and how would his hypothesis solve it? (Hint: what’s special about 5 nucleotides in DNA?)

11

Avery et al. Assignment

Griffith (1928) identified several strains of the bacterium Streptococcus pneumoniae and named them IIR, IIIS, etc. He mixed live IIR cells with an extract made from heat-killed, lysed IIIS bacteria. Afterward, he found some live IIIS cells in the mixture. He concluded that a substance from the dead IIIS cells had entered the live IIR cells and converted them into the IIIS strain, and he named this phenomenon transformation. Avery, MacLeod, and McCarty (1944) studied transformation further, attempting to determine what chemical compound the "transforming principle" actually was. They prepared heat-killed IIIS cell extract, treated it in various ways, and then tested it for "biological activity," that is, the ability to transform IIR cells into IIIS cells. Here is an excerpt from Avery et al.'s 1944 paper:

Enzymatic Analysis- Various crude and crystalline enzymes have been tested for their capacity to destroy the biological activity of potent bacterial extracts. Extracts buffered at the optimal pH, to which were added crystalline trypsin and chymotrypsin or combinations of both, suffered no loss in activity following treatment with these enzymes. Pepsin could not be tested because extracts are rapidly inactivated at the low pH required for its use. Prolonged treatment with crystalline ribonuclease under optimal conditions caused no demonstrable decrease in transforming activity. The fact that trypsin, chymotrypsin, and ribonuclease had no effect on the transforming principle is further evidence that this substance is not ribonucleic acid or a protein susceptible to the action of tryptic enzymes.

In addition to the crystalline enzymes, sera and preparations of enzymes obtained from the organs of various animals were tested to determine their effect on transforming activity. Certain of these were found to be capable of completely destroying biological activity. The various enzyme preparations tested included highly active phosphatases obtained from rabbit bone by the method of Martland and Robison and from swine kidney as described by H. and E. Albers. In addition, a preparation made from the intestinal mucosa of dogs by Levene and Dillon and containing a polynucleotidase for thymus nucleic acid was used. Pneumococcal autolysates and a commercial preparation of pancreatin were also tested. The alkaline phosphatase activity of these preparations was determined by their action on -glycerophosphate and phenyl phosphate, and the esterase activity by their capacity to split tributyrin. Since the highly purified transforming material isolated from pneumococcal extracts was found to contain desoxyribonucleic acid, these same enzymes were tested for depolymerase activity on known samples of desoxyribonucleic acid isolated by Mirsky from fish sperm and mammalian tissues. The results are summarized in Table 2 in which the phosphatase, esterase, and nucleodepolymerase activity of these enzymes is compared with their capacity to destroy the transforming principle. Analysis of these results shows that irrespective of the presence of phosphatase or esterase only those preparations shown to contain an enzyme capable of depolymerizing authentic samples of desoxyribonucleic acid were found to inactivate the transforming principle.

(Avery et al. 1944)

12

Table 2:Crude enzyme preparations

Enzymatic activityPhosphatase Tributyrin

esteraseDepolymerase for desoxyribonucleate

Inactivation of transforming principle

Dog intestinal mucosa

+ + + +

Rabbit bone phosphatase

+ + - -

Swine kidney phosphatase

+ - - -

Pneumococcus autolysates

- + + +

Normal dog and rabbit serum

+ + + +

(Table 2 adapted from Avery et al. 1944)

Avery, O.T., MacLeod, C.M., McCarty, M. (1944). Studies on the chemical nature of the substance inducing transformation of pneumococcal types: Induction of transformation by a desoxyribonucleic acid fraction isolated from Pneumococcus type III. J. Exp. Med. 79: 137-158.

Griffith, F. (1928). The significance of pneumococcal types. J. Hyg. 27: 113-159. Assignment:

A. List at least 4 terms in the above passage from Avery et al. that you don't know (if there aren't four terms here that you don't already know, congratulations. Pretend there are anyway). Look them up and give definitions, then tell the significance of each in the context of this particular paper (in your own words). Cite sources. You may quote directly in the definitions ONLY, but be sure to indicate it with appropriate punctuation if you do (that is, put the quotation inside quotation marks). It's okay to use wikipedia for these definitions, as long as the entry in wikipedia cites original sources. Online dictionaries are okay as well.

B. Explain each of the following in your own words:

1. What is the question Avery et al. were trying to answer?2. What hypotheses did they have? (These are implied, not stated explicitly.)3. What experiments were performed? (You should start by deciding how many different experiments are reported in this passage.)4. What results did each hypothesis predict for each experiment? Why did each hypothesis make these predictions?(Again, these are implied; you have to use deductive reasoning from the hypotheses to arrive at the predictions.)5. What results did the authors actually obtain?6. What could they conclude based on those results? (The authors' conclusions aren't all given here; again, you have to use reasoning to decide what conclusions they could be justified in making.)

13

Format: Answer the questions above in a Word document and upload it to the drop box. Where it says "explain," think of your intended audience as another student in the class who never saw the assignment. Explain in your own words so that student would understand. Do not quote directly from the paper, and do not paraphrase closely. You may quote directly ONLY in the definitions of terms. Elsewhere, all writing must be your own words.

Citations should use APA style. This format is available online at the Online Writing Lab (http://ustudies.semo.edu/writing/owl.asp). Click on Tutorials > Writing with Sources > APA guide. Online sources are listed under "electronic media" in the list. Most web pages will be cited as Stand-Alone Documents without authors, like this:

GVU's 8th WWW user survey. (n.d.). Retrieved August 8, 2000, from http://www.cc.gatech.edu/gvu/ user_surveys/survey-1997-10/

Note that the URL given must be complete; if you paste it into a browser, it should take you to the exact page you were looking at. Don't try to type in the URL; highlight it and copy and paste it into your assignment.

You must cite both in the text, parenthetically (Author, year), and then in a list of sources cited, using full bibliographic entries. A web page without author or date is cited in the text with a shortened title of the page and "n.d." -- (GVU's, n.d.) -- and then cited in the list of sources as shown above.

14

Comparison of enzymology of DNA replicationin a prokaryote and a eukaryote

Function E. coli HeLa (human)/SV40Helicase dnaB T antigenLoading helicase/primase (assembly of primosome)

dnaC T antigen

Single strand maintenance SSB RPAPriming dnaG Pol α/primaseSliding clamp (holds polymerase to template)

β subunit, Pol III PCNA

Clamp loading gd complex RFCCatalysis of DNA synthesis Pol III core Pol δHoloenzyme dimerization τ ?RNA removal Pol I MF1Ligation ligase ligase I

Adapted from Lewin, Genes VII.

One point of origin in proks (oriC), many in euks.Rate: 1000 nuc/sec in proks, 100-200 nuc/sec in euks.

15

Mechanism of DNA Polymerase activity:

All DNA-dependent DNA polymerases operate in approximately the same way. The substrates are the 3'-hydroxyl end of the growing DNA strand, and a deoxyribonucleoside triphosphate or dNTP.

The oxygen in 3'-OH makes a nucleophilic attack on the alpha phosphate (the one closest to the sugar) of the dNTP. The oxygen has two orbitals full of electrons that aren't involved in bonding, and they are attracted to large nuclei with multiple protons, such as the phosphate nucleus. When these electrons move toward the phosphorus nucleus, there is the possibility of forming a covalent bond between the phosphorus and that oxygen. However, in order for this to happen, one of the oxygens already bound to the phosphorus must be displaced. Normally, this would be quite difficult, as the covalent bond between the oxygen and phosphorus is quite stable. In this case, though, one of those oxygens already bound to the phosphorus is also bound to another phosphate – see the figure above. In fact, it's bound to a group of two phosphates, called pyrophosphate (and also a Mg2+ ion, which is a cofactor for the enzyme). This group of two phosphates is an example of what is known as a "good leaving group." If the pyrophosphate group leaves the dNTP, it will quickly react with water to form two inorganic phosphates (Pi). Since pyrophosphate is so unstable and reactive, it doesn't last long at all in water; this means that its concentration is always low. Think of the reactions like this:

dNTP -------> dNMP + pyrophosphate --------> dNMP + 2 Pi

Since the pyrophosphate concentration is always quite low, the reaction equilibrium is shifted forward; in other words, it's relatively likely that the pyrophosphate will come off the dNTP. That means that it's pretty easy to displace the oxygen in that pyrophosphate from the alpha phosphorus, so the nucleophilic attack succeeds. The result is that the dNMP (a

16

deoxyribonucleoside monophosphate, or nucleotide) becomes covalently bound to the 3' carbon of the sugar at the end of the DNA strand, thus lengthening the strand by one nucleotide. Then the process repeats.

Why can't this happen at the other end of the strand? Assume that the active site of DNA polymerase is going to orient the incoming dNTP so that a 5'-3' bond would form (rather than joining the 5' carbon of the dNTP to the 5' end of the DNA strand, upside down). So instead, the dNTP would be coming down toward the 5' end of the existing strand with its 3' OH down, to make a nucleophilic attack on the 5' phosphate of the DNA strand. Draw this out and take a look at it.

In order for the nucleophilic attack to succeed, an oxygen has to leave the phosphate on the 5' end of the DNA strand, but there's nothing else attached to it. It's not a good leaving group at all, so this reaction isn't favored. Therefore, DNA always grows from the 5' to 3' direction, by adding nucleotides onto the 3' end of the existing strand.

17

B. DNA Manipulations

Objectives:

Describe how a genomic or cDNA library may be created in a plasmid or phage vector.

Describe strategies for identifying and isolating a particular desired clone in a library.

Explain the technique of dideoxy (Sanger) DNA sequencing.

Explain how microarrays are used to compare gene expression under different conditions.

Explain techniques used in current genetics research articles.

On your own:

Explain what restriction enzymes (endonucleases) do, what types there are, and how they may be used in the lab.

Describe plasmid and phage vectors, and explain how they are used.

Explain the processes of Southern and Northern blotting and their applications.

Explain PCR (polymerase chain reaction) and its applications.

Problems:

1. If you digest the genomic DNA of a beaver (3 x 109 base pairs) to completion with HaeIII (a 4-cutter) about how many pieces of DNA will result? SHOW YOUR WORK.

2. You hit a beaver on I-55, and stop and throw it in your trunk. Back at home in your basement laboratory, you extract some RNA from its liver. How would you produce a beaver cDNA library using this RNA? Diagram a flow chart of the steps you would follow, using techniques and materials from the list on the next page.

3. You have made the beaver cDNA library mentioned above, and it contains 14,000 different cDNAs, one of which is the trypsin gene cDNA. How many colonies will you need to plate to be 95% sure of getting the cDNA for the trypsin gene? SHOW YOUR WORK.

4. You have the beaver cDNA library mentioned above. You want to find the beaver G6PD gene and get it in a form that you can use to produce lots of copies of it. Diagram a flow chart of the steps you would follow, using techniques and materials from the list on the next page.

5. You have a catfish, and you want to know if catfish have a G6PD gene. (But you don’t care if you can clone the gene afterward). Diagram a flow chart of the steps you would follow, using techniques and materials from the list on the next page. You need not explain the techniques.

6. The E. coli genome is about 4.5 x 106 bp. If you had a mole of E. coli DNA, would you carry it around in a teaspoon, a lunchbox, a dump truck, or a river barge? SHOW YOUR WORK and explain.

18

7. You have a microgram of E. coli DNA in a test tube. How many copies of the E. coli genome is this? SHOW YOUR WORK.

8. For PCR, typically you want about a million copies of your template sequence. You’re trying to use PCR to amplify a sequence found once in the E. coli genome, and you have a solution of isolated E. coli DNA at a concentration of 500 ng per l.

a. What volume of this solution should you use in a PCR reaction? b. The smallest volume you can reliably dispense is 0.1 l. What should you do? Explain and be specific.

10. a. Go to Entrez (http://www.ncbi.nlm.nih.gov/gquery/gquery.fcgi) and find the nucleotide and protein sequences for human hemoglobin beta (gi # 28302128). Paste them into a Word document. Convert to double spacing.

b. Find the start codon in the HBB gene and write the amino acid sequence in above the codons in the nucleotide sequence.

c. The sickle cell allele of this gene has a T instead of an A at position 70. Circle that nucleotide on the sequence.

d How will the protein sequence of the sickle-cell hemoglobin differ from that of the normal hemoglobin beta?

e) Why does this result in a disease condition? Explain.

f) The restriction enzyme MstII has the target site CCTNAGG. How can it be used to determine whether a human carries the sickle cell allele? Explain.

19

LIST OF TECHNIQUES AND ITEMS(Restriction endonucleases followed by target site, cleavage site marked with /)

molecular weight of DNA = 650

gmol⋅bp (that is, 650 g/mol per base pair)

Avogadro’s number(6.022 x 1023) (no units)acrylamideanti-IIR antibodiesanti-IIIS antibodiesG6PD gene from ladybugG6PD gene from chickenG6PD gene from ratG6PD gene from frogG6PD gene from humanG6PD gene from sharkG6PD gene from dogagarosealkaline phosphatasealkaline solution (NaOH)ampicillin annealautoradiographybakeBam HI (G/GATTC)beerboilbuy oligonucleotidecalcium chloridecall 911call Dr. Gathmancall Dr. Lillycentrifugechocolate chip cookieschromosome walkchymotrypsinclone by phone clone by emailclone aroundcoffeecolony liftsdATPdCTPdGTPdTTP

ddNTPsddATPddCTPddGTPddTTPdCTP- 32PdNTPsEastern blotEco RI (G/AATTC)electrophoresisextract DNAgel loading dyegyraseHae III (blunt cutter)

(GG/CC)helicasehybridize with probehybridize with cousininterrupted matingIPTGlambda armslambda DNAligaseNaOHnitrocellulose filtersNorthern blot Not I (GC/GGCCGC)nucleophilic attacknylon filtersOkazaki fragmentsoligo-dToriCpBluescriptpBR322PCRphage protein coatsplaque liftsplate libraryplate phage & bacteria

Pol IPol IIPol IIIpraypreprimosomeprimaseprimerprimosomePst I (CTGCA/G)pUC18random-primed PCRreplica platereplisomerestriction digestreverse transcriptaseRNAseSal I (G/TCGAC)shakesingle-strand binding proteinssingle-strand endonucleaseS1 nucleaseSouthern blottaq polymeraseterminal transferasetetracycline thermal cyclertopoisomerase IItransform E. colitrippin’trypsinultraviolet lightwashwaterWestern blotwineXba I (T/CTAGA)X-Gal

20

C. Lesions, Mutations, and DNA Repair

Reading: Kozmin et al. 2005 or de Boer et al. 2002.

Objectives:

Given information about the mechanism of action of a particular mutagen, predict the types of mutations it will produce at the DNA and protein levels.

Explain the Streisinger slipped-mispairing model of frameshift mutation.

Explain the role of tautomeric shift in spontaneous and induced mutation.

Describe direct reversal, nucleotide excision repair, base excision repair, and mismatch repair systems and explain how and when they operate.

Use ENTREZ (http://www.ncbi.nlm.nih.gov/gquery/) to identify a specific mutation causing a genetic disorder in humans, and locate information about its nature and effects.

Distinguish between various types of mutations at the DNA level and at the protein level.

Problems:

1. A new base analog, 4-dingosyldongine (4-DD) is discovered in Hostess Ding-Dongs. Under normal conditions this base pairs with guanine. However, in the presence of caffeine it undergoes a reversible tautomeric shift that causes it to pair with adenine.

What type of mutation would you expect to see as a result of eating Ding-Dongs with Classic Coke? Draw a diagram showing the original DNA and each step as the lesion and mutation occur. Show all DNA replications necessary. Label each DNA product as wild type, lesion, or mutation.

2. In the sequence below, the first A on the upper strand happens to be in its rare imino form when Pol III reaches it during replication. Diagram this DNA replication and all subsequent steps leading to the production of a mutation.

GCTGACCTCGACTGGA

3. Why are transition mutations more common than transversion mutations?

4. At what kind of sequence is Streisinger slipped mispairing most likely to occur, and why?

21

Questions for Kozmin et al.

Background information:

Some notes on yeast terminology (IMPORTANT):

Genes are italicized. Normal (also known as wild-type or WT) alleles of genes are written in all caps: OGG1. Mutant alleles of genes are written in lower case: ogg1.The protein encoded by a gene has the name of the gene, not italicized, plus a p: Ogg1p.

Pay attention to this. If you don’t distinguish among normal alleles, mutant alleles, and proteins, your reader (me) won’t be able to tell what you meant to say. I WILL count off for confusing these different typographical conventions.

Pairing of 7,8 dihydro-8-oxoguanine (8oG) with adenine:

http://www.dcu.ie/chemistry/ssg/blanaid_work.shtml

Photoproducts formed from pyrimidines: CPD: cyclobutane pyrimidine dimer6-4: Pyrimidine 6-4 pyrimidone

http://people.bath.ac.uk/pr1cemb/DNAdamage.htm

Canavanine resistance occurs in yeast by mutation of the gene CAN1, which encodes an arginine permease. Canavanine is an arginine analog; wild type cells take it up (using arginine permease) and incorporate it into proteins instead of arginine. It doesn't function properly in 22

those proteins, and the cells die. Mutants that can't take up arginine from the medium can't take in canavanine either. They make their own arginine, so the lack of arginine isn't a problem, and since they don't take in canavanine, they are resistant to its effects. Any mutation in CAN1 that causes it to produce an inactive product therefore gives canavanine resistance. It's a handy way to assay how mutagenic a treatment is -- hit yeast with the mutagen, plate them on canavanine medium, and look for survivors. The more mutations there were, the more survivors you see.

Questions: As always, all answers must be in your own words. You may want to look up terms in google, or wikipedia, or other sources; please cite any outside sources you use, both parenthetically in your text and at the end in a literature cited page.

1. On page 13538, the authors state that GC->TA transversions result from formation of 8-oxoG. Why is that? Explain, and diagram the process by which such a transversion would take place.

2. Look up genes UNG1, NTG1, NTG2, OGG1, and MAG1 in the SGD (Saccharomyces Genome Database) http://www.yeastgenome.org/. What does each one code for, and what does its product do, as specifically as possible? Most important, if the enzyme it codes removes an abnormal base from DNA, you must tell what abnormal base(s) it removes.

3. On p. 13540, the authors say that figure 1d shows that the absence of Ogg1p is the cause of high mutation rates in ogg1 cells. Explain the experiment, and tell how the experimental results depicted in figure 1d lead to this conclusion.

4. a. Explain the experiment and results depicted in figure 1c. Based on the evidence shown here, what kind of lesions does UVA produce in yeast? Explain how you know.

b. Explain the experiment and results depicted in figure 2b. Based on the evidence shown here, what kind of lesions does UVA produce in yeast? Explain how you know.

c. When these two sets of data are compared, what conclusion can be drawn? Explain.

5. Explain and draw conclusions from the experiment and results depicted in figure 4.

6. What do the authors recommend for sun protection in humans, and why? Explain.

23

D. Proteins and Genes

Objectives:

Explain the work of Beadle and Tatum on auxotrophs and its significance in inferring enzyme pathways.

Infer the positions of steps in a metabolic pathway from data on growth of auxotrophic mutants.

Predict the growth of auxotrophic mutants on various media based on a metabolic pathway.

On your own:

Describe the levels of protein structure.

Explain how the primary structure of a protein influences its secondary and tertiary structure and its function.

Problems:

1. You isolated six different tryptophan auxotroph mutants from the fungus Coprinus cinereus. You then attempted to culture each of them on minimal media supplemented with various compounds (ones you suspect are intermediates in tryptophan synthesis). For simplicity, we'll just call the compounds A,B,C,D, and E. Your results are as follows:

Growth on minimal medium supplemented with:Mutant A B C D E Trp1 + - - + + +2 + + + + + +3 - - - - - +4 - - - - + +5 + + - + + +6 - - - + + +

In this table, + indicates that the mutant fungus grew when placed on minimal medium with that specific nutrient added – that is, the + in the upper left means that mutant strain number 1 was able to grow on a plate of minimal medium with compound A added to it. A – in the table indicates that the mutant did not grow when placed on that particular medium; for instance, the – in the column just to the right of the + mentioned earlier means that mutant strain number 1 did not grow when placed on a plate of minimal medium with compound B added to it.

Draw a diagram of the pathway for synthesis of tryptophan in this organism, giving the order of the compounds A,B,C,D,E, and Trp in the pathway. Draw arrows between the compounds indicating chemical reactions. Over each arrow, put the number of the mutant that lacks the enzyme required to catalyze that reaction.

24

2. In the pathway below, each number identifies a mutant that is unable to catalyze the indicated reaction. Compound H is required for growth of the organism. In the table below (or a xerox) fill in + if the mutant will grow on minimal medium with that one compound added, and – if the mutant would not grow on minimal medium with that one compound added (as in problem 1). Note in this pathway that mutant number 3 is unable to catalyze a hydrolysis reaction that splits B into C and E. Also, mutant number 6 is unable to catalyze a condensation reaction that uses D and F as substrates and combines them to make G.

Growth on Minimal medium supplemented with compound:Mutant A B C D E F G H1

2

3

4

5

6

7

25

E. Gene Expression: Transcription and Translation

Reading: Cheng et al. 1991. Functional importance of sequence in the stem-loop of a transcription terminator. Science 254: 1205-1207.

Objectives:

Given a DNA sequence, tell the mRNA and polypeptide that are coded for by it (with a genetic code table).

Explain how RNA transcripts are processed in eukaryotes.

Explain the process of intron removal from RNA transcripts (splicing)

Identify the functions of RNA POL I, II, and III in eukaryotes.

Use wobble rules to deduce the likely anticodons for given codons.

Explain the significance of the universality of the genetic code.

On your own:

Explain the process of translation in a prokaryote, including mechanisms of initiation, elongation and termination, and the roles of the IFs, EFs, and RFs.

26

Lariat structure

27

Problems:1. The sequence of a portion of a DNA molecule from the chromosome of E. coli containing the beginning of a typical gene (including promoter) is shown below.

5' GCGTCCTTGACAAGGCTACGCGAGGGCTCCTTATAATGATGACTGCCAGGAGATGGGTGGCAAGTG 3'

3' CGCAGGAACTGTTCCGATGCGCTCCCGAGGAATATTACTACTGACGGTCCTCTACCCACCGTTCAC 5'

a) Label the template and RNA-like (nontemplate) strands of the molecule, and identify the promoter elements and the point where transcription would begin.

b) Give the sequence of the mRNA transcribed from this molecule (the part you can see).

c) Give the sequence of the polypeptide formed when this messenger is translated.

2. Assuming that cells use the minimum possible number of tRNAs, how many tRNAs are there that carry tyrosine (tyr), and what are their anticodon sequences? Do the same for serine (ser). Explain how you know.

28

Questions for Cheng et al. (and for analysis of any scientific paper):

1. What is the main question behind this paper? What are the hypotheses being tested as potential answers to that question?

2. Describe the main experimental procedure used to test the hypotheses. Do not include details that are not necessary for understanding the purpose of the procedure (Use your judgment here. Some details of procedure are crucial to understanding the experimental test, while others are of interest only if you are trying to repeat the experiment in your own lab.) Explain any important controls used in the experiments, describing the source of error that is controlled for, and how the control rectifies this error.

3. Tell what each hypothesis predicts should occur in the relevant experiments, and explain why each hypothesis makes the predictions it does.

4. Summarize the results of the experiments, paying attention primarily to those results that will help to distinguish among hypotheses.

5. State the conclusion that may be drawn about each of the hypotheses, and explain how the conclusion follows from the results.

6. If a new hypothesis is suggested by the results of the experiments, explain that new hypothesis.

Format: Answer the questions above in a Word document and upload it to the drop box. Where it says "explain," think of your intended audience as another student in the class who never saw the assignment. Explain in your own words so that student would understand. Do not quote directly from the paper, and do not paraphrase closely.

Citations should use APA style. This format is available online at the Online Writing Lab (http://ustudies.semo.edu/writing/owl.asp). Click on Tutorials > Writing with Sources > APA guide. Online sources are listed under "electronic media" in the list. Most web pages will be cited as Stand-Alone Documents without authors, like this:

GVU's 8th WWW user survey. (n.d.). Retrieved August 8, 2000, from http://www.cc.gatech.edu/gvu/ user_surveys/survey-1997-10/

Note that the URL given must be complete; if you paste it into a browser, it should take you to the exact page you were looking at. Don't try to type in the URL; highlight it and copy and paste it into your assignment.

You must cite sources both in the text, parenthetically (Author, year), and then in a list of sources cited, using full bibliographic entries. A web page without author or date is cited in the text with a shortened title of the page and "n.d." -- (GVU's, n.d.) -- and then cited in the list of sources as shown above. Be sure to cite the paper itself in the Works Cited page, but you need not cite it parenthetically. All other sources used require both citations.

29

F. Prokaryotic Gene Regulation

Objectives:

Explain the process of transcription in a prokaryote, including mechanisms of promoter function, initiation, elongation, and rho-dependent and rho-independent termination.

Explain positive control, negative control, repressible and inducible systems in prokaryotes.

Predict the effects of various mutations in operon systems.

Explain the phenomenon of attenuation in the trp operon.

Problems:

1. You have isolated an E. coli mutant in which ß-galactosidase enzyme activity is very low, regardless of environmental conditions. Make a list of all the possible mutations that could cause this phenotype. For each possible mutation, tell what DNA (gene or site) has been changed, how the change would cause the phenotype, and whether the mutation affects the positive control system, the negative control system, or neither.

30

31

GA

C

G

Leader folding - 1 A

G

U

C

A

G

UGG

GGU

GCACUUCCUGA A A

CGG

G

AGUGUAUU

C

CC

A

A

U

U

U

U

G

GG

A AA

AA

CC

CA

A

A

CCC

C

CC

CC

CG

GG

GG

GA

AA

UU

U U U U UU

CU

U

TrpTrp

STOP

G

32

Leader folding - 2

High [trp]

3.

The figure above shows growth of two separate cultures of E. coli cells, both placed in a medium containing equal amounts of glucose and lactose.

33

Low [trp]

trp

What's wrong with the mutant? Explain generally, and then propose some possible mutations that could cause this effect.

4. Here's the definition of "regulatory gene" from thefreedictionary.com:

" regulatory gene - a gene that produces a repressor substance that inhibits an operator gene".

Critique this definition.

34

G. Eukaryotic Gene Regulation

Reading: McKnight and Kingsbury 1982 (Transcriptional signals of a eukaryotic protein-coding gene. Science 217: 316-324.) or Godowski et al 1987 (Glucocorticoid receptor mutants that are constitutive activators of transcriptional enhancement. Nature 325:365-368.)

Objectives:

Describe mechanisms of gene regulation in eukaryotes at various levels of the expression process.

Explain the interaction of cis-acting sites and trans-acting protein factors in eukaryotic transcriptional control.

Explain the mechanism of gene regulation by steroid hormones in eukaryotes.

Describe mechanisms of chromatin structure modification, RNAi, and alternative splicing and explain how they affect gene expression.

Problems:1. The gene for antibody light chains was isolated from (a) a stem cell and (b) a mature B lymphocyte. Each of these genes was denatured by heating and the two DNA strands were separated. The single-stranded template strand DNA was then mixed with light chain mRNA from the cytoplasm of B lymphocytes and allowed to renature. DNA-RNA pairing gave the structures shown below, with double-stranded paired regions and some single-stranded loops and tails. Tell what genetic information is contained in EACH loop and tail in each structure and explain why the loops and tails are there.

2. In cows (Bos taurus), the protein

mammarase is produced in cells of the mammary glands of females in large amounts in response to estradiol (a steroid hormone). A particular cow, Bossie, is found to produce high levels of mammarase even when estradiol levels are low. Further study shows that her mammarase gene has a normal protein-coding region.

35

a. Discuss in your group how estradiol affects transcription of the mammarase gene in normal individuals.

b. List all possible mutations that might be responsible for Bossie’s condition. For each possible mutation, tell what DNA (gene or site) has been altered, and explain how the mutation would produce this phenotype. Different mutations in the same gene are acceptable if they cause different functional changes in the protein encoded.

36

EUKARYOTIC GENE REGULATION - some examples

DNA AMPLIFICATIONGeneral - dipteran polytene chromosomesSpecific - Xenopus oocyte produces rings of DNA

coding for rRNA - 1000s of copies - Dipteran polytene chromosomes contain many more copies of euchromatin than heterochromatin in puffs

DNA REARRANGEMENTmating type switching in yeastantibody diversity in mammals

DNA ACCESSIBILITYsupercoiling (histones bind and form nucleosomes)methylation of cytosine residuesX- chromosome inactivationacetylation of histone “tails” by locally bound enzymes can reduce supercoiling

TRANSCRIPTIONAL CONTROLlots of activators in eukaryotesrepressors (often compete with activators for DNA sites)hormonal influence (glucocorticoid and other steroid receptors bind to enhancer sites)

POST-TRANSCRIPTIONAL CONTROLpoly-A tail, mG cap - non-specific (?)exon splicing (snurps)alternative splicing (calcitonin – CGRP, mating type genes in Drosophila, many others)RNAi – short RNAs complementary to RNA transcripts can cause degradation of

transcriptRNA editing – "guide RNA" pairs with transcript and serves as template for insertion of extra bases.

TRANSLATIONAL CONTROLTOR proteinslight control of translation in chloroplasts

POST-TRANSLATIONAL CONTROLcontrol over folding by chaperoninsprotein processingtrypsinogen

37

Questions for McKnight and Kingsbury 1982. (SEE plagiarism note p.1, and "scientific papers" notes p.2 of the objectives).

1. Explain what the authors mean by the two kinds of signals they expect to see upstream of genes.

2. Briefly explain the “linker scanning” technique of producing mutants. Be sure to read both the explanation in the body of the paper and in note 22.

3. Explain the primer extension assay used to detect transcription of the mutant tk genes. (Read note 27 as well as fig 3 caption and text of the paper).

4. Why did they inject “pseudo-wild type” tk gene along with the linker scanning mutant in each oocyte tested? EXPLAIN.

5. How can you tell from figure 5 and table 1 which linker scanning mutants had altered upstream transcriptional control sites? Which ones are they, and which of them correspond with each of the two predicted types of signals from question 1? Explain.

38

Questions for:

Godowski PJ, Rusconi S, Miesfeld R, and Yamamoto KR. Glucocorticoid receptor mutants that are constitutive activators of transcriptional enhancement. Nature 325:365-368.

As usual, answer all questions IN YOUR OWN WORDS. Don’t copy without using quotation marks, of course, but don’t even quote directly with quotation marks.

1. Techniques: Use the web (Google Scholar is good, but any searcher should do) to find out what each of the following is. Explain IN YOUR OWN WORDS the significance of each of these TO THIS STUDY. Please note that a lot of web pages give oversimplified information for the general public. Since you have greater background knowledge than the general public, you should exercise your judgment in interpreting what you see.

a. SP6 RNA polymeraseb. reticulocyte lysatec. dexamethasoned. immunoprecipitation

Cite sources in APA style, both in the text in parentheses and in a works cited page at the end.

2. Explain in your own words the two hypotheses (induction and derepression) that the authors propose for mechanisms by which hormone binding to glucocorticoid receptor protein (GR) could cause the GR to bind to the GRE.

3. Cotransfection means introducing two (or more) different plasmids into the same cells. In the experiment reported in figure 3b, the two plasmids used were one that contained a gene coding for a version of the GR, and one that had a chloramphenicol acetyltransferase (CAT) gene and a GRE. What was the purpose of the second plasmid? Explain.

4. What did the induction hypothesis predict should have occurred in figure 3b for cells with GRs from which part or all of the hormone-binding region was deleted? What did the derepression hypothesis predict? Explain.

5. What actually occurred in the experiment reported in figure 3b? What did the authors conclude? Explain.

39

H. Changes in Chromosome Number

Reading: Guo and Birchler 1994 (Science 266:1999) or

Yunis JJ, Prakash O. 1982. The origin of man: a chromosomal pictorial legacy. Science 215:1525-1530.

Objectives:

Describe the phenotypic consequences of variations in chromosome number in selected animals and plants.

Diagram meiosis in an aneuploid, polyploid, or monoploid organism.

Predict the gametes formed and genotypes of offspring in crosses involving aneuploids or polyploids.

Predict the fertility of polyploids.

On your own:

Describe the processes by which aneuploidy and polyploidy occur in organisms.

