Infection, Genetics and Evolution 3 (2003) 159–163

Isolation of polymorphic microsatellite loci fromthe tapewormEchinococcus multilocularis�

Minoru Nakao∗, Yasuhito Sako, Akira ItoDepartment of Parasitology, Asahikawa Medical College, Asahikawa, Hokkaido 078-8510, Japan

Received 7 February 2003; received in revised form 28 March 2003; accepted 15 April 2003

Abstract

Two microsatellites were isolated from a genomic library ofEchinococcus multilocularis. The microsatellites, designated EMms1 andEMms2, consist of tandem repeats of CAC-trinucleotide unit. Southern blot hybridization suggests that each of them is a single locus.Using fox-derived wild tapeworms(N = 104), PCR-amplification of microsatellites was performed to assess the usefulness of these loci.We found four alleles of EMms1 and two alleles of EMms2. The heterozygosities observed were 10.6% in EMms1 and 7.7% in EMms2.The result suggests that both selfing and outcrossing occur in the adult stage ofE. multilocularis.© 2003 Elsevier Science B.V. All rights reserved.

Keywords: Echinococcus multilocularis; Microsatellite DNA; Heterozygosity

1. Introduction

Echinococcosis is important for public health in manycountries of the world. The causative agent is the tapeworm,Echinococcus granulosusor Echinococcus multilocularis,which develops in the small intestine of canine definitivehosts. Eggs from the tapeworms develop into cystic larvaein the viscera of intermediate hosts including humans. Thenatural intermediate hosts ofE. granