Hong Kong Baptist University

DOCTORAL THESIS

Redox control of the transcriptional response to oxidative stress byArabidopsis redox-sensitive basic leucine zipper protein 68Li, Yimin

Date of Award:2016

Link to publication

General rightsCopyright and intellectual property rights for the publications made accessible in HKBU Scholars are retained by the authors and/or othercopyright owners. In addition to the restrictions prescribed by the Copyright Ordinance of Hong Kong, all users and readers must alsoobserve the following terms of use:

• Users may download and print one copy of any publication from HKBU Scholars for the purpose of private study or research • Users cannot further distribute the material or use it for any profit-making activity or commercial gain • To share publications in HKBU Scholars with others, users are welcome to freely distribute the permanent URL assigned to thepublication

Download date: 19 Feb, 2022

i

Redox Control of the Transcriptional Response to Oxidative

Stress by Arabidopsis Redox-sensitive BASIC LEUCINE ZIPPER

PROTEIN 68

LI Yimin

A thesis submitted in partial fulfillment of the requirements

for the degree of

Doctor of Philosophy

Principal Supervisor: Prof. XIA Yiji

Hong Kong Baptist University

June 2016

ii

Declaration

I hereby declare that this thesis represents my own work which has been done

after registration for the degree of PhD at Hong Kong Baptist University, and has

not been previously included in a thesis or dissertation submitted to this or any

other institution for a degree, diploma or other qualifications.

Signature: _ _

Date: June 2016

iii

Abstract

Cellular redox states mediate various physiological and developmental processes.

Mechanisms involved in sensing cellular redox state and linking it to an

appropriate physiological response remains poorly understood in plants.

Arabidopsis bZIP68 was previously found to undergo reversible oxidation in its

Cys320 in cells under oxidative stress. In this study, it was found that bZIP68 was

localized in the nucleus in Arabidopsis seedlings under normal conditions. Upon

treatment of oxidative stress, bZIP68 underwent nucleocytoplasmic shuttling and

accumulated in the cytoplasm. This stress-dependent nucleocytoplasmic shuttling

depends on the redox-sensitive Cys320 and its nuclear export signal. bZIP68

suppresses expression of stress response genes under normal conditions and its

loss-of-function mutation of bZIP68 leads to elevated expression of genes

involved in oxidative stress defense including genes encoding for antioxidant

proteins and for enzymes involved in biosynthesis of small molecule antioxidants.

The bzip68 mutant also showed enhanced responses to stress treatment such as the

oxidative stress and cold stress. Our study suggests that bZIP68 directly or

indirectly senses perturbation of cellular redox states and links the redox change

to activation of oxidative stress defense genes through redox regulation of

transcription.

iv

Acknowledgements

In the first place I wish to give my deepest gratitude to my principal supervisor,

Prof. XIA Yiji. I am deeply grateful to him for detailed discussions on my project

and experimental plans. I would never have been able to finish my thesis without

his support. I remember that he used to say something like “there is no easy

experiment that can lead to significant findings without solid training, full

dedication, persistence and patience.” which encouraged me when I was in

difficulty. I hope that one day I would become as good as an advisor to my

students as Prof. Xia has been to me.

I am grateful to Prof. Jiang Liwen and his student Dr. Wang Juan and Dr.

Ding Yu for the help during the time when I did the experiments in CUHK. I

would like to thank Dr. Ng Danny Wang Kit for serving as my co-supervisor.

I am grateful to Dr. Liu Changjun and Prof. Jiang Liwen for serving as

external examiners of the thesis and their suggestion to improve the thesis. I

would also like to thank Prof. Zhao Zhongying, Prof. Ricky M S Wong, Prof.

Chris K C Wong, and Prof. Nai Ki Mak on oral examination board.

I would like to express my sincere gratitude to my colleagues Dr. Liu Pei,

Miss. Zhong Huan and Mr. Zhang Hailei, for their contributions to the production

of my thesis. Their fruitful discussions and friendship help me to finish my thesis.

I am also thankful to the staff in scientific office: Ms. Ng Louise Lai Ha, Mr.

Chung Wai Shing, Mr. Ma Kwok Keung, and Ms. Chau Olivia Ching Wah. Thank

them for their grateful helps and supports.

In the course of my doctoral study, I have had the opportunity to collaborate

with brilliant fellow students, colleagues and friends: Ms Jiang Tiantian, Dr. Wu

Yingying, Dr. Wang Yiping, Dr. Zhang Shoudong, Dr. Yu Boying, Miss Yin Zhao,

Miss Pan Shuying and Dr. Wang Hai. I would like to thank them for their

contributions, valuable discussions and continued collaboration.

Besides, I would like to give my gratitude to my roommate, Dr. Li Yuanxi,

for always supporting and encouraging me during the difficult time. If love makes

v

me grow up, then friendship let me go back to the times when I was a little girl

and days when I had been pursuing the initial dream.

I owe my gratitude to all those people who have made this thesis possible

and because of them my graduate experience has been one that I will cherish

forever.

Most importantly, none of this would have been possible without the love

and patience of my family. Without the supporting of my husband Dr. Zhang Gang,

I could not overcome setbacks and stay focused on my graduate study. He has

always been there cheering me up and stood by me through the good times and

bad. I would also like to thank my parents in-law and I deeply appreciate their

support and encouragement on me. Finally, my deepest heartfelt thanks to my

beloved parents, they make my family be a constant source of love, concern,

support and strength all these years. I will always love them until the end of the

world.

vi

Table of Contents

Chapter 1 General Introduction and the Objective ............................................ 1

1.1 The Concepts of Redox Homostasis and Redox Signaling in Plants ... 1

1.2 Production of ROS and RNS in Plants .................................................. 2

1.3 Antioxidants in scavenging ROS and repairing oxidized biomolecules

3

1.3.1 Characteristics of antioxidants ........................................................... 3

1.3.2 Superoxide dismutases ........................................................................ 4

1.3.3 Catalases ............................................................................................. 5

1.3.4 Ascorbate and Glutathione ................................................................. 5

1.3.5 Others .................................................................................................. 7

1.4 Redox Regulation and Redox signaling in Plants ................................. 8

1.4.1 The term of redox regulation............................................................... 8

1.4.2 Redox regulation during different biological processes ..................... 9

1.5 Redox signaling in environmental stress ................................................ 9

1.5.1 Redox signaling responding to abiotic stress.................................... 10

1.5.2 Oxidative burst in response to biotic stress in plants ....................... 10

1.5.3 Redox–phytohormone interactions ................................................... 11

1.5.4 MAPK cascades in oxidative stress response ................................... 12

1.6 Examples of redox signaling components ............................................ 13

1.6.1 Redox sensor in bacteria and yeast .................................................. 13

1.6.2 Redox sensitive proteins in human .................................................... 14

1.6.3 Redox sensors in plants ..................................................................... 14

1.7 bZIP transcription factors in Arabidopsis ........................................... 15

vii

1.7.1 Overview of the bZIP factor family ................................................... 15

1.7.2 Functions of the Arabidopsis G-group bZIPs ................................... 16

1.7.3 Well known bZIPs in other groups .................................................... 17

1.8 Objective ................................................................................................. 18

Chapter 2 Materials and Methods...................................................................... 19

2.1 Plant Materials and Growth Conditions.............................................. 19

2.2 Transformation of Arabidopsis ............................................................. 19

2.3 Constructs for Subcellular Localization Study of bZIP68-eYFP and

its point mutations and seedling treatment .................................................... 20

2.4 Confocal Microscopy for subcellular localization of eYFP ................ 20

2.5 Phenotypic analysis under stress treatments ....................................... 21

2.6 Genetic complementation of the bzip68 mutant .................................. 21

2.7 GUS reporter assay ................................................................................ 22

2.8 RNA isolation, RNA-seq and quantitative real-time RT-PCR .......... 22

2.9 Accession Numbers ................................................................................ 23

Chapter 3 Results ................................................................................................. 27

3.1 bZIP68 is localized in nuclei under normal conditions ...................... 27

3.2 Nucleocytoplasmic shuttling of bZIP68 is dictated by its

redox-sensitive Cys320 and requires its nuclear export signal..................... 34

3.4 The bzip68 mutant showed an enhanced response to the oxidative

stress treatment ................................................................................................. 66

3.5 The bzip68-1 mutant showed an enhanced stress response under cold

70

Chapter 4 Discussion ........................................................................................... 75

4.1 bZIP68 directly or indirectly senses perturbation of cellular redox

viii

states ................................................................................................................. 75

4.2 bZIP68 links the redox change to activation of oxidative stress

defense genes through redox regulation of transcription ............................. 77

4.3 bZIP68 mediates plant abiotic stress responses .................................. 77

4.4 Conclusion and Working model ........................................................... 78

List of References ................................................................................................. 88

Curriculum Vitae ............................................................................................... 109

ix

List of Tables

Table 2.1 Information of the primers used for genotyping and construction of

various constructs used in this study. ..................................................................... 24

Table 2.2 Information of the primers used for qRT-PCR analysis. ....................... 26

Table 3.1 Gene ontology (GO) categories enriched among the genes expressed at

higher levels in bzip68-1 and bzip68-2 than in wildtype. ...................................... 50

Table 3.2 Differentially expressed genes between wt and the bzip68 mutants that

were shown in the heat map (Fig 3.12). ................................................................. 54

Table 3.3 Examples of antioxidant genes and stress response genes that were

expressed at the higher levels in the bzip68 mutants compared with the WT plants.

............................................................................................................................... 62

Supplementary Table 1 Differentially expressed genes between wt and the bzip68

mutants under H2O2 treatment and the differences in their expression levels

between mock and treated and ROS-treated seedlings. ......................................... 81

x

List of Figures

Figure 3.1 Expression patterns of AtbZIP68 revealed by the GUS reporter assay.

............................................................................................................................... 28

Figure 3.2 bZIP68-eYFP is primarily localized in nuclei of Arabidopsis root cells

under the normal growth condition. ....................................................................... 29

Figure 3.3 bZIP68-eYFP became localized in the cytoplasm under the ROS

treatment. ............................................................................................................... 32

Figure 3.4 eYFP signal in the At5g09240-eYFP transgenic line. ......................... 33

Figure 3.5 bZIP68C320S-eYFP is retained in the nuclei under oxidative stress. . 35

Figure 3.6 bZIP68 is predicted to have a NES signal around AAs 148-162 (A, B).

............................................................................................................................... 37

Figure 3.7 Both bZIP68L157A-eYFP and bZIP68L160A-eYFP were localized in

nuclei under the normal condition, and under the oxidative stress. ....................... 39

Figure 3.8 The L157A&L160A mutation partially hinders bZIP68’s shuttling to

the cytosol under oxidative stress. ......................................................................... 41

Figure 3.9 The LMB treatment partially inhibited the nuclearcytoplasmic

shuttling of bZIP68-eYFP under oxidative stress. ................................................. 43

Figure 3.10 Structural organization of bZIP68 and the bzip68-1 and bzip68-2

mutants and the bZIP68 transcript levels in the wt and mutant plants. ................. 45

Figure 3.11 A heat map of transcriptome profiles of wt and the mutant seedlings

of bzip68-1 and bzip68-2. ...................................................................................... 47

Figure 3.12 The heat maps of expression profiles of the differentially expressed

genes between wt and bzip68-1 and bzip68-2 in the categories of oxidative stress

response (A) and defense response (B). ................................................................. 53

Figure 3.13 qRT-PCR analysis of selective stress-related genes. ......................... 64

Figure 3.14 Venn diagram comparisons of differentially expressed genes. .......... 65

Figure 3.15 The morphology of the bzip68 mutants under the normal conditions.

............................................................................................................................... 67

Figure 3.16 The morphological phenotypes of wt and bzip68-1 seedlings under

xi

oxidative stress. ...................................................................................................... 69

Figure 3.17 The phenotypes of wt and bzip68-1 mutant under cold stress. .......... 73

Figure 4.1 A working model on the molecular mode of action of bZIP68. .......... 79

xii

List of Abbreviations

ABA, abscisic acid;

ADF, adult T cell leukemia–derived factor;

AOX, alternative oxidase;

APX, ascorbate peroxidases;

as-1, activation sequence-1;

AsA, ascorbate;

At, Arabidopsis thaliana;

AtXPO1,Arabidopsis exportin 1;

bZIP, basic region/leucine zipper;

bZIP68, basic region/leucine zipper transcription factor 68;

CaMV, cauliflower Mosaic Virus;

CAT, catalase;

ChIP, chromatin immunoprecipitation;

CoQ, coenzyme Q;

DHA, dehydroascorbate;

DTT, dithiothreitol;

ECL, enhanced chemiluminescence;

ETI, effector-triggered immunity;

eYFP, enhanced yellow fluorescent protein;

GA, gibberellic acid;

GBF1, G-box binding factor 1;

GO, gene ontology;

GPx, glutathione peroxidase;

GPXs, glutathione peroxidases;

GR, glutathione reductase;

Grx1, glutaredoxin 1;

GSH, glutathione;

GSSG, glutathione disulfide;

xiii

GST, glutathione S-transferases;

GUS, beta-glucuronidase;

HL, high light;

HR, hypersensitive response;

JA, jasmonic acid;

LD, long day;

LHC, light-harvesting complex;

LHCB2.4, light-harvesting chlorophylla/b-binding protein2.4;

LMB, leptomycin B;

LTR, long term response;

MAPK, mitogen-activated-protein kinase;

MDHA, monodehydroascorbate;

MIOX1, myo-inositol oxygenase 1;

MIOX2, myo-inositol oxygenase 2;

mtETC, mitochondrial electron transport chains;

MTI, molecular pattern-triggered immunity;

NES, nuclear export signal;

NF-κB, nuclear factor kappa B;

NLS, nuclear localization signal;

NPC, nuclear pore complexes;

NPR1, non-expressor of pathogenesis-related gene 1;

OST1, open stomata 1;

OXI1, oxidative signal inducible 1

PCD, programmed cell death;

POX, peroxidases;

PQ, plastquinone;

Prx, peroxiredoxins

PSI, photosystem I;

PSII, photosystem II;

P-SO2H, sulfinic acid;

xiv

P-SO3H, sulfonic acid;

PVDF, polyvinylidene difluoride;

Rboh, respiratory burst oxidase homologs;

RNS, nitrogen species;

ROIs, reactive oxygen intermediates;

ROS, reactive oxygen species;

SA, salicylic acid;

SAA, systemic acquired acclimation;

SAR, systemic acquired resistance;

SD, short day;

SODs, superoxide dismutase enzymes;

TBHP, tert-Butyl hydroperoxide;

X-Gluc, 5-bromo-4-chloro-3-indolyl glucuronide;

Δp, protonmotive force;

1

Chapter 1 General Introduction and the Objective

Aerobic metabolism could lead to continuous production of reactive oxygen

species (ROS) or reactive oxygen intermediates (ROIs) including singlet oxygen

(1O2), superoxide anion radical (O2•–), hydrogen peroxide (H2O2), and hydroxyl

radicals (OH•) in mitochondria, chloroplasts, peroxisomes, and other enzymatic

systems (1-3). However, generation or accumulation of ROS, is also a common

process during plant responses to different abiotic and biotic stresses such as

excessive light, cold, heat, drought, wounding, UV-B irradiation, osmotic shock

and pathogens (4-11). Under normal conditions, ROS are scavenged by various

antioxidants defense mechanisms. Under stress conditions, the balance between

ROS producing and scavenging is often disturbed, which leads to oxidative

damage to various biomolecules. On the other hand, ROS also play a role as

signals and oxidative stress activates signaling pathways leading to transcriptional

regulation of genes encoding transcription factors, antioxidant defense enzymes,

metabolic enzymes, and structural proteins, resulting in physiological and

developmental adjustment (12).

1.1 The Concepts of Redox Homostasis and Redox Signaling in Plants

Cellular redox states are maintained by the delicate balance between production

and scavenging of ROS/RNS (13). Both in animals and plants, oxidative stress

occurs when redox homeostasis is broken. Over-production of ROS and/or

depletion of antioxidant, lead to damage to DNA, lipids and proteins (14). Redox

signaling occurs when a biological system alters in response to a change in

cellular redox states (15, 16). In plants, redox signaling mediates many biological

processes such as programmed cell death, plant-pathogen interaction and abiotic

stress responses (17). ROS have been known to act as second messengers in

2

response to various biotic and abiotic stresses; however, how redox signals

regulate biological pathways in plants are largely unknown (18, 19).

1.2 Production of ROS and RNS in Plants

For the aerobic metabolism process, many organelles could attribute to the

production of ROS both in unstressed and stressed conditions (20). ROS produced

by the photosynthetic and respiratory electron transport chains from chloroplasts

and mitochondria are known as organellar ROS. Besides, apoplastic ROS are

generated by NADPH oxidases or other cytoplasmic enzyme systems (21).

The major site of ROS production is in the mitochondrial electron transport

chains (mtETC), specifically in the complex I (NADH dehydrogenase) and III

(cytochrome b/c1 complex). In vitro isolated mitochondria assay in mammalian

cells indicates that, from complex I, when the mitochondria stop making ATP,

which leads to a high protonmotive force (Δp) and reduced coenzyme Q (CoQ),

then the high NADH/NAD+ ratio in matrix can result in significant superoxide O2

•− production (22). In complex III, molecular oxygen (O2) are catalyzed to O2•− by

accepting a single electron transfer, and then converted to H2O2, which locate both

in the matrix and intermembrane space (23). In mitochondria respiratory chain,

when electrons pass down the respiratory chain exit prior to the reduction of

oxygen to water at cytochrome c oxidase, O2•–can be formed, and this process is

called electron leak. Moreover, the producing sites are thought to be a

semiquinone radical or a reduced favin (24).

Photosystem I (PSI) and photosystem II (PSII), as well as free electron

carriers plastoquinone and plastocyanin are composed of the photosynthetic

electron transport chain in chloroplast. Together with the light-harvesting complex

(LHC), PSI acceptor center and PSII reaction center form three major sites for the

generation of ROS or oxidizing molecules in chloroplast thylakoids (4, 25). In PSI,

oxygen subjects to photoreduction leading to the production of O2•−, and its

disproportionation is responsible for the generation of H2O2 and O2 (26).

3

Both in plants and animal cells, NOX family of NADPH oxidases are able to

transport electrons across the plasm membrane, leading to the generation of

superoxide and other downstream ROS (27). In plants, NOX homologs were

named as respiratory burst oxidase homologs (Rboh). Those Rboh proteins are

involved in the generation of O2•– which depend on the electrons transfer process

from membrane to extracellular (EC) acceptor (28). For example, AtrbohD and

AtrbohF contribute to ROS production in response to pathogen infection (29). In

the apoplastic space, cell wall bound peroxidases (POX) is one of plants specific

oxidoreductase, and ROS are produced as by products in some POX-dependent

organic radical generation process (30). During normal metabolism process,

peroxisomes are a major site for H2O2, O2•−, GSNO and nitric oxide (NO

•)

production in eukaryotic organisms (31).

Molecules derived by NO are designated as reactive nitrogen species (RNS),

such as radicals like nitric oxide (NO•), nitric dioxide (NO2

•), dinitrogen tridoxide

(N2O3), peroxynitrite (ONOO−), S-nitrosothiols (RSNOs), S-nitrosoglutathione

(GSNO), which could trigger specific physiology process in plants (32). In

animals, NO is primarily generated by nitric oxide synthase(s) (NOS).

Peroxynitrite (ONOO−) is very reactive, formed by the condensation of O2•− and

NO (33).

In general, ROS and RNS are well acceptable for playing a dual role as both

beneficial and deleterious species. The accumulation of ROS/RNS acts as

signaling molecules or leading to damage is determined by the antioxidative

system (34, 35).

1.3 Antioxidants in scavenging ROS and repairing oxidized biomolecules

1.3.1 Characteristics of antioxidants

An efficient ROS-scavenging system is crucial to maintain the low levels of ROS

pools (36). The term antioxidant should be any compound capable of quenching

ROS without undergoing conversion to a detrimental radical (37). The antioxidant

4

enzymes include those that could catalyze such reactions (38). Therefore, the

antioxidant systems consist of low molecular weight antioxidants, such as

glutathione, ascorbate, α-tocopherol, carotenoids and flovonoids, and antioxidant

protective enzymes, such as catalases, superoxide dismutase enzymes (SODs),

glutathione peroxidases (GPXs), and thioredoxins (39, 40). A large number of

genes coding for proteins involved in antioxidant biosynthesis, ROS

detoxification, and oxidative damage repair (41-43). Here some key components

of the antioxidant system are introduced.

1.3.2 Superoxide dismutases

All SODs are multimeric metalloproteins and very efficient in scavenging the

superoxide radical (44). Previous study identified seven genes for SODs in

Arabidopsis including three CuZnSODs (CSD1, CSD2, and CSD3), three FeSODs

(FSD1, FSD2 and FSD3) and one MnSOD (MSD1) (45). At transcription levels,

CSD1 and CSD2 can be induced in response to oxidative stress, while the

overexpressing of CSD2 thereby resulted in more tolerance to high light, heavy

metals and other oxidative stresses (46). SODs catalyze the conversion of O2•− to

H2O2 by dismutation reaction (2O2•− + 2H+ → H2O2 + O2) (47). For subcellular

localization of SOD isoenzymes. Typically, MnSOD is mitochondrial. CuZnSOD

is plastidic or cytosolic, and FeSOD is plastic (48). Knocking down of CSD2

suppress the development of photosynthetic apparatus, and induce the transcripts

of a number of defense genes under oxidative stress. In addition, those

mechanisms could not be complemented if the water-water cycle is suppressed,

thereby supporting the view that water-water cycle play a role in the protection of

photooxidative damage (49). In mammalian cells, there are three known genes

(CuZn-SOD, EC-SOD and Mn-SOD) encoding SOD1, SOD2 and SOD3

respectively. SODs play important roles against ROS in mammals. For example,

the knockout of SOD2 gene in mice results in a lethal cardiomyopathy (50).

5

1.3.3 Catalases

In Arabidopsis, the catalase multigene family includes three genes (CAT1, CAT2

and CAT3) (51). Catalase is mainly associated with the removal of H2O2 in

peroxisomes by catalyzing the dismutation reaction (2H2O2 → 2H2O + O2) (52).

As H2O2 scavengers, CAT2 is primary activated under cold and drought, while

CAT1 and CAT3 are mainly induced in light or darkness (53). The concentration

of light-dependent H2O2 during photorespiration are regulated by CAT2, and the

knock-out of CAT2 caused perturbation of redox signaling and severely cell death

phenotype (54). In general, catalase is essential for development and growth

regulation, and it also modifies the plants innate defense responses by redox

mechanisms (55, 56).

1.3.4 Ascorbate and Glutathione

Low molecular weight antioxidants ascorbate (AsA) and glutathione (GSH) are

the best studied water-soluble antioxidants in plants (57). Ascorbic acid (AA;

ascorbate; vitamin C) is a powerful free radical scavenger both in plants and

humans (58). In addition, ascorbate is the most abundant low molecular

antioxidant by far (59). The first described ascorbate deficient mutant in

Arabidopsis is soz1, and the mutant displays hypersensitive to both sulfur dioxide

and UVB stresses (60). soz1 is also known as vitamin c-1 (vtc1-1) which encodes

for the GDP-mannose pyrophosphorylase. Five VTC genes (VTC1, VTC2, VTC3,

VTC4 and VTC5) have been identified in the ascorbate biosynthesis pathway in

Arabidopsis (61). VTC2 and VTC5 genes encode for GDP-L-galactose

phosphorylase enzymes catalyzing the first step in ascorbate biosynthesis pathway

(62, 63). The deficient of those genes changes the ascorbate steady-state levels in

plants (64).

Glutathione (GSH; γ-glutamylcysteinyl glycine) is a ubiquitous thiol with

roles in stabilizing enzymes of the Calvin cycle, and keeping ascorbic acid in the

reduced form in chloroplast (65, 66). The cellular redox state is dependent upon

6

the GSH/GSSG (reduction/oxidation) ratio, as well as its biosynthesis, utilization,

degradation and transport (67). The oxidized GSSG can be converted back to

GSH by glutathione reductase (GR) with NADPH (68). GSH protects proteins

against the oxidization of thiol groups during stress, with consequence to form

glutathione disulphide (GSSG) (69). γ-GLUTAMYLCYSTEINE SYNTHETASE

1(GSH1) encodes a chloroplastic γ-glutamylcysteine synthetase controlling the

critical step of glutathione biosynthesis, and the mutation of GSH1 leads to the

transcriptinal changes of several defense-related gene (70). Glutathione

S-transferases (GST) catalyze the S-conjugation of reactive compounds with GSH

(71). The Arabidopsis genome contains 48 GST genes that have diverse functions,

and the major studied function of those encoded GSTs are their roles in

detoxification of xenobiotics and protection of tissues against oxidative damage

(72). Zeta-class glutathione transferase (AtGSTZ1) contains three active-site

cysteines which can undergo spontaneous thiolation with GSSG-biotin (73).

Furthermore, Arabidopsis contains eight glutathione peroxidases GPX genes that

encodes ubiquitous enzymes associated with GST to detoxify lipid

hydroperoxides under several stress conditions (74). Among those GPXs,

ATGPX3 is described as an oxidative signal transducer that act as a general

scavenger, which specifically relay on the H2O2 signal in ABA and drought

stresses signaling pathway (75).

AsA and GSH could perform function separately as well as form AsA−GSH

cycle together with water−water cycle to scavenge ROS in chloroplasts (76). The

purpose of water-water cycle in chloroplast is photoreduction of dioxygen to

water. As a consequence, water-water cycle dissipate excess photons and adjust

the ratio of ATP/NADPH (77). For AsA-GSH cycle, reduced GSH is oxidized to

disulphide form glutathione disulfide (GSSG) which could be recycled to GSH by

NADPH-dependent glutathione reductase (GR). Moreover, GSH can react with

dehydroascorbate (DHA) to generate AsA by dismutation of

monodehydroascorbate (MDHA) (78). While, MDHA could be produced in

ascorbate peroxidases (APX) catalyzed reaction, with a short lifetime, then

7

disproportionates to AsA and DHA (79). As a key enzyme, the class I superfamily

peroxidase APX plays a central role in the AsA-GSH cycle which functions to

control the H2O2 level in photosynthetic organisms (80). Six APX genes are

identified in Arabidopsis, including three cytosolic types (APX1, APX2, APX6),

two chloroplastic (stromal sAPX, thylakoid tAPX), and three microsomal isoforms

(APX3, APX4, APX5) (81). Among those genes, evidence shows that cytosolic

type APX1 plays a central role for the chloroplast protection during light stress

(82). Deficient APX1 in Arabidopsis results in the accumulation of H2O2, thereby

leading to the suppression of development under optimal conditions, and

induction of heat shock proteins during light stress (82, 83). Study described that,

together with glutathione, APX1 and APX2 regulates the reversible

photoinhibition of photosynthesis in response to low light or excess light stress

(84).

1.3.5 Others

In addition to ascorbate and glutathione, tocopherols also exhibit a high affinity to

peroxy radicals. It could also protect membranes by controlling the oxidation rate

of lipid peroxidation (85). Besides above mentioned pathway, different from

mammalian cells, plant mitochondria have a single homodimeric protein that form

an alternative respiratory pathway: alternative oxidase (AOX) (86). AOX involves

in regulating the balance of energy and carbon during environmental changing

(87). AOX plays a role in lowering ROS formation in plant mitochondria (88). It

could also acts as reductant especially for the products of photosynthesis, allowing

the TCA cycle to proceed when the cytochrome pathway subjects to detriment

(89). Evidence suggests that during abiotic stress, when the generation of NADPH

in chloroplast exceeds the Calvin cycle consuming, AOX in plant mitochondria

may oxidize the “excess” reducing power (90).

Peroxiredoxins (Prx) are also important antioxidants in higher plants,

including one each of cytosolic, mitochondrial, plastidic type II Prx, PrxQ in

8

chloroplast, one 2-CysPrx for plastid and one nucleo-cytoplasmic 1-CysPrx,

which could reduce H2O2 by employing a thiol-based catalytic mechanism (91).

About 286 peroxisomal genes encode for potential peroxisomal proteins have

been identified in Arabidopsis (92). H2O2-detoxificaton and photorespiration are

believed as major mechanisms that peroxisomes take part in. For example, 2 CP

take part in the anti-oxidant network of chloroplast, and the suppressed mutation

increase the expression of other anti-oxidative genes (93). Due to decreasing the

accumulation of ROS, AtrbohC is essential for plant root cell expansion which

dependent on Ca2+ uptake (94).

Since the interaction between ROS and antioxidant determine the specificity

of the ROS signal, absorb and buffer oxidants that controlled by these antioxidants

are the determinants of redox homeostasis (95). In other words, ROS and

antioxidants govern plant to sense environment, regulate gene expression, and

affect metabolism and physiology by regulating the cellular redox state (96).

1.4 Redox Regulation and Redox signaling in Plants

1.4.1 The term of redox regulation

Typically, the post-translational modification of reversible change of thiol groups

(S−S↔2SH) of a protein, leading to change in its oxidative state and activity was

called the redox regulation (97). Several systems contribute to redox regulation of

many biological processes, including the NADP/thioredoxin system, the

glutathione/glutaredoxin system and the ferredoxin/thioredoxin system. These

systems each linking a hydrogen donor to an intermediary disulfide protein to

alter the activity of target proteins (98-100). The regulation of redox status of a

protein could alter signaling pathway, leading to changes in biological processes

such as translation, transcription, programmed cell death, environmental and

biological stresses response. And those regulations are considered as redox

signaling. Therefore, redox signaling is a special form of redox regulation (97).

9

1.4.2 Redox regulation during different biological processes

Redox regulation is common in both animals and plants (101, 102). The pathway

and mechanism of redox regulation remain poorly characterized (103). In yeast,

mitosis happened at the reductive condition and cell division occur in the

oxidative condition during respiratory process (104). In plants, growing evident

suggests that by regulating the specific gene expression through redox sensitive

transcription factors, cellular redox state has an important effect on cell division

and multicellular organism development (105). For example, a transcription factor

UPBEAT1 (UPB1) directly regulates certain peroxidases to manage the balance of

ROS between the zones of cell proliferation and the zone of cell elongation to

control the initiation of cell differentiation in root (106). The cellular redox state

also has a major impact on cell fate (107).

For triggering the programmed cell death (PCD), ROS acts as signals to

regulate gene expression which involvs in cell suicide events, rather than direct

create physicochemical damage (108). In addition, the interaction between NO

and H2O2 are identified the only factor to trigger the hypersensitive cell death in

response to pathogen attack in plant (109). In mammalian cells, intracellular ROS

play a specific signaling role in induction of the cellular senescence which is

related to aging process (110). Under environment stress, the excessive ROS

primary damage the Rubisco in chloroplast during leaf senescence process (111).

At low levels, as signaling molecules, ROS regulate the autophagy process to

decide the survival or death of cell by mitochondrial origin both in mammalian

and plant cells (112). In general, by redox regulation, plants act as masters that

employ flexible oxidants and antioxidants to integrate signals from metabolism

and environment (113).

1.5 Redox signaling in environmental stress

Besides local responses, acclimation mechanism under abiotic stimuli, such as

high light (HL), heat, cold, drought or salinity, is termed as systemic acquired

10

acclimation (SAA) (114). Various pathogenic and insect invaders may induce

long-lasting systemic protection against a broad spectrum of microorganisms in

plant, and the mechanism is termed systemic acquired resistance (SAR) (115, 116).

Any subtle disturb of the cellular redox balance may induce acclimation responses

in plant; however, how the redox signal trigger the cellular reprogramming in

response to environmental stress are still obscure in plants (21).

1.5.1 Redox signaling responding to abiotic stress

Most of abiotic stresses such as ozone, heat, cold, drought, high light (HL) and

UV may lead to a burst of ROS, epically H2O2 (117). ROS and redox cues which

generated in the chloroplast and mitochondria could activate acclimation response

under abiotic stress to control the SAA and cellular coordination in plants (118).

Here are some studies that link the ROS with abiotic stress. Drought inducing

reductions in photosynthesis in conjunction with photorespiration may contribute

to the production of ROS in mitochondria, leading to the ratio of mitochondrial

respiration (R) to photosynthesis (R/P) being greater, and then the water loss may

affect the function of mitochondria (119). Acclimation to HL need to maintain the

redox states in chloroplast. During short term response, besides phosphorylation

of thylakoid-bound protein, the reduction and oxidation of plastquinone (PQ) pool

are essential for balancing the photosynthetic energy distribution between PSII

and PSI. Moreover, the balance in long term response (LTR) is maintained by

regulating photosystem stoichiometry and antenna structure, and adjusting the

abundance of reaction central and light harvesting proteins (120-122). Chilling

can impair electron transport, ATP activity and respiratory activity, leading to the

production of H2O2, which may induce the antioxidants enzymes for the

mitochondria against oxidative damage (123). Under salinity stress, ionic stress

leads to the production of ROS in mitochondria, and salt tolerance can be

enhanced by overexpressing antioxidant genes AOX and MnSOD (124).

1.5.2 Oxidative burst in response to biotic stress in plants

11

Two forms of immunity can be activated by microbial elicitors in plants. The first

one related to basal resistance is known as microbe-associated molecular

pattern-triggered immunity (MTI). While the other one effector-triggered

immunity (ETI) is activated by R genes. Oxidative burst acts as a key role both in

MTI and ETI signaling (125). Rapid production and accumulation of ROS during

microbe infection are known as oxidative burst, which usually follow by

cross-linking of cell wall proteins, induction of defense-related genes,

biosynthesis of phytoalexin and activation of hypersensitive response (HR) (126).

For orchestration of localized hypersensitive response, H2O2 could also induce

some antioxidants (127). Besides, the rapid production of H2O2 may contributes

as the first induced line for plant in defense against pathogens (128). NADPH

oxidase acts as predominant enzymatic mechanism responsible for oxidative burst

(19). During the early stage of pathogen invasion, antioxidants appearing in

apoplast may prevent the occurring of sustained oxidation that contribute to

pathogen sensitivity (129). Oxidative signal inducible 1 (OXI1) kinase is induced

by H2O2 and is essential for signal transduction linking oxidative burst and

downstream responses (130).

NO was identified as a key signal in disease resistance in plants (131). The

interaction between NO and ROS signaling pathways is essential during plant

biotic interactions (132). However, how the ROS wave integrated with these

different stress-specific signals is poorly understand, although it is known that the

formation of a wave of ROS production leads to spatial and temporal responses

throughout different tissues (133).

1.5.3 Redox–phytohormone interactions

The crosstalks between biotic and abiotic stresses are regulated by ROS signaling

pathways, as well as hormone signaling pathways (134). These hormones include

defense-related signals containing JA and SA, as well as some classic hormones

including auxin, ABA, GA and ethylene (96). Both auxin and ROS are rapidly

12

stimulated by environmental stresses, and it was suggested that auxin links ROS

with developmental and physiological response to stress tolerance (135). For ABA,

under water deficit, salinity stress, and/or high light stress condition, OST1

directly intact with respiratory burst oxidase homolog F protein (RBOHF) to

regulate stomatal closure, but the systemic ROS/Ca2+/hydraulic/electric wave

could cause the opening of stomata and induce the ABA accumulation which may

turn on gene expression and eventually induce acclimation (114). ROS linked with

GA by the nuclear growth-repressing DELLA proteins. Stress induced DELLA

can stimulate upregulating of antioxidant genes, resulting in delaying cell death

and promoting tolerance (136). SA alters the cellular redox status and enhances

the oxidative burst (137).

1.5.4 MAPK cascades in oxidative stress response

Mitogen-activated-protein kinase (MAPK) cascade works with ROS signaling in

various biological pathways. MAPK cascade is activated to control a variety of

transcription factors to copy with the detected oxidative stress by regulating

expression of some corresponding genes, hormone responses networks, and

antioxidant systems (36). For example, MEK4 and MEK5 in Arabidopsis are

induced by H2O2 and eventually leading to HR cell death associated with plant

disease resistance (138). Some studies proposed that MAPK pathways might act

upstream of ROS signaling, such as the tobacco MEK2 pathway, the Arabidopsis

MPK3 and MPK6 (139). On the other hand, it is known that ROS can enhance

MAPK cascade by deactivating phosphatases through their oxidation (140). Many

phosphatases are known to be redox sensitive, such as the nuclear factor kappa B

(NF-κB), p38 in animal, the Arabidopsis ABI1 and ABI2 (141-144) .

In generally, ROS signaling is integrated with many different signaling

networks in plants, and accumulation of ROS could either precede the activation

of these signaling or activated by those networks (145).

13

1.6 Examples of redox signaling components

It is believed that ROS play their signaling roles largely by acting through

oxidative modifications of redox-sensitive proteins whose reduction and oxidation

can function as a molecular switch to link redox changes into physiological

responses (146). Proteins undergo oxidative modification in diverse amino acid

residues; however, irreversible modification is often associated with permanent

loss of function or damage to those proteins, although reversible modifications at

the cysteine residues can act as a molecular switch in redox regulation (147).

Many proteins have been known to sense cellular redox changes by using their

redox-sensitive thiols of cysteine residues (148). Protein thiols can be oxidatively

modified in different ways: some modifications, such as formation of sulfenic acid

and a disulfide bond are reversible whereas others such as oxidation to sulfonic

acid (P-SO3H) and sulfinic acid (P-SO2H) are irreversible (149). Recently,

gel-based and gel-free quantitative redox proteomics methods have been used to

identify proteins whose thiols underwent oxidative modifications in response to

redox perturbation (150-153).

1.6.1 Redox sensor in bacteria and yeast

Reversible modifications of cysteines such as disulfide bond formation,

glutathionylation, and nitrosylation can alter protein activities and/or protein

localization and act as a molecular switch (14, 108, 154). Redox control of

transcriptional activation of antioxidant genes by redox-sensitive transcription

factors was discovered from studies initially performed on Escherichia coli (155).

A bacterial transcription factor called OxyR is activated by its reversible oxidation

by H2O2, which enhances DNA binding and activates antioxidative genes (156).

Redox sensing protein OhrR in bacteria is a transcription suppressor in its reduced

form in normal condition which repress transcription of ohrA resistance gene, and

is inactivated by form a cysteine sulfenic acid in the presence of hydroperoxides,

which leads to the sensing of ROS and inducing of repair genes (157, 158).

14

In yeast, YAP1 is in a reduced status and localized in the cytoplasm under

normal conditions. Furthermore, it forms several disulfide bonds with the

glutathione peroxidase (GPx)-like enzyme Gpx3 under oxidative stress, and is

translocated to the nucleus to activate genes encoding oxidative stress defense

proteins (159-161). Multi-step formation of disulfide bonds are required for the

activation of Yap1 in response to H2O2, which include the formation of multiple

interdomain disulfide bonds to transduce redox signaling, and the intramolecular

disulfide bond that dependent on the forms of thionilate anion (162). Reduction of

YAP1 in the nucleus by a thioredoxin alters its conformation so that its nuclear

export signal (NES) is recognized by CRM1 (Exportin 1) and it is transported

back to the cytosol (163). In addition to a NLS recognized by an importin protein

for targeting to the nucleus, proteins that undergo nucleocytoplasmic shuttling

generally contain a leucine-rich NES which is recognized by an exportin protein

and are then exported across nuclear pore complexes (NPC) to the cytosol (164).

1.6.2 Redox sensitive proteins in human

Adult T cell leukemia–derived factor (ADF) is a human thioredoxin, which

subjects to nucleocytoplasmic shuttling through the reduction/oxidation of protein

cysteine residues in response to stress (165). p53 tumor repressor is an

well-characterized redox-sensitive protein. Moreover, the DNA-binding activity

of p53 is regulated through redox modification of its several cysteine residues

(166). NF-κB is known to be involved in transcriptional induction of their target

genes through redox-regulation (167, 168).

1.6.3 Redox sensors in plants

Although only few redox-sensitive proteins in plants have been characterized in

details, increasing evidences support that redox sensors play important role in

modulating redox-mediated biological processes in plants (169). The master

immune regulator NPR1 (non-expressor of pathogenesis-related gene 1) is a well

15

characterized redox sensor protein in Arabidopsis. Under stressed condition, the

reduced monomer of NPR1 translocate from cytoplasm to nuclear to induce

defense gene expression owing to the conformation changes via S-Nitrosylation

and Thioredoxins (170, 171). During SAR acclimation process, the redox

sensitive NPR1 could modulates the crosstalk between SA and JA in cytosol. In

addition, the SA induced response of translocation of NPR1 is dependent on the

interaction between NPR1 and basic leucine zipper protein transcription factors

AHBP-1b and TGA6. And then, after trigger the transcriptional reprogramming,

NPR1 subjects to degradation which mediated by the nuclear SA receptors NPR3

and NPR4 (172-174). Recent study shows that, NPR1 sensor the redox rhythm

interacts with the circadian clock in response to vigorous environmental stimuli in

order to alleviate the sacrifice of organism physiological activity (175).

1.7 bZIP transcription factors in Arabidopsis

Previously, we developed a redox proteomics approach termed oxiTRAQ for

identifying redox-sensitive proteins in Arabidopsis (176). basic leucine zipper

protein transcription factors bZIP68 and G-box binding factor 1 (GBF1) were

identified among the redox-sensitive proteins that underwent reversible oxidative

modifications in Arabidopsis suspension cells under the treatment of 5 mM

hydrogen peroxide for 15 minutes.

1.7.1 Overview of the bZIP factor family

Basic region/leucine zipper domain (bZIP) proteins constitute a major class of

eukaryotic transcriptional regulators (177). In plants, bZIP family proteins contain

a basic region involved in DNA binding and nuclear import, and a leucine zipper

dimerization domain. These proteins are found in all eukaryotes and implicated in

gene expression and regulation not only by transcriptional modification but also

through protein-protein interaction, protein degradation and intracellular

partitioning (178). bZIPs also control important processes in plants, such as

16

morphogenesis, seed formation, abiotic and biotic stress responses (179).

The Arabidopsis thaliana (At) genome encodes approximately 75 predicted

bZIP factors. On the basis of sequence similarity and conserved motifs, the

AtbZIP family can be subdivided into ten groups: A, B, C, D, E, F, G, H, I and S

(180). The group G GBF genes of Arabidopsis have been mainly linked to

ultraviolet, blue light signal transduction and the regulation of light-responsive

promoters. There are five members of G group genes: GBF1-3, AtbZIP16 and

AtbZIP68. Members in G group all have conservative protein structure: a highly

homological DNA binding domain and a proline-rich domain in the N-terminal

(181). Moreover, all five members of bZIPs can form homo- and heterodimers

with each other, which may specifically recognize the G-box motif (182, 183).

Additionally, through in vitro DNA binding assay, pull-down assay, and yeast one

hybrid screen, the G group bZIPs are found to bind to the cis elements with the

ATGC core, such as G-box, C-box, and the activation sequence-1 (as-1) element

that have been linked to responses to light, phytohormones, and oxidative stress

(184-188).

1.7.2 Functions of the Arabidopsis G-group bZIPs

In vitro assay showed that the DNA binding activity of bZIP16, bZIP68, and

GBF1 is inhibited by oxidant treatment and enhanced by DTT treatment (189).

AtbZIP16, AtbZIP68, andAtGBF1 could recognize and specifically bind to the

fragment of CACGTG G-box that derived from light-harvesting

chlorophylla/b-binding protein2.4 (LHCB2.4) promoter. Besides, AtbZIP16,

AtbZIP68 and AtGBF1 could also interact with each other in the yeast two-hybrid

system (190). Through transcriptome comparison between wild type and bzip16

mutant plants, and chromatin immunoprecipitation (ChIP) followed by qPCR

analysis, bZIP16 is reported to be a primarily transcriptional repressor that

regulating light-, GA-, and ABA-responsive genes (186). Modeling of the bZIP

domain of bZIP16 reveals that if the redox-sensitive thiols form a disulfide bond

17

between the dimer partners, the configuration of the zipper domain may not be

open or flexible enough to allow DNA binding (189).

AtGBF1 could bind to the CAT2 promoter in vitro. In addition, in vivo,

AtGBF1 negative regulates the expression of CAT2 at bolting time, and controls

leaf senescence through the content of H2O2 (191). Besides, AtGBF1 also exhibits

elongated hypocotyls in response to white and blue light (192). Indeed, GBF1

functions as a repressor for RBCS and CAT2 but an activator for LHCs (191, 192).

For other GBFs, AtGBF2 is known to undergo phosphorylation-dependent nuclear

translocation in response to light, and the expression of AtGBF3 is also regulated

by light (193).

1.7.3 Well known bZIPs in other groups

Increasing studies suggest that bZIP factors play crucial role in various pathways

and post-translational modifications are involved in regulating activities of many

bZIPs (178). ABI5 belongs to the A group bZIP proteins, and deficient ABI5 leads

to the insensitiveness to ABA responses including germination stage and embryos

period. The protein accumulation, phosphorylation, stability and activity of ABI5

are all highly regulated by ABA (194-196). During light-regulated development

process, the group H bZIP factor HY5 directly binds to the promoters of

light-inducible genes, promoting the photomorphogenic development (197, 198).

Under dark, HY5 subjects to degradation dependent on the interaction with a WD

protein COP1; but when illuminated, COP1 is exported from the nucleus to

cytosol leading to the accumulation of HY5 (199-201). A couple of TGA proteins

of the D group bZIPs are involved in plant’s defense against pathogens by directly

activating PR gene expression (202). NPR1 interaction protein TGA1 is also a

bZIP that binds to the as-1 element present in many pathogen-responsive genes,

leading to activation of defense mechanism (203, 204). Formation of a disulfide

bond in TGA1 under oxidizing conditions leads to an inactive conformation (203).

18

1.8 Objective

Our preliminary study on bZIP68 raises an intriguing possibility that bZIP68

might act as a transcriptional repressor that suppresses oxidative stress-responsive

genes under normal growth conditions. Sensing oxidative stress, bZIP68

undergoes a reversible oxidation and is shuttled from the nucleus to the cytosol,

leading to activation of the stress-responsible genes.

To unravel the possible function and molecular mechanisms of bZIP68 in

response to oxidative stress, experimental plants were designed to understand the

role of redox regulation of bZIP68 in its function and genes that are regulated by

bZIP68. Various mutational analyses were carried out to reveal molecular

mechanisms of transcriptional regulation by bZIP68 and its biological function.

19

Chapter 2 Materials and Methods

2.1 Plant Materials and Growth Conditions

Arabidopsis thaliana T-DNA insertion lines bzip68-1 (SALK_065543) and

bzip68-2 (SALK_094254C) (Col-0 background) were obtained from the

Arabidopsis Biological Resource Center (ABRC) (http://abrc.osu.edu/).

Homozygous insertion lines were confirmed by genomic PCR analysis using the

T-DNA left border primer LBb1 and the gene-specific primers (listed in Table 2.1).

The gene-specific primers were designed by using T-DNA Primer Design Tool of

Salk Institute Genomic Analysis Laboratory

(http://signal.salk.edu/tdnaprimers.2.html). Col-0 plants were used as the

wild-type control for phenotype analysis and transcript level analysis and for

transformation with various constructs used in this study.

Plants were grown in soil in an walk-in growth room with 23ºC ± 2ºC, 50%

humidity, and 125 mol m-2 sec-1 light intensity provided by cool-white fluorescent

bulbs under a 16 h light/8 h dark cycle. For growing seedlings on agar media,

surface sterilized seeds were plated on the medium with half-strength Murashige

and Skoog (MS) Basal Salts (Sigma, M5524-1L), 1% (w/v) sucrose, 0.7% agar,

and 0.05% MES, pH 5.7 (adjusted by 1M KOH). Seedlings in petri dishes were

placed in a growth chamber (SANYO, MLR-351H or CONVIRON, E7/2 ) at

23ºC or 15ºC with 50% humidity and a light intensity of 125 mol m-2 sec-1 under a

16h light/8h dark photoperiod.

2.2 Transformation of Arabidopsis

All constructs in binary vectors for Arabidopsis transformation were first

transformed into Agrobacterium tumefaciens strain GV3101 and then into

Arabidopsis by floral dipping (205). The T2 and/ or T3 generation stable

transgenic lines were selected and used for the subcellular localization analysis.

20

2.3 Constructs for Subcellular Localization Study of bZIP68-eYFP and its

point mutations and seedling treatment

To generate the bZIP68-eYFP fusion under the control of the 35S promoter, a

genomic region of bZIP68 was amplified with the primers SalI-35SAtbZIP68-F

and 35SAtbZIP68-BamHI-R from Col-0) genomic DNA and cloned into the

SalI/BamHI-digested pCAM35S::eYFP (206) vector to yield 35S::bZIP68-eYFP.

To place bZIP68-eYFP under the control of the bZIP68 promoter, a 3.4-kb (-1164

to +2270) genomic fragment of bZIP68 was amplified with the primers

BamHI-pAtbZIP68-F and pAtbZIP68-AgeI-R, subcloned into a

BamHI/AgeI-digested pBAR-eYFP vector to yield bZIP68p::bZIP68-eYFP.

The bZIP68C320S, bZIP68L157A, bZIP68L160A, and

AtbZIP68L157A&L160A point mutation were generated through site-directed

mutagenesis assay (207). The C320S, L157A, L160A and L157A&L160A

mutations were generated using the bZIP68 genomic fragment of

35S::bZIP68-pmD-T19 cloning vector as the template by using the following

primer pairs, respectively: C320S-F and C320S-R, L157A-F and L157A-R,

L160A-F and L160A-R, L157A&L160A-F and L157A&L160A-R. The clones

containing the point mutations were subcloned into the pCAM35S::eYFP vector

as described above to generate 35S::bZIP68C320S-eYFP,

35S:bZIP68L157A-eYFP, 35S:bZIP68L160A-eYFP and

35S::bZIP68L157&AL160A-eYFP that were transformed into Col-0. Homozygous

transgenic seedlings were identified and used for confocal microscopy

observation of eYFP.

2.4 Confocal Microscopy for subcellular localization of eYFP

For determining subcellular localization of the eYFP reporter, 4-d-old seedlings

expressing various eYFP reporter constructs were observed under a confocal

21

laser-scanning microscope (Leica TCS SP5 II) with 488nm excitation and

500-530nm emission. For the oxidant treatment, the seedlings were dipped in

5mM H2O2 solution and observed with the confocal microscope at different time

after the oxidant treatment. The seedlings dipped in water were served as a control.

The eYFP transgenic lines observed in the study carried one of the eYFP reporter

constructs described above. To determine the effect of Leptomycin B (LMB) on

bZIP68 subcellular localization, the 35S::bZIP68-eYFP lines were treated with

80ng/ml LMB (Sigma, L2913) for 24h as described previously (208) and then

treated with 5mM H2O2 before observation by confocal microscopy.

2.5 Phenotypic analysis under stress treatments

For the treatment with tert-Butyl hydroperoxide (TBHP), surface-sterilized seeds

were sowed on petri dishes (90mm) containing 15ml of solid 1/2 MS medium

with or without 0.4mM tert-Butyl TBHP. The plates were placed at 4ºC for 3d for

cold stratification to synchronize the germination and then placed in a growth

chamber for germination and seedling growth with 23ºC, 16 h light/8 h dark cycle,

and 125 mol m-2 sec-1 light intensity in growth chamber (SANYO, MLR-351H).

For the cold stress treatment, surface sterilized seeds were germinated and

seedlings were grown on the 1/2 MS medium at 15ºC for 10-14 days with 16 h

light/8 h dark cycle, and 125 mol m-2 sec-1 light intensity in a growth chamber

(SANYO, MLR-351H). For cold treatment on soil grown plants, seeds were

germinated and seedlings were grown in pots in the growth room (23ºC ± 2ºC) for

one week. The plants were then transferred to a growth chamber (CONVIRON,

E7/2) with 125 mol m-2 sec-1 light intensity provided by cool-white fluorescent

bulbs under a 16 h light/8 h dark cycle.

2.6 Genetic complementation of the bzip68 mutant

A 3.7-kb (-1170 to +2517) genomic fragment of bZIP68 was amplified with the

primers BamHI-combZIP68-F and combZIP68-PstI-R from Col-0 Arabidopsis

22

genomic DNA and cloned into a BamHI/ PstI-digested pCAMBIA1300 vector

(SnapGene). The construct was transformed into the bzip68-1 mutant. Similarly,

the other constructs investigated in the study were also transformed into the

mutant for complementation analysis. Multiple independent transgenic lines were

identified and used for phenotypic analysis under the stress treatments described

above.

2.7 GUS reporter assay

A 1.2 kb bZIP68 promoter fragment was amplified from Col-0 genomic DNA

using the primers KpnI-GusbZIP68-F and GusbZIP68-AgeI-R and subcloned into

the binary vector pBAR-GUS which harboring a GUS reporter gene (206) which

was then transformed into Col-0. Histochemical GUS activity staining of the GUS

reporter lines was performed as described previously (209). Stained tissues were

then observed under a dissecting microscope (Nikon, Eclipse Ti-S).

2.8 RNA isolation, RNA-seq and quantitative real-time RT-PCR

bzip68-1, bzip68-2 and Col were grown on 1/2 MS agar media (3% (w/v) sucrose,

and 0.7% agar, pH 5.7) for 14 days under 8 h light/16 h dark cycle, and 125 mol

m-2 sec-1 light intensity, and the leaves of seedlings were collected. Three

biological replication were collected for each sample. Total RNA was extracted

using the Plant RNA Isolation Mini kit (Agilent), RNA (1μg) was digested by

DNase I (NEB, M0203L) and then reverse transcribed using the M-MLV Reverse

Transcriptase (Affymetrix, 78306) with oligo (dT) primers according to the

manufacture’s instruction (Affymetrix, 77405). The quality of the RNA samples

were analyzed by spectrophotometer (Thermo, NANO drop, ND1000).

Barcoded mRNA libraries were constructed by BGI using Illumina reagents and

protocols. Samples were sequenced on 2500 Illumina HiSeq. Total reads were

mapped to the Arabidopsis genome (TAIR10; www.arabidopsis.org) using the

TopHat 2.2.0 and SOAP2 software (210, 211). Read counts for every gene were

23

generated using HTseq 0.6.1 with and other scripts (212). Differential expressed

genes between samples were defined by DEseq2, based on fold change>2 and

false discovery rate-adjusted P value < 0.05 (213). Gene Ontology analysis, and

the functional categories were identified by using the annotation of the

Arabidopsis genome (TAIR10; www.arabidopsis.org).

Primers bZIP68-qF-1 and bZIP68-qR-1 were used to determine the bZIP68

gene expression levels in bzip68-1 and bzip68-2 mutants. Quantitative PCR with

gene specific primers (listed in Table 2.2) were performed with the SYBR qPCR:

SYBR Premix Ex Taq (TaKaRa, DRR420A) on Mx3000P Real-Time PCR

detection system (Agilent Technologies). Signals were normalized to the

reference gene ACTIN2 using the ΔCT method and relative expression of a

candidate gene was calculated from the ratio of bzip68 mutants to wt. Three

biological replicates were included in the quantitative real-time RT-PCR analysis.

2.9 Accession Numbers

Sequence data for this study can be found in the Arabidopsis Genome Initiative

database under accession number At1g32150 (bZIP68), At5g09240.

24

Table 2.1 Information of the primers used for genotyping and construction of various constructs used in this study.

Purpose Primer pairs Oligo Sequence

genotyping for SALK_065543 bzip68-1-LP GTAACAGCCACTCCAGCACTC

bzip68-1-RP TTGCTAATTGCTATCATCGGAG

genotyping for SALK_094254C bzip68-2-LP CAGATGGGATCTTGCTTGAAG

bzip68-2-RP AACCTCTGCTCGTTGTGCTAG

35s::bZIP68-eYFP SalI-35SAtbZIP68-F GTCGACATCTGATTGTTGGATTTTGGTAGGT

35SAtbZIP68-BamHI-R GGATCCTTCGCAACATCCTGACGTGTACTT

bZIP68p::bZIP68-eYFP BamHI-pAtbZIP68-F GGATCCTAACTTTCACGCCCACCACTC

pAtbZIP68-AgeI-R ACCGGTAACGCAACATCCTGACGTGTACTT

35S::C320SbZIP68-eYFP C320S-F GCGGAGAGTGATGAGCTAGCAC

C320S-R GTGCTAGCTCATCACTCTCCGC

35S::L157AbZIP68-eYFP L157A-F GCGGGAAGTTTGAATATGATTATAGGA

L157A-R TCCTATAATCATATTCAAACTTCCCGC

35S::L160AbZIP68-eYFP L160A-F GAAGCTTGGGAAGTGCGAATAT

L160A-R ATATTCGCACTTCCCAAGCTTC

35S::L157A&L160AbZIP68-eYFP L157A&L160A-F AGGAAGCGCGGGAAGTGCGAATATGATTA

L157A&L160A-R TAATCATATTCGCACTTCCCGCGCTTCCT

25

chip assay BamHI-ChipbZIP68-F GGATCCTAACTTTCACGCCCACCACTC

ChipbZIP68-AgeI-R ACCGGTAACGCAACATCCTGACGTGTACTT

complementation BamHI-combZIP68-F GGATCCTAGGGTTAACTTTCACGCCCA

combZIP68-PstI-R CTGCATAAAGATTGAGAAGAAGACTCCGAAA

overexpression SmaI-OXbZIP68-F CCCGGGATCTGATTGTTGGATTTTGGTAGGT

OXbZIP68-ClaI-R ATCGATCTACGCAACATCCTGACGTGTACTT

GUS::bZIP68 KpnI-GusbZIP68-F GGTACCTAACTTTCACGCCCACCACTC

GusbZIP68-AgeI-R ACCGGTGAAGCTGCGTGGGCTTGAC

The underlined nucleotides indicate the position of mutagenesis, and nucleotides in red are the added resriction enzyme recognition

sequence.

26

Table 2.2 Information of the primers used for qRT-PCR analysis.

Primer pairs Oligo Sequence

bZIP68-qF-1 ATGGATTATTGGAGCGGTCATG

bZIP68-qR-1 GTTTACGCAACCTGGATCTACGA

PER62-qF-1 TCCGCTTTTCGCCTCAACACTC

PER62-qR-1 ATTCCTCTGTTACGGCTGAGATTGATG

WRKY18-qF-1 GGAAATACGGACAAAAGGTTACAAGAGA

WRKY18-qR-1 CAGATATAGCAGCAGCAAGAGCAGCT

CBF2-qF-1 AAGATGCGTTTTATATGGATGAAGAGG

CBF2-qR-1 TTTTACCATTTACATTCGTTTCTCACAA

JAZ10-qF-1 CTAATGAAGCAGCATCTAAGAAAGACGAG

JAZ10-qR-1 GAAATAAGCCAAATCCAAAAACGAACA

27

Chapter 3 Results

3.1 bZIP68 is localized in nuclei under normal conditions

bZIP68 is predicted to contain a nuclear localization signal (NLS). For

experimental verification of subcellular localization of bZIP68, transgenic

Arabidopsis plants expressing bZIP68 fused with eYFP at its C’ terminus were

generated. The chimeric gene was under the control of the 35S promoter

(35S::bZIP68-eYFP) or the bZIP68 promoter (bZIP68p::bZIP68-eYFP). The

bZIP68 promoter is active in roots mainly in the meristem and elongation zones,

in newly emerging leaves and guard cells (Fig 3.1A-3.1G).

The YFP signal was found to be primarily localized in nuclei under normal

growth conditions in the seedlings expressing bZIP68-eYFP under the control of

either the bZIP68 promoter (Fig 3.2A-3.2C) or the 35S promoter (Fig 3.2D-3.2F).

28

Figure 3.1 Expression patterns of AtbZIP68 revealed by the GUS reporter

assay.

