oni

Available online 4 August 2012

Keywords:InterferonCytokineSerotoninDepression

pathology has increasingly gained acceptance. In this regard, several lines of evidence suggested that

sion linkage has come from reports indicating that depressivesymptoms frequently develop in patients undergoing immuno-therapy with cytokines, such as interferon alpha (IFN-a), for thetreatment of some types of cancer or chronic viral diseases, suchas hepatitis C (Capuron and Miller, 2004; Capuron et al., 2002a).To a considerable extent, the features associated with depression

tumor necrosis factor-a (TNF-a), treatment with IFN-a does not af-fect plasma corticosterone levels or induces only modest effects inthis regard (Menzies et al., 1996), and does not engender a behav-ioral prole reminiscent of depression. Indeed, even after 3 weeksof treatment with either of two forms of pegIFN in rats, there wasno indication of weight change, disturbed locomotor activity or per-formance in a forced swim test (Loftis et al., 2006). Similarly, De LaGarza et al. (2005) reported that neither acute nor chronic IFN-atreatment affected plasma corticosterone, central cytokine expres-sion or depressive-like behaviors (sucrose pellet self administration,

Corresponding author. Tel.: +1 613 520 2699.E-mail addresses: hymie_anisman@carleton.ca, hanisman@connect.carleton.ca

Brain, Behavior, and Immunity 31 (2013) 115127

Contents lists available at

r,

.e(H. Anisman).1. Introduction

The view that activation of the inammatory immune systemmay promote depressive illness has been supported by severallines of research. These have included studies showing correspon-dence between circulating cytokine levels and major depressivedisorder (Maes, 1995), the impact of immune challenges on mood(Haroon et al., 2012; Miller et al., 2009), and the fact that antide-pressant treatments attenuate the symptoms of depression elicitedby inammatory factors in animal models (Yirmiya et al., 2001)and in humans (Musselman et al., 2001).

One of the strongest sources of support for a cytokine-depres-

induced by immunotherapy are characterized by vegetative symp-toms (fatigue, feelings of sickness, soporic-like effects), as well aslow mood (Raison et al., 2010). The occurrence of depression fol-lowing IFN-a immunotherapy tends to be more pronouncedamong individuals with sub-syndromal symptoms or a history ofdepression (Beratis et al., 2005; Capuron et al., 2003, 2004), as wellas low levels of the serotonin (5-HT) precursor, tryptophan(Capuron et al., 2003). Moreover, these symptoms diminished withtreatment cessation (Loftis and Hauser, 2004) and can be attenu-ated by antidepressants (Kraus et al., 2005; Musselman et al.,2001; Raison et al., 2005).

Animal studies indicated that unlike interleukin-1b (IL-1b) and0889-1591/$ - see front matter 2012 Elsevier Inc. Ahttp://dx.doi.org/10.1016/j.bbi.2012.07.023interleukin-1b (IL-1b) and tumor necrosis factor-a (TNF-a) can provoke neurochemical and hormonalchanges akin to those associated with psychological stressors, and that these cytokines also induce sick-ness behaviors that resemble some of the neurovegetative features of depression. Similarly, humandepressed patients often display marked changes of pro-inammatory cytokine levels and immune cellactivity. Perhaps more germane in the analysis of the cytokine-depression connection, reports of humansundergoing interferon-a (IFN-a) treatment for certain cancers or viral infections have indicated that thepro-inammatory cytokine caused signs of major depression in a substantial subset of those treated. Inthe present investigation, we demonstrated that acute or repeated infusion of IFN-a into the lateral ven-tricles provoked depressive-like behavior and concomitant changes in serotonin (5-HT) and mRNAexpression of particular 5-HT receptors and pro-inammatory cytokines. These actions were less evidentfollowing administration directly into the prefrontal cortex and not apparent at all when administered tothe dorsal raphe nucleus. The data are discussed in relation to the induction of depression elicited by IFN-a, and are presented in the context of a mini-review that highlights potential mechanisms through whichthe cytokine might act to promote psychomotor and affective disturbances and interact with stressors.

2012 Elsevier Inc. All rights reserved.Article history: A role for pro-inammatory cytokines and their neuroinammatory signaling cascades in depressiveCentral administration of murine interferbehavioral, brain cytokine and neurochemA mini-review and original experiments

Shawn Hayley, Jeff Scharf, Hymie Anisman Department of Neuroscience, Carleton University, Ottawa, Canada K1S 5B6

a r t i c l e i n f o a b s t r a c t

Brain, Behavio

journal homepage: wwwll rights reserved.-a induces depressive-likecal alterations in mice:

SciVerse ScienceDirect

and Immunity

lsevier .com/locate /ybrbi

(Spalletta et al., 2006), raises the possibility that the depressive

(22 C) and humidity (63%) kept constant, and were permitted free

andforced swimbehavior). In fact, itwas suggested that using a ratmod-el to assess the depressogenic action of IFN-amight not be produc-tive (Loftis et al., 2006). However, contrary to the negative ndings,others reported that administration of IFN-a increased immobilityin a forced swim test,without affectingperformance in a tail suspen-sion test or on an elevatedplusmaze test (Makinoet al., 2000a;Orsalet al., 2008), although the use of the forced swim test to assessdepressive-like pathology is controversial.

The fact that IFN-a increased corticosterone in myeloprolifera-tive disorder patients (after a single but not repeated injections)and that direct stimulation of hypothalamic and adrenal cultureswith IFN-a elicited corticotropin releasing hormone (CRH) and cor-ticosterone production, indicates the potential for the cytokine toinuence neuroendocrine processes under certain conditions(Gisslinger et al., 1993). As well, repeated IFN-a treatment affected5-HT turnover in the prefrontal cortex (PFC) and amygdala (De LaGarza et al., 2005), as well as dopamine (DA) and norepinephrine(NE) within the cortex, hypothalamus and medulla (Kamataet al., 2000; Kumai et al., 2000; Shuto et al., 1997). Consistent witha role for inammatory processes in promoting these effects, pre-treatment with diclofenac, a non-steroidal anti-inammatory drug,prevented the increased turnover of 5-HT in prefrontal cortex andDA in the hippocampus ordinarily elicited by intracerebroventric-ular (ICV) IFN-a administration (De La Garza et al., 2003).

It is uncertain why the different effects of IFN-amight have oc-curred, although it was suggested that it may be related to the factthat the murine form of IFN-a was used in some studies, whereashuman IFN-a was used in others, possibly reecting differences inreceptors across species (Crnic and Segall, 1992). Yet, it was re-ported that in both rats and mice human IFN-a disrupted forcedswim performance, whereas murine IFN-a did not produce a com-parable outcome. Moreover, this was the case irrespective ofwhether IFN-a was administered intravenously or into the brainintracisternally (Makino et al., 2000a,b,c). While not disputing theeffects of human IFN-a, it was reported that acute intraperitonealmurine IFN-a administration dose-dependently increased plasmacorticosterone levels and elicited mild signs of sickness. Interest-ingly, when the IFN-a treatment was preceded by a psychosocialstressor the effects of IFN-a were greatly enhanced, reected bygreater sickness, plasma corticosterone and hippocampal norepi-nephrine utilization, as well as elevated levels of circulating IL-6,IFN-a and IL-10 (Anisman et al., 2007, 2008a). Based on these nd-ings, it was suggested the effects of IFN-a in humans might simi-larly reect the conjoint effects of the cytokine coupled with thedistress experienced by cancer or hepatitis C patients.

Although it is thought that the effects of IFN-a, like that of othercytokines, involves peripheral actions, cytokines and their recep-tors are present in the brain, likely being produced within astro-cytes and microglia, and possibly even in neurons (Huang et al.,2011; Hulse et al., 2004; Kawanokuchi et al., 2006; Rivest, 2009).Moreover, pro- and anti-inammatory cytokine levels are elevatedin association with a variety of neuropathological conditions, suchas ischaemic stroke, as well as head injury (Kamm et al., 2006; Zhuet al., 2006) and in response to systemic, neurogenic and psycho-genic stressors (Maier et al., 1999; Miyahara et al., 2000; Nguyenet al., 1998). It seems that these cytokines could be acting in a ben-ecial manner (clearing debris and reducing infection), or at highconcentrations they might act in a neurodestructive fashion, there-by furthering psychopathology (Rivest, 2009). In the context of thepresent investigation it may be particularly signicant that theperiod following stroke is frequently accompanied by depression(Pascoe et al., 2011; Stoll et al., 1998), possibly secondary to ele-vated cytokine levels and variations of indoleamine 2,3-dioxygen-

116 S. Hayley et al. / Brain, Behavior,ase (IDO) and and the ensuing depletion of serotonin (Spallettaet al., 2006). In fact, it was shown in a rodent stroke model thatmiddle cerebral artery occlusion (MCAO) provoked a key featureaccess to food (Ralston Purina, St. Louis, MO, USA) and water. Tolimit variability associated with diurnal rhythms, all experimentalprocedures were conducted between 0800 and 1200 h. The studiesmet the guidelines set out by the Canadian Council on Animal Careand were approved by the Carleton University Animal CareCommittee.

2.2. Surgery

Animals were anesthetised with 2.5% isouorane and stereotax-ically implanted with a 26-gauge stainless steel guide cannula(Plastic One, Roanoke, VA, USA) in the lateral ventricle (ML +1.0,AP 0.22, DV 2.5 mm) relative to bregma, according to coordi-nates from Franklin and Paxinos (1997). In Experiments 47, thecannula was implanted either in the prefrontal cortex (L .31, AP268, DV 2.25) or dorsal raphe nucleus (L .20, AP 4.36, DV 3.4, low-ered at a 25 angle). The guide cannula was anchored to the skullwith three stainless steel screws and dental cement. A cannuladummy was inserted into the guide cannula to prevent blockageof the guide cannula prior to intracerebroventricular (ICV) injec-tion. Following surgery, animals were individually housed andallowed a 7-day recovery period prior to behavioral testing.

Following testing or sacrice brains were sliced (40 micronthickness) and examined to verify cannulae placements, and onlythe data from animals with correct placements were used for sta-state stems directly from actions of IFNs on other processes, ratherthan effects secondary to the peripheral actions of this cytokine.Thus, it was of particular interest in the present investigation to as-sess the effects of IFN-a administered directly into the brain, there-by limiting the potential contribution of peripheral effects ofinterferon.

2. Materials and methods

2.1. Subjects

Nave, male CD-1 strain mice obtained from Charles River Can-ada (St. Constant, PQ) at 67 weeks of age and were accustomed tothe vivarium for 2 weeks prior to being used as experimental sub-jects. Mice were housed in groups of four in standard(27 21 14 cm) polypropylene cages and maintained on a 12-hlightdark cycle (light phase: 08002000 h), with temperatureof depression, namely that of anhedonia (reduced consumptionof sucrose relative to water), which could be attenuated by treat-ment with interleukin-1 antagonist (IL-1ra) (Craft and DeVries,2006).

Given the potential links between IFN-a treatment and depres-sion, the present investigation was conducted to determinewhether murine IFN-a administered directly into the brain (eitheracutely or repeatedly) would elicit behavioral effects related toanxiety or depression, engender variations of monoamine levelsand utilization, and affect mRNA expression 5-HT receptors andcytokines in brain. Although cytokines, including IFN-a have somedifculty entering the brain parenchyma, systemically adminis-tered IFN-a may gain access to the brain (Pan, Banks & Kastin,1997) where receptors for this cytokine are present on microgliaand hence should be widely distributed (Wilkinson et al., 2010;Yamada and Yamanaka, 1995). The nding that IFN-a and/orIFN-c are increased in brain following traumatic injury (Khorooshiand Owens, 2010), and may contribute to poststroke depression

Immunity 31 (2013) 115127tistical analyses. For ICV treatment all animals but two had correctplacements. All animals with placements in the prefrontal cortexwere correct. Only 60% of animals with cannulae aimed at the

, anddorsal raphe were correct as this region is small and cannulae werelowered at a 25 angle.

2.3. Blood collection and brain removal

Between 0800 and 1000 h mice were sacriced by rapid decap-itation. Trunk blood was collected in tubes containing 10 lg ofEDTA, centrifuged for 8 min at 3600 RPM, and the plasma storedat 80 C for subsequent corticosterone determination. Brainswere rapidly removed and placed on a stainless steel brain matrix(2.5 3.75 2.0 cm) positioned on a block of ice. The matrix com-prised a series of stainless steel plates that had a series of slotsspaced 500 lm apart that guided razor blades to provide coronalbrain sections. Once the brains were sliced, tissue punches fromthe PFC and hippocampus were collected by micropunch using hol-low 20 gauge needles with a beveled tip following the mouse atlasof Franklin and Paxinos (1997). The collection of these punchestook no longer than 2 min following the decapitation of the animal.Tissue punches were stored at 80 C for subsequent determina-tion of cytokine or 5-HT receptor mRNA expression. Samples thatwere to be used for monoamine determinations the tissue puncheswere placed in 0.3 Monochloroacetic acid containing 10% methanoland internal standards, and then stored at 80 C.

2.4. Plasma corticosterone determination

Plasma corticosterone levels were determined in duplicateusing a commercially available radioimmunoassay kit (ICN Bio-medicals, CA, USA). Assays were conducted in a single run preclud-ing inter-assay variability, and the intra-assay variability was lessthan 8%.

2.5. High performance liquid chromatography (HPLC) assay

The levels of DA, NE and 5-HT, and their metabolites, DOPAC,MHPG and 5-HIAA, were determined by HPLC. Tissue puncheswere sonicated in a homogenizing solution comprising 14.17 gmonochloroacetic acid, 0.0186 g disodium ethylenediamine tetra-acetate (EDTA), 5.0 ml methanol and 500 ml H2O. Following centri-fugation, the supernatants were used for the HPLC analysis. Usingan Agilent (Mississauga, Ontario) pump, guard column, radial com-pression column (5 m, C18 reverse phase, 8 mm 10 cm), and cou-lometric electrochemical detector (ESA Model 5100,A), 40 ll of thesupernatant was passed through the system at a ow rate of1.5 ml/min (14001600 PSI). Each liter of mobile phase consistedof sodium dihydrogen phosphate (90 mM), 1-octase sulfonic acid(sodium sal) (1.7 mM), EDTA (50 mM), citric acid (50 mM), potas-sium chloride (5 mM) and 10% acetonitrile. The mobile phase hadbeen ltered (0.22 mm lter paper) and degassed. The area andheight of the peaks were determined using an Agilent integrator.Protein content of each sample was determined using bicinchoni-nic acid with a protein analysis kit (Pierce Scientic, Brockville,Ontario) and a Fluorostar colorimeter (BMG, Durham, NC). Thelower limit of detection for the monoamines and metaboliteswas approximately 1.0 qg.

2.6. Reverse transcription-quantitative polymerase chain reactionanalysis in brain

In Experiment 1 and 2, RNA from within the hippocampus andPFC was isolated and puried by standard methodologies employ-ing Trizol according to the manufacturers protocol (Invitrogen;Burlington, ON, Canada). The RNA was then reverse transcribed

S. Hayley et al. / Brain, Behaviorusing Superscript II reverse transcriptase (Invitrogen; Burlington,ON, Canada), and aliquots of this reaction were used in simulta-neous quantitative polymerase chain reactions (QPCR). For QPCR,SYBR green detection was used according to the manufacturersprotocol (Stratagene Brilliant QPCR kit). A Stratagene MX-4000 realtime thermocycler was used to collect the data. All PCR primerpairs used generated amplicons between 129 and 200 base pairs.Amplicon identity was checked by restriction analysis. Primer ef-ciency was measured from the slope relation between absolutecopy number or RNA quantity and the cycle threshold determinedusing the MX-4000 software. All primer pairs had a minimum of90% efciency. Primers that amplify GAPDH mRNA were used asa control to normalize the data.

To compensate for inter-individual variability that ordinarilyexists within the assay, the expression of each species within thehippocampus and PFC was normalized by subtracting its Ct fromthe GAPDH Ct, thus providing the normalized Ct values (Ctn) foreach mRNA species. A difference between Ctns for an mRNA spe-cies represents the fold change (i.e., as power of two) in abundance.To simplify data presentation, the nCt values were converted tofold changes relative to mice in the nave group, following the pro-cedure described by Livak and Schmittgen (2001). Primer se-quences were as follows: GAPDH, forward: GGT CGG TGT GAACGG ATT TG, reverse: TGC CGT GAG TGG AGT CAT ACT G; MusIL-1b, forward: TGTCTGAAGCAGCTATGGCAAC, reverse: CTGCCTGAAGCTCTTGTTGATG; Mus IL-1R1, forward: ATGAGTTACCCGAGGTCCAGTG, reverse: TACTCGTGTGACCGGA TATTGC; MusIL-6, forward: TCTTGGGACTGATGCTGGTG, reverse: CAGAATTGCCATTGCACAACTC; Mus IL-6R, forward: CTCTCCAACCACGAAGGCTG, reverse: TGCAACGCACAGTGACACTATG; Mus TNF-a, for-ward: CTCAGCCTCTTCTCATTCCTGC reverse: CCATAGAACTG ATGAGAGGG; Mus IL-10, forward: AATTCCCTGGGTGAGAAGCTG, re-verse: TCATGGCCTTGTAGACACCTTG; Mus 5-HT1A (Htr1a), for-ward: TCACCTTG AGTTTGCAGCCTC, reverse: GCAGGAGTTGGAAGCACTTAGG; Mus 5-HT1B (Htr1b), forward: GTCAAAGTGCGAGTCTCAGACG; reverse: ACAGATAGGCATCACCAGGGAG;Mus 5-HT2A (Htr2a), forward: TGCCACCAACTATTTCCTG ATG, re-verse: ACATCCAGGTAAATCCAGACGG; Mus 5-HT2C (Htr2c), for-ward: GTTCAATTCGC GGACTAAGGC, reverse: GTCAACGGGATGAAGAATGCC.

2.7. Experiment 1: acute infusion of IFN-a

Mice (N = 10/group) received infusion of murine IFN-a (100 or1000 IU) or vehicle into the lateral ventricles. Recombinant mouseIFN-a (R&D Systems, Minneapolis, MN, USA) was dissolved in 0.5%bovine serum albumin (BSA) as a stabilizing agent and carrier pro-tein. The control animals received equal amounts of 0.5% BSA sal-ine solution (vehicle). IFN-a or vehicle was microinjected intothe lateral ventricle in a 2-ll volume, infused over 5 min, via aninjection cannula connected to an infusion pump with polyethyl-ene tubing (Harvard Apparatus, Holliston, MA, USA). Followingdrug infusion, the injector was left in place for an additional2 min to ensure drug diffusion.

Immediately following drug administration, mice were re-turned to their home cages. The cages were part of a Micromax(Accuscan) motor activity monitoring system allowing home-cagemotor activity to be recorded for 90 min. Measuring activity in thehome cage permitted assessment of behavior relatively uncontam-inated by experimental procedures (e.g., novel environment) thatcould inuence the response to treatments.

Ninety minutes after infusion, mice were rapidly decapitated,and plasma trunk blood was collected in tubes containing 10 lgof EDTA for subsequent determinations of corticosterone. Bloodsamples were centrifuged for 15 min at 3,600 rpm, and the super-natant was stored in separate aliquots at 80 C for subsequent

Immunity 31 (2013) 115127 117analyses of corticosterone levels.Brains were rapidly removed and placed on a stainless steel

brain matrix (1 1.5 0.75 in.) situated on top of a block of ice.

crose preference/consumption over days (and periods within

andThe brain blocker had a series of slots (spaced 500 lm apart) thatserved as guides for razor blades to provide coronal brain sections.Tissue from hippocampus and PFC were collected by multiple mi-cro-punches using a hollow 20-gauge microdissection needle fol-lowing the mouse atlas of Franklin and Paxinos (1997). In thecase of the PFC, eight punches were used to form an inverted trian-gle, whereas hippocampal punches comprised four punchesextending approximately 2 mm on either side of the midline. Tis-sue was stored at 80 C for subsequent neurochemicaldeterminations.

2.8. Experiment 2: repeated infusion of IFN-a

Mice (N = 10/group) received intracranial infusion of IFN-a orvehicle into the lateral ventricles (as described in Exp. 1) on eachof 6 consecutive days. After each infusion, mice were returned totheir individual cages. Following the fth infusion, sickness behav-iors were recorded for 1 h at 20-min intervals following adminis-tration of IFN-a or vehicle. The overall appearance of each animalwas rated to assess the degree of sickness exhibited. Sickness mea-surements were scored on a four-point scale (0 = no symptom,1 = one symptom present, 2 = two symptoms presents, 3 = threeor more symptoms) with respect to absent exploration and loco-motion, curled body posture, ptosis, ragged fur, lethargy, pilo erec-tion, drooping eyelids, and overall nonresponsiveness. Wepreviously observed that this procedure yielded better than 90%agreement between two raters blind to the treatment mice re-ceived. Moreover, the results obtained using this procedure werehighly correlated with the more common procedure in which eachsymptom was independently scored for severity on a four-pointscale (Gibb et al., 2011). On the sixth day of treatment, 90 min afterthe nal infusion, mice were rapidly decapitated; blood and braincollection procedures were the same as described in Experiment 1.

2.9. Experiment 3: sucrose consumption following repeated centralIFN-a administration

To examine whether administration of IFN-a provoked depres-sive-like behaviors, a sucrose preference test that has been used asa measure of anhedonia was conducted over a six-day period. Inthis test, all mice (N = 9 or 10/group) were provided seven daysof pre-training to establish a stable baseline of sucrose consump-tion. To this end, mice had access to two 200 ml bottles, one con-taining 2% sucrose and the other tap water, with the positionaltered on a predetermined random schedule. Bottles wereweighed and changed daily. Intake volume of each was determinedon the basis of the bottle weights prior to vs. after the 24 h test per-iod. Following the training phase, mice received intracranial infu-sion of IFN-a or vehicle into the lateral ventricles (as describedin Exp. 1) on each of 6 consecutive days. Additionally, mice wereweighed every day prior to infusion.

