HLA-DP antigen and Takayasu arteritis

HLA-DP antigen and Takayasu arteritis R.-P. Dong, A. Kimura, F. Numano, M. Yajima, Y. Hashimoto, Y. Kishi, Y. Nishimura, T. Sasazuki. HLA-DP antigen and Takayasu arteritis. Tissue Antigens 1992: 39: 106-1 10.

Abstract: Sixty-four patients with Takayasu arteritis and 3 17 healthy individuals in the Japanese population were examined for HLA-A, -B and -C alleles by serological typing and for HLA-DRY DQ and DP alleles by DNA typing using PCR/SSOP analysis. The frequencies of HLA- Bw52, DRB1*1502, DRB5*0102, DQA1*0103. DQB1*0601 and DPB 1 *090 1 alleles were significantly increased and the frequencies of HLA- Bw54, DRB1*0405, DRB4*0101, DQA1*0301, DQB1*0401 alleles were significantly decreased. Strong linkage disequilibria among the increased alleles and among the decreased alleles were evident in the Japanese population. Therefore, the combination or haplotype of HLA-Bw52-

DPB 1 *090 1 may confer susceptibility to Takayasu arteritis while another combination or haplotype of HLA-Bw54-DRB 1 *0405-DRB4*0101- DQA 1 *030 1 -DQB 1 *040 1 may confer resistance to the disease. Because this is the first evidence for the association between an HLA-DP allele and Takayasu arteritis, we examined the nucleotide sequences of the DPB1*0901 allele from a patient and her healthy relatives and found no difference. The disease is therefore not caused by a mutated DPBl gene.

DRB 1 * 1502-DRB5*0 102-DQA1*0103-DQB1*0601-DPA1*02-

Introduction

Takayasu arteritis is a chronic inflammatory arteri- opathy of unknown origin and is prevalent in women. Genetic factor(s) may possibly be involved in the etiology of Takayasu arteritis because of the relatively high incidence in Asian and South American countries (1, 2), and data on multiplex families with the disease (3-6) have been reported. Several investigators including ourselves noted the association between Takayasu arteritis and HLA class I and class I1 alleles in Japanese. HLA-Bw52, Dw12 (DHO), DR2 and DQw1 (MBI) were found in serological and cellular HLA typing to be associated with Takayasu arteritis (7-9). There was a statistically significant increase in the frequency of DQA Taq 16.6 Kb fragment associated with DQw6 (a split of DQwl) in these patients (10).

Molecular and genetic analysis of HLA class I1 polymorphism has been facilitated using the polymerase chain reaction (PCR) (1 1-13). PCR/sequence-specific oligonucleotide (SSOP) analysis re- veals not only that two alleles are different but how they differ, thereby allowing for a precise identification of individual alleles or polymorphic residues that are critical for disease susceptibility and resistance (14, 15).

We investigated 64 Japanese patients and a fam-

Rui-Ping Dong, Akinori Kimura, Fujio Numano', Michiyoshi Yajima', Yuji Hashimoto', Yukio Kishi', Yasuharu Nishimura and Takehiko Sasazuki The Department of Genetics, Medical Institute of Bioregulation, Kyushu University, Fukuoka and *The Third Department of Internal Medicine, Tokyo Medical and Dental University, Tokyo, Japan

Key words: HLA - genetic susceptibility - polymerase chain reaction - sequencespecific oligonucleotide probe - Takayasu arteritis

Received 7 November, accepted for publication 30 December 1991

ily with Takayasu arteritis for class I genes by serological typing and for class I1 (DRB1, DRB3, DRB4, DRBS, DQA1, DQBl, DPAl and DPB1) genes by DNA typing, using PCR/SSOP analysis. We observed a positive association between the HLA-DPB1*0901 allele and Takayasu arteritis. We sequenced the DPBl genes from 1 patient and her healthy relatives to determine whether or not the patient's DPBl allele is identical to a normal DPB1*0901 allele.

Material and methods Patients

Sixty-four unrelated Japanese patients with Takay- asu arteritis and one family with affected twins were the subjects investigated. The diagnosis was made on the basis of criteria set by the aortitis research group, Ministry of Health and Welfare, Japan (1 6). Healthy control subjects were 3 17 Japa- nese selected at random.

Serological typing

A standard complement-dependent microlympho- cytotoxicity assay (17) and a panel of highly selected alloantisera were used to identify HLA-A, -B and -C antigens.