GUS staining of bZIP68:GUS transgenic plants in 3-d-old seedlings (A), 7-d-old

seedlings (B), 14-d-old seedlings (C), plant at 6-8 true leaf stage (D), young

inflorescence and floral buds (E), inflorescence (F, G) and silique (G). Scale bars

= 500 μm.

29

Figure 3.2 bZIP68-eYFP is primarily localized in nuclei of Arabidopsis root

cells under the normal growth condition.

Location of bZIP68-eYFP in root cells of a transgenic plant carrying

bZIP68p::bZIP68-eYFP (A-C) and another line carrying 35S::bZIP8-eYFP (D-F).

The left panels show the fluorescence signal, the right panels are bright filed

images and the middle panels are merged images.

30

However, approximately 15 minutes after the roots were treated with 5mM H2O2,

the eYFP signal disappeared from the nuclei and instead accumulated in the

cytoplasm of many root cells (Fig 3.3A-3.3O). This redistribution of the eYFP

signal was not likely due to leakage of the protein from the nuclei to the

cytoplasm due to damage of nuclear membrane. In the seedling expression eYFP

fused with another nuclear protein (At5g09240), the eYFP signal remained in the

nuclei in the seedlings under the same ROS treatment (Fig 3.4A-3.4F).

31

32

Figure 3.3 bZIP68-eYFP became localized in the cytoplasm under the ROS

treatment.

The photos were taken from Arabidopsis roots treated with 5mM H2O2 for

approximately 15 minutes (A, B, C), 30 minutes (D, E, F), and 2 hours (G, H, I).

The plants are bZIP68P::bZIP68-eYFP transgenic lines. The nucleocytoplasmic

shuttling was also observed in the 35S::bZIP68-eYFP transgenic plants (J, K, L,

M, N, O) which were treated with 5mM H2O2 for about 15 minutes.

33

Figure 3.4 eYFP signal in the At5g09240-eYFP transgenic line.

The At5g09240-eYFP fusion protein was found to be remained in the nuclei under

the normal condition (A, B, C) and the oxidative stress condition (D, E, F).

34

3.2 Nucleocytoplasmic shuttling of bZIP68 is dictated by its redox-sensitive

Cys320 and requires its nuclear export signal

The change in bZIP68 subcellular distribution patterns in response to the

oxidative stress prompted us to examine whether bZIP68 undergoes

nucleocytoplasmic shuttling that is dictated by its redox states. To test the

hypothesis, the codon for the redox-sensitive Cys320 was mutagenized to the

serine codon and the mutated version was fused with eYFP to generate

bZIP68p::bZIP68C320S-eYFP, which was transformed into Arabidopsis to

generate stable transgenic lines. Like the wildtype bZIP68, bZIP68C320S-eYFP

was also localized in nuclei under the normal condition (Fig 3.5A-3.5C). However,

in contrast to the redistribution of bZIP68-eYFP following the ROS treatment,

bZIP68C320S-eYFP largely remained in the nuclei in the seedlings under the

same oxidative stress treatment (Fig 3.5D-3.5F).

35

Figure 3.5 bZIP68C320S-eYFP is retained in the nuclei under oxidative

stress.

Photos were taken from the transgenic plants of 35S: bZIP68C320S-eYFP mock

treatment (A, B, C) or with the treatment of 5mM H2O2 for 30 minutes (D, E, F).

36

Nuclear proteins that undergo nucleoplasmic shuttling often contain a nuclear

export signal (NES) for its transport from the nucleus to the cytoplasm through

nuclear pores. NES often have a consensus sequence of LxxxLxxLxL, where "L" is

a hydrophobic residue (often leucine) and "x" is any other amino acid. bZIP68 is

predicted by the NetNES algorithm (http://www.cbs.dtu.dk/services/NetNES/)

(214) to have a NES around AAs 148-162 (Fig 3.6A-3.6B). Leu157 and Leu160

are predicted to be critical residues for that region to function as a NES. The

Leu157 codon and Leu160 codon was mutated to an Ala codon, and the mutated

bZIP60L157A, bZIP68L160A, and bZIP68L157A&L160A in which both Leu157

and L160 were substituted with Ala were fused with eYFP. Subcellular

localization of these Leu-to-Ala substituted bZIP68-eYFP fusion proteins were

observed in the transgenic seedlings with and without the oxidative stress

treatment. The single mutation of bZIP68L157A and bZIP68L160A did not lead

to obvious difference in their nucleocytoplasmic shutting from the wildtype

bZIP68 in response to the oxidative stress treatment (Fig 3.7A-3.7L); however, the

dual mutation of both Leu157 and Leu160 largely blocked nucleocytoplasmic

shuttling of bZIP68L157A&L160A-eYFP following the oxidative stress treatment

(Fig 3.8A-3.8F).

37

Figure 3.6 bZIP68 is predicted to have a NES signal around AAs 157-162 (A,

B).

38

39

Figure 3.7 Both bZIP68L157A-eYFP and bZIP68L160A-eYFP were localized

in nuclei under the normal condition, and under the oxidative stress.

Photos were taken from transgenic plants of carrying bZIP68L157A-eYFP (A-F)

or bZIP68L160A-eYFP (G-L) under the normal condition (A-C, and G-I) and

under the ROS stressed condition (D-F, and J-L). For the oxidative stress

treatment, all of the seedlings were treated for 30 minutes with 5mM H2O2.

40

41

Figure 3.8 The L157A&L160A mutation partially hinders bZIP68’s shuttling

to the cytosol under oxidative stress.

The localization of the eYFP signal in the bZIP68L157A&L160A-eYFP transgenic

plants without (A, B, C) and with (D, E, F) the treatment by H2O2 for 30 minutes.

42

Leptomycin B (LMB) is a nuclear export inhibitor by modifying CRM1 (exportin

1), which recognizes NES to mediate transport of proteins from nuclei to

cytoplasm. The Arabidopsis Exportin 1 (AtXPO1/AtCRM1) can also be inhibited

by LMB (215). In the transgenic seedlings expressing bZIP68-eYFP, after the

seedlings were incubated with LMB first and then treated with the oxidative stress,

nucleocytoplasmic shuttling was also pronouncedly compromised (Fig

3.9A-3.9F).

43

.

Figure 3.9 The LMB treatment partially inhibited the nuclearcytoplasmic

shuttling of bZIP68-eYFP under oxidative stress.

eYFP signal in the bZIP68:bZIP68-eYFP seedlings after treatment with 80ng/ml

LMB for 24h of (A-C) and after 1 hour treatment with 5mM H2O2 (D, E, F)

following the LMB treatment.

44

3.3 The bzip68 mutation leads to elevated levels of expression of

stress-responsive genes including antioxidant genes

We obtained two T-DNA insertion lines for the bZIP68 gene. bzip68-1 carries a

T-DNA insertion at its promoter (-16 related to the putative transcription start site)

whereas bzip68-2 has an insertion in the eleventh exon (Fig 3.10A). The insertion

in bzip68-2 is expected to cause a deletion of 76 amino acid in the C’ terminus of

bZIP68 just after the basic domain of the protein. Using a pair of the primers

located in the 10th and 11th exons. The bZIP68 transcript level was found to be 74

fold and 163 folds reduced in bzip68-1 and bzip68-2, respectively. Indicating that

bzip68-1 and bzip68-2 are severe knockdown alleles (Fig 3.10B-3.10C). However,

it is remains to be determined whether the truncated protein of bzip68-2 allele

might have any function.

45

Figure 3.10 Structural organization of bZIP68 and the bzip68-1 and bzip68-2

mutants and the bZIP68 transcript levels in the wt and mutant plants.

(A) Diagram of bZIP68 gene organization and the location of T-DNA insertion

sites in bzip68-1 (SALK_065543) and bzip68-2 (SALK_094254C). The black

bars represent exons and the grey bars are the UTR regions. qF1 and qR1

represent the relative positions of primers used in quantitative real time PCR

analysis to detect AtbZIP68 transcripts. (B) and (C) QRT-PCR analysis results of

the AtbZIP68 expression levels in WT, bzip68-1 (B) and bzip68-2 (C) using

primers qF1 and qR1.

Error bars indicate standard deviation from three biological replicates. (t test;

*P<0.05,**P<0.01).

46

We employed high throughput RNA-sequencing (RNA-seq) to generate

transcriptome profiles from these two insertion lines and wt seedlings growing

under the normal agar medium for 14 days. Three biological replicates were

included for wt, bzip68-1, and bzip68-2. The average count of bZIP68 transcript

level in the three replicates of the bzip68-1 samples was 4 whereas the average

count in the three wt samples was 320, again indicating that the bzip68-1 is a

severe knock-down allele under the normal growth condition. The transcript level

were reduced by 2.3 folds in bzip68-2 mutant and 48.1 folds in bzip68-1

compared to the wt seedlings. It remains to be determined whether the truncated

protein from the bzip68-2 allele is functional. However, the bzip68-2 apparently

causes a similar effect to that by the bzip68-1 mutation on the overall the

transcriptome profiles (Fig 3.11).

47

Figure 3.11 A heat map of transcriptome profiles of wt and the mutant

seedlings of bzip68-1 and bzip68-2.

The heat map show of the differential expressed genes based on comparisons

between the wt and the bzip68 mutants. Their relative expression levels in each of

the three replicates are shown in color with red pixels as an indication of a higher

transcript level and green a lower level in the mutants. The genes expressed

differentially tended to show more similar expression profiles in the mutants than

48

in the wt seedlings and the difference between bzip68-1 and wt was more striking

than that between bzip68-2 and wt.

49

The genes whose expression levels differed more than 2 folds (with a FDR of

smaller than 0.05) are regarded as “differentially expressed genes” in the thesis.

Overall, bzip68-1 and bzip68-2 exhibited more similar global gene expression

profiles compared to the wt profile. However, the differences in the expression

levels of those differentially expressed genes tended to be more striking between

bzip68-1 and wt than those between bzip68-2 and wt (Fig 3.11), indicating that

bzip68-1 is a stronger allele than bzip68-2.

Gene ontology (GO) enrichment analysis (Table 3.1) revealed that the most

significantly enriched GO terms among the genes expressed at a higher level in

the bzip68-1 are “oxidative stress responsive genes and defense responsive genes”.

Table 3.2 lists the differentially expressed genes that belong to the GO terms

related to stress response such as defense response and oxidative stress responses.

These groups of genes showed similar profiles in bzip68-1 and bzip68-2 mutants

compared to that of wt (Fig 3.12A-3.12B).

Among the genes encoding for antioxidant system are two methionine

sulfoxide reductase which are involved in reducing oxidized methionines of a

protein, a GST, two peroxidases, two myo-inositol oxygenases (MIOXs) that are

involved in ascorbate synthesis, and several Abscisic acid (ABA) and

pathogen-responsive genes (Table 3.3). The expression levels of the few

differentially expressed genes were further examined by quantitative real time

RT-PCR (qPCR), the results were consistent with those from the RNA-seq

analysis (Fig 3.13).

50

Table 3.1 Gene ontology (GO) categories enriched among the genes expressed at higher levels in bzip68-1 and bzip68-2 than in wildtype.

Data set GO ID Term Count PValue Fold

Enrichment Benjamini

bzip68-1/

wildtype

GO:0019825 oxygen binding 31 3.07E-06 2.59 2.24E-04

GO:0006952 defense response 99 5.97E-09 1.81 6.89E-07

GO:0006955 immune response 39 2.70E-07 2.51 1.76E-05

GO:0045087 innate immune response 36 1.25E-06 2.47 6.84E-05

GO:0006979 response to oxidative stress 31 2.85E-04 2.04 8.67E-03

bzip68-2/

wildtype

GO:0045454 cell redox homeostasis 13 2.88E-03 2.74 9.83E-02

GO:0006979 response to oxidative stress 20 3.11E-03 2.11 9.76E-02

GO:0006800

oxygen and reactive oxygen species metabolic

process 11 3.16E-03 3.06 9.57E-02

GO:0042744 hydrogen peroxide catabolic process 10 1.89E-03 3.56 8.31E-02

GO:0070301 cellular response to hydrogen peroxide 10 1.89E-03 3.56 8.31E-02

GO:0006955 immune response 24 1.09E-04 2.48 7.46E-03

GO:0016667

oxidoreductase activity, acting on sulfur group of

donors 13 1.24E-04 3.89 5.29E-03

GO:0015035 protein disulfide oxidoreductase activity 10 4.23E-05 5.87 2.72E-03

GO:0030613

oxidoreductase activity, acting on phosphorus or

arsenic in donors 6 4.78E-05 13.59 2.63E-03

GO:0055114 oxidation reduction 72 5.00E-07 1.84 8.24E-05

51

Significantly enriched GO terms with FDR of enrichment scores is less than 0.05 among the high-confidence bZIP68 regulation genes by

Molecular Function. Numbers of “count” means the median read count of genes in category. “Fold enrichment” indicates the function of

intensity.

52

53

Figure 3.12 The heat maps of expression profiles of the differentially

expressed genes between wt and bzip68-1 and bzip68-2 in the categories of

oxidative stress response (A) and defense response (B).

54

Table 3.2 Differentially expressed genes between wt and the bzip68 mutants that were shown in the heat map (Fig 3.12).

Gene ID Gene names 68-1/WT 68-2/WT Gene Description

Antioxidant system

AT1G14540 PER4 16.2 8.3 Peroxidase superfamily protein

AT1G68850 PER11 1.2 0.0 Peroxidase superfamily protein

AT2G18150 PER15 1.8 0.3 Peroxidase superfamily protein

AT2G24800 PER18 4.2 0.5 Peroxidase superfamily protein

AT2G37130 PER21 1.0 0.3 Peroxidase superfamily protein

AT2G38380 PER22 2.7 1.1 Peroxidase superfamily protein

AT2G38390 PER23 2.2 0.5 Peroxidase superfamily protein

AT3G01420 ALPHA-DOX1 2.0 2.2 Peroxidase superfamily protein

AT3G13750 BGAL1 1.4 0.5 beta galactosidase 1

AT3G28200 PER31 1.7 1.1 Peroxidase superfamily protein

AT4G08770 Prx37 0.0 2.2 Peroxidase superfamily protein

AT4G30170 PER45 0.6 7.3 Peroxidase family protein

AT4G33420 PER47 1.2 0.5 Peroxidase superfamily protein

AT4G36430 PER49 2.1 0.6 Peroxidase superfamily protein

AT5G05340 PER52 0.3 1.1 Peroxidase superfamily protein

AT5G17820 PER57 0.0 3.5 Peroxidase superfamily protein

AT5G19880 PER58 0.0 5.8 Peroxidase superfamily protein

AT5G39580 PER62 23.3 18.3 Peroxidase superfamily protein

AT5G47000 PER65 2.9 8.2 Peroxidase superfamily protein

55

AT5G64120 PER71 2.9 0.8 Peroxidase superfamily protein

Redox response

AT1G06620

5.1 1.3 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily

protein

AT1G13080 CYP71B2 1.3 0.4 cytochrome P450, family 71, subfamily B, polypeptide 2

AT1G17420 LOX3 6.1 1.4 lipoxygenase 3

AT1G17745 PGDH 0.4 1.3 D-3-phosphoglycerate dehydrogenase

AT1G19630 CYP722A1 1.7 1.1 cytochrome P450, family 722, subfamily A, polypeptide 1

AT1G25230 PAP4 1.2 0.5 Calcineurin-like metallo-phosphoesterase superfamily protein

AT1G29690 CAD1 2.3 2.2 MAC/Perforin domain-containing protein

AT1G64500

1.3 0.5 Glutaredoxin family protein

AT1G65860 FMO GS-OX1 1.4 1.1 flavin-monooxygenase glucosinolate S-oxygenase 1

AT1G66540

1.4 0.3 Cytochrome P450 superfamily protein

AT1G72520 LOX4 8.0 4.0 PLAT/LH2 domain-containing lipoxygenase family protein

AT1G72610 GLP1 2.3 0.9 germin-like protein 1

AT1G77760 NIA1 0.5 1.6 nitrate reductase 1

AT2G06050 OPR3 5.8 1.3 oxophytodienoate-reductase 3

AT2G19800 MIOX2 12.6 7.2 myo-inositol oxygenase 2

AT2G22330 CYP79B3 3.5 1.7 cytochrome P450, family 79, subfamily B, polypeptide 3

AT2G27690 CYP94C1 3.9 1.6 cytochrome P450, family 94, subfamily C, polypeptide 1

AT2G29090 CYP707A2 1.3 0.7 cytochrome P450, family 707, subfamily A, polypeptide 2

AT2G29350 SAG13 0.0 3.6 senescence-associated gene 13

AT2G34770 FAH1 2.3 1.0 fatty acid hydroxylase 1

AT2G37130 PER21 1.0 0.3 Peroxidase superfamily protein

AT2G42580 TTL3 2.6 1.1 tetratricopetide-repeat thioredoxin-like 3

56

AT3G03470 CYP89A9 0.0 1.1 cytochrome P450, family 87, subfamily A, polypeptide 9

AT3G13750 BGAL1 1.4 0.5 beta galactosidase 1

AT3G26290 CYP71B26 1.1 0.5 cytochrome P450, family 71, subfamily B, polypeptide 26

AT3G28200 PER31 1.7 1.1 Peroxidase superfamily protein

AT3G30775 ERD5 5.8 2.7 Methylenetetrahydrofolate reductase family protein

AT4G04840 ATMSRB6 2.3 1.7 methionine sulfoxide reductase B6

AT4G12290

0.1 1.3 Copper amine oxidase family protein

AT4G14690 ELIP2 0.0 1.5 Chlorophyll A-B binding family protein

AT4G15690 GRXS5 0.8 1.5 Thioredoxin superfamily protein

AT4G15700 GRXS3 1.1 1.9 Thioredoxin superfamily protein

AT4G20830

1.3 0.8 FAD-binding Berberine family protein

AT4G21850 ATMSRB9 4.4 1.5 methionine sulfoxide reductase B9

AT4G22880 LDOX 1.1 0.5 leucoanthocyanidin dioxygenase

AT4G30210 ATR2 1.3 0.8 P450 reductase 2 [Source:TAIR__Acc:AT4G30210]

AT4G31500 CYP83B1 1.0 0.1 cytochrome P450, family 83, subfamily B, polypeptide 1

AT4G33040 GRXC6 2.3 2.2 Thioredoxin superfamily protein

AT4G33420 PER47 1.2 0.5 Peroxidase superfamily protein

AT4G37320 CYP81D5 1.1 0.5 cytochrome P450, family 81, subfamily D, polypeptide 5

AT4G37370 CYP81D8 1.2 0.1 cytochrome P450, family 81, subfamily D, polypeptide 8

AT5G05600

5.0 0.4 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily

protein

AT5G06690 WCRKC1 1.3 0.5 WCRKC thioredoxin 1

AT5G07440 GDH2 3.6 1.6 glutamate dehydrogenase 2

AT5G15350 ENODL17 1.5 1.6 early nodulin-like protein 17

AT5G20230 ATBCB 3.5 2.1 blue-copper-binding protein

57

AT5G24030 SLAH3 8.3 4.4 SLAC1 homologue 3

AT5G36220 CYP81D1 0.0 1.0 cytochrome p450 81d1

AT5G44070 CAD1 1.2 0.7 phytochelatin synthase 1 (PCS1)

AT5G45340 CYP707A3 1.5 2.8 cytochrome P450, family 707, subfamily A, polypeptide 3

AT5G52320 CYP96A4 3.5 0.5 cytochrome P450, family 96, subfamily A, polypeptide 4

AT5G57220 CYP81F2 2.3 1.9 cytochrome P450, family 81, subfamily F, polypeptide 2

AT5G61440 ACHT5 0.5 1.8 atypical CYS HIS rich thioredoxin 5

AT5G63450 CYP94B1 7.2 2.1 cytochrome P450, family 94, subfamily B, polypeptide 1

AT5G64120 PER71 2.9 0.8 Peroxidase superfamily protein

Defense response

AT1G14870 PCR2 2.7 0.4 PLANT CADMIUM RESISTANCE 2

AT1G17380 JAZ5 3.1 0.9 jasmonate-zim-domain protein 5

AT1G17420 LOX3 6.1 1.4 lipoxygenase 3

AT1G19020

3.2 1.8 unknown protein

AT1G19180 TIFY10A 1.5 0.3 jasmonate-zim-domain protein 1

AT1G19630 CYP722A1 1.7 1.1 cytochrome P450, family 722, subfamily A, polypeptide 1