2.10. Experiment 4 and 5: intra-PFC infusion of IFN-a

Two additional experiments were undertaken to assess whetherthe effects observed following ICV administration of IFN-a wouldalso be apparent when administered directly into brain regionsthat might be relevant to depressive behaviors. Thus, an initialstudy assessed the effects of IFN-a administered directly into theprefrontal cortex, a region in which 5-HT and CRH changes thatcould be elicited by IFN-a, might contribute to depressive likebehaviors. In this regard, we previously observed marked varia-tions of cytokine mRNA expression and monoamine changes in

118 S. Hayley et al. / Brain, Behavior,the PFC in responses to systemic cytokine or endotoxin challenges(e.g., Gibb et al., 2011). Thus, in Experiment 4 and 5 we repeatedthe infusion procedure of Experiment 1, except that IFN-a anddays) was assessed through repeated measures ANOVA, with timeas a within-group factor. In all instances, follow-up t tests wereconducted using Bonferroni corrections to control for family-wiseerror.

3. Results

3.1. Experiment 1. Locomotor activity, sickness behaviors and plasmacorticosterone levels following acute IFN-a administration

There was no signicant effect of IFN-a treatment on motorbehavior, nor was there any indication of sickness behaviors beingapparent following acute IFN-a administration (Fs < 1; data notshown). In contrast, plasma corticosterone levels, were dependenton treatment administered, F(2,24) = 5.44, p < .05. A single ICVtreatment of IFN-a moderately, but signicantly increased levelsof plasma corticosterone at both 100 and 1000 IU doses(M SEM = 12.90 2.08 and 12.11 1.14), compared to vehicletreatment (M SEM = 7.26 .26 ug/dl).

3.2. Cytokine mRNA expression

Cytokine mRNA expression in both the PFC and hippocampuswas markedly inuenced by the treatment mice received (Fig. 1).Specically, a Treatment effect was observed in the PFC with re-spect to mRNA expression of IL-1b, IL-6, and TNF-a, F0s(2,24) = 5.57, 9.78, and 4.52 p < .01, .01 and .05, respectively. Fol-low up tests showed that relative to the vehicle treatment, theadministration of both doses of IFN-a increased the mRNA expres-sion of each of these pro-inammatory cytokines.

The cytokine variations within the hippocampus were very sim-ilar to those seen within the PFC, such that IFN-a altered the mRNAexpression of IL-1b, IL-6 and TNF-a, Fs(2,24) 5.57, 7.37, and 4.52,vehicle were infused directly into the medial prefrontal region.Immediately following infusion mice were placed in their homecages, wherein motor activity was measured as in Experiment 1.After 90 min mice were decapitated and blood and brain tissue col-lected for determination of corticosterone as well as mRNA expres-sion of the cytokine and 5-HT receptors as described earlier,whereas in Experiment 5 tissue was punches were sonicated andassayed for NE and 5-HT and their respective metabolites MHPGand 5-HIAA.

2.11. Experiment 6 and 7: intra-raphe infusion of IFN-a

Given the potential relationship between CRH and the seroto-nergic system (Anisman et al., 2008a,b; Linthorst, 2005), we evalu-ated whether IFN-a applied to the dorsal raphe nucleus wouldinuence cytokine mRNA expression and monoamine variationsin the PFC and hippocampus, thereby providing a link betweenCRH and the dorsal raphe and anxiety/depression. The experimen-tal outcomes and procedures were identical to those of the previ-ous two experiments, with the exception being that the dorsalraphe was targeted rather than the PFC.

2.12. Statistical analyses

Data for corticosterone, as well as mRNA changes for each of thecytokines, 5-HT receptor subtypes, and the monoamines and theirmetabolites were analyzed using one-way between-group analy-ses of variance (ANOVA). Motor activity, sickness scoring, and su-

Immunity 31 (2013) 115127ps < .01, .01, and .05, respectively. The follow-up tests conrmedthat the 1000 IU dose increased the expression of each of thesecytokines relative to vehicle treated mice. The 100 IU dose also

dosage did not reach statistical signicance (.05 < p < .10).

, and3.3. Serotonin receptor mRNA expressionincreased IL-6 mRNA expression, whereas the rise of TNF-a at this

Fig. 1. Cytokine (IL-1b, IL-6 and TNF-a) mRNA expression (fold changes) in theprefrontal cortex (PFC) and hippocampus following acute i.c.v. administration ofIFN-a (100 or 1000 IU) or vehicle (M SEM). p < 0.05 compared to vehicle.S. Hayley et al. / Brain, BehaviorIntracerebroventricular IFN-a infusion did not affect the expres-sion of 5-HT1A receptors within the PFC, but did promote a reduc-tion of 5-HT2A receptor expression, F(2,24) = 5.59, p = .01, that wasprimarily attributable to the reduced expression of this receptor inmice treated with the 100 IU dose of IFN-a. The change of 5-HT1Breceptor expression approached, but did not reach statistical sig-nicance, F(2,24) = 2.48, p = .07.

Within the hippocampus, there was a treatment effect with re-gard to 5HT1A mRNA expression, F(2,24) = 5.59, p = .05 (Fig. 2). Spe-cically, reduced 5-HT1A expression was evident at both doses ofIFN-a compared to vehicle (p < .05). In contrast, expression of5-HT1B and 5-HT2A receptors was not affected by IFN-a (p = .11and .26, respectively).

3.4. Experiment 2. Effects of repeated IFN-a administration

3.4.1. Sickness behaviorSickness scores were recorded for 60 min following the fth day

of treatment. Analysis of sickness behaviors revealed a main effectof Treatment, F(1,34) = 16.32, p < .001. Specically, as depicted inFig. 3, IFN-a affected sickness at each of the assessment times(20, 40, 60 min) relative to vehicle treated mice (p < .05), yet theextent of the sickness was modest, being well below that typicallyobserved following moderate doses of IL-1b or LPS administeredsystemically.

3.4.2. Plasma corticosteroneRepeated administration of IFN-a signicantly increased corti-

costerone levels, F(1,17) = 39.78, p < .001. Plasma corticosteronelevels after repeated infusion of IFN-a, (M + SEM = 14.65 + 1.30)were nearly ve times that of vehicle-treated mice (M + SEM =3.78 + 1.09) (p < .05).

3.4.3. Cytokine mRNA expressionRepeated infusion of IFN-a increased proinammatory cytokine

mRNA expression in the PFC. As shown in Fig. 4, IL-1b expressionwas greater in mice repeatedly treated with IFN-a than in vehi-cle-treated mice, F(1,16) = 5.95, p = .03, as was the expression ofTNF-a, F(1,16) = 4.53, p = .05. Furthermore, IL-6 expression withinthe PFC was also increased by IFN-a, F(1,16) = 4.61, p = .05, but thisoutcome was marginal.

Repeated infusion of IFN-a increased proinammatory cytokinemRNA expression in the hippocampus, and as observed in Fig 4,these effects were appreciably greater, but more variable thanthose seen in the PFC. Specically, IFN-a increased IL-1b, IL-6,and TNF-a mRNA expression compared to vehicle, F(1,15) = 5.74,6.64, and 4.31, ps = .02, .03, and .05.

3.4.4. Serotonin receptor mRNA expressionFig 5 provides the fold changes of 5-HT receptor subtypes as a

function of the IFN-a treatment mice received. As observed follow-ing acute IFN-a administration, 5-HT1A expression was unaffectedin the PFC. Moreover, the decline of this receptor in the hippocam-pus of acutely treated mice was no longer apparent after repeatedadministration of IFN-a. Likewise, the decline of 5-HT1B in the cor-tex was entirely absent following repeated IFN-a, whereas in thehippocampus the 5-HT1B expression was somewhat diminished,although not signicantly so (p = .11). This same pattern wasapparent with regard to 5-HT2C expression (p = .06), whereas amodest rise of 5-HT2A was apparent in the hippocampus (p < .07)just as it was following the acute IFN-a treatment.

3.5. Experiment 3. Anhedonia following repeated administration ofIFN-a

Prior to treatment with IFN-a or vehicle, and after establish-ment of a stable baseline, sucrose and water intake was compara-ble (>85% preference for sucrose) in mice that had been treatedwith either vehicle or IFN-a. Most of the consumption (>85100%) following the experimental treatments consisted of the su-crose solution (i.e., very little tap water was consumed), and thegroups were comparable with respect to the amount water con-sumed (data not shown). As within group variance associated withpreference scores was largely attributable to changes of water con-sumption, the absolute consumption of sucrose was used as thedependent variable, although the ANOVA yielded comparable re-sults irrespective of whether sucrose preference or absolute su-crose consumption was assessed. This analysis of variancerevealed that over the 5 test days, sucrose consumption was signif-icantly reduced among mice that received the IFN-a treatmentF(1,17) 13.93, p < .001. However, as seen in Fig. 6, the reductionof sucrose consumption was particularly notable after 5 days ofIFN-a treatment as consumption had declined to about 50% ofwhat it had been at baseline training.

3.6. Experiments 47: intra-PFC and intra-DRN infusion of IFN-a

When IFN-a was administered directly to the PFC (Experiment4), home cage locomotor activity was reduced relative to vehicletreated animals, F(1,14) = 4.86, p < .05 (M + SEM = 1237 + 270 vs3264 + 878 arbitrary units, respectively). However, unlike the ef-fects induced by ICV IFN-a administration, intra-PFC infusion didnot inuence the plasma corticosterone levels (M + SEM =

Immunity 31 (2013) 115127 11910.89 + 2.41 and 8.63 + 1.85, respectively). Furthermore, the proleof hippocampal cytokine changes observed when IFN-a wasadministered to the prefrontal cortex was markedly different from

and120 S. Hayley et al. / Brain, Behavior,that apparent following ICV treatment. Specically, the IFN-atreatment did not inuence the expression of IL-1b, TNF-a or IL-6 within the hippocampus. Likewise, the expression of hippocam-pal 5-HT receptor subtypes (5-HT1A, 5-HT1B, 5-HT2A and 5-HT2C)were not affected by the cytokine treatment (data not shown).

Fig. 2. mRNA expression (fold changes) of 5HT receptors in the prefrontal cortex (PFC) a(M SEM). p < .05, relative vehicle. p < .0025, relative to vehicle-treated mice.

Fig. 3. Mean (SEM) sickness scores over 1 h following ICV infusion of IFN-a orvehicle.Immunity 31 (2013) 115127As evident in Fig. 7, in Experiment 5, IFN-a administration tothe PFC increased the hippocampal accumulation of the NE metab-olite MHPG relative to levels in vehicle treated mice, F(1,13) = 8.04,p = .01, and also increased NE levels, F(1,13) = 4.34, p = .05. The5-HT metabolite, 5-HIAA, was also elevated following IFN-aadministration, F(1,13) = 5.20, p = .04, whereas the level of 5-HTwas unaffected by the cytokine treatment.

Experiments 6 and 7 were conducted to assess the effects ofIFN-a administered at the dorsal raphe nucleus (DRN). In contrastto the effects observed following ICV or PFC infusion, when IFN-a(1000 IU) was administered into the DRN no signicant changesin the expression of cytokines, 5-HT receptors or central mono-amine levels were apparent (data not shown).

4. Discussion

The use of IFN-a in the treatment of hepatitis-C and some formsof cancer (hematological maligancies, leukemia and lymphomas,melanoma) has become more prevalent owing to its ability to as-sist in viral clearance, antiproliferative, anti-angiogenic andapoptotic effects, as well as boosting the immune system. A large

nd hippocampus following i.c.v. administration of IFN-a (100 or 1000 IU), or vehicle

Fig. 4. Expression of cytokine mRNA (fold changes) in the prefrontal cortex (PFC) and hi(M SEM). p < 0.05, p < 0.01 compared to vehicle-treated mice.

Fig. 5. mRNA expression (fold changes) of 5HT receptors in the PFC and hippocampus

Fig. 6. Sucrose consumption over days associated with repeated intraventricularadministration of IFN-a (1000 IU) or vehicle (M SEM).

Fig. 7. Mean SEM concentrations of MHPG, NE as well as 5-HIAA and 5-HT in thehippocampus following acute administration of IFN-a to the nedial prefrontalcortex. p < 0.05.

S. Hayley et al. / Brain, Behavior, andppocampus following repeated i.c.v. administration of of IFN-a (1000 IU) or vehicle

following repeated i.c.v. administration of IFN-a (1000 IU) or vehicle (M SEM).

Immunity 31 (2013) 115127 121sub-group of patients receiving IFN-a treatment manifest depres-sive symptoms (Capuron and Miller, 2004), and although someinconsistencies are apparent in animal studies, several reportsindicated that IFN-a can induce some depressive-like changes inrodents (Maes et al., 2011; Myint et al., 2009). Consistent withour earlier report concerning the effects of systemic murine IFN-a administration (Anisman et al., 2007), in the present investiga-tion modest sickness behavior was induced in mice following re-peated but not acute ICV infusion of IFN-a. As well, ICV (but notintra-PFC or DRN) administered IFN-a increased plasma corticoste-rone and this outcome was apparent with both acute and repeatedexposure, pointing to the independence of the corticosterone vari-ations and the sickness behaviors.

Like the neurovegetative changes associated with IFN-a immu-notherapy, the cytokine initially provoked only modest reductionsof sucrose consumption, but once mice had received the treatmentover successive days, sucrose consumption declined appreciably,possibly reecting anhedonia, a characteristic feature of depres-sion. Insofar as sickness behavior has been taken to resemble thevegetative behaviors associated with major depression (Dantzeret al., 2008, 2011), and the changes of sucrose intake reect anhe-donia associated with depression, the present ndings are consis-tent with the view that inammatory challenges are related tothe emergence of a depressive-like state. Given that IFN-a affectedanhedonia, but did not elicit sickness that might reect somaticfeatures of depression, shouldnt necessarily be taken to suggestthat the link between IFN-a and depressive features is uncertainin an animal model. To be sure, depression comprises both somaticand cognitive/affective symptoms, possibly reecting diverseunderlying mechanisms (Anisman et al., 2008a). Thus, it may beparticularly relevant that among hepatitis C patients responses toquestions on the Beck Depression Inventory that targeted cognitiveand affective symptoms appeared to provide better validity

andconcerning depression relative to questions that focused on so-matic features (Patterson et al., 2011). It might similarly be thecase that symptoms that reect anhedonia (or cognitive distur-bances) in an animal model might be more aligned with depressionthan are somatic characteristics.

Admittedly, the magnitude of the anhedonic effects observed inthe present study was modest, and it is possible that it was second-ary to the sickness elicited by the IFN-a. As will be discussedshortly, there are any number of reasons why repeated treatmentwas necessary to elicit the observed behavioral changes, but it isunlikely that the behavioral disturbances were due to cumulativedrug effects as the half life of IFN-a, like that of other cytokinesis brief. Signicantly, the neurovegetative effects of IFN-a in hu-mans also appear only after a few weeks after treatment begins,and the mood changes, including anhedonia, develop later (Capu-ron et al., 2002a). Thus, with a more chronic regimen, the anhe-donic effects of IFN-a might have become more notable. Also ofsignicance is the fact that we presently found that low doses ofIFN-a administered directly into the brain elicited anhedonia,implicating central mechanisms as being the source of the behav-ioral changes observed.

An important consideration regarding the IFN-a induced behav-ioral effects is whether they actually represent a genuine depres-sive-like syndrome. Recent data seem to support this contentiongiven that antidepressant medications are as effective in reducingcore depressive features in IFN-a treated patients as those in thegeneral depressed population. Indeed, the SSRI, paroxetine, wasshown to reduce symptoms of depression in hepatitis C patientsthat received IFN-a with or without concomitant ribavirin treat-ment (Capuron et al., 2002a,b; McNutt et al., 2012). Moreover, anti-depressant treatment was equally effective in melanoma patientsthat had IFN-a induced depressive features relative to depressedpatients that had not been treated with this cytokine (Navinset al., 2009). However, IFN-a induced depression appears to beassociated with more pronounced psychomotor retardation andweight loss, coupled with less severe feelings of guilt, comparedto depressed patients that had not received cytokine therapy(Capuron et al., 2009). Animal studies have paralleled these humanndings, as IFN-a induced anhedonia in rats was attenuated by re-peated antidepressant treatment (Sammut et al., 2002). Interest-ingly, paroxetine was not effective as a prophylactic treatmentwhen given to prevent the initial emergence of IFN-a induceddepressive symptoms (McNutt et al., 2012). Similarly, a doubleblind clinical trial failed to reveal signicant prophylactic effectsof citalopram with respect to the onset of IFN-a induced depres-sion (Morasco et al., 2010). Thus, SSRIs appear to help managesymptoms after their emergence, but might not appreciably inu-ence the pro-depressive process initially set into motion by IFN-a.It is likely that early pro-inammatory processes engaged by IFN-aare not substantially affected by antidepressant pre-treatment andthat the antidepressant only becomes relevant after the initialinammatory processes come to provoke 5-HT and other aminer-gic changes.

4.1. Cytokine variations in brain induced by IFN-a

In contrast to its well delineated signaling pathways within theperipheral immune system, limited data are available concerningthe central mechanisms through which IFN-a might provokedepressive symptoms. One obvious mechanism through whichIFN-a could inuence emotional processes is through the dysregu-lation of the central cytokine network, as well as the provocationof glial-dependent pro-inammatory actions. Immunotherapywith

122 S. Hayley et al. / Brain, Behavior,IFN-awas found to elevate serumconcentrations of IL-6, IL-8 and IL-10 and these cytokine changes were correlated with the manifesta-tion of depressive feelings, although these ndings didnt speakdirectly to potential cytokine variations in brain (Bonaccorso et al.,2001). In the present investigation, acute or repeated administra-tion of IFN-a directly into the brain (ICV)markedly increasedmRNAexpression of IL-1b, IL-6 and TNF-a in the PFC and hippocampus.This is particularly important in light of the evidence indicating thatIL-1b and TNF-a can induce stressor-like neurochemical anddepressive-like behavioral effects that resemble vegetative symp-toms of depression in humans (e.g., anorexia, anxiety, reduced mo-tor activity) (Dantzer et al., 2008; Hayley et al., 2005). By contrast,administration of IL-6 generally does not elicit substantial behav-ioral changes (Bluth et al., 2000), but itmay act synergisticallywithIL-1b in promoting behavioral disturbances (Brebner et al., 2000).

The PFC and the hippocampus have been implicated in depres-sion, and long-termhippocampal inammation has been associatedwith depressive behavior (Curran and OConnor, 2001; Fu et al.,2010). The hippocampus also expresses a particularly high densityof IL-1 receptors (Parnet et al., 2002) and, as such, it might also berelatively susceptible to the adverse consequences of neuroinam-mation and could contribute to the cognitive disruptions thataccompany IFN-a treatment. However, the role of specic proin-ammatory cytokines (IL-1a, IL-6, or TNF-a) to depression inducedby IFN-a is uncertain. Even in the present experiment, inwhich IFN-a up-regulated each of these cytokines, it is not clear which (if any)of these cytokines contributed to depressive features.

A specic role for IL-6 has increasingly gained support as a con-tributing factor in depression given that elevated circulating IL-6levels in depressed patients normalize with successful antidepres-sant treatment (Basterzi et al., 2005). Further evidence has comefrom two meta-analyses, one reporting that plasma IL-1b and IL-6 were positively associated with depression (Howren et al.,2009), and the second that indicated signicantly higher levels ofIL-6 in plasma of depressed patients compared to controls (Dowlatiet al., 2010). Paralleling these conditions, immunotherapy withIFN-a in patients was also associated with increased IL-6, and pa-tients with elevated plasma IL-6 prior to treatment had been foundto be especially vulnerable to subsequent depression induced byIFN-a (Wichers et al., 2006), possibly accounting for the variabilitythat exists concerning the depressogenic effects of IFN-a. In thepresent investigation acute ICV IFN-a provoked a marked elevationof IL-6 that was considerably more pronounced in the PFC than inthe hippocampus. With repeated IFN-a treatment, however, the IL-6 rise in the PFC was diminished, whereas that in the hippocampuswas exaggerated. Why these region-specic variations developedwith repeated administration of the cytokine isnt certain. How-ever, given that the behavioral symptoms of depression also in-creased with repeated treatment, these data point to the IL-6hippocampal variations being more closely aligned with the behav-ioral changes relative to the PFC variations.

4.2. Serotonergic alterations in the brain following IFN-aadministration

Studies in humans have suggested that diminished availabilityof 5-HT, the 5-HT transporter or variations of particular 5-HTreceptors is linked to depression. For instance, in both humanand animal studies, 5-HT1A (Albert and Franois, 2010; Nishiet al., 2009), 5-HT1B (Sari, 2004), and 5-HT2A (Bhagwagar et al.,2006) might contribute to affective disorders, as well as the actionsinvolved in the effectiveness of antidepressants. Thus, it was ofparticular interest in the present investigation to assess 5-HTreceptor mRNA expression in response to IFN-a.

The 5-HT changes induced by IFN-a in the present study were,in several respects, consistent with experiments that implicated 5-

Immunity 31 (2013) 115127HT functioning in depression. Previous reports indicated that a sin-gle ICV injection of IFN-a (200 or 2000 IU) reduced 5-HT and NElevels in the frontal cortex (Kamata et al., 2000) and that its re-

, andpeated systemic administration also reduced cortical 5-HT levels(Asnis et al., 2003). In the present investigation, acute ICV infusionof murine IFN-a reduced 5-HT1B and 5-HT2A receptor mRNAexpression within the PFC, whereas 5-HT1A was reduced in the hip-pocampus. It is unlikely that the 5-HT receptor changes were dueto any adverse reactions to IFN-a, as the doses used were far belowthose thought to be associated with toxicity.

The decreased levels of 5-HT1B mRNA in the PFC are consistentwith reports in human post-mortem studies indicating reduced5-HT1B mRNA in individuals with major depression who had diedby suicide (Anisman et al., 2008b). Similarly, the impact of IFN-aon hippocampal 5HT1A mRNA expression is consistent with studiesin humans showing that the 5-HT1A receptor expression was notonly down-regulated in depression but was linked to SSRI effec-tiveness (Artigas et al., 1996). Furthermore, a genetic polymor-phism for the 5-HT1A receptor has been linked to the onset ofIFN-a-induced depression in patients undergoing immunotherapy(Kraus et al., 2007). Besides being of importance in neurotransmis-sion, the 5-HT1A receptor is believed to play a fundamental role invarious immune processes, including macrophage phagocytosis, Tcell proliferation, as well as adhesion and chemotaxis of mast cells(Ahern, 2011). Moreover, T cell leukemia-derived cell lines incu-bated with IFN-a displayed reduced 5-HT1A receptor expressionand this effect was attenuated by co-incubation with either tricy-clic or SSRI antidepressants (Cai et al., 2005). Thus, IFN-a mighthave similar actions upon multiple cell types that could ultimatelystimulate neuroinammatory processes and conversely, the anti-inammatory effects, known to exist for certain antidepressants,could facilitate benecial clinical outcomes by antagonizing IFN-a effects at multiple nodes of the neuro-immune axis.

The present nding concerning decreased 5-HT2A expression inPFC and slightly elevated levels in hippocampus are in some re-spects difcult to reconcile with ndings in humans. Specically,it has been reported 5-HT2A receptor density was increased withinthe PFC of individuals with a history of depression (Shelton et al.,2009) and was also elevated among individuals that died by sui-cide (Arango et al., 1990; Hrdina et al., 1993; Pandey et al.,2002), although these effects could have been related to suiciderather than depression (Pandey et al., 2002). To be sure, variationsof 5-HT2A density within cortical brain structures are not uniformlyevident among depressed individuals (Underwood et al., 2011). Inthis regard, for instance, increased 5-HT2A binding was seen in thedorsolateral prefrontal cortex among those patients with particu-larly elevated feelings of pessimism and hopelessness (Meyeret al., 2003). Such ndings speak to the view that individual symp-toms ought to be given greater attention in assessing characteris-tics of depression, but obviously characteristics such as thesecannot be determined in an animal model of depression.

As indicated earlier, depressive symptoms in humans becomemore pronounced with continued IFN-a treatment, with neuroveg-etative features becoming apparent rst, followed by affectivesymptoms (Capuron et al., 2002a; Trask et al., 2004; Wicherset al., 2007). It likewise appeared that some of the behavioral dis-turbances observed in the present investigation became more pro-nounced with repeated IFN-a administration. In contrast, however,the 5-HT receptor variations associated with acute treatment wereless pronounced after repeated treatment. This disconnect be-tween the effects of repeated IFN-a on behavior and 5-HT receptorchanges appears to argue against a role for 5-HT in the behavioraloutcomes. This said, it is certainly possible that with continuedIFN-a treatment the initial 5-HT receptor changes could provokestill further downstream changes that might be aligned withdepression. For instance, dysregulation of brain derived neurotro-

S. Hayley et al. / Brain, Behaviorphic factor (BDNF) and other trophic factors may come to disruptneurogenesis and the proper incorporation of new neurons intohippocampal circuits, or alternatively, existing neural and synapticconnections could become weakened. In fact, it was reported thatsystemic IFN-a treatment to rodents, using a schedule that wasaligned with human therapeutic application, reduced hippocampalcell proliferation (Kaneko et al., 2006). Likewise, humans treatedwith IFN-a displayed time-dependent reduction of serum BDNFlevels that correlated with depressive symptom severity, and itwas suggested that reductions in neuroprotective capacity couldexplain such outcomes (Kenis et al., 2011). Although antidepres-sants and cytokines are both known to affect BDNF (Sen et al.,2008), their timing in relation to one another as well as their exactroute of action are uncertain.

4.3. Alternative mechanisms of IFN-a induced depressive-likepathology

It is unclear whether IFN-a could be exerting its neurochemicaleffects through central or peripheral mechanisms, although thepresent data certainly support a central mode of action. Indeed,IFN-a receptors are normally located on peripheral immune cells,such as macrophages and natural killer cells, where they regulateantigen presentation (via MHC molecules) and anti-viral re-sponses. Thus, it is possible that IFN-a inuenced brain processes,secondarily by way of systemic immune cell activity. However,IFN-a receptors have also been observed on astrocytes and microg-lia, at least in response to immunogenic stimuli and in neuropa-thology (Huang et al., 2011; Hulse et al., 2004; Kawanokuchiet al., 2006; Rivest, 2009). Moreover, the closely related receptor,IFN-c, has been localized to human microglia and is believed tobe one of the most potent endogenous inducers of microglial reac-tivity (Hashioka et al., 2010).Although less convincing, there iseven evidence that IFN-a expression occurs in cultured humanneuronal cell lines (NT2-N) (Wan et al., 2008). At this juncture, itis unclear as to the exact cell type(s) through which IFN-a im-parted its central effects in the current experiments, nor is it clearwhether brain-region specic differences in IFN-a receptor expres-sion (or easier access following infusion) could explain the greaterneurochemical changes elicited in certain regions.

Pro-inammatory states in the brain are known to affect themetabolism of tryptophan and levels of 5-HT by affecting the en-zyme, indoleamine-2,3-dioxygenase (IDO), resulting in changes inthe kynurenine (KYN)/kynurenic (KYNA) acid ratio and degrada-tion of tryptophan, which could favor the development of depres-sion (Dantzer et al., 2011; Maes et al., 2011). In particular,neuroinammation induces KYN metabolism in astrocytes andmicroglia, and results in 5-HT being degraded by IDO into for-myl-5-hydroxykynuramine, resulting in diminished availability of5-HT (Myint, 2012). In the case of IFN-a therapy, the cytokinewas shown to increase IL-6 and the KYN/KYNA ratio that was asso-ciated with depressive pathology (Wichers et al., 2007; Maes et al.,2011). Similarly, the immune agent, bacillus Calmette-Guerin(BCG), used to induce depressive-like behaviors in mice, activatedthe IDO enzyme; conversely, inhibition of IDO prevented thedepressive-like behaviors of BCG (OConnor et al., 2009).

The link between IFN-a therapy and the induction of IDO activ-ity might involve IFN-c, which is the major endogenous regulatorof IDO and is strongly induced by IFN-a. Thus, it is of signicancethat IFN-c knockout mice were resistant to the development ofdepressive-like behaviors when challenged with BCG (OConnoret al., 2009). Similarly, our ownwork indicated that IFN-c null micedisplayed basal differences in open eld exploration, along with in-creased noradrenergic and serotonergic activity within the centralamygdala, relative to their wild-type counterparts (Litteljohn et al.,2009, 2010). Moreover, stressor-induced elevations of corticoste-

Immunity 31 (2013) 115127 123rone and TNF-a, as well as DA turnover (prefrontal cortex, hypo-thalamus and central amygdala) were blunted in IFN-c-decientmice. However, chronic stressor exposure induced anxiety-like (re-

medical condition. Thus, the depressogenic actions of IFN-a mightreect the conjoint effects of the cytokine superimposed on a back-

andduced open eld exploration) and depressive-like behaviors(forced swim immobility, reduced sucrose consumption) amongboth wild-type and IFN-c knockout mice alike. Hence, the immu-nological, hormonal and dopaminergic process affected by endog-enous IFN-c did not appear to be translated into obvious affectivedisturbances (Litteljohn et al., 2009, 2010).

Besides a role for IFN-c and IDO processes in depressive symp-toms, changes in the ratio of tryptophan to large neutral aminoacids (LNAA) (tryptophan, tyrosine, valine, leucine, isoleucine,phenylalanine) induced by IFN-a treatment might also be ofimportance (Capuron et al., 2002a,b). Indeed, diminished trypto-phan levels and a reduced tryptophan/LNAA ratio was evident fol-lowing IFN-a treatment and was associated with anorexia,pessimistic and suicidal thoughts, as well as poor concentration(Capuron et al., 2002b). Additionally, the fact that pre-existing highcirculating levels of sIL-2R, IL-6 and IL-10 was associated with agreater likelihood of depression following IFN-a therapy indicatesthat an enhanced immune state, particularly the T cell adaptivebranch of immunity, may render individuals vulnerable to thedevelopment of depression (Wichers et al., 2006). Similarly, itwas reported that pre-existing immune activation, in this case re-ected by elevated sTNFR-1, predicted later vulnerability to IFN-ainduced depressive symptoms (Friebe et al., 2007).

Although IFN-a treatment certainly elicits a depressive condi-tion, it also produces a wide range of neurocognitive and other ef-fects, many of which are unrelated to mood. Indeed, delirium, u-like symptoms, cognitive disturbances, muscle pain and thyroiddysfunction have all been reported to occur with fairly high fre-quencies (Patten, 2006; Raison et al., 2005). Alterations of 5-HTand DA activity, along with psychomotor retardation and changesin metabolic activity of the basal ganglia and anterior cingulatecortex were also reported in non-human primates (Miller, 2009).IFN-a treatment in rodents has been associated with extreme fati-gue, as well as cataplexy together with concomitant disturbancesof DA accumulation and turnover (Shuto et al., 1997). In fact, ro-dent models of chronic fatigue (with either administration of im-mune activating agents or excessive wheel running) implicatedIFN-a in such outcomes (Davis et al., 1998; Katafuchi et al.,2005). Similarly, general reductions of motor performance acrossseveral measures, including open eld, muscle strength tests alongwith swim posture and endurance have been reported (Dunn andCrnic, 1993). A microarray study that identied 252 up-regulatedgenes, found that 20-50-oligoadenylate synthetase 2, a gene linkedto chronic fatigue syndrome, was the only one differentially ex-pressed in patients with IFN-a-induced depression and fatigue(Felger et al., 2011). Thus, caution ought to be exercised wheninterpreting IFN-a effects in relation to potential depressive-likebehaviors, especially in animal models. In fact, it is highly likelythat common IFN-mediated immune mechanisms contribute toneurovegetative aspects of a range of disorders/syndromes.

Recent studies have linked malaise, sickness and anhedonia togeneral disturbances in cell mediated immunity, in which the IFNsplay a critical role. In this regard, thepossibilitywasevenentertainedthat the translocation of bacteria normally found in the gut couldgive rise to such behaviors by triggering oxidative and nitrosativestress pathways (Leonard and Maes, 2012). Indeed, enhanced anti-body and oxidative stress reactions to immune challenges (e.g.LPS) was observed in depressed patients, which was suggested topossibly stem from leaky gut syndrome thatmight become appar-ent with chronic depression (Haroon et al., 2012). In such situations,individuals with pre-existing depression coupledwith a leaky gut,would already have heightened ongoing inammatory responses(owing tobacterial translocation),whichwouldplace thematpartic-

124 S. Hayley et al. / Brain, Behavior,ular risk for the deleterious consequences of IFN-a administration.We have suggested previously (Anisman et al., 2008a,b) that pa-

tients treated with IFN-a comprise a unique population as most aredrop of distress. Indeed, we demonstrated that although systemicadministration of murine IFN-a in mice has modest depressive-likebehavioral effects and limited action on brain and plasma cyto-kines, as well as central monoamine turnover and levels, these out-comes were markedly augmented when administered following astressor (Anisman et al., 2007). The increased depressive-likebehaviors observed could be due to the elevated cytokine function-ing in brain or downstream effects of these cytokine changes, butthe possibility cannot be dismissed that the stress-IFN-a synergyis attributable to inammatory effects on gut microbial processes,variations of IDO or BDNF, or other as yet unidentied factors. Fur-ther to this same point, hepatitis C and cancer patients are alsoundergoing substantial immunological stress which can be ex-pected to elicit IFN-mediated inammatory reactions resultingthe up-regulation of IFN receptor expression in brain (Wilkinsonet al., 2010). Thus, in the context of this immunological stress, fur-ther administration of IFN-a would be expected to have more pro-found effects than it would otherwise.