40

Yunis JJ, Prakash O. 1982. The origin of man: a chromosomal pictorial legacy. Science 215:1525-1530. (Human, Chimp, Gorilla, Orang)

41

Bull (Bos taurus)

Cat (Felis catus)

Pig (Sus scrofa)

Mouse (Mus musculus)

42

Human aneuploidy:

There is an old and often-duplicated table based on an article by Sankaranarayanan in Mutation Research (v.61, 1979) that shows about 15% of conceptions terminate in spontaneous abortion. This is pretty certainly an underestimate, because this is based on conceptions resulting in a diagnosed pregnancy. Lots of conceptions don't make it to implantation, much less through the month or two of development before the mother knows she's pregnant. The exact proportion of conceptuses that fail to make it to implantation is unknown, because it's quite difficult to detect that such a conceptus ever formed; an estimate is that about 50-75% of normal conceptuses fail to implant. (http://www.inciid.org/newsletter/oct/coulam2.html, http://haveababy.com/rpl/causes.asp?site=rpl)

While about 0.6% of live births are chromosomally abnormal, 5-10% of stillborns are, and over 50% of spontaneous first-trimester abortions. (Pauli RM, Chromosomes and stillbirth: introduction to cytogenetics. Wissp 3(2), 3(3), online at http://www.wisc.edu/wissp/wisspers/jun96001.htm.). It's estimated that 20% of all conceptuses are trisomic (cited in Shaffer et al. 1998)

Human aneuploidies found in live births include XO, trisomy 21 (Down syndrome), trisomy 18 (Edwards syndrome), and trisomy 13 (Patau syndrome). Patau is very rare, and survival is quite low. As of 2001, six cases were known to have survived to age 10 (Tunca et al. 2001. Clin. Dysmorphology 10:149-150).

It is well known that the incidence of Down syndrome increases geometrically with maternal age. This is presumably due to declining quality of eggs in older mothers. Chromosomal abnormalities may be transmitted via sperm as well, however. Shi and Martin (2000) found that rates of disomy in sperm from normal males were 0.07% for disomy 13, 0.18% for disomy 21, 0.05% for XX, 0.02% for YY, and 0.29% for XY. Diploid sperm were found at frequencies slightly above 0.3 %. Overall, Martin estimates that about 20% of sperm from normal males are chromosomally abnormal.

Frequencies in live births of various chromosomal abnormalities:

Condition Frequency in live births Life expectancyTrisomy 21 (Down) 1/650 30-50 yrsTrisomy 18 (Edwards) 1/6500 <1 yrTrisomy 13 (Patau) 1/13000 <1 yrXO (monosomy-X) 1/1000 femaleXXX (trisomy-X) unknownXXY (Klinefelter) 1/500 to 1/1000 maleXYY ("super-male") 1/1000 male

Ref Cit

Shi Q, Martin RH. 2000. Spontaneous frequencies of aneuploid and diploid sperm in 10 normal Chinese men: assessed by multicolor fluorescence in situ hybridization. Cytogenetics and Cell Genetics 90:79-83.

Shaffer LG, McCaskill C, Adkins K, Hassold TJ. 1998. Systematic search for uniparental disomy in early fetal losses: the results and a review of the literature. Am J Med Genet 79(5): 366-72

43

Problems:

1. The poinsettia type of Datura is trisomic for the chromosome that carries the gene P/p for flower color (Purple is completely dominant to white). For each of the following crosses, give the genotype and phenotypic ratios of the progeny (include ploidy in phenotype).

Assume:-The individual on the right is the pollen parent in each case.-Aneuploid female gametes are viable, aneuploid male gametes are not.-2x1 segregation.

a. PPp x PPp

b. PPp x Pp

c. Ppp x PPp

d. Ppp x Pp

2. Bob is a colorblind male. His wife, Sue, is homozygous for the normal allele of the gene controlling color vision. They have a daughter, Tania, who has Turner's syndrome (XO) and is colorblind. (The form of colorblindness referred to is caused by the recessive allele of an X-linked gene, C/c).

a. How did Tania's condition most likely originate, when, in whom, in what kind of cell division?

b. Diagram the cell division referred to in your answer to part a, showing the alleles of the gene C/c.

3. A triploid barley plant was found (3N=21).

a. If only balanced (2N or N) gametes are viable, determine the probability of obtaining a functional gamete. Assume 2x1 segregation in meiosis.

b. If two such plants are crossed, what is the probability of obtaining a seed?

4. An autotetraploid corn plant with the genotype RRrr is crossed to one with the genotype Rrrr. Assuming 2x2 segregation, no crossover between the gene and the centromere, and complete dominance of the R allele (giving the red plant phenotype), predict the phenotypic ratio of the offspring.

Questions for Guo and Birchler's article (Science 266:1999). (SEE plagiarism note p.1, and "scientific papers" notes p.2 of the objectives)

1. In this paper, what is meant by a “structural gene”? What is meant by a “regulatory gene?" You may have noticed that these terms are used in the paper as if they refer to two discrete classes of genes. The definitions you find must be consistent with this usage – they vary. Note: Just because I'm asking for definitions, this does not constitute a license to plagiarize, or even to quote directly. USE YOUR OWN WORDS. Cite any sources you use, both parenthetically and in a works cited section at the end. Do not cite me.

44

2. Under the traditional enzyme imbalance hypothesis (as I have described it in class), what happens to gene expression as the number of copies of a gene in a cell increases? How does this cause phenotypic abnormalities in aneuploids, according to the traditional view?