AT1G21250 WAK1 0.0 2.2 cell wall-associated kinase

AT1G27770 ACA1 2.2 1.8 autoinhibited Ca2+-ATPase 1

AT1G28380 NSL1 1.6 0.7 MAC/Perforin domain-containing protein

AT1G29690 CAD1 2.3 2.2 MAC/Perforin domain-containing protein

AT1G52200 PCR8 2.5 0.2 PLAC8 family protein

AT1G52410 TSA1 1.0 0.1 TSK-associating protein 1

AT1G56510 WRR4 1.8 1.0 Disease resistance protein (TIR-NBS-LRR class)

AT1G59870 PEN3 2.1 0.4 ABC-2 and Plant PDR ABC-type transporter family protein

AT1G61100

2.6 1.5 disease resistance protein (TIR class), putative

58

AT1G63750

3.3 2.6 Disease resistance protein (TIR-NBS-LRR class) family

AT1G63860

5.8 3.1 Disease resistance protein (TIR-NBS-LRR class) family

AT1G64760

1.8 1.4 O-Glycosyl hydrolases family 17 protein

AT1G66090

0.3 1.2 Disease resistance protein (TIR-NBS class)

AT1G70700 JAZ9 2.0 0.4 TIFY domain/Divergent CCT motif family protein

AT1G72060

2.6 0.3 serine-type endopeptidase inhibitors

AT1G72520 LOX4 8.0 4.0 PLAT/LH2 domain-containing lipoxygenase family protein

AT1G72920

1.8 0.2 Toll-Interleukin-Resistance (TIR) domain family protein

AT1G73080 PEPR1 2.1 0.8 PEP1 receptor 1

AT1G74950 JAZ2 2.2 0.4 TIFY domain/Divergent CCT motif family protein

AT1G75230

1.6 0.4 DNA glycosylase superfamily protein

AT1G76650 CML38 2.6 2.9 calmodulin-like 38

AT1G77760 NIA1 0.5 1.6 nitrate reductase 1

AT1G80130

0.9 1.4 Tetratricopeptide repeat (TPR)-like superfamily protein

AT2G01180 ATPAP1 2.6 2.0 phosphatidic acid phosphatase 1

AT2G13790 ATSERK4 1.5 0.3 somatic embryogenesis receptor-like kinase 4

AT2G17480 MLO8 1.4 0.5 Seven transmembrane MLO family protein

AT2G22330 CYP79B3 3.5 1.7 cytochrome P450, family 79, subfamily B, polypeptide 3

AT2G26560 PLP2 4.0 0.0 phospholipase A 2A

AT2G27500

1.7 1.0 Glycosyl hydrolase superfamily protein

AT2G27690 CYP94C1 3.9 1.6 cytochrome P450, family 94, subfamily C, polypeptide 1

AT2G34600 JAZ7 3.5 1.7 jasmonate-zim-domain protein 7

AT2G34770 FAH1 2.3 1.0 fatty acid hydroxylase 1

AT2G34930

2.1 0.4 disease resistance family protein / LRR family protein

AT2G35930 PUB23 1.1 1.0 plant U-box 23

59

AT2G37130 PER21 1.0 0.3 Peroxidase superfamily protein

AT2G41100 TCH3 2.9 2.3 Calcium-binding EF hand family protein

AT2G41110 CAM2 1.7 1.0 calmodulin 2

AT2G43290 MSS3 1.6 1.2 Calcium-binding EF-hand family protein

AT2G43530 ATTI3 1.4 0.0 Scorpion toxin-like knottin superfamily protein

AT2G43550 ATTI6 1.5 1.0 Scorpion toxin-like knottin superfamily protein

AT3G03190 ATGSTF11 1.2 2.2 glutathione S-transferase F11

AT3G03470 CYP89A9 0.0 1.1 cytochrome P450, family 87, subfamily A, polypeptide 9

AT3G10300 CML49 3.3 1.1 Calcium-binding EF-hand family protein

AT3G13750 BGAL1 1.4 0.5 beta galactosidase 1

AT3G15210 ATERF-4 2.1 1.0 ethylene responsive element binding factor 4

AT3G17860 JAZ3 2.6 0.6 jasmonate-zim-domain protein 3

AT3G28200 PER31 1.7 1.1 Peroxidase superfamily protein

AT3G30775 ERD5 5.8 2.7 Methylenetetrahydrofolate reductase family protein

AT3G44300 NIT2 0.0 3.7 nitrilase 2

AT3G47340 ASN1 7.1 3.2 glutamine-dependent asparagine synthase 1

AT3G48360 BT2 5.5 6.5 BTB and TAZ domain protein 2

AT3G52400 SYP122 2.4 1.4 syntaxin of plants 122

AT3G57530 CPK32 0.9 1.2 calcium-dependent protein kinase 32

AT4G01250 WRKY22 1.4 1.5 WRKY family transcription factor

AT4G02380 SAG21 1.4 0.4 senescence-associated gene 21

AT4G12720 NUDT7 1.4 1.0 MutT/nudix family protein

AT4G14400 ACD6 1.0 4.4 ankyrin repeat family protein

AT4G14690 ELIP2 0.0 1.5 Chlorophyll A-B binding family protein

AT4G19520

3.4 1.3 disease resistance protein (TIR-NBS-LRR class) family

60

AT4G19530

1.4 0.6 disease resistance protein (TIR-NBS-LRR class) family

AT4G20110 VSR7 0.0 1.6 VACUOLAR SORTING RECEPTOR 7

AT4G20260 ATPCAP1 1.1 0.2 plasma-membrane associated cation-binding protein 1

AT4G20830

1.3 0.8 FAD-binding Berberine family protein

AT4G23190 CRK11 1.7 1.1 cysteine-rich RLK (RECEPTOR-like protein kinase) 11

AT4G26850 VTC2 1.2 0.4 mannose-1-phosphate guanylyltransferase (GDP)s__GDP-galactose

AT4G31500 CYP83B1 1.0 0.1 cytochrome P450, family 83, subfamily B, polypeptide 1

AT4G31800 WRKY18 9.5 3.9 WRKY DNA-binding protein 18

AT4G33420 PER47 1.2 0.5 Peroxidase superfamily protein

AT4G34410 RRTF1 7.7 3.5 redox responsive transcription factor 1

AT4G35770 SEN1 3.5 0.6 Rhodanese/Cell cycle control phosphatase superfamily protein

AT5G06860 PGIP1 1.1 0.4 polygalacturonase inhibiting protein 1

AT5G06870 PGIP2 2.9 0.6 polygalacturonase inhibiting protein 2

AT5G07440 GDH2 3.6 1.6 glutamate dehydrogenase 2

AT5G13220 JAZ10 6.9 2.4 jasmonate-zim-domain protein 10

AT5G20230 ATBCB 3.5 2.1 blue-copper-binding protein

AT5G22690

3.6 2.3 Disease resistance protein (TIR-NBS-LRR class) family

AT5G26220

0.8 1.0 ChaC-like family protein

AT5G36220 CYP81D1 0.0 1.0 cytochrome p450 81d1

AT5G37770 TCH2 1.6 2.0 EF hand calcium-binding protein family

AT5G41740

0.6 1.5 Disease resistance protein (TIR-NBS-LRR class) family

AT5G41750

1.5 0.5 Disease resistance protein (TIR-NBS-LRR class) family

AT5G44070 CAD1 1.2 0.7 phytochelatin synthase 1 (PCS1

AT5G44420 PDF1.2 0.0 5.1 plant defensin 1.2

AT5G45340 CYP707A3 1.5 2.8 cytochrome P450, family 707, subfamily A, polypeptide 3

61

The numbers indicate fold changes of the gene expression levels between bzip68 mutants and WT.

AT5G45380 ATDUR3 0.2 2.1 solute:sodium symporters__urea transmembrane transporters

AT5G47230 ERF5 2.8 0.6 ethylene responsive element binding factor 5

AT5G48850 ATSDI1 0.9 1.4 Tetratricopeptide repeat (TPR)-like superfamily protein

AT5G57220 CYP81F2 2.3 1.9 cytochrome P450, family 81, subfamily F, polypeptide 2

AT5G58120

0.9 1.0 Disease resistance protein (TIR-NBS-LRR class) family

AT5G59780 MYB59 0.4 1.4 myb domain protein 59

AT5G61600 ERF104 4.7 0.7 ethylene response factor 104

AT5G63450 CYP94B1 7.2 2.1 cytochrome P450, family 94, subfamily B, polypeptide 1

AT5G64120 PER71 2.9 0.8 Peroxidase superfamily protein

AT5G66210 CPK28 2.8 2.1 calcium-dependent protein kinase 28

AT5G67300 ATMYBR1 1.9 1.3 myb domain protein r1

62

Table 3.3 Examples of antioxidant genes and stress response genes that were expressed at the higher levels in the bzip68 mutants

compared with the WT plants.

Gene ID Gene names bzip68-1/WT bzip68-2/WT Functions

AT5G39580 PER62 18.4 11.3 Peroxidase superfamily protein

AT2G19800 MIOX2 9.2 5.3 myo-inositol oxygenase 2; ascorbate synthesis

AT1G35140 PHI-1 7.5 7.0 Phosphate-responsive 1 family protein

AT1G64380 ERF061 7.0 2.6 Integrase-type DNA-binding protein

AT4G31800 WRKY18 6.1 3.5 WRKY DNA-binding protein 18

AT4G21830 ATMSRB7 6.1 4.3 methionine sulfoxide reductase

AT1G09950 RAS1 6.1 2.8 RESPONSE TO ABA AND SALT 1

AT1G14540 PER4 5.7 5.3 Peroxidase superfamily protein

The numbers indicate fold changes of the gene expression levels between bzip68 mutants and WT.

63

64

Figure 3.13 qRT-PCR analysis of selective stress-related genes.

(A), defense related gene (B), stress response genes (C, D) in wt, bzip68-1 and

bzip68-2 seedlings to identify the RNA-SEQ data. Error bars indicate standard

deviation from three biological repeats. (t test; *P< 0.05, **P<0.01).

65

We also generated transcriptome profiles of the wt and mutant seedlings that were

under the treatment with 5 mM H2O2 for 90 minutes. Many genes that were

expressed at higher levels in the bzip68 mutants under the normal condition were

found to be among the ROS-responsive genes (Fig 3.14). Table 3.1 list the

differentially expressed genes related to stress response under H2O2 treatment

between wt and bzip68 mutants, and the differences in their expression levels

between mock treated and H2O2-treated in wt seedlings (S Table 3.1).

Figure 3.14 Venn diagram comparisons of differentially expressed genes.

Numbers of defense related genes (left panel), antioxidant genes (middle panel),

and oxidative stress responses (right panel) that were expressed at a higher level

in the bzip68 mutants than in wt under the normal condition in comparison with

the numbers of those groups of genes that were induced by ROS in the wt

seedling.

66

3.4 The bzip68 mutant showed an enhanced response to the oxidative stress

treatment

When growing in soil or the solid growth medium under the normal growth

condition, the bzip68 mutant plants were slightly smaller than wt plants and

showed a slight delay in flowering (Fig 3.15A-3.15D). The bzip68-1 mutant

morphological phenotype under the normal condition was genetically

complemented by the genomic clone of bZIP68. (Fig 3.15E, 3.15F).

67

Figure 3.15 The morphology of the bzip68 mutants under the normal

conditions.

The bzip68-1 mutant plants were slightly smaller than WT plants and displayed a

delay in flowering time. The plant were grown for 3 weeks and 5 weeks under

long day (A and B, respectively), and short day (C and D, respectively) in soil.

The bzip68-1 mutant plant which carried the bZIP68 transgene showed no

morphological difference from the wt seedlings at 3 weeks (E) and 5 weeks (F)

under long day condition.

68

To determine whether the bzip68 mutations alter the oxidative stress response and

tolerance, oxidative stress was introduced to wt and the mutant seedlings by

growing them on the agar medium with or without tertiary-butyl hydroperoxide

(TBHP). TBHP causes oxidative stress by production of ROS and/or by depletion

of reduced form of GSH. TBHP is much more stable than H2O2, making it more

suitable than H2O2 for a phenotypic analysis described here which involve long

term oxidative stress treatment. In presence of 0.4 mM TBHP in the growth

medium, the seedlings accumulated more anthocyanin and showed growth

retardation for both the wt and mutant seedlings (Fig 3.16A-3.16B). Anthocyanins

and other flavonoids are known to act as antioxidants in plants and anthocyanin

accumulation is a characteristic response of plants to environmental stresses.

Genes involved in anthocyanin biosynthesis are regulated by hydrogen peroxide

and various stresses (Vanderauwera et al., 2005; Fini et al., 2011). More

anthocyanin accumulation was displayed in the bzip68-1 seedlings than in the wt

seedlings under the oxidative stress (Fig 3.16a1-3.16b3). Besides, under the stress,

the bzip68-1 seedlings showed more reduced growth than the wt seedlings. The

phenotypic difference between the bzip68-2 seedlings and the wt seedlings was

not very obvious. The bzip68-1 mutant transformed with a genomic clone of

bZIP68 was found to have a phenotype indistinguishable from the wt seedlings

under the normal conditions and under the TBHP treatment (Fig 3.16C-3.16D),

indicating again that the bzip68 phenotype is caused by a loss-of-function

mutation of the bZIP68 gene.

69

Figure 3.16 The morphological phenotypes of wt and bzip68-1 seedlings

under oxidative stress.

Wt and mutant seedlings on the growth medium without (A) and with (B) 0.4 mM

tert-Butyl hydroperoxide (TBHP). The bzip68-1 seedlings displayed enhanced

accumulation of anthocyanin and smaller than wt seedlings under the TBHP. (C)

The close up views of some seedlings shown in A and B. (D) and (E) shows the

bzip68-1 phenotype were complemented by transforming the mutant with the

bZIP68 genomic clone. The seedlings were 7 days old under the long day

condition.

70

3.5 The bzip68-1 mutant showed an enhanced stress response under cold

Anthocyanin accumulation is known to be induced by cold. When wt and bzip68

seeds were germinated and the seedling grew under 15C, more pronounced purple

pigmentation was seen in the bzip68-1 seedlings than in the wt seedlings (Fig

3.17A-3.17D). Seedling growth was also more reduced under the low temperature

for the mutant than the wt. The phenotypic difference was more obvious when

seedlings were grown on vertical plates (Fig 3.17E). The purple color

accumulation and grown retardation were also observed in soil grown bzip68-1

(Fig 3.17H-3.17M). The bzip68-1 mutant phenotype under the cold stress can also

be genetically complemented by the genomic clone of bZIP68 (Fig 3.17G).

To examine whether the subcellular localization of bZIP68 might alter under

the cold stress, the bZIP68-eYFP seedlings were placed under 4 ºC and the YFP

signal was observed. We observed some level of the YFP signal in both the

cytoplasm and nuclei after several hours of the cold treatment (Fig 3.17N).

71

72

73

Figure 3.17 The phenotypes of wt and bzip68-1 mutant under cold stress.

7-days and 15 days old seedlings under normal temperature (A, E) and 15 ºC (B,

C, F) respectively. (D) The close up views of some seedlings shown in A, B and C.

74

(G) Complementation of the mutant phenotype by the genomic clone of bZIP68.

(H-J) Seedlings grown under 15ºC in soil. (Q) A portion of a 10 days old seedling

of the 35S::bZIP68-eYFP line which was grown in normal temperature and then

placed at 4ºC for overnight before observing for YFP signal.

75

Chapter 4 Discussion

Aerobic organisms are under constant threat by ROS. Adverse environmental

conditions result in excessive production of ROS that damage biomolecules,

leading to oxidative stress. Living organisms have evolved complex mechanisms

to sense various oxidative stresses to activate an appropriate physiological and

developmental response. Redox signaling is apparently initiated by

redox-sensitive proteins whose function can be switched on and off by its

reduction/oxidation and eventually leads to activation of genes encoding for

proteins involved in enhancing the cellular reducing potential, in detoxification of

ROS, and in repairing ROS-induced damage.

In Escherichia coli a transcription factor called OxyR is required for the

induction of H2O2 response genes (156). H2O2 activates OxyR by formation of

intramolecular disulfide linkages between Cys-199 and Cys-208. Disulfide bond

formation presumably causes a conformational change in OxyR that results in

enhanced DNA binding and the activation of H2O2 response genes (216, 217). In

yeast, Yap1, which is a bZIP protein, is normally localized in the cytosol. Upon,

oxidative stress, Yap1 is oxidized that results in its translocation to nuclei and the

subsequent induction of a number of genes involved in combating oxidative stress

including thioredoxin system genes. As the levels of H2O2 subside, disulfides of

oxidized Yap1 protein are reduced by thioredoxin, resulting in cytoplasmic

localization of Yap1 and loss of Yap1-dependent gene expression.

4.1 bZIP68 directly or indirectly senses perturbation of cellular redox states

We previously found that Cys320 of the Arabidopsis bZIP68 underwent reversible

oxidation in Arabidopsis cells upon H2O2 treatment. In this study, it was found

bZIP68 is localized in nuclei under normal growth condition but some of them

were found in the cytoplasm in the seedlings treated with H2O2. The change of

subcellular localization of bZIP68 under oxidative stress is dependent on the

76

redox-sensitive Cys320 and the intact NES, and mutations in Cys320 and the NES

cause bZIP68 to be constitutively nuclear, indicating that the localization are

controlled through redox control and regulated nuclear export.

There are several mechanisms to regulate signal/importin-dependent nuclear

protein transport, enhanced by phosphorylation, and inhibited by intermolecular

or phosphorylation masking of targeting signals (218). Short NES peptides can

mediate export when fused to the N-terminus of a reporter protein, and preference

of a-helical structure in NES regions, which may use for new protein interaction

(214). Importantly, in yeast, a bZIP transcription factor Pap1 is required for

inducing oxidative stress response gene on imposition of oxidative stress. Pap1 is

also regulated by changes in subcellular localization in response to oxidative

stress. The nuclear-cytoplasmic shuttling of Pap1 is mediated by CRM1/exportin1

(219). In addition, two cysteine (Cys278 and Cys501) in Pap1 are subject to

reversible modification during redox sensing (220). What’s more, bZIP10 in

Arabidopsis are also compromised by LMB treatment. bZIP10 is involved in

pathogen-induced HR and basal defense response and may be have a function in

oxidative stress signaling as it could partially rescues pap1 (221). The oxidative

stress of Yap1 leads to the modification of NES that can be recognized by export

receptor Crm1/Xpo1, which is important for the nuclear export of Yap1 (163). For

the well-known redox sensor in NPR1, the nuclear translocation which induced by

redox changes are required for the induction of defense gene.

Our findings suggests that bZIP68 might directly or indirectly sense cellular

redox status, and the Cys320 and NES dependent nucleocytoplasmic shuttling

involved in fulfilling the function of a redox sensor. Nucleocytoplasmic shuttling

is a common phenomenon for redox sensors as mentioned earlier in the case of

YAP1 mediated redox control.

77

4.2 bZIP68 links the redox change to activation of oxidative stress defense

genes through redox regulation of transcription

The loss-of-function mutation of bZIP68 causes elevated expression of many

stress-related genes, indicating that bZIP68 plays a role of a transcriptional

repressor that suppresses a range of oxidative stress response genes under the

normal growth conditions. Our results suggest that oxidation of bZIP68 under

oxidative stress apparently causes its conformational change and its NES is then

recognized by exportin, leading to its shuttling from nuclei to cytoplasm, resulting

in de-repression of the stress-responsive genes. The genes that are suppressed by

bZIP68 include those that encodes for antioxidant proteins such as methionine

sulfoxide reductases which are involved in reduced oxidized methionine

(ATMSRB7), a GST (ATGSTF11), two myo-inositol oxygenases (MIOX1, MIOX2)

that are involved in ascorbate synthesis. About 25% differentially expressed genes

between the bzip68 mutant and wt seedlings are predicted to be involved in

defense.