106

HLA and Takayasu arteritis

removed any probes that had one or more mismat- ches with the target sequence. Autoradiography was done for 10 rnin to 1 h at room temperature with Kodak XAR5 film (Eastman Kodak).

DNA extraction and polymerase chain reaction (PCR)

DNA was extracted from peripheral granulocytes of each subject using standard techniques (1 8). Genomic DNA was subjected to PCR in 10 mM Tris-HC1 (pH 8.4 at 24"C), 50 mM KC1, 0.1 mg/ ml gelatin, 0.02% NP40 and 1.5 or 2.0 mM MgClz (see below) to amplify the second exons of DRBI, DRB3, DRB4, DRB5, DQAl, DQB1, DPAl or DPB 1 gene, using thermostable DNA polymerase (Ampli Taq, Perkin Elmer Cetus). The primers are shown in Table 1. Amplification of the DRB genes was done using AKRBPl and AKRBP2. Group- specific amplifications of DRBI gene were made for DRl group with AKRBP2 and AKRBP3, for DR2 group with AKRBP2 and AKRBP4, for DR4 group with AKRBP2 and AKRBP5, and for DRw52-associated- (DR3, 5, 6, w8) group with AKRBP2 and AKRBP6. Locus-specific amplification of DRB3 gene was done using AKRBP2 and AKRBP7, and that of DRB5 gene was done using AKRBP2 and AKRBP8. DQAl, DQB1, DPA1, and DPBl genes were amplified using AKQAP1 and AKQAP2, AKQBPl and AKQBP2, AKPAPI and AKPAP2, and AKPBPl and AKPBP2, respectively. The denaturation, an- nealing and extension step for each 1 rnin was from 96°C to 55°C to 72°C in condition A and from 96°C to 60°C to 72°C in condition B. The concen- tration of MgCl, was 1.5 mM in condition A or 2.0 mM in condition B. Five hundred nanograms of DNA were subjected to 30 cycles of amplification with a thermal cycler (Perkin Elmer Cetus).

Dot blot analysis with sequence-specific oligonucleotides (SSOS)

The amplified DNAs were spotted onto a nylon membrane (Hybond N plus, Amersham) and im- mobilized by alkaline denaturation in 0.4 N NaOH and subsequent baking at 80°C for 1 h. Filters were prehybridized for 1 h at 54°C in 10 ml of hybridization buffer composed of 50 mM Tris-HC1 (pH KO), 3.0 M tetramethylammonium chloride, 2 mM EDTA (pH 8.0), 5 x Denhardt's solution, 0.1% SDS and 100 pg/ml heat-denatured herring sperm DNA. HLA class I1 probes (19) were labelled with [y-32p]-ATP (ICN Biomedicals Inc.), using T4 po- lynucleotide kinase (TOYOBO co. Ltd.). After hybridization with labelled probes at 54°C for 1 h, the filters were washed twice for 5 min each at room temperature in 2 x SSPE and 0.1 % SDS with constant gentle agitation, once for 10 min at room temperature in TMAC solution [50 mM Tris-HC1 (pH 8.0), 3.0 M tetramethylammonium chloride, 2 mM EDTA and 0.1% SDS] and twice for 15 rnin at 58 to 60°C in TMAC solution. The procedure

DNA sequencing analysis

To search for a mutation in the DPBl genes which would be associated with Takayasu arteritis, we amplified the second exon of DPBl gene from a patient (7 in Fig. l), her healthy parents (1 and 2 in Fig. l), her healthy sister (6 in Fig. l), and one in-law (3 in Fig. 1) and cloning into the bluescript vector was done. At least four independent clones were selected and sequenced by the dideoxynucleo- tide chain-termination method (20).

Statistical analysis

The frequencies of HLA-A, -By -C, DRB1, DRB3, DRB4, DRB5, DQA1, DQBl, DPAl and DPBl alleles in 64 patients with Takayasu arteritis were compared with those in 3 17 healthy unrelated Japanese controls. Strength of the statistical association between Takayasu arteritis and genetic markers was expressed by the relative risk (R.R.) as given by Woolf (21) and the statistical significance was examined by chi-square test with Yates' correction. The corrected p value (pc) was calcu- lated by multiplying the p value (p) by 154 - the number of alleles tested at HLA class I and class I1 loci. Linkase disequilibrium was estimated ac- cording to the method of Mittal (22).