3. Guo and Birchler worked with translocations with portions of regular (A) chromosomes of corn attached to supernumerary (B) chromosomes. If you don’t know what B chromosomes are, look them up in Wikipedia. They used these to produce lines of corn carrying various numbers of copies of a particular A chromosome fragment.

a. What does the Glb1 gene code for in corn?b. On what chromosomal region is the Glb1 structural gene located?c. Based on the hypothesis you described in question 2, what Glb1 mRNA levels would

you expect in cells that are monosomic and trisomic for the chromosomal region you named in part b, compared to the level (1.00) in normal diploid embryo cells? What levels would you expect in endosperm with 2, 3, and 4 copies of that chromosomal region? Give numbers for each. Explain why the hypothesis makes these predictions.

d. What Glb1 mRNA levels are predicted by the hypothesis from question 2 for cells that are monosomic and trisomic for the short arm of chromosome 5 (5S), compared to the level (1.00) in diploid embryo cells? What Glb1 mRNA levels would you expect in endosperm with 2, 3, and 4 copies of 5S? Give numbers for each. Explain why the hypothesis makes these predictions.

e. What are the actual Glb1 mRNA levels observed by Guo and Birchler for the cells monosomic and trisomic for the 5S region and for the chromosomal region you named in 3b, relative to the diploid level? For each region, are Glb1 mRNA levels in the monosomic and trisomic significantly different from each other and from the diploid? Are there significant differences in Glb1 mRNA levels in endosperm tissues that are disomic, triploid, and tetrasomic for those chromosomal regions? Explain, and be sure to explain how they determined whether a difference was significant. Read the caption for table 2 and note 17 carefully.

f. Are there other chromosomal regions that, when monosomic or trisomic (or disomic or tetrasomic, for endosperm), affect Glb1 mRNA levels significantly? If so, which regions, and what happens to Glb1 transcription as the number of copies of these regions increases?

4. Why did Guo and Birchler also probe their blots with an antisense rRNA transcript (one that is complementary to rRNA)? EXPLAIN.

5. Based on the results of this study, what can you conclude about the original hypothesis?

6. Based on the results of this study, there are some chromosomal regions which, when aneuploid, affect rates of transcription elsewhere in the genome. What sort of genes do you think are present on these chromosomal regions? What kind of transcriptional control (positive, negative, or some of each) does this seem to be? Explain.

45

Questions for

Yunis JJ, Prakash O. 1982. The origin of man: a chromosomal pictorial legacy. Science 215:1525-1530.

1. Remove the last page (a copy of figure 2) from the paper. Explain the following fully in writing, and mark the relevant break points, etc. on the figure, turning the figure in with your answers to these questions. Indicate the question being answered by using the letter designations given below. When describing structural changes in chromosomes, be as specific as possible.

1a. Assuming (as the authors did) that the ancestral 2p and 2q were like those of the chimpanzee, how did the human chromosome 2 form?

1b. How did gorilla chromosome 8 arise from a human or chimp chromosome 8 ancestor?

1c. How did gorilla chromosomes 5 and 17 arise from chromosomes like the human 5 and 17? 1d. How did human, chimp, and gorilla chromosomes 3 arise from an ancestral chromosome 3?

2. a. How do human and chimp chromosomes 5 differ? Which one was ancestral to the gorilla chromosome 17? Explain how you know.

b. Which arrangement is ancestral, the human or chimp chromosome 5? (Hint: compare to orangutan, which is an outgroup).

3. Consider chromosomes 9 from human, chimp, gorilla, and orangutan (left to right). The gorilla and orangutan have the ancestral arrangement (same as in old world monkeys). The human chromosome 9 has some additional bands around q1.2 (region 1, part 2 of long arm) that are probably due to duplication.

a. How did human chromosome 9 arise from the ancestral type? Tell what kind of change occurred and mark break points on the human chromosome, labeling them "3a".

b. How did chimp chromosome 9 arise? Tell what kind of change occurred and mark break points on the chimp chromosome, labeling them "3b". c. Based on the chromosome banding patterns, did the chimp chromosome arise from the human-type chromosome, or directly from the gorilla-orang type chromosome? Explain which is most likely and why.

d. What implications does chromosome 9 have for the phylogeny of chimps, humans, and gorillas? 4. There is a consensus sequence that occurs at all centromeres. Now that we have the ability to sequence large regions of chromosomes, can you propose a way to test the hypothesis presented in your answer to question 1a?

46

I. Changes in Chromosome Structure

Objectives:

Explain the effects of each type of structural change on the phenotype of the organism.

Diagram meiosis I in an individual heterozygous for either a paracentric or a pericentric inversion.

Predict gametes formed from a translocation heterozygote with adjacent-1, adjacent-2, and alternate segregation, and with chiasmata in selected regions.

Predict progeny from crosses involving individuals with each type of structural change.

Discuss the influence of each type of structural change on the evolution of organisms.

On your own:

Describe the various types of chromosomal structural changes.

Explain how chromosomal structural changes occur in organisms.

Problems:

1. A wild Papilio dardanus is heterozygous for an inversion. One homolog has the alleles M.NOPQRST, linked in that order; the other has m.nrqpost (the dot represents the centromere). During meiosis in one cell, crossing over occurs between the genes P/p and Q/q. Crossing over occurs in both sexes in Papilio.

(a) Diagram pachytene and anaphase I in the cell above.

(b) The heterozygous individual is a female. Predict the genotypes of gametes produced and tell if they are viable.

(c) The heterozygous individual is a male. Predict the genotypes of gametes produced and tell if they are viable.

2 (a). Diagram the pairing of chromosomes at pachytene in a reciprocal translocation heterozygote with the chromosomes shown below. The homologous centromeres are 1 and 1'; 2 and 2'. Show crossovers between centromere 1 and C/c, and between centromere 2 and Y/y.

__.____ __._____ ____.___ ____.__ AB1CDEF ab1'cwnp fedr2'yz pnwr2yz

(b) Predict the genotypes and viability of gametes formed by alternate segregation.

(c) Predict the genotypes and viability of gametes formed by adjacent-1 segregation.

47