4.3 bZIP68 mediates plant abiotic stress responses

Different environmental stresses might lead to different oxidative stresses that

differ in ROS species, concentration, subcellular distribution, and duration of the

imposed stress. Therefore, cellular responses might be fine-tuned toward different

oxidative stresses through multiple pathways that coordinate to regulate shared

and different sets of target genes. Such a regulation might be coordinated by

several redox-sensitive transcription factors whose redox states might are

differentially altered under different ROS stresses.

The bZIP68 mutations was found to accumulate a much higher level of

anthocyanins under cold stress than wt plants, indicating a stronger oxidative

stress response caused by the cold treatment. bZIP-eYFP was also found to

undergo nucleocytoplasmic shuttling when the seedlings were placed under 4ºC

78

for several hours. These results also indicate that bZIP68 plays a role in

responding to cold stress. It is likely that the cold treatment also disturbs redox

homeostasis that is sensed by bZIP68. Its oxidation and translocation to the

cytoplasm helps transcriptional reprogramming to cope with the cold stress.

4.4 Conclusion and Working model

Figure 4.1 is our working to explain the mode of action of bZIP68. Under the

normal condition, bZIP68 is translocated to nuclei mediated by recognition of its

NLS by importin where it acts as a suppressor to inhibit the expression of some

oxidative stress response gene. Under oxidative stress, bZIP68 undergoes

reversible oxidative modification which may alter its conformation and exposes

its NES that is then recognized by exportin for its translocation to the cytoplasm.

Redistribution of bZIP68 can lead to some level of relieving of its suppressed

gene. The degree of its oxidation and relative nucleus-cytoplasm distribution are

likely dependent on types and severity of environmental stresses, thereby

fine-tuning transcription regulation of stress response genes. When the

environment returns to normal, oxidized bZIP68 may be reduced by another

protein (such as a thioredoxin) that results in its shuttling back to nuclei to again

suppress stress response genes.

79

Figure 4.1 A working model on the molecular mode of action of bZIP68.

bZIP68 is predicted to be in the nucleus as it contains a nuclear localization signal

(NLS). In normal condition, bZIP68 acts as a suppressor to inhibit the expression

of some ROS-responsive genes. While, bZIP68 also contains a nuclear export

signal (NES) which may be blocked under normal condition, under oxidative

stress, bZIP68 undergo reversible oxidative modification which may relieve the

block of those specific genes, leading to the expression of those genes for the

acclimation processes, the other consequence of the changes of conformation is:

the nuclear export signal (NES) was recognized in oxidized conformation, the

exposed NES allow the oxidized bZIP68 transport from the nucleus to the

cytoplasm through nuclear pores. In the cytoplasm, the oxidized bZIP68 may be

reduced by other proteins.

80

Although ours and previous studies on in vitro sensitivity of bZIP68 to ROS

suggests that bZIP68 could be a direct sensor of cellular redox states, we could

not rule out the possibility that another protein such as thioredoxin might sense

oxidative stress and becomes oxidized, which then causes oxidation of bZIP68.

Similarly, it is expected that oxidized bZIP68 will be reduced likely by another

protein when cellular redox state returns to normal. Reduced bZIP68 exposes its

NLS region which is recognized by importin for its shuttling back into nuclei.

Either directly or indirectly, bZIP68 apparently is a key player in sensing cellular

redox states and modulating expression of oxidative stress response genes.

In addition to bZIP68, we also identified GBF1 as a redox-sensitive protein

that underwent reversible oxidation of its thiol in the H2O2-stressed cells in

previous work. The redox-sensitive cysteines in bZIP68 and GBF1 are in the

conserved region. In addition, bZIP16 and other GBF proteins are also known to

be redox-sensitive at least in the in-vitro conditions. These bZIP proteins are

grouped into the F subgroup due to their high sequence similarity. These bZIP

subfamily members were found to form heterodimmers with each other. It is

possible that this bZIP transcriptional factors response to different oxidative

stresses to coordinate oxidative stress responses by redox control of transcription

of different target genes.

To further understand the role of bZIP68, we are carrying out chromatin

immunoprecipitation (ChIP) followed by high-throughput DNA sequencing

(ChIP-seq) to identify direct target genes controlled by bZIP68. The identification

of its direct targets and analysis of expression patterns of those target genes under

various stress conditions will further shed light on the mechanisms of

transcriptional regulation of the stress response mediated by bZIP68.

81

Supplementary Table 1 Differentially expressed genes between wt and the bzip68 mutants under H2O2 treatment and the differences in their

expression levels between mock and treated and ROS-treated seedlings.

Gene ID Gene names

WT

ROS

T/Mock

ROS

Treatment

bzip68-1/WT

ROS

Treatment

bzip68-2/WT

Gene Description

AT1G55010 PDF1.5 -8.6 6.9 8.9 plant defensin 1.5

AT3G25880

-10.0 5.2 7.4 NAD(P)-binding Rossmann-fold superfamily protein

AT1G63522

-7.6 5.9 7.3 Defensin-like (DEFL) family protein

AT4G11393

-7.9 5.7 5.7 Defensin-like (DEFL) family protein

AT5G18050

-4.0 4.0 5.5 SAUR-like auxin-responsive protein family

AT5G67010 ERF121 -3.2 3.3 5.4 Integrase-type DNA-binding superfamily protein

AT3G53200 AtMYB27 -5.5 4.9 4.9 myb domain protein 27

AT3G22360 AOX1B -4.2 3.8 4.4 alternative oxidase 1B

AT4G37500

-5.1 3.7 4.3 Aldehyde oxidase/xanthine dehydrogenase,

molybdopterin binding protein

AT5G57420 IAA33 -5.0 4.0 4.3 indole-3-acetic acid inducible 33

AT2G04395 POT1C -1.5 1.7 4.1 Nucleic acid-binding, OB-fold-like protein

AT5G18010

-2.8 3.4 3.9 SAUR-like auxin-responsive protein family

AT3G24510

-4.0 4.7 3.7 Defensin-like (DEFL) family protein

AT4G22217

-4.3 3.1 2.9 Arabidopsis defensin-like protein

AT2G21260

-2.1 0.3 2.8 NAD(P)-linked oxidoreductase superfamily protein

AT1G49715

-1.5 2.9 2.6 Defensin-like (DEFL) family protein

82

AT1G29420

-2.8 3.0 2.5 SAUR-like auxin-responsive protein family

AT1G55290 F6'H2 -2.2 0.7 2.4 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase

superfamily protein

AT1G26870 FEZ -2.5 1.6 2.4 NAC (No Apical Meristem) domain transcriptional

regulator superfamily protein

AT3G56700 FAR6 0.3 -2.3 2.4 fatty acid reductase 6

AT5G56550 OXS3 0.3 2.3 2.4 oxidative stress 3

AT3G49630

-1.2 1.2 2.2 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase

superfamily protein

AT1G66370 MYB113 2.6 3.1 2.2 myb domain protein 113

AT2G30670

-1.5 1.9 2.2 NAD(P)-binding Rossmann-fold superfamily protein

AT1G24010

-1.8 2.4 2.0 Polyketide cyclase/dehydrase and lipid transport

superfamily protein

AT2G45130 ATSPX3 -2.4 2.2 2.0 SPX domain gene 3

AT1G12630 ERF027 -1.9 2.5 1.9 Integrase-type DNA-binding superfamily protein

AT1G62886

-2.8 -6.2 1.9 Nucleotide excision repair, TFIIH, subunit TTDA

AT2G17770 BZIP27 -2.0 1.5 1.9 basic region/leucine zipper motif 27

AT1G63390

-3.0 0.6 1.9 FAD/NAD(P)-binding oxidoreductase family protein

AT2G24850 TAT3 -1.3 2.3 1.9 tyrosine aminotransferase 3

AT5G42580 CYP705A12 -1.8 1.4 1.8 cytochrome P450, family 705, subfamily A, polypeptide

12

AT1G51802

-0.3 0.7 1.8 Encodes a defensin-like (DEFL) family protein.

AT3G23240 ERF1 2.3 1.6 1.8 ethylene response factor 1

AT2G07727 MT-CYB -2.3 2.8 1.7 Di-haem cytochrome, transmembrane__Cytochrome

b/b6, C-terminal

83

AT3G21460 GRXS10 -1.8 2.6 1.6 Glutaredoxin family protein

AT2G42885

-1.1 -4.5 1.6 Defensin-like (DEFL) family protein

AT3G13403

-1.8 1.6 1.6 Defensin-like (DEFL) family protein

AT5G13220 JAZ10 0.5 1.1 1.6 jasmonate-zim-domain protein 10

AT4G22620

-0.2 1.6 1.5 SAUR-like auxin-responsive protein family

AT1G26410

0.5 0.9 1.5 FAD-binding Berberine family protein

AT2G24940 AtMAPR2 -1.8 1.8 1.5 membrane-associated progesterone binding protein 2

AT3G03820

-2.8 0.4 1.5 SAUR-like auxin-responsive protein family

AT3G27831

-0.7 1.5 1.4 Gamma-thionin family protein

AT5G57450 XRCC3 -1.3 1.4 1.4 homolog of X-ray repair cross complementing 3

(XRCC3)

AT1G13608

7.1 -7.1 1.4 Defensin-like (DEFL) family protein

AT4G15680 GRXS4 -2.0 0.7 1.4 Thioredoxin superfamily protein

AT3G62960 GRXC14 0.1 0.0 1.4 Thioredoxin superfamily protein

AT4G19050

-0.2 0.7 1.4 NB-ARC domain-containing disease resistance protein

AT5G45240

0.1 0.9 1.4 Disease resistance protein (TIR-NBS-LRR class)

AT1G47510 AT5PTASE11 2.6 0.6 1.3 inositol polyphosphate 5-phosphatase 11

AT1G19830

-1.2 -0.5 1.3 SAUR-like auxin-responsive protein family

AT2G38340 DREB19 0.4 1.1 1.3 Integrase-type DNA-binding superfamily protein

AT1G03020 GRXS1 -0.7 1.2 1.3 Thioredoxin superfamily protein

AT5G48170 SLY2 -1.0 0.9 1.3 F-box family protein

AT1G75490 DREB2D -0.1 1.9 1.3 Integrase-type DNA-binding superfamily protein

AT4G25560 AtMYB18 -1.7 2.5 1.3 myb domain protein 18

AT5G40090

-1.8 1.0 1.2 Disease resistance protein (TIR-NBS class)

AT1G64195

0.4 1.3 1.2 Defensin-like (DEFL) family protein

84

AT1G80555

0.2 0.8 1.2 Isocitrate/isopropylmalate dehydrogenase family protein

AT3G12955

-1.9 1.3 1.2 SAUR-like auxin-responsive protein family

AT1G29440

-2.7 1.4 1.2 SAUR-like auxin-responsive protein family

AT1G10810

-0.7 0.3 1.1 NAD(P)-linked oxidoreductase superfamily protein

AT3G61400

-2.2 1.3 1.1 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase

superfamily protein

AT3G02000 ROXY1 -0.5 0.7 1.1 Thioredoxin superfamily protein

AT2G30770 CYP71A13 0.2 0.8 1.1 cytochrome P450, family 71, subfamily A, polypeptide 13

AT5G25370 PLDALPHA3 -0.9 1.2 1.1 phospholipase D alpha 3

AT2G28085

-0.7 1.1 1.1 SAUR-like auxin-responsive protein family

AT2G45900

-2.0 1.2 1.1 Phosphatidylinositol N-acetyglucosaminlytransferase

subunit P-related

AT1G75590

-0.9 0.7 1.1 SAUR-like auxin-responsive protein family

AT5G04330

-0.9 1.0 1.1 Cytochrome P450 superfamily protein

AT1G29500

-1.8 0.5 1.1 SAUR-like auxin-responsive protein family

AT1G30135 JAZ8 2.3 0.1 1.0 jasmonate-zim-domain protein 8

AT2G47190 ATMYB2 3.6 -0.6 1.0 myb domain protein 2

AT2G01090

-1.5 1.0 1.0 Ubiquinol-cytochrome C reductase hinge protein

AT2G12190

0.1 0.9 -1.0 Cytochrome P450 superfamily protein

AT4G37340 CYP81D3 -1.5 -0.8 -1.0 cytochrome P450, family 81, subfamily D, polypeptide 3

AT1G70860

-0.5 -0.6 -1.0 Polyketide cyclase/dehydrase and lipid transport

superfamily protein

AT5G56860 GNC -1.0 -0.4 -1.0 GATA type zinc finger transcription factor family protein

AT4G15380 CYP705A4 -1.2 -0.6 -1.0 cytochrome P450, family 705, subfamily A, polypeptide 4

AT1G48000 MYB112 -0.1 0.0 -1.1 myb domain protein 112

85

AT5G12870 ATMYB46 0.3 -0.3 -1.1 myb domain protein 46

AT3G61250 AtMYB17 0.0 -0.2 -1.1 myb domain protein 17

AT3G16360 AHP4 0.0 0.0 -1.1 HPT phosphotransmitter 4

AT1G31772

0.3 -7.1 -1.1 Defensin-like (DEFL) family protein

AT1G72950

1.6 -0.6 -1.2 Disease resistance protein (TIR-NBS class)

AT2G07671

-0.4 -0.1 -1.2 ATP synthase subunit C family protein

AT4G37580 HLS1 -0.3 0.1 -1.2 Acyl-CoA N-acyltransferases (NAT) superfamily protein

AT1G13150 CYP86C4 -0.1 -0.3 -1.2 cytochrome P450, family 86, subfamily C, polypeptide 4

AT2G02147 LCR73 1.2 0.7 -1.2 low-molecular-weight cysteine-rich 73

AT3G46130 ATMYB48-1 -1.2 -0.4 -1.2 myb domain protein 48

AT3G08040 FRD3 -1.0 0.0 -1.3 MATE efflux family protein

AT4G11210

-1.8 -0.5 -1.3 Disease resistance-responsive (dirigent-like protein)

family protein

AT5G16600 MYB43 -0.2 -0.8 -1.3 myb domain protein 43

AT5G19880 PER58 1.9 -0.3 -1.3 Peroxidase superfamily protein

AT3G61890 ATHB-12 0.8 -1.1 -1.3 homeobox 12

AT4G30064 LCR61 7.4 -0.8 -1.3 low-molecular-weight cysteine-rich 61

AT1G29450

-0.1 -1.1 -1.3 SAUR-like auxin-responsive protein family

AT3G53250

1.7 -0.8 -1.3 SAUR-like auxin-responsive protein family

AT3G46490

-0.1 0.2 -1.4 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase

superfamily protein

AT1G63370

-0.5 -1.5 -1.5 Flavin-binding monooxygenase family protein

AT1G80100 AHP6 -0.5 -1.4 -1.5 histidine phosphotransfer protein 6

AT5G63580 FLS2 0.3 -0.2 -1.5 flavonol synthase 2

AT2G37700

-1.5 0.5 -1.5 Fatty acid hydroxylase superfamily

86

AT1G33660

-0.3 -1.1 -1.6 peroxidase family protein

AT3G63360

0.1 -0.6 -1.7 defensin-related

AT3G26125 CYP86C2 1.1 -0.6 -1.7 cytochrome P450, family 86, subfamily C, polypeptide 2

AT1G03120 ATRAB28 0.1 -0.9 -1.8 responsive to abscisic acid 28

AT2G41480 PER25 -1.3 -1.0 -1.9 Peroxidase superfamily protein

AT1G47990 ATGA2OX4 1.5 -0.7 -2.0 gibberellin 2-oxidase 4

AT5G27780

7.8 -7.8 -2.0 SAUR-like auxin-responsive protein family

AT1G66030 CYP96A14P -1.3 -5.0 -2.1 cytochrome P450, family 96, subfamily A, polypeptide 14

pseudogene

AT1G53130 GRI -0.3 -0.4 -2.1 Stigma-specific Stig1 family protein

AT5G48905 LCR12 0.3 -0.9 -2.2 low-molecular-weight cysteine-rich 12

AT1G76190

1.3 -2.0 -2.3 SAUR-like auxin-responsive protein family

AT1G62580

1.0 -1.5 -2.3 Flavin-binding monooxygenase family protein

AT1G43040

2.0 -0.1 -2.5 SAUR-like auxin-responsive protein family

AT3G56380 ARR17 -1.5 0.6 -2.6 response regulator 17

AT1G79800 ENODL7 2.2 -2.0 -2.6 early nodulin-like protein 7

AT5G51310

-0.5 -1.1 -2.7 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase

superfamily protein

AT5G06470

2.6 -6.5 -2.9 Glutaredoxin family protein

AT2G45550 CYP76C4 1.3 0.1 -3.0 cytochrome P450, family 76, subfamily C, polypeptide 4

AT1G30990

-0.7 -1.0 -3.1 Polyketide cyclase/dehydrase and lipid transport

superfamily protein

AT3G55310

2.4 -1.4 -3.1 NAD(P)-binding Rossmann-fold superfamily protein

AT2G14920 ATST4A 1.0 -4.0 -3.3 sulfotransferase 4A

AT3G32920

-0.3 -2.9 -3.7 P-loop containing nucleoside triphosphate hydrolases

87

superfamily protein

AT1G48940 ENODL6 0.9 -4.4 -4.4 early nodulin-like protein 6

AT1G57850

-1.7 -0.1 -4.7 Toll-Interleukin-Resistance (TIR) domain family protein

AT4G18823

4.7 -4.7 -4.7 Defensin-like (DEFL) family protein

AT5G08315

4.9 -4.9 -4.9 Defensin-like (DEFL) family protein

AT1G35537

1.5 -0.7 -5.4 Defensin-like (DEFL) family protein

AT1G77093

5.5 -5.5 -5.5 Defensin-like (DEFL) family protein

AT2G20350 ERF120 1.4 -0.6 -5.8 Integrase-type DNA-binding superfamily protein

AT3G17675

5.8 -1.3 -5.8 Cupredoxin superfamily protein

AT3G04903

5.9 -5.9 -5.9 Defensin-like (DEFL) family protein

AT2G31953 LCR76 -0.5 -6.0 -6.0 low-molecular-weight cysteine-rich 76

AT1G66380 MYB114 1.4 -1.6 -6.6 myb domain protein 114

AT3G06985 LCR44 -0.3 -0.3 -6.9 low-molecular-weight cysteine-rich 44

AT1G64107

0.4 -0.4 -7.5 Putative membrane lipoprotein

The numbers indicate fold changes of the gene expression levels between bzip68 mutants and WT.

88

List of References

1. Apel K & Hirt H (2004) Reactive oxygen species: metabolism, oxidative

stress, and signal transduction. Annu Rev Plant Biol 55:373-399.

2. Dalton TP, Shertzer HG, & Puga A (1999) Regulation of gene expression

by reactive oxygen. Annu Rev Pharmacol Toxicol 39:67-101.

3. Nathan C & Ding A (2010) SnapShot: Reactive Oxygen Intermediates

(ROI). Cell 140(6):951-951 e952.

4. Niyogi KK (1999) PHOTOPROTECTION REVISITED: Genetic and

Molecular Approaches. Annu Rev Plant Physiol Plant Mol Biol

50:333-359.

5. Chinnusamy V, Zhu J, & Zhu JK (2007) Cold stress regulation of gene

expression in plants. Trends in Plant Science 12(10):444-451.

6. Lamb C & Dixon RA (1997) The Oxidative Burst in Plant Disease

Resistance. Annu Rev Plant Physiol Plant Mol Biol 48:251-275.

7. Jansen MAK, Gaba V, & Greenberg BM (1998) Higher plants and UV-B

radiation: balancing damage, repair and acclimation. Trends in Plant

Science 3(4):131-135.

8. Kotak S, et al. (2007) Complexity of the heat stress response in plants.

Curr Opin Plant Biol 10(3):310-316.

9. Ramachandra Reddy A, Chaitanya KV, & Vivekanandan M (2004)

Drought-induced responses of photosynthesis and antioxidant metabolism

in higher plants. J Plant Physiol 161(11):1189-1202.