There are certainly several limitations to the ndings of thepresent investigation. One that bears particular mention is thatthe effects of IFN-a were assessed only in male mice. Yet, in hu-mans depression occurs 23 times more often in females thanmales, and female rodents typically exhibit a greater glucocorticoidresponse relative to males (Anisman et al., 2008b). Furthermore, itwas reported that in humans a stressor in the form of social exclu-sion following intravenous endotoxin treatment elicited self-re-ported signs of depression. However, in females (but not males)the increased levels of plasma IL-6 elicited by the endotoxin wasassociated with increased social pain and feelings of depressionthat appeared to be mediated by neuronal activity within the dor-sal anterior cingulate cortex and anterior insula (Eisenberger et al.,2009), brain regions that have frequently been linked to majordepressive disorder. Indeed, it has been suggested that social rejec-tion, promoted self-conscious emotions (e.g., humiliation, shame)and negative self-referential cognitions that were mediated bythese brain regions, which might have inuenced HPA functioning,inammatory processes and promotion of depressive disorder(Slavich et al., 2010).

A second limitation of the present investigation, at least with re-spect to its clinical relevance, is that the IFN-awas administered di-rectly into brain as opposed to being administered systemically asin clinical situations. Further to this, the IFN-a treatment wasadministered acutely or involved a limited administration protocol,unlike the lengthy treatment schedule administered clinically totreat hepatitis C or cancer. In fact, it would not be unrealistic to ex-pect that these different treatment schedules and routes of admin-istration might engender neurobiological changes that differedfrom those observed in the present investigation, and might yieldoutcomes, including 5-HT receptor changes, that would be morein line with those hypothesized to be associated withmajor depres-sive disorder. However, the ICV route of administration does havethe potential benet of ensuring the cytokine greater access tohypothalamic neurons than a systemic route. This may be particu-larly important given that IFN-a could directly stimulate CRH re-lease from cultured hypothalamic neurons (Gisslinger et al.,1993); which may help explain differences between our resultsand some previous studies.

5. Conclusionlikely experiencing considerable distress stemming from their

Immunity 31 (2013) 115127Treatment with IFN-a elevates brain cytokines and plasma cor-ticosterone, and could potentially mediate some of the behavioral

Ahern, G.P., 2011. 5-HT and the immune system. Curr. Opin. Pharmacol. 11, 2933.

2008a. Serotonin receptor subtype and p11 mRNA expression in stress-relevant

, andbrain regions of suicide and control subjects. J. Psychiatry Neurosci. 33, 131141.

Anisman, H., Merali, Z., Hayley, S., 2008b. Neurotransmitter, peptide and cytokineprocesses in relation to depressive disorder: comorbidity between depressionand neurodegenerative disorders. Prog. Neurobiol. 85, 174.

Arango, V., Ernsberger, P., Marzuk, P.M., Chen, J.S., Tierney, H., Stanley, M., et al.,1990. Autoradiographic demonstration of increased serotonin 5HT2 and b-adrenergic receptor binding sites in the brain of suicide victims. Arch. Gen.Psychiatry 47, 10381046.

Artigas, F., Romero, L., De Montigny, C., Blier, P., 1996. Acceleration of the effect ofselected antidepressant drugs in major depression by 5-HT1A antagonists.Trends Neurosci. 19, 378383.

Asnis, G.M., De la Garza, R., Kohn, S.R., Reinus, J.F., Henderson, M., Shah, J., 2003. IFN-induced depression: a role for NSAIDs. Psychopharmacol. Bull. 37, 2950.

Basterzi, A.D., Aydemir, C., Kisa, C., Aksaray, S., Tuzer, V., Yazici, K., Gka, E., 2005. IL-6 levels decrease with SSRI treatment in patients with major depression. Hum.Psychopharmacol. 20, 473476.

Beratis, S., Katrivanou, A., Georgiou, S., Monastirli, A., Pasmatzi, E., Gourzis, P.,Tsambaos, D., 2005. Major depression and risk of depressive symptomatologyassociated with short-term and low-dose interferon-alpha treatment. J.Psychosom. Res. 58, 1518.

Bhagwagar, Z., Hinz, R., Taylor, M., Fancy, S., Cowen, P., Grasby, P., 2006. Increased 5-HT(2A) receptor binding in euthymic, medication-free patients recovered fromdepression: a positron emission study with [(11)C]MDL 100,907. Am. J.Psychiatry 163, 15801587.

Bluth, R.M., Michaud, B., Poli, V., Dantzer, R., 2000. Role of IL-6 in cytokine-inducedsickness behavior: a study with IL-6 decient mice. Physiol. Behav. 70, 367373.

Bonaccorso, S., Puzella, A., Marino, V., Pasquini, M., Biondi, M., Artini, M., Almerighi,C., Levrero, M., Egyed, B., Bosmans, E., Meltzer, H.Y., Maes, M., 2001.Immunotherapy with interferon-alpha in patients affected by chronichepatitis C induces an intercorrelated stimulation of the cytokine networkAlbert, P.R., Franois, B.L., 2010. Modifying 5-HT1A receptor gene expression as anew target for antidepressant therapy. Front Neurosci. 4, 35.

Anisman, H., Poulter, M.O., Gandhi, R., Merali, Z., Hayley, S., 2007. Interferon-aeffects are exaggerated when administered on a psychosocial stressorbackdrop: cytokine, corticosterone and brain monoamine variations. J.Neuroimmunol. 186, 4553.

Anisman, H., Du, L., Palkovits, M., Faludi, G., Kovacs, G.G., Szontagh-Kishazi, P., et al.,effects elicited by this cytokine. As central infusion of IFN-a, at adose far below that which would induce any effects if administeredsystemically, suggests that central processes activated by IFN-a areresponsible for the behavioral effects provoked. The cytokinechanges, neuroendocrine upregulation, and serotenergic modica-tions elicited by IFN-a have been observed in studies that involvedits systemic administration or directly into the brain. These nd-ings are consistent with the proposition that systemic IFN-a is ableto cross the BBB or activate peripheral mechanisms that activatecentral processes, including IFN-a in the CNS. Indeed, Raisonet al. (2009) reported that pegylated IFN-a administered peripher-ally leads to increased CSF IFN-a in patients undergoing immuno-therapy, although they were not able to determine whether theIFN-a in the CSF was the exogenous IFN-a or was produced endog-enously following treatment (Raison et al., 2009). Taken together,the present data support a role for IFN-a in the provocation of adepressive-like syndrome that is associated with signicant alter-ations of 5-HT receptors and central cytokine expression. It is likelythat IFN-a driven pro-inammatory consequences are particularlyimportant for the psychomotor and vegetative aspects of depres-sion, and those individuals with pre-existing immune disturbancesor an extensive previous stressor history would be especially vul-nerable to the deleterious effects of IFN-a treatment.

Acknowledgment

The Research was supported by grants to SH and HA from theCanadian Institutes of Health Research, and both hold CanadaResearch Chairs in Neuroscience.

References

S. Hayley et al. / Brain, Behaviorand an increase in depressive and anxiety symptoms. Psychiatry Res. 15, 4555.Brebner, K., Hayley, S., Zacharko, R., Meral, i Z., Anisman, H., 2000. Synergistic

effects of interleukin-1beta, interleukin-6, and tumor necrosis factor-alpha:central monoamine, corticosterone, and behavioral variations. Neuropsy-chopharmacology 22, 566580.

Cai, W., Khaoustov, V.I., Xie, Q., Pan, T., Le, W., Yoffe, B., 2005. Interferon-alpha-induced modulation of glucocorticoid and serotonin receptors as a mechanismof depression. J. Hepatol. 42, 880887.

Capuron, L., Miller, A.H., 2004. Cytokines and psychopathology: lessons frominterferon-alpha. Biol. Psychiatry 1, 819824.

Capuron, L., Gumnick, J.F., Musselman, D.L., Lawson, D.H., Reemsnyder, A., Nemeroff,C.B., et al., 2002a. Neurobehavioural effects of interferon-alpha in cancerpatients: phenomenology and paroxetine responsiveness of symptomdimensions. Neuropsychopharmacology 26, 643652.

Capuron, L., Ravaud, A., Neveu, P.J., Miller, A.H., Maes, M., Dantzer, R., 2002b.Association between decreased serum tryptophan concentrations anddepressive symptoms in cancer patients undergoing cytokine therapy. Mol.Psychiatry 7, 468473.

Capuron, L., Neurauter, G., Musselman, D.L., Lawson, D.H., Nemeroff, C.B., Fuchs, D.,Miller, A.H., 2003. Interferon-alpha-induced changes in tryptophan metabolism.relationship to depression and paroxetine treatment. Biol. Psychiatry 54,906914.

Capuron, L., Ravaud, A., Miller, A.H., Dantzer, R., 2004. Baseline mood andpsychosocial characteristics of patients developing depressive symptomsduring interleukin-2 and/or interferon-alpha cancer therapy.. Brain Behav.Immun. 18, 205213.

Capuron, L., Fornwalt, F.B., Knight, B.T., Harvey, P.D., Ninan, P.T., Miller, A.H., 2009.Does cytokine-induced depression differ from idiopathic major depression inmedically healthy individuals? J. Affect. Disord. 119, 181185.

Craft, T.K., DeVries, A.C., 2006. Role of IL-1 in poststroke depressive-like behavior inmice. Biol. Psychiatry 60, 812818.

Crnic, L.S., Segall, M.A., 1992. Behavioral effects of mouse interferons-alpha and -gamma and human interferon-alpha in mice. Brain Res. 590, 277284.

Curran, B., OConnor, J.J., 2001. The pro-inammatory cytokine interleukin-18impairs long-term potentiation and NMDA receptor-mediated transmission inthe rat hippocampus in vitro. Neuroscience 108, 8390.

Dantzer, R., OConnor, JC., Freund, G.G., Johnson, R.W., Kelley, K.W., 2008. Frominammation to sickness and depression: when the immune system subjugatesthe brain. Nat. Rev. Neurosci. 9, 4656.

Dantzer, R., OConnor, J.C., Lawson,M.A., Kelley, K.W., 2011. Inammation-associateddepression: from serotonin to kynurenine. Psychoneuroendocrinology 36, 426436.

Davis, J.M., Weaver, J.A., Kohut, M.L., Colbert, L.H., Ghaffar, A., Mayer, E.P., 1998.Immune system activation and fatigue during treadmill running: role ofinterferon. Med. Sci. Sports Exerc. 30, 863868.

De La Garza, R 2nd., Asnis, G.M., 2003. The non-steroidal anti-inammatory drugdiclofenac sodium attenuates IFN-alpha induced alterations to monoamineturnover in prefrontal cortex and hippocampus. Brain Res. 4, 7079.

De La Garza, R 2nd., Asnis, G.M., Pedrosa, E., Stearns, C., Migdal, A.L., Reinus, J.F.,Paladugu, R., Vemulapalli, S., 2005. Recombinant human interferon-alpha doesnot alter reward behavior, or neuroimmune and neuroendocrine activation inrats. Prog. Neuropsychopharmacol. Biol. Psychiatry 29, 781792.

Dowlati, Y., Herrmann, N., Swardfager, W., Liu, H., Sham, L., Reim, E.K., Lanctt, K.L.,2010. A meta-analysis of cytokines in major depression. Biol. Psychiatry 67,446457.

Dunn, A.L., Crnic, L.S., 1993. Repeated injections of interferon-alpha A/D in Balb/cmice. Behavioral effects. Brain Behav. Immun. 7, 104111.

Eisenberger, N.I., Inagaki, T.K., Rameson, L.T., Mashal, N.M., Irwin, M.R., 2009. AnfMRI study of cytokine-induced depressed mood and social pain: the role of sexdifferences. Neuroimage 47, 881890.

Felger, J.C., Cole, S.W., Pace, T.W., Hu, F., Woolwine, B.J., Doho, G.H., Raison, C.L.,Miller, A.H., 2011. Molecular signatures of peripheral blood mononuclear cellsduring chronic interferon-a treatment: relationship with depression andfatigue. Psychol. Med. 9, 113.

Franklin, K.B.J., Paxinos, G., 1997. A Stereotaxic Atlas of the Mouse Brain. AcademicPress, San Diego, CA.

Friebe, A., Schwarz, M.J., Schmid-Wendtner, M., Volkenandt, M., Schmidt, F., Horn,M., Janssen, G., Schaefer, M., 2007. Pretreatment levels of sTNF-R1 and sIL-6Rare associated with a higher vulnerability for IFN-alpha-induced depressivesymptoms in patients with malignant melanoma. J. Immunother. 30, 333337.

Fu, X., Zunich, S.M., OConnor, J.C., Kavelaars, A., Dantzer, R., Kelley, K.W., 2010.Central administration of lipopolysaccharide induces depressive-like behaviorin vivo and activates brain indoleamine 2,3 dioxygenase in murine organotypichippocampal slice cultures. J. Neuroinammation 2, 743.

Gibb, J., Hayley, S., Poulter, M.O., Anisman, H., 2011. Effects of stressors and immuneactivating agents on peripheral and central cytokines in mouse strains thatdiffer in stressor responsivity. Brain Behav. Immun. 25, 468482.

Gisslinger, H., Svoboda, T., Clodi, M., Gilly, B., Ludwig, H., Havelec, L., Luger, A., 1993.Interferon-alpha stimulates the hypothalamic-pituitary-adrenal axis in vivoand in vitro. Neuroendocrinol 57, 489495.

Haroon, E., Raison, C.L., Miller, A.H., 2012. Psychoneuroimmunology meetsneuropsychopharmacology: translational implications of the impact ofinammation on behavior. Neuropsychopharmacology 37, 137162.

Hashioka, S., Klegeris, A., Schwab, C., Yu, S., McGeer, P.L., 2010. Differentialexpression of interferon-gamma receptor on human glial cells in vivo andin vitro. J. Neuroimmunol. 225 (12), 9199.

Immunity 31 (2013) 115127 125Hayley, S., Poulter, M.O., Meral, Z., Anisman, H., 2005. The pathogenesis of clinicaldepression: stressor- and cytokine-induced alterations of neuroplasticity.Neuroscience 135, 659678.

andHowren, M.B., Lamkin, D.M., Suls, J., 2009. Associations of depression with C-reactive protein, IL-1, and IL-6: a meta-analysis. Psychosom. Med. 71, 171186.

Hrdina, P.D., Demeter, E., Vu, T.B., Sotonyi, P., Palkovits, M., 1993. 5HT uptake sitesand 5HT2 receptors in brain of antidepressant-free suicide victims/depressives:increase in 5HT2 sites in cortex and amygdala. Brain Res. 614, 3744.

Huang, Y., Smith, D.E., Ibez-Sandoval, O., Sims, J.E., Friedman, W.J., 2011. Neuron-specic effects of interleukin-1b are mediated by a novel isoform of the IL-1receptor accessory protein. Neuroscience 7, 1804818059.

Hulse, R.E., Kunkler, P.E., Fedynyshyn, J.P., Kraig, R.P., 2004. Optimization ofmultiplexed bead-based cytokine immunoassays for rat serum and braintissue. J. Neurosci. Methods 136, 8798.

Kamata, M., Higuchi, H., Yoshimoto, M., Yoshida, K., Shimizu, T., 2000. Effect ofsingle intracerebroventricular injection of alpha-interferon on monoamineconcentrations in the rat brain. Eur. Neuropsychopharmacol. 10, 129132.

Kamm, K., Vanderkolk, W., Lawrence, C., Jonker, M., Davis, A.T., 2006. The effect oftraumatic brain injury upon the concentration and expression of interleukin-1beta and interleukin-10 in the rat. J. Trauma 60, 152157.

Kaneko, N., Kudo, K., Mabuchi, T., Takemoto, K., Fujimaki, K., Wati, H., Iguchi, H.,Kanba, S., Tezuka, H., 2006. Suppression of cell proliferation by interferon-alphathrough interleukin-1 production in adult rat dentate gyrus.Neuropsychopharmacology 31, 26192626.

Katafuchi, T., Kondo, T., Take, S., Yoshimura, M., 2005. Enhanced expression of braininterferon-alpha and serotonin transporter in immunologically induced fatiguein rats. Eur. J. Neurosci. 22, 28172826.

Kawanokuchi, J., Mizuno, T., Takeuchi, H., Kato, H., Wang, J., Mitsuma, N., Suzumura,A., 2006. Production of interferon-gamma by microglia. Multiphase Scler. 12,558564.

Kenis, G., Prickaerts, J., van Os, J., Koek, G.H., Robaeys, G., Steinbusch, H.W., Wichers,M., 2011. Depressive symptoms following interferon-a therapy: mediated byimmune-induced reductions in brain-derived neurotrophic factor? Int. J.Neuropsychopharmacol. 4, 247253.

Khorooshi, R., Owens, T., 2010. Injury-induced type I IFN signaling regulatesinammatory responses in the central nervous system. J Immunol. 185 (2),12581264.

Kraus, M.R., Schfer, A., Al-Taie, O., Scheurlen, M., 2005. Prophylactic SSRI duringinterferon alpha re-therapy in patients with chronic hepatitis C and a history ofinterferon-induced depression. J. Viral Hepat. 12, 96100.

Kraus, M.R., Al-Taie, O., Schfer, A., Pfersdorff, M., Lesch, K.P., Scheurlen, M., 2007.Serotonin-1A receptor gene HTR1A variation predicts interferon-induceddepression in chronic hepatitis C. Gastroenterology 132, 12791286.

Kumai, T., Tateishi, T., Tanaka, M., Watanabe, M., Shimizu, H., Kobayashi, S., 2000.Effect of interferon-alpha on tyrosine hydroxylase and catecholamine levels inthe brain of rats. Life Sci. 30, 663669.

Leonard, B., Maes, M., 2012. Mechanistic explanations how cell-mediated immuneactivation, inammation and oxidative and nitrosative stress pathways andtheir sequels and concomitants play a role in the pathophysiology of unipolardepression. Neurosci. Biobehav. Rev. 36, 764785.

Linthorst, A.C., 2005. Interactions between corticotropin-releasing hormone andserotonin: implications for the aetiology and treatment of anxiety disorders.Handb. Exp. Pharmacol. 169, 181204.

Litteljohn, D., Mangano, E., Shukla, N., Hayley, S., 2009. Interferon-gammadeciency modies the motor and co-morbid behavioral pathology andneurochemical changes provoked by the pesticide paraquat. Neuroscience164, 18941906.

Litteljohn, D., Cummings, A., Brennan, A., Gill, A., Chunduri, S., Anisman, H., Hayley,S., 2010. Interferon-gamma deciency modies the effects of a chronic stressorin mice. Implications for psychological pathology. Brain Behav. Immun. 24,462473.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25,402408.

Loftis, J.M., Hauser, P., 2004. The phenomenology and treatment of interferoninduced depression. J. Affect. Disord. 82, 175190.

Loftis, J.M., Wall, J.M., Pagel, R.L., Hauser, P., 2006. Administration of pegylatedinterferon-alpha-2a or -2b does not induce sickness behavior in Lewis rats.Psychoneuroendocrinology 31, 12891294.

Maes, M., 1995. Evidence for an immune response in major depression: a reviewand hypothesis. Prog. Neuropsychopharmacol. Biol. Psychiatry 19, 1138.

Maes, M., Leonard, B.E., Myint, A.M., Kubera, M., Verkerk, R., 2011. The new 5-HThypothesis of depression: cell-mediated immune activation inducesindoleamine 2,3-dioxygenase, which leads to lower plasma tryptophan andan increased synthesis of detrimental tryptophan catabolites (TRYCATs), both ofwhich contribute to the onset of depression. Prog. Neuropsychopharmacol. Biol.Psychiatry 35, 702721.

Maier, S.F., Nguyen, K.T., Deak, T., Milligan, E.D., Watkins, L.R., 1999. Stress, learnedhelplessness, and brain interleukin-1 beta. Adv. Exp. Med. Biol. 461, 235249.

Makino,M., Kitano, Y., Komiyama, C., Hirohashi,M., Takasuna, K., 2000a. Involvementof central opioid systems in human interferon-alpha induced immobility in themouse forced swimming test. Br. J. Pharmacol. 130, 12691274.

Makino, M., Kitano, Y., Komiyama, C., Hirohashi, M., Kohno, M., Moriyama, M.,Takasuna, K., 2000b. Human interferon-alpha induces immobility in the mouseforced swimming test: involvement of the opioid system. Brain Res. 852, 482484.

Makino, M., Kitano, Y., Komiyama, C., Takasuna, K., 2000c. Human interferon-alpha

126 S. Hayley et al. / Brain, Behavior,increases immobility in the forced swimming test in rats. Psychopharmacology148 (1), 106110.McNutt, M.D., Liu, S., Manatunga, A., Royster, E.B., Raison, C.L., Woolwine, B.J.,Demetrashvili, M.F., Miller, A.H., Musselman, D.L., 2012. Neurobehavioraleffects of interferon-a in patients with hepatitis-C: symptom dimensions andresponsiveness to paroxetine. Neuropsychopharmacology 37, 14441454.

Menzies, R., Phelps, C., Wiranowska, M., Oliver, J., Chen, L., Horvath, E., Hall, N., 1996.The effect of interferon-alpha on the pituitary-adrenal axis. J. InterferonCytokine Res. 16, 619629.

Meyer, J.H., McMain, S., Kennedy, S.H., Korman, L., Brown, G.M., DaSilva, J.N., et al.,2003. Dysfunctional attitudes and 5-HT2 receptors during depression and self-harm. Am. J. Psychiatry 160, 9099.

Miller, A.H., 2009. Norman cousins lecture. Mechanisms of cytokine-inducedbehavioral changes: psychoneuroimmunology at the translational interface.Brain Behav. Immun. 23, 149158.

Miller, A.H., Maletic, V., Raison, C.L., 2009. Inammation and its discontents: therole of cytokines in the pathophysiology of major depression. Biol. Psychiatry65, 732741.

Miyahara, S., Komori, T., Fujiwara, R., Shizuya, K., Yamamoto, M., Ohmori, M.,Okazaki, Y., 2000. Effects of repeated stress on expression of interleukin-6 (IL-6)and IL-6 receptor mRNAs in rat hypothalamus and midbrain. Life Sci. 66, 9398.

Morasco, B.J., Loftis, J.M., Indest, D.W., Ruimy, S., Davison, J.W., Felker, B., Hauser, P.,2010. Prophylactic antidepressant treatment in patients with hepatitis C onantiviral therapy: a double-blind, placebo-controlled trial. Psychosomatics 51,401408.

Musselman, D.L., Lawson, D.H., Gumnick, J.F., Manatunga, A.K., Penna, S., Goodkin,R.S., Goodkin, R.S., Nemeroff, C.B., Miller, A.H., 2001. Paroxetine for theprevention of depression induced by high-dose interferon alfa. N. Engl. J.Med. 344, 961966.

Myint, A.M., 2012. Kynurenines: from the perspective of major psychiatricdisorders. FEBS J. 279, 13751385.

Myint, A.M., Schwarz, M.J., Steinbusch, H.W., Leonard, B.E., 2009. Neuropsychiatricdisorders related to interferon and interleukins treatment. Metab. Brain Dis. 24,5568.

Navins, R., Gmez-Gil, E., Puig, S., Baeza, I., De Pablo, J., Martn-Santos, R., 2009.Depression in hospitalized patients with malignant melanoma treated withinterferon-alpha-2b: primary to induced disorders. Eur. J. Dermatol. 19, 611615.

Nguyen, K.T., Deak, T., Owens, S.M., Kohno, T., Fleshner, M., Watkins, L.R., Maier, S.F.,1998. Exposure to acute stress induce brain interleukin-1b protein in the rat. J.Neurosci. 19, 27992805.

Nishi, K., Kanemaru, K., Diksic, M., 2009. A genetic rat model of depression, Flinderssensitive line, has a lower density of 5-HT(1A) receptors, but a higher density of5-HT(1B) receptors, compared to control rats. Neurochem. Int. 54, 299307.

OConnor, J.C., Andr, C., Wang, Y., Lawson, M.A., Szegedi, S.S., Lestage, J., Castanon,N., Kelley, K.W., Dantzer, R., 2009. Interferon-gamma and tumor necrosis factor-alpha mediate the upregulation of indoleamine 2,3-dioxygenase and theinduction of depressive-like behavior in mice in response to bacillusCalmette-Guerin. J. Neurosci. 29, 42004209.

Orsal, A.S., Blois, S.M., Bermpohl, D., Schaefer, M., Coquery, N., 2008. Administrationof interferon-alpha in mice provokes peripheral and central modulation ofimmune cells, accompanied by behavioral effects. Neuropsychobiology 58,211222.

Pan, W., Banks, W.A., Kastin, A.J., 1997. Permeability of the blood-brain and blood-spinal cord barriers to interferons. J Neuroimmunol. 76 (12), 105111.

Pandey, G.N., Dwivedi, Y., Rizavi, H.S., Ren, X., Pandey, S.C., Pesold, C., et al., 2002.Higher expression of serotonin 5-HT(2A) receptors in the postmortem brains ofteenage suicide victims. Am. J. Psychiatry 159, 419429.

Parnet, P., Kelley, K.W., Bluth, R.M., Dantzer, R., 2002. Expression and regulation ofinterleukin-1 receptors in the brain. Role in cytokines-induced sicknessbehavior. J. Neuroimmunol. 125, 514.

Pascoe, M.C., Crewther, S.G., Carey, L.M., Crewther, D.P., 2011. Inammation anddepression: why poststroke depression may be the norm and not the exception.Int. J. Stroke 6, 128135.

Patten, S.B., 2006. Psychiatric side effects of interferon treatment. Curr. Drug Saf. 1,143150.

Patterson, A.L., Morasco, B.J., Fuller, B.E., Indest, D.W., Loftis, J.M., Hauser, P., 2011.Screening for depression in patients with hepatitis C using the Beck DepressionInventory-II: do somatic symptoms compromise validity? Gen. Hosp. Psychiatry33, 354362.

Raison, C.L., Demetrashvili, M., Capuron, L., Miller, A.H., 2005. Neuropsychiatricadverse effects of interferon-alpha: recognition and management. CNS Drugs19, 105123.

Raison, C.L., Borisov, A.S., Majer, M., Drake, D.F., Pagnoni, G., Woolwine, B.J., Vogt,G.J., Massung, B., Miller, A.H., 2009. Activation of central nervous systeminammatory pathways by interferon-alpha: relationship to monoamines anddepression. Biol. Psychiatry 65, 296303.

Raison, C.L., Rye, D.B., Woolwine, B.J., Vogt, G.J., Bautista, B.M., Spivey, J.R., Miller,A.H., 2010. Chronic interferon-alpha administration disrupts sleep continuityand depth in patients with hepatitis C: association with fatigue, motor slowing,and increased evening cortisol. Biol. Psychiatry 68, 942949.

Rivest, S., 2009. Regulation of innate immune responses in the brain. Nat. Rev.Immunol. 9, 429439.

Sammut, S., Bethus, I., Goodall, G., Muscat, R., 2002. Antidepressant reversal ofinterferon-alpha-induced anhedonia. Physiol. Behav. 75, 765772.

Immunity 31 (2013) 115127Sari, Y., 2004. Serotonin1B receptors: from protein to physiological function andbehavior. Neurosci. Biobehav. Rev. 28, 565582.

Sen, S., Duman, R., Sanacora, G., 2008. Serum brain-derived neurotrophic factor,depression, and antidepressant medications: meta-analyses and implications.Biol. Psychiatry 64, 527532.

Shelton, R.C., Sanders-Bush, E., Manier, D.H., Lewis, D.A., 2009. Elevated 5-HT 2Areceptors in postmortem prefrontal cortex in major depression is associatedwith reduced activity of protein kinase A. Neuroscience 158, 14061415.

Shuto, H., Kataoka, Y., Horikawa, T., Fujihara, N., Oishi, R., 1997. Repeated interferon-alpha administration inhibits dopaminergic neural activity in the mouse brain.Brain Res. 747, 348351.

Slavich, G.M., ODonovan, A., Epel, E.S., Kemeny, M.E., 2010. Black sheep get theblues: a psychobiological model of social rejection and depression. Neurosci.Biobehav. Rev. 35, 3945.

Spalletta, G., Boss, P., Ciaramella, A., Bria, P., Caltagirone, C., Robinson, R.G., 2006.The etiology of poststroke depression: a review of the literature and a newhypothesis involving inammatory cytokines. Mol. Psychiatry 11, 984991.

Stoll, G., Jander, S., Schroeter, M., 1998. Inammation and glial responses inischemic brain lesions. Prog. Neurobiol. 56, 149171.

Trask, P.C., Paterson, A.G., Esper, P., Pau, J., Redman, B., 2004. Longitudinal course ofdepression, fatigue, and quality of life in patients with high risk melanomareceiving adjuvant interferon. Psychooncology 13, 526536.

Underwood, M.D., Kassir, S.A., Bakalian, M.J., Galfalvy, H., Mann, J.J., Arango, V.,2011. Neuron density and serotonin receptor binding in prefrontal cortex insuicide. Int. J. Neuropsychopharmacol. 9, 113.

Wan, Q., Wang, X., Wang, Y.J., Song, L., Wang, S.H., Ho, W.Z., 2008. Morphinesuppresses intracellular interferon-alpha expression in neuronal cells. J.Neuroimmunol. 199, 19.

Wichers, M.C., Kenis, G., Leue, C., Koek, G., Robaeys, G., Maes, M., 2006. Baselineimmune activation as a risk factor for the onset of depression during interferon-alpha treatment. Biol. Psychiatry 60, 7779.

Wichers, M.C., Kenis, G., Koek, G.H., Robaeys, G., Nicolson, N.A., Maes, M., 2007.Interferon-alpha-induced depressive symptoms are related to changes in thecytokine network but not to cortisol. J. Psychosom. Res. 62, 207214.

Wilkinson, J., Radkowski, M., Eschbacher, J.M., Laskus, T., 2010. Activation of brainmacrophages/microglia cells in hepatitis C infection. Gut 59, 13941400.

Yamada, T., Yamanaka, I., 1995. Microglial localization of alpha-interferon receptorin human brain tissues. Neurosci. Lett. 189, 7376.

Yirmiya, R., Pollak, Y., Barak, O., Avitsur, R., Ovadia, H., Bette, M., Weihe, E.,Weidsenfeld, J., 2001. Effects of antidepressant drugs on the behavioral andphysiological responses to lipopolysaccharide (LPS) in rodents.Neuropsychopharmacology 24, 531544.

Zhu, Y., Saito, K., Murakami, Y., Asano, M., Iwakura, Y., Seishima, M., 2006. Earlyincrease in mRNA levels of pro-inammatory cytokines and their interactions inthe mouse hippocampus after transient global ischemia. Neurosci. Lett. 393,122126.

S. Hayley et al. / Brain, Behavior, and Immunity 31 (2013) 115127 127

Central administration of murine interferon- in1 Introduction2 Materials and methods2.1 Subjects2.2 Surgery2.3 Blood collection and brain removal2.4 Plasma corticosterone determination2.5 High performance liquid chromatography (HPLC) assay2.6 Reverse transcription-quantitative polymerase chain reaction analysis in brain2.7 Experiment 1: acute infusion of IFN-2.8 Experiment 2: repeated infusion of IFN-2.9 Experiment 3: sucrose consumption following 2.10 Experiment 4 and 5: intra-PFC infusion of I2.11 Experiment 6 and 7: intra-raphe infusion of2.12 Statistical analyses

3 Results3.1 Experiment 1. Locomotor activity, sickness b3.2 Cytokine mRNA expression3.3 Serotonin receptor mRNA expression3.4 Experiment 2. Effects of repeated IFN- admi3.4.1 Sickness behavior3.4.2 Plasma corticosterone3.4.3 Cytokine mRNA expression3.4.4 Serotonin receptor mRNA expression

3.5 Experiment 3. Anhedonia following repeated a3.6 Experiments 47: intra-PFC and intra-DRN infusion of IFN-a

4 Discussion4.1 Cytokine variations in brain induced by IFN-4.2 Serotonergic alterations in the brain follow4.3 Alternative mechanisms of IFN- induced depr

5 ConclusionAcknowledgmentReferences