Results Frequencies of HLA class I alleles

The frequencies of HLA-A and -C specificities did not differ significantly between patients and controls. Among the HLA-B specificities tested, the frequency of Bw52 was significantly increased; this antigen was positive in 53.1% of the patients and in 24.0"/0 of the controls (p < 0.00001; R.R. = 3.59). This confirmed our previous findings (7). The frequency of B39 was also significantly increased (10.9Y0 vs 4.4%; p < 0.05; R.R. =2.66). On the other hand, the frequencies of B51 (1.6% vs 13.20/0; ~ ~ 0 . 0 2 ; R.R.=0.10) and Bw54 (3.1% vs 13.9%; p < 0.04; R.R. = 0.20) were significantly decreased. When pc correction was applied, the association with Bw52 in the patients remained (pc < 0.002) while that with B39, B51 and Bw54 lost statistical significance.

Frequencies of HLA class I1 alleles

As shown in Table 2 the frequencies of HLA class I1 alleles in the 64 patients were compared with

107

Dong et al.

1 2n3 plied, only the DRB 1 * 1502 (pc < 0.05), DRB5* 0102 (pc<0.05) and DPB1*0901 (pc<0.02) remained and the other alleles in the patients lost statistical significance.

' q - 9 a l b 9 A** a / c a / c a / d a / c / a / c

Sequencing analysis of the DPBl gene

The nucleotide sequences of the second exon of DPBl gene were analyzed in 1 patient and her 3 healthy relatives. The patient was the individual from whom the lymphoblastoid cell line, EB-AKI- BA, had been established. This cell line had been reported to carry an unique DPBl allele (23). Dur- ing the preparation of this manuscript, the DPBl gene from the AKIBA cell line was re-analyzed and was found to be identical to the DPB1*0901 sequences (24). We have confirmed this result. The nucleotide sequence of DPB1*0901 allele that was associated with the disease in these individuals was identical to that reported for the DPB1*0901 allele by Bugawan et al. (24). No mutation was observed in the patient's DPBl allele. Thus, the autoimmune process in Takayasu arteritis is not due to a mutant DPB 1 *090 1 allele.

haplotype Br DRB1* DRB4* DR85* DQAl* DQBl* DPAl* a and C : 52 1502 ---- 0102 0103 0601 02

0301 0303 01 0301 0302 02

b: -- 0901 0101 ---- d: -- 0403 0101 ----

DPB1' 0901 0201 0501

Figure 1. Pedigree of a multiplex case family with Takayasu arteritis and segregation analysis of parental HLA haplotypes, a, b, c and d. a and b; paternal haplotypes, c dnd d; maternal haplotypes; a and c haplotypes are identical. Closed symbols; Takayasu arteritis, open symbols; healthy persons. The designations of HLA class I1 alleles are those of the official No- menclature Committee (WHO Nomenclature Committee 1991). Dashes indicate blank.

findings in 3 I7 healthy, unrelated controls. Positive associations between HLA and Takayasu arteritis were observed with DRB 1 * I502 (46.9% vs 24.0%; p < 0.0003; R.R. =2.80), DRB5*0102 (46.9% vs 24.0%; p<0.0003; R.R.=2.80), DQA1*0103 (59.4% vs 39.1'Yo; p < 0.004; R.R. = 2.27), DQB1*0601 (57.8% vs 38.8%; p<0.006; R.R.= 2.16) and DPB1*0901 (43.8% vs 20.50/0; p<O.OOOI; R.R.=3.02). On the other hand, negative associations were observed with DRB1*0405 (10.9Y0 vs 28.00/; ~(0.006; R.R. =0.31), DRB4*0101 (50.0% vs 63.7%; p < 0.05; R.R. = 0.57), DQAl*0301 (53.1% vs 68.1%; p<0.03; R.R.=0.53) and DQB1*0401 (10.9% vs 27.8%; p < 0.006; R.R. = 0.32). An increase of DPA1*02 (90.6% vs 84.9%) was not significant. When pc correction was ap-

Discussion

Functional HLA class I1 consists of DR, DQ and DP loci, and a positive association between Takay- asu arteritis and the HLA-Bw52-DR2-Dw12 (DH0)-DQw1 (MB1) haplotype was noted by serological typing and restriction fragment length polymorphism (RFLP) analysis of DQ genes

Table 2. Association between Takayasu arteritis and HLA class II alleles in the Japanese

HLA Patients Controls Relative alleles# N=64 N=317 risk X2' P'

Table 1. Oligounclectide primers for amplification of HLA class II genes

DRBl' 1502 0405

DRBC 01 01

DRBS 01 02

DQA1' 01 03 0301

DQBl' 0601 0401

DPB1' 0901

Gene Name Sequence 5' to 3 Condition" 46.9% 10.9

50.0

24.0% 28.0

63.7

2.80 14.21 0.31 8.30

0.57 4.23

c 0.0003 < 0.006

< 0.05

ORB1 AKRBP1 AKRBP2

DRBl-OR1 AKRBP3 DRBl-DR2 AKRBP4 DRB1-DR4 AKRBP5

DR83 AKRBP7 OR85 AKRBPB DQAl AKQAP1

AKQAPZ DQBl AKQBP1

AKQBP2 OPA1 AKPAPl

AKPAP2 OPE1 AKPBP1

AKPBP2

DRB1-DR3, 5, 6, 8AKRBP6

CCCCACAGCACGmCTTG CCGCTGCACTGTGAAGCTCT TrCTTGTGGCAGCllAAGTT TTCCTGTGGCAGCCTAAGAGG GlllCTTGGAGCAGGlTA AAC CACGmCTTGGAGTACTCTAC CCCAGCACGTTClTGGAGCT CAGCACGllTCllGCAGCAGGA ATGGTGTMACTTGTACCAGT 'ITGGTAGCAGCGGTbGAGlTG CATGTGCTACTEACCAACGG CTGGTAGTTGTGTCTGCACAC GCGG ACCATGTGTGTCMCTAT GCCTGAGTGTGGTTGGAACG GAGAGTGGCGCCTCCGCTC AT GCCGGCCCAAAGCCCTC ACTC

A

46.9 24.0 2.80 14.21 < 0.0003

59.4 53.1

39.1 68.1

2.27 8.94 0.53 5.32

< 0.004 < 0.03

57.8 10.9

38.8 27.8

2.1 6 7.90 0.32 8.05

< 0.006 < 0.006 A

A 43.8 20.5 3.02 15.59 < 0.0001

# The allele designations are those of the offical Nomenclature Committee (WHO Nomenclature Committee 1991).

The statistical significance of the association between HLA and disease was determined by chi-square analysis with Yates' correction.

B

** Conditions for PCR are dscribed in Material and methods.

108

HLA and Takayasu arteritis

itis may be: 1) The combination of two or more of

0103, DQB1*0601, DPAl*02 and DPB1*0901 alleles; 2) An unidentified gene(s) in strong linkage disequilibrium with the HLA-Bw52-DRB 1 * 1502-

DPBl*O901 haplotype. On the other hand, the frequencies of Bw54,

DRB1*0405, DRB4*0101, DQA1*0301 and DQB1*0401 were significantly decreased in patients with Takayasu arteritis. DRBl*0405-DRB4 *010 1 haplotype is in linkage disequilibrium with Bw54 (t=4.13) and DQA1*0301-DQB1*0401 haplotype (t = 1 1.9) in the Japanese population. This would suggest that the Bw54-DRBI *04O5- DRB4*O 10 1 -DQA 1 *030 1 -DQB 1 *040 1 haplotype confers resistance to Takayasu arteritis.

Amino acids at a particular position on HLA class I1 molecules were found to be associated with IDDM (25) and RA (26). We identified HLA class I1 alleles from patients with Takayasu disease, but found no particular epitope (or amino acid) primarily associated with the disease. The existence of trans-DQ u/P dimers has also been noted in patients with celiac disease (27) and SLE (28). Some trans-dimers may be more common than heretofore believed and certain combinations may be involved in autoantibody expression (29). In our study, no specific trans-DQ a / p dimers could be postulated for Takayasu arteritis.

In summary, the HLA-Bw52-DRB 1 * 1502-

DPB 1 *090 1 haplotype was identified as being responsible for the susceptibility to Takayasu arteritis and the Bw54-DRB1*0405-DRB4*0101-DQA1* 030 1-DQB 1 *040 1 haplotype may control resistance to this disease.

HLA-Bw52, DRB1*1502, DRB5*0102, DQAl*

DRB5*010ZDQAl *O 103-DQB1*0601-DPA1*02-

DRBS*O 102-DQA1*0103-DQBI *0601-DPA 1 *02-

(7-10). In the present work, HLA-DRB1, DRB3, DRB4, DRBS, DQA1, DQB1, DPAl and DPBl alleles were directly assigned at the DNA level, so that the HLA class I1 alleles, including HLA-DP associated with Takayasu arteritis, could be pre- cisely identified. We especially asked whether the HLA-DP locus could be associated with the susceptible gene.

Among the genetic markers tested, the frequencies of HLA-Bw52, DRB1*1502, DRB5*0102, DQA1*0103, DQB1*0601 and DPB1*0901 were significantly increased in the patients. The DQAl *O 103 and DQBl"O601 alleles encode for the alpha and beta chain of the DQw6 (a split of DQwl) molecule, respectively. DRBl * 1502- DRB5*0102 (DR2-Dw12) is in strong linkage disequilibrium with DQw6 (DQA1*0103-DQBl* 060 1). Therefore; the increased frequencies of

0103, and DQB1*0601 alleles in Takayasu arteritis were consistent with the increase in frequency of

haplotype determined by serological typing and RFLP analysis. Because DPAl*02-DPB 1 *090 1 is in linkage disequilibrium with DRB 1 * 1502 (t = 8.75) and with HLA-Bw52 (t = 8.21) in the Japa- nese population, it is likely that DPAl*O2- DPB1*0901 is also in linkage disequilibrium with the HLA-BwS2-DRBI*1502-DRB5*0102-DQAl *0103-DQB 1 *060 1 haplotype. This observation strongly suggests that the HLA-Bw52-DRBI *

*02-DPB 1 *0901 haplotype controls susceptibility to Takayasu arteritis in the Japanese population. The existence of HLA-Bw52-DRB 1*1502-DRB5*

090 1 haplotype was also confirmed by examination of DNAs from family members with Takayasu disease (Fig. 1). Thus, the combination of these alleles associated with the susceptibility to Takayasu arteritis was extended to the HLA-DP locus.

With regard to the locus which is responsible for Takayasu arteritis, we could exclude the DQ locus by the following reasoning. Due to strong linkage disequilibria between the HLA-DR and DQ alleles, the HLA-DQAI *0103-DQB1*0601 haplotype is in complete association with DRB 1 * 1502 and DRBI *0803 alleles in the Japanese population (t = 10.1 and 7.80, respectively). However, the frequency of the DRB1*0803-DQA1*0103-DQB1* 060 1 haplotype did not differ significantly between the patients and controls (p> 0.05, R.R. =0.88). This would imply that DQA1*0103 and DQB1* 0601 alone were not the major susceptible alleles for Takayasu arteritis.

From these observations, we suggest that the gene(s) controlling susceptibility to Takayasu arter-

HLA-Bw52, DRBl*1502, DRB5*0102,. DQAl*

HLA-Bw52-DR2-Dwl2 (DH0)-DQwl (MB 1)

1502-DRB5*0102-DQAI*0103-DQB1*0601-DPAI

0 102-DQAI *O 103-DQB I *060 1 -DPA 1 *02-DPB 1 *

Acknowledgments

We thank M. Ohara for critical reading the manuscript. This work was supported in part by Grants- in-aid (01480192 and 02304037) from the Ministry of Education, Science and Culture, Japan, and by a research grants from the Ministry of Health and Welfare, Japan, and Naito Memorial Foundation.

References

1 . Herrera EL, Torres GS, Marchushamer J, Honvitz S, Vela JE. Takayasu's arteritis, clinical study of 107 cases. Am Heart J 1977 93: 94-104.

2. Ishikawa K. Natural history and classificatidn of occlusive thromboaortopathy (Takayasu's disease). Circulation 1978: 57: 27-35.

3. Numano F, Isohisa I, Kishi U, Arita M, Maezawa H. Takayasu's disease in twin sisters - possible genetic factors. Cirnilation 1978: 58: 173-7.

109

Dong et al.

4. Makino N, Senda Y, Yamaguchi Y. Takayasu‘s disease in two brothers: Analysis of HLA types. Br Heart J 1981: 46:

5. Enomoto S, Iwasaki Y, Bannai S, et al. Takayasu’s disease in twin sisters. Jpn Heart J 1984: 25: 147-2.

6. Kodama K, Kida 0, Morotomi K, Tanaka K. Male siblings with Takayasu’s arteritis suggest genetic etiology. Heart and Vessels 1986: 2: 51-4.

7. Isohisa I, Numano F, Maezawa H, Sasazuki T. HLA-Bw52 in Takayasu disease. Tissue Antigens 1978: 12: 246-8.

8. Sasazuki T, Ohta N. Isohisa I, Numano F, Maezawa H. Association between Takayasu disease and HLA-DHO. Tissue Antigens 1979: 14: 177-8.

9. Moriuchi J, Wakisaka A, Aizawa M, et at. HLA-iinked susceptibility gene of Takayasu disease. Hum Imrnunol1982:

10. Takeuchi Y, Matsuki K, Saito Y, Sugimoto T, Juji T. HLA- D region genomic polymorphism associated with Takaya- su’s arteritis. Angiology 1990: 41: 421-6.

11. Saiki RK, Bugawan TL, Horn GT, Mullis KB, Erlich HA. Analysis of enzymatically amplified P-globin and HLA DQa DNA with allele specific probes. Nature 1986: 324:

12. Mullis KB, Faloona F. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Merhods Enzym- ol 1987: 155: 335-50.

13. Saiki RK, Gelfand DH, Stoffel S, et al. Primer-directed enzymatic amplification of DNA with thermostable DNA polymerase. Science 1988: 239: 487-91.

14. Erlich HA, Bugawan TL. HLA DNA typing. In: Innis MA, Gelfand DH. Sninsky JJ, White TJ, eds. PCR protocols. New York: Academic Press, 1990: 261-71.

15. Sasazuki T. Nishimura Y, Muto M, Ohta N. HLA-linked eenes controlling the immune response and disease suscepti- iility. Inoiiirna/ ~ e v 1983: 70: 51-75.

16. Committee report: Clinical and pathological studies of Takayasu’s disease. A report by the Ministry of Health and welhre, Japan. 1975.

17. Terasaki PL. McClelland JD. Microdroplet assay of human serum cytotoxins. Nature 1964 204: 998-1000.

18. Sambrook J. Fritsch EF, Maniatis TM. Molecular cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor: Cold Spring Harbor Laboratory, 1989: 916-23.

19. Kimura A, Dong RP, Sasazuki T. Structural analysis of HLA class I1 genes in Japanese population. Proc Ann Sci Meeting ASEATTA 1990: 54-66.

446-8.

4 87-91. ,

163-6.

20. Sanger F, Nicklen S, Cludon AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci 1977: 74:

21. Woolf B. On estimating the relation between blood group and disease. Ann Hum Genet 1955: 19: 251-3.

22. Mittal KK. The HLA polymorphism and susceptibility to disease. Vox Sang 1976: 31: 161-3.

23. Ando A, Inoko H, Kimura M, Ogata S, Tsuji K. Isolation and allelic polymorphism of cDNA clones and genomic clones of HLA-DP heavy and light chains. Hum Immunol 1986: 1 7 355-67.

24. Bugawan TL, Begovich AB, Erlich HA. Rapid HLA-DPB typing using enzymatically amplified DNA and nonra- dioactive sequence-specific oligonucleotide probes. Immun- ogenetics I990 32: 23 1-4 I.

25. Todd JA, Bell JI, McDevitt HO. HLA-DQP gene contrib- utes to susceptibility and resistance to insulin-dependent diabetes mellitus. Nature 1987: 329: 599-604.

26. Rsnningen KS, Spurkland A, Egeland T, Iwe E, Munthe F. Rheumatoid arthritis may be primarily associated with HLA-DR4 molecules sharing a particular sequence at residues 67-74. Tissue Antigens 1990: 36: 23540.

27. Sollid LM, Markussen G, Johan EK, Gjerde H, Vartdal F, Thorsby E. Evidence for a primary association of celiac disease to a particular HLA-DQalP heterodimer. J E . u ~ Med 1989: 169: 345-50.

28. Reinharz D, Tiercy JM, Mach B, Jeannet M. Absence of DRw15/3 and of DRwl5/7 heterozygotes in Caucasian patients with systemic lupus erythematosus. Tissue Antigens 1991: 37 10-5.

29. Harley JB, Reichlin M. Arnett FC, Alexander EL, Bias WB, Provost TT. Gene-interaction of HLA-DQ enhances autoantibody production in primary Sjogren‘s syndrome. Science 1986: 232: I 145-7.

5463-7.

Address: 7: Smcixki, M. D. Department of Genetics Medical Institute of Bioregulation Kyushu University 3-1-1 Maidashi, Higashi-ku Fukuoka 812 Japan (Fax: 8 1-92-632-01 50)

110

Documents

HLA-DP antigen and Takayasu arteritis