10. Orozco-Cardenas ML, Narvaez-Vasquez J, & Ryan CA (2001) Hydrogen

peroxide acts as a second messenger for the induction of defense genes in

tomato plants in response to wounding, systemin, and methyl jasmonate.

Plant Cell 13(1):179-191.

11. Boudsocq M & Lauriere C (2005) Osmotic signaling in plants: multiple

pathways mediated by emerging kinase families. Plant Physiol

89

138(3):1185-1194.

12. Laloi C, Apel K, & Danon A (2004) Reactive oxygen signalling: the latest

news. Curr Opin Plant Biol 7(3):323-328.

13. Moller IM, Jensen PE, & Hansson A (2007) Oxidative modifications to

cellular components in plants. Annu Rev Plant Biol 58:459-481.

14. Scandalios JG (2005) Oxidative stress: molecular perception and

transduction of signals triggering antioxidant gene defenses. Braz J Med

Biol Res 38(7):995-1014.

15. Collins Y, et al. (2012) Mitochondrial redox signalling at a glance. J Cell

Sci 125(Pt 4):801-806.

16. Finkel T (2011) Signal transduction by reactive oxygen species. J Cell Biol

194(1):7-15.

17. Gechev TS, Van Breusegem F, Stone JM, Denev I, & Laloi C (2006)

Reactive oxygen species as signals that modulate plant stress responses

and programmed cell death. Bioessays 28(11):1091-1101.

18. Xiong L, Schumaker KS, & Zhu JK (2002) Cell signaling during cold,

drought, and salt stress. Plant Cell 14 Suppl:S165-183.

19. Torres MA, Jones JD, & Dangl JL (2006) Reactive oxygen species

signaling in response to pathogens. Plant Physiol 141(2):373-378.

20. Giorgio M, Trinei M, Migliaccio E, & Pelicci PG (2007) Hydrogen

peroxide: a metabolic by-product or a common mediator of ageing signals?

Nat Rev Mol Cell Biol 8(9):722-728.

21. Sierla M, Rahikainen M, Salojarvi J, Kangasjarvi J, & Kangasjarvi S

(2013) Apoplastic and chloroplastic redox signaling networks in plant

stress responses. Antioxid Redox Signal 18(16):2220-2239.

22. Murphy MP (2009) How mitochondria produce reactive oxygen species.

Biochem J 417(1):1-13.

23. Fleury C, Mignotte B, & Vayssiere JL (2002) Mitochondrial reactive

oxygen species in cell death signaling. Biochimie 84(2-3):131-141.

24. Jastroch M, Divakaruni AS, Mookerjee S, Treberg JR, & Brand MD (2010)

90

Mitochondrial proton and electron leaks. Essays Biochem 47:53-67.

25. Rochaix JD (2011) Reprint of: Regulation of photosynthetic electron

transport. Biochim Biophys Acta 1807(8):878-886.

26. Asada K (2006) Production and scavenging of reactive oxygen species in

chloroplasts and their functions. Plant Physiol 141(2):391-396.

27. Bedard K & Krause KH (2007) The NOX family of ROS-generating

NADPH oxidases: physiology and pathophysiology. Physiol Rev

87(1):245-313.

28. Sagi M & Fluhr R (2006) Production of reactive oxygen species by plant

NADPH oxidases. Plant Physiol 141(2):336-340.

29. Torres MA, Dangl JL, & Jones JD (2002) Arabidopsis gp91phox

homologues AtrbohD and AtrbohF are required for accumulation of

reactive oxygen intermediates in the plant defense response. Proc Natl

Acad Sci U S A 99(1):517-522.

30. Kawano T (2003) Roles of the reactive oxygen species-generating

peroxidase reactions in plant defense and growth induction. Plant Cell Rep

21(9):829-837.

31. del Rio LA, Sandalio LM, Corpas FJ, Palma JM, & Barroso JB (2006)

Reactive oxygen species and reactive nitrogen species in peroxisomes.

Production, scavenging, and role in cell signaling. Plant Physiol

141(2):330-335.

32. Chaki M, et al. (2009) Involvement of reactive nitrogen and oxygen

species (RNS and ROS) in sunflower-mildew interaction. Plant Cell

Physiol 50(2):265-279.

33. Wendehenne D, Pugin A, Klessig DF, & Durner J (2001) Nitric oxide:

comparative synthesis and signaling in animal and plant cells. Trends in

Plant Science 6(4):177-183.

34. Pallavi Sharma, Ambuj Bhushan Jha, Rama Shanker Dubey, & Pessarakli

aM (2012) Reactive Oxygen Species, Oxidative Damage, and

Antioxidative Defense Mechanism in Plants under Stressful Conditions.

91

Journal of Botany 10:26.

35. Valko M, et al. (2007) Free radicals and antioxidants in normal

physiological functions and human disease. Int J Biochem Cell Biol

39(1):44-84.

36. Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends

in Plant Science 7(9):405-410.

37. Rose RC & Bode AM (1993) Biology of free radical scavengers: an

evaluation of ascorbate. FASEB J 7(12):1135-1142.

38. Noctor G & Foyer CH (1998) ASCORBATE AND GLUTATHIONE:

Keeping Active Oxygen Under Control. Annu Rev Plant Physiol Plant Mol

Biol 49:249-279.

39. Alscher RG & Hess JL (1993) Antioxidants in higher plants (CRC Press,

Boca Raton) p 174 p.

40. Gupta SD (2011) Reactive oxygen species and antioxidants in higher

plants (Science Publishers; Distributed by CRC Press, Enfield, NH Boca

Raton, FL) pp xv, 368 p.

41. Nguyen T, Sherratt PJ, & Pickett CB (2003) Regulatory mechanisms

controlling gene expression mediated by the antioxidant response element.

Annu Rev Pharmacol 43:233-260.

42. Alscher RG, Donahue JL, & Cramer CL (1997) Reactive oxygen species

and antioxidants: Relationships in green cells. Physiol Plantarum

100(2):224-233.

43. Mittler R, Vanderauwera S, Gollery M, & Van Breusegem F (2004)

Reactive oxygen gene network of plants. Trends in Plant Science

9(10):490-498.

44. Scandalios JG (1993) Oxygen Stress and Superoxide Dismutases. Plant

Physiol 101(1):7-12.

45. Kliebenstein DJ, Monde RA, & Last RL (1998) Superoxide dismutase in

Arabidopsis: an eclectic enzyme family with disparate regulation and

protein localization. Plant Physiol 118(2):637-650.

92

46. Sunkar R, Kapoor A, & Zhu JK (2006) Posttranscriptional induction of

two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by

downregulation of miR398 and important for oxidative stress tolerance.

Plant Cell 18(8):2051-2065.

47. Halliwell B (2006) Reactive species and antioxidants. Redox biology is a

fundamental theme of aerobic life. Plant Physiology 141(2):312-322.

48. Bowler C, Vanmontagu M, & Inze D (1992) Superoxide-Dismutase and

Stress Tolerance. Annu Rev Plant Phys 43:83-116.

49. Rizhsky L, Liang HJ, & Mittler R (2003) The water-water cycle is

essential for chloroplast protection in the absence of stress. Journal of

Biological Chemistry 278(40):38921-38925.

50. Igor N. Zelko TJM, and Rodney J. Folz (2002) Superoxide dismutase

multigene family: a comparison of the CuZn-SOD (SOD1), Mn-SOD

(SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression.

Free Radical Biology & Medicine 33.

51. Frugoli JA, et al. (1996) Catalase is encoded by a multigene family in

Arabidopsis thaliana (L) Heynh. Plant Physiology 112(1):327-336.

52. Willekens H, Inze D, Vanmontagu M, & Vancamp W (1995) Catalases in

Plants. Mol Breeding 1(3):207-228.

53. Du YY, Wang PC, Chen J, & Song CP (2008) Comprehensive functional

analysis of the catalase gene family in Arabidopsis thaliana. J Integr Plant

Biol 50(10):1318-1326.

54. Queval G, et al. (2007) Conditional oxidative stress responses in the

Arabidopsis photorespiratory mutant cat2 demonstrate that redox state is a

key modulator of daylength-dependent gene expression, and define

photoperiod as a crucial factor in the regulation of H2O2-induced cell

death. Plant J 52(4):640-657.

55. Pavet V, et al. (2005) Ascorbic acid deficiency activates cell death and

disease resistance responses in Arabidopsis. Plant Physiol

139(3):1291-1303.

93

56. Conklin PL (2001) Recent advances in the role and biosynthesis of

ascorbic acid in plants. Plant Cell and Environment 24(4):383-394.

57. Foyer CH & Shigeoka S (2011) Understanding oxidative stress and

antioxidant functions to enhance photosynthesis. Plant Physiol

155(1):93-100.

58. Purr A (1934) The influence of vitamin C (ascorbic acid) on plant and

animal amylases. Biochem J 28(3):1141-1148.

59. Ishikawa T & Shigeoka S (2008) Recent advances in ascorbate

biosynthesis and the physiological significance of ascorbate peroxidase in

photosynthesizing organisms. Biosci Biotechnol Biochem

72(5):1143-1154.

60. Conklin PL, Williams EH, & Last RL (1996) Environmental stress

sensitivity of an ascorbic acid-deficient Arabidopsis mutant. Proc Natl

Acad Sci U S A 93(18):9970-9974.

61. Smirnoff N, Conklin PL, & Loewus FA (2001) Biosynthesis of ascorbic

acid in plants: A renaissance. Annu Rev Plant Phys 52:437.

62. Dowdle J, Ishikawa T, Gatzek S, Rolinski S, & Smirnoff N (2007) Two

genes in Arabidopsis thaliana encoding GDP-L-galactose phosphorylase

are required for ascorbate biosynthesis and seedling viability. Plant J

52(4):673-689.

63. Gao Y, et al. (2011) Expression analysis of the VTC2 and VTC5 genes

encoding GDP-L-galactose phosphorylase, an enzyme involved in

ascorbate biosynthesis, in Arabidopsis thaliana. Biosci Biotechnol Biochem

75(9):1783-1788.

64. Linster CL & Clarke SG (2008) L-Ascorbate biosynthesis in higher plants:

the role of VTC2. Trends in Plant Science 13(11):567-573.

65. Foyer CH & Halliwell B (1976) The presence of glutathione and

glutathione reductase in chloroplasts: A proposed role in ascorbic acid

metabolism. Planta 133(1):21-25.

66. May MJ, Vernoux T, Leaver C, Van Montagu M, & Inze D (1998)

94

Glutathione homeostasis in plants: implications for environmental sensing

and plant development. Journal of Experimental Botany 49(321):649-667.

67. Noctor G, Gomez L, Vanacker H, & Foyer CH (2002) Interactions

between biosynthesis, compartmentation and transport in the control of

glutathione homeostasis and signalling. Journal of Experimental Botany

53(372):1283-1304.

68. Rotruck JT, et al. (1973) Selenium: biochemical role as a component of

glutathione peroxidase. Science 179(4073):588-590.

69. Noctor G, Arisi ACM, & Foyer CH (1997) Interactions between

glutathione biosynthesis and photorespiration in poplar. Plant Physiology

114(3):198-198.

70. Ball L, et al. (2004) Evidence for a direct link between glutathione

biosynthesis and stress defense gene expression in Arabidopsis. Plant Cell

16(9):2448-2462.

71. Chen W, Chao G, & Singh KB (1996) The promoter of a H2O2-inducible,

Arabidopsis glutathione S-transferase gene contains closely linked OBF-

and OBP1-binding sites. Plant J 10(6):955-966.

72. Dixon DP, Lapthorn A, & Edwards R (2002) Plant glutathione transferases.

Genome Biol 3(3):REVIEWS3004.

73. Dixon DP, Skipsey M, Grundy NM, & Edwards R (2005) Stress-induced

protein S-glutathionylation in Arabidopsis. Plant Physiol

138(4):2233-2244.

74. Bela K, et al. (2015) Plant glutathione peroxidases: emerging role of the

antioxidant enzymes in plant development and stress responses. J Plant

Physiol 176:192-201.

75. Miao Y, et al. (2006) An Arabidopsis glutathione peroxidase functions as

both a redox transducer and a scavenger in abscisic acid and drought stress

responses. Plant Cell 18(10):2749-2766.

76. Moller IM (2001) PLANT MITOCHONDRIA AND OXIDATIVE

STRESS: Electron Transport, NADPH Turnover, and Metabolism of

95

Reactive Oxygen Species. Annu Rev Plant Physiol Plant Mol Biol

52:561-591.

77. Asada K (1999) THE WATER-WATER CYCLE IN CHLOROPLASTS:

Scavenging of Active Oxygens and Dissipation of Excess Photons. Annu

Rev Plant Physiol Plant Mol Biol 50:601-639.

78. Noctor G, et al. (2012) Glutathione in plants: an integrated overview.

Plant Cell Environ 35(2):454-484.

79. Ushimaru T, et al. (1997) Induction of enzymes involved in the

ascorbate-dependent antioxidative system, namely, ascorbate peroxidase,

monodehydroascorbate reductase and dehydroascorbate reductase, after

exposure to air of rice (Oryza sativa) seedlings germinated under water.

Plant and Cell Physiology 38(5):541-549.

80. Shigeoka S, et al. (2002) Regulation and function of ascorbate peroxidase

isoenzymes. J Exp Bot 53(372):1305-1319.

81. Panchuk, II, Zentgraf U, & Volkov RA (2005) Expression of the Apx gene

family during leaf senescence of Arabidopsis thaliana. Planta

222(5):926-932.

82. Davletova S, et al. (2005) Cytosolic ascorbate peroxidase 1 is a central

component of the reactive oxygen gene network of Arabidopsis. Plant Cell

17(1):268-281.

83. Pnueli L, Liang H, Rozenberg M, & Mittler R (2003) Growth suppression,

altered stomatal responses, and augmented induction of heat shock

proteins in cytosolic ascorbate peroxidase (Apx1)-deficient Arabidopsis

plants. Plant J 34(2):187-203.

84. Karpinski S, Escobar C, Karpinska B, Creissen G, & Mullineaux PM

(1997) Photosynthetic electron transport regulates the expression of

cytosolic ascorbate peroxidase genes in Arabidopsis during excess light

stress. Plant Cell 9(4):627-640.

85. Burlakova EB, Krashakov SA, & Khrapova NG (1998) The role of

tocopherols in biomembrane lipid peroxidation. Membr Cell Biol

96

12(2):173-211.

86. Vanlerberghe GC (2013) Alternative oxidase: a mitochondrial respiratory

pathway to maintain metabolic and signaling homeostasis during abiotic

and biotic stress in plants. Int J Mol Sci 14(4):6805-6847.

87. Vanlerberghe GC & McIntosh L (1997) ALTERNATIVE OXIDASE:

From Gene to Function. Annu Rev Plant Physiol Plant Mol Biol

48:703-734.

88. Maxwell DP, Wang Y, & McIntosh L (1999) The alternative oxidase

lowers mitochondrial reactive oxygen production in plant cells. Proc Natl

Acad Sci U S A 96(14):8271-8276.

89. Umbach AL, Ng VS, & Siedow JN (2006) Regulation of plant alternative

oxidase activity: a tale of two cysteines. Biochim Biophys Acta

1757(2):135-142.

90. Wilson KE, et al. (2006) Energy balance, organellar redox status, and

acclimation to environmental stress. Can J Bot 84(9):1355-1370.

91. Dietz KJ (2011) Peroxiredoxins in plants and cyanobacteria. Antioxid

Redox Signal 15(4):1129-1159.

92. Hayashi M & Nishimura M (2003) Entering a new era of research on plant

peroxisomes. Curr Opin Plant Biol 6(6):577-582.

93. Baier M, Noctor G, Foyer CH, & Dietz KJ (2000) Antisense suppression

of 2-cysteine peroxiredoxin in Arabidopsis specifically enhances the

activities and expression of enzymes associated with ascorbate metabolism

but not glutathione metabolism. Plant Physiol 124(2):823-832.

94. Foreman J, et al. (2003) Reactive oxygen species produced by NADPH

oxidase regulate plant cell growth. Nature 422(6930):442-446.

95. Foyer CH & Noctor G (2005) Oxidant and antioxidant signalling in plants:

a re-evaluation of the concept of oxidative stress in a physiological context.

Plant, Cell & Environment 28(8):1056-1071.

96. Foyer CH & Noctor G (2009) Redox regulation in photosynthetic

organisms: signaling, acclimation, and practical implications. Antioxid

97

Redox Signal 11(4):861-905.

97. Buchanan BB & Balmer Y (2005) Redox regulation: a broadening horizon.

Annu Rev Plant Biol 56:187-220.

98. Buchanan BB (1991) Regulation of CO2 assimilation in oxygenic

photosynthesis: the ferredoxin/thioredoxin system. Perspective on its

discovery, present status, and future development. Arch Biochem Biophys

288(1):1-9.

99. Buchanan BB, Schurmann P, Decottignies P, & Lozano RM (1994)

Thioredoxin: a multifunctional regulatory protein with a bright future in

technology and medicine. Arch Biochem Biophys 314(2):257-260.

100. Grant CM (2001) Role of the glutathione/glutaredoxin and thioredoxin

systems in yeast growth and response to stress conditions. Mol Microbiol

39(3):533-541.

101. Sen CK & Packer L (1996) Antioxidant and redox regulation of gene

transcription. FASEB J 10(7):709-720.

102. Chiu J & Dawes IW (2012) Redox control of cell proliferation. Trends

Cell Biol 22(11):592-601.

103. Couturier J, Chibani K, Jacquot JP, & Rouhier N (2013) Cysteine-based

redox regulation and signaling in plants. Front Plant Sci 4:105.

104. Tu BP, Kudlicki A, Rowicka M, & McKnight SL (2005) Logic of the yeast

metabolic cycle: temporal compartmentalization of cellular processes.

Science 310(5751):1152-1158.

105. Schmidt R & Schippers JH (2015) ROS-mediated redox signaling during

cell differentiation in plants. Biochim Biophys Acta 1850(8):1497-1508.

106. Tsukagoshi H, Busch W, & Benfey PN (2010) Transcriptional regulation

of ROS controls transition from proliferation to differentiation in the root.

Cell 143(4):606-616.

107. De Pinto MC, Locato V, & De Gara L (2012) Redox regulation in plant

programmed cell death. Plant Cell Environ 35(2):234-244.

108. Foyer CH & Noctor G (2005) Redox homeostasis and antioxidant

98

signaling: a metabolic interface between stress perception and

physiological responses. Plant Cell 17(7):1866-1875.

109. Delledonne M, Zeier J, Marocco A, & Lamb C (2001) Signal interactions

between nitric oxide and reactive oxygen intermediates in the plant

hypersensitive disease resistance response. Proc Natl Acad Sci U S A

98(23):13454-13459.

110. Colavitti R & Finkel T (2005) Reactive oxygen species as mediators of

cellular senescence. IUBMB Life 57(4-5):277-281.

111. Khanna-Chopra R (2012) Leaf senescence and abiotic stresses share

reactive oxygen species-mediated chloroplast degradation. Protoplasma

249(3):469-481.

112. Scherz-Shouval R & Elazar Z (2007) ROS, mitochondria and the

regulation of autophagy. Trends Cell Biol 17(9):422-427.

113. Foyer CH & Noctor G (2013) Redox signaling in plants. Antioxid Redox

Signal 18(16):2087-2090.

114. Mittler R & Blumwald E (2015) The roles of ROS and ABA in systemic

acquired acclimation. Plant Cell 27(1):64-70.

115. Sticher L, Mauch-Mani B, & Metraux JP (1997) Systemic acquired

resistance. Annu Rev Phytopathol 35:235-270.

116. Durrant WE & Dong X (2004) Systemic acquired resistance. Annu Rev

Phytopathol 42:185-209.

117. Wang W, Vinocur B, & Altman A (2003) Plant responses to drought,

salinity and extreme temperatures: towards genetic engineering for stress

tolerance. Planta 218(1):1-14.

118. Suzuki N, Koussevitzky S, Mittler R, & Miller G (2012) ROS and redox

signalling in the response of plants to abiotic stress. Plant Cell Environ

35(2):259-270.

119. Atkin OK & Macherel D (2009) The crucial role of plant mitochondria in

orchestrating drought tolerance. Ann Bot 103(4):581-597.

120. Zer H & Ohad I (2003) Light, redox state, thylakoid-protein

99

phosphorylation and signaling gene expression. Trends Biochem Sci

28(9):467-470.

121. Dietzel L & Pfannschmidt T (2008) Photosynthetic acclimation to light

gradients in plant stands comes out of shade. Plant Signal Behav

3(12):1116-1118.

122. Murata N (1969) Control of excitation transfer in photosynthesis. I.

Light-induced change of chlorophyll a fluorescence in Porphyridium

cruentum. Biochim Biophys Acta 172(2):242-251.

123. Prasad TK, Anderson MD, & Stewart CR (1994) Acclimation, Hydrogen

Peroxide, and Abscisic Acid Protect Mitochondria against Irreversible

Chilling Injury in Maize Seedlings. Plant Physiol 105(2):619-627.

124. Jacoby RP, Taylor NL, & Millar AH (2011) The role of mitochondrial

respiration in salinity tolerance. Trends in Plant Science 16(11):614-623.

125. Vellosillo T, Vicente J, Kulasekaran S, Hamberg M, & Castresana C (2010)

Emerging complexity in reactive oxygen species production and signaling

during the response of plants to pathogens. Plant Physiol 154(2):444-448.

126. Low PS & Merida JR (1996) The oxidative burst in plant defense:

Function and signal transduction. Physiol Plantarum 96(3):533-542.

127. Levine A, Tenhaken R, Dixon R, & Lamb C (1994) H2O2 from the

oxidative burst orchestrates the plant hypersensitive disease resistance

response. Cell 79(4):583-593.

128. Apostol I, Heinstein PF, & Low PS (1989) Rapid Stimulation of an

Oxidative Burst during Elicitation of Cultured Plant-Cells - Role in

Defense and Signal Transduction. Plant Physiology 90(1):109-116.

129. Vanacker H, Carver TL, & Foyer CH (1998) Pathogen-induced changes in

the antioxidant status of the apoplast in barley leaves. Plant Physiol

117(3):1103-1114.

130. Rentel MC, et al. (2004) OXI1 kinase is necessary for oxidative

burst-mediated signalling in Arabidopsis. Nature 427(6977):858-861.

131. Delledonne M, Xia Y, Dixon RA, & Lamb C (1998) Nitric oxide functions

100

as a signal in plant disease resistance. Nature 394(6693):585-588.

132. Scheler C, Durner J, & Astier J (2013) Nitric oxide and reactive oxygen

species in plant biotic interactions. Curr Opin Plant Biol 16(4):534-539.

133. Baxter A, Mittler R, & Suzuki N (2014) ROS as key players in plant stress

signalling. Journal of Experimental Botany 65(5):1229-1240.

134. Fujita M, et al. (2006) Crosstalk between abiotic and biotic stress

responses: a current view from the points of convergence in the stress

signaling networks. Current Opinion in Plant Biology 9(4):436-442.

135. Krishnamurthy A & Rathinasabapathi B (2013) Oxidative stress tolerance

in plants. Plant Signaling & Behavior 8(10):e25761.

136. Achard P, Renou JP, Berthome R, Harberd NP, & Genschik P (2008) Plant

DELLAs restrain growth and promote survival of adversity by reducing

the levels of reactive oxygen species. Curr Biol 18(9):656-660.

137. Shirasu K, Nakajima H, Rajasekhar VK, Dixon RA, & Lamb C (1997)

Salicylic acid potentiates an agonist-dependent gain control that amplifies

pathogen signals in the activation of defense mechanisms. Plant Cell

9(2):261-270.

138. Ren D, Yang H, & Zhang S (2002) Cell death mediated by MAPK is

associated with hydrogen peroxide production in Arabidopsis. The Journal

of biological chemistry 277(1):559-565.

139. Pitzschke A & Hirt H (2006) Mitogen-activated protein kinases and

reactive oxygen species signaling in plants. Plant Physiol 141(2):351-356.

140. Ray PD, Huang BW, & Tsuji Y (2012) Reactive oxygen species (ROS)

homeostasis and redox regulation in cellular signaling. Cell Signal

24(5):981-990.

141. Meinhard M & Grill E (2001) Hydrogen peroxide is a regulator of ABI1, a

protein phosphatase 2C from Arabidopsis. Febs Letters 508(3):443-446.

142. Meinhard M, Rodriguez PL, & Grill E (2002) The sensitivity of ABI2 to

hydrogen peroxide links the abscisic acid-response regulator to redox

signalling. Planta 214(5):775-782.

101

143. Pantano C, Reynaert NL, van der Vliet A, & Janssen-Heininger YM (2006)

Redox-sensitive kinases of the nuclear factor-kappaB signaling pathway.

Antioxid Redox Signal 8(9-10):1791-1806.

144. Robinson KA, et al. (1999) Redox-sensitive protein phosphatase activity

regulates the phosphorylation state of p38 protein kinase in primary

astrocyte culture. J Neurosci Res 55(6):724-732.

145. Mittler R, et al. (2011) ROS signaling: the new wave? Trends in Plant

Science 16(6):300-309.

146. Wang H, Wang S, & Xia Y (2012) Identification and verification of

redox-sensitive proteins in Arabidopsis thaliana. Methods Mol Biol

876:83-94.

147. Ghezzi P & Bonetto V (2003) Redox proteomics: identification of

oxidatively modified proteins. Proteomics 3(7):1145-1153.

148. Poole LB, Karplus PA, & Claiborne A (2004) Protein sulfenic acids in

redox signaling. Annu Rev Pharmacol Toxicol 44:325-347.

149. Eaton P (2006) Protein thiol oxidation in health and disease: techniques for

measuring disulfides and related modifications in complex protein

mixtures. Free Radic Biol Med 40(11):1889-1899.

150. Leichert LI, et al. (2008) Quantifying changes in the thiol redox proteome

upon oxidative stress in vivo. Proc Natl Acad Sci U S A

105(24):8197-8202.

151. Brandes N, Reichmann D, Tienson H, Leichert LI, & Jakob U (2011)

Using quantitative redox proteomics to dissect the yeast redoxome. J Biol

Chem 286(48):41893-41903.

152. McDonagh B, et al. (2012) Application of iTRAQ Reagents to Relatively

Quantify the Reversible Redox State of Cysteine Residues. Int J

Proteomics 2012:514847.

153. Ong SE & Pandey A (2001) An evaluation of the use of two-dimensional

gel electrophoresis in proteomics. Biomol Eng 18(5):195-205.

154. Rinalducci S, Murgiano L, & Zolla L (2008) Redox proteomics: basic

102

principles and future perspectives for the detection of protein oxidation in

plants. J Exp Bot 59(14):3781-3801.

155. Marshall HE, Merchant K, & Stamler JS (2000) Nitrosation and oxidation

in the regulation of gene expression. FASEB J 14(13):1889-1900.

156. Storz G, Tartaglia LA, & Ames BN (1990) Transcriptional regulator of

oxidative stress-inducible genes: direct activation by oxidation. Science

248(4952):189-194.

157. Fuangthong M & Helmann JD (2002) The OhrR repressor senses organic

hydroperoxides by reversible formation of a cysteine-sulfenic acid

derivative. Proc Natl Acad Sci U S A 99(10):6690-6695.

158. Panmanee W, et al. (2002) OhrR, a transcription repressor that senses and

responds to changes in organic peroxide levels in Xanthomonas campestris

pv. phaseoli. Mol Microbiol 45(6):1647-1654.

159. Delaunay A, Isnard AD, & Toledano MB (2000) H2O2 sensing through

oxidation of the Yap1 transcription factor. EMBO J 19(19):5157-5166.

160. Wood MJ, Storz G, & Tjandra N (2004) Structural basis for redox

regulation of Yap1 transcription factor localization. Nature

430(7002):917-921.

161. Delaunay A, Pflieger D, Barrault MB, Vinh J, & Toledano MB (2002) A

thiol peroxidase is an H2O2 receptor and redox-transducer in gene

activation. Cell 111(4):471-481.

162. Okazaki S, Tachibana T, Naganuma A, Mano N, & Kuge S (2007)

Multistep disulfide bond formation in Yap1 is required for sensing and

transduction of H2O2 stress signal. Mol Cell 27(4):675-688.

163. Kuge S, Toda T, Iizuka N, & Nomoto A (1998) Crm1 (XpoI) dependent

nuclear export of the budding yeast transcription factor yAP-1 is sensitive

to oxidative stress. Genes Cells 3(8):521-532.

164. Macara IG (2001) Transport into and out of the nucleus. Microbiol Mol

Biol Rev 65(4):570-594.

165. Nakamura H, Nakamura K, & Yodoi J (1997) Redox regulation of cellular

103

activation. Annu Rev Immunol 15:351-369.

166. Hainaut P & Mann K (2001) Zinc binding and redox control of p53

structure and function. Antioxid Redox Signal 3(4):611-623.

167. Flohe L, Brigelius-Flohe R, Saliou C, Traber MG, & Packer L (1997)

Redox regulation of NF-kappa B activation. Free Radic Biol Med

22(6):1115-1126.

168. Hirota K, et al. (1999) Distinct roles of thioredoxin in the cytoplasm and

in the nucleus. A two-step mechanism of redox regulation of transcription

factor NF-kappaB. The Journal of biological chemistry

274(39):27891-27897.

169. Dietz KJ (2008) Redox signal integration: from stimulus to networks and

genes. Physiol Plant 133(3):459-468.

170. Tada Y, et al. (2008) Plant immunity requires conformational changes

[corrected] of NPR1 via S-nitrosylation and thioredoxins. Science

321(5891):952-956.

171. Kinkema M, Fan W, & Dong X (2000) Nuclear localization of NPR1 is

required for activation of PR gene expression. Plant Cell

12(12):2339-2350.

172. Fu ZQ, et al. (2012) NPR3 and NPR4 are receptors for the immune signal

salicylic acid in plants. Nature 486(7402):228-232.

173. Zhang Y, Fan W, Kinkema M, Li X, & Dong X (1999) Interaction of

NPR1 with basic leucine zipper protein transcription factors that bind

sequences required for salicylic acid induction of the PR-1 gene. Proc Natl

Acad Sci U S A 96(11):6523-6528.

174. Spoel SH, et al. (2003) NPR1 modulates cross-talk between salicylate- and

jasmonate-dependent defense pathways through a novel function in the

cytosol. Plant Cell 15(3):760-770.

175. Zhou M, et al. (2015) Redox rhythm reinforces the circadian clock to gate

immune response. Nature 523(7561):472-476.

176. Liu P, Zhang H, Wang H, & Xia Y (2014) Identification of redox-sensitive

104

cysteines in the Arabidopsis proteome using OxiTRAQ, a quantitative

redox proteomics method. Proteomics 14(6):750-762.

177. Ellenberger T (1994) Getting a grip on DNA recognition: structures of the

basic region leucine zipper, and the basic region helix-loop-helix

DNA-binding domains. Current Opinion in Structural Biology 4(1):12-21.

178. Schutze K, Harter K, & Chaban C (2008) Post-translational regulation of

plant bZIP factors. Trends in Plant Science 13(5):247-255.

179. Alves MS, et al. (2013) Plant bZIP Transcription Factors Responsive to

Pathogens: A Review. Int J Mol Sci 14(4):7815-7828.

180. Jakoby M, et al. (2002) bZIP transcription factors in Arabidopsis. Trends

in Plant Science 7(3):106-111.

181. Williams ME, Foster R, & Chua NH (1992) Sequences flanking the

hexameric G-box core CACGTG affect the specificity of protein binding.

Plant Cell 4(4):485-496.

182. Schindler U, Menkens AE, Beckmann H, Ecker JR, & Cashmore AR

(1992) Heterodimerization between Light-Regulated and Ubiquitously

Expressed Arabidopsis Gbf Bzip Proteins. Embo Journal 11(4):1261-1273.

183. Shen HS, Cao KM, & Wang XP (2008) AtbZIP16 and AtbZIP68, two new

members of GBFs, can interact with other G group bZIPs in Arabidopsis

thaliana. Bmb Rep 41(2):132-138.

184. Jakoby M, et al. (2002) bZIP transcription factors in Arabidopsis. Trends

in Plant Science 7(3):106-111.

185. Garreton V, Carpinelli J, Jordana X, & Holuigue L (2002) The as-1

promoter element is an oxidative stress-responsive element and salicylic

acid activates it via oxidative species. Plant Physiol 130(3):1516-1526.

186. Hsieh WP, Hsieh HL, & Wu SH (2012) Arabidopsis bZIP16 transcription

factor integrates light and hormone signaling pathways to regulate early

seedling development. Plant Cell 24(10):3997-4011.

187. Shen H, Cao K, & Wang X (2008) AtbZIP16 and AtbZIP68, two new

members of GBFs, can interact with other G group bZIPs in Arabidopsis

105

thaliana. BMB Rep 41(2):132-138.

188. Schindler U, Terzaghi W, Beckmann H, Kadesch T, & Cashmore AR (1992)

DNA binding site preferences and transcriptional activation properties of

the Arabidopsis transcription factor GBF1. EMBO J 11(4):1275-1289.

189. Shaikhali J, et al. (2012) Redox-mediated mechanisms regulate DNA

binding activity of the G-group of basic region leucine zipper (bZIP)

transcription factors in Arabidopsis. J Biol Chem 287(33):27510-27525.

190. Shaikhali J, et al. (2012) Redox-mediated Mechanisms Regulate DNA

Binding Activity of the G-group of Basic Region Leucine Zipper (bZIP)

Transcription Factors in Arabidopsis. Journal of Biological Chemistry

287(33):27510-27525.

191. Smykowski A, Zimmermann P, & Zentgraf U (2010) G-Box binding

factor1 reduces CATALASE2 expression and regulates the onset of leaf

senescence in Arabidopsis. Plant Physiol 153(3):1321-1331.

192. Mallappa C, Yadav V, Negi P, & Chattopadhyay S (2006) A basic leucine

zipper transcription factor, G-box-binding factor 1, regulates blue

light-mediated photomorphogenic growth in Arabidopsis. The Journal of

biological chemistry 281(31):22190-22199.

193. Terzaghi WB, Bertekap RL, Jr., & Cashmore AR (1997) Intracellular

localization of GBF proteins and blue light-induced import of GBF2

fusion proteins into the nucleus of cultured Arabidopsis and soybean cells.

Plant J 11(5):967-982.

194. Finkelstein RR & Lynch TJ (2000) The Arabidopsis abscisic acid response

gene ABI5 encodes a basic leucine zipper transcription factor. Plant Cell

12(4):599-609.

195. Lopez-Molina L, Mongrand S, McLachlin DT, Chait BT, & Chua NH

(2002) ABI5 acts downstream of ABI3 to execute an ABA-dependent

growth arrest during germination. Plant J 32(3):317-328.

196. Lopez-Molina L, Mongrand S, & Chua NH (2001) A postgermination

developmental arrest checkpoint is mediated by abscisic acid and requires

106

the ABI5 transcription factor in Arabidopsis. Proc Natl Acad Sci U S A

98(8):4782-4787.

197. Oyama T, Shimura Y, & Okada K (1997) The Arabidopsis HY5 gene

encodes a bZIP protein that regulates stimulus-induced development of

root and hypocotyl. Genes Dev 11(22):2983-2995.

198. Chattopadhyay S, Ang LH, Puente P, Deng XW, & Wei N (1998)

Arabidopsis bZIP protein HY5 directly interacts with light-responsive

promoters in mediating light control of gene expression. Plant Cell

10(5):673-683.

199. Ang LH, et al. (1998) Molecular interaction between COP1 and HY5

defines a regulatory switch for light control of Arabidopsis development.

Mol Cell 1(2):213-222.

200. Osterlund MT, Hardtke CS, Wei N, & Deng XW (2000) Targeted

destabilization of HY5 during light-regulated development of Arabidopsis.

Nature 405(6785):462-466.

201. Hardtke CS, et al. (2000) HY5 stability and activity in arabidopsis is

regulated by phosphorylation in its COP1 binding domain. EMBO J

19(18):4997-5006.

202. Fobert PR & Despres C (2005) Redox control of systemic acquired

resistance. Curr Opin Plant Biol 8(4):378-382.

203. Lindermayr C, Sell S, Muller B, Leister D, & Durner J (2010) Redox

regulation of the NPR1-TGA1 system of Arabidopsis thaliana by nitric

oxide. Plant Cell 22(8):2894-2907.

204. Mou Z, Fan W, & Dong X (2003) Inducers of plant systemic acquired

resistance regulate NPR1 function through redox changes. Cell

113(7):935-944.

205. Clough SJ & Bent AF (1998) Floral dip: a simplified method for

Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J

16(6):735-743.

206. Lu Y, et al. (2011) AtPPR2, an Arabidopsis pentatricopeptide repeat

107

protein, binds to plastid 23S rRNA and plays an important role in the first

mitotic division during gametogenesis and in cell proliferation during

embryogenesis. Plant J 67(1):13-25.

207. Ho SN, Hunt HD, Horton RM, Pullen JK, & Pease LR (1989)

Site-directed mutagenesis by overlap extension using the polymerase chain

reaction. Gene 77(1):51-59.

208. Jang BC, et al. (2003) Leptomycin B, an inhibitor of the nuclear export

receptor CRM1, inhibits COX-2 expression. The Journal of biological

chemistry 278(5):2773-2776.

209. Xia Y, Nikolau BJ, & Schnable PS (1996) Cloning and characterization of

CER2, an Arabidopsis gene that affects cuticular wax accumulation. Plant

Cell 8(8):1291-1304.

210. Trapnell C, Pachter L, & Salzberg SL (2009) TopHat: discovering splice

junctions with RNA-Seq. Bioinformatics 25(9):1105-1111.

211. Li R, et al. (2009) SOAP2: an improved ultrafast tool for short read

alignment. Bioinformatics 25(15):1966-1967.

212. Anders S, Pyl PT, & Huber W (2015) HTSeq--a Python framework to

work with high-throughput sequencing data. Bioinformatics

31(2):166-169.

213. Love MI, Huber W, & Anders S (2014) Moderated estimation of fold

change and dispersion for RNA-seq data with DESeq2. Genome Biol

15(12):550.

214. la Cour T, et al. (2004) Analysis and prediction of leucine-rich nuclear

export signals. Protein Eng Des Sel 17(6):527-536.

215. Haasen D, Kohler C, Neuhaus G, & Merkle T (1999) Nuclear export of

proteins in plants: AtXPO1 is the export receptor for leucine-rich nuclear

export signals in Arabidopsis thaliana. Plant J 20(6):695-705.

216. Zheng M, Aslund F, & Storz G (1998) Activation of the OxyR

transcription factor by reversible disulfide bond formation. Science

279(5357):1718-1721.

108

217. Zheng M & Storz G (2000) Redox sensing by prokaryotic transcription

factors. Biochem Pharmacol 59(1):1-6.

218. Jans DA, Xiao CY, & Lam MH (2000) Nuclear targeting signal

recognition: a key control point in nuclear transport? Bioessays

22(6):532-544.

219. Toone WM, et al. (1998) Regulation of the fission yeast transcription

factor Pap1 by oxidative stress: requirement for the nuclear export factor

Crm1 (Exportin) and the stress-activated MAP kinase Sty1/Spc1. Genes

Dev 12(10):1453-1463.

220. Castillo EA, et al. (2002) Diethylmaleate activates the transcription factor

Pap1 by covalent modification of critical cysteine residues. Mol Microbiol

45(1):243-254.

221. Kaminaka H, et al. (2006) bZIP10-LSD1 antagonism modulates basal

defense and cell death in Arabidopsis following infection. EMBO J

25(18):4400-4411.

109

Curriculum Vitae

Academic qualifications of the thesis author, Ms. LI Yimin:

Received the degree of Bachelor of Plant Protection from Northwest A&F

University of China, July 2007

Received the degree of Master of Plant Pathology from Northwest A&F

University of China, July 2010

June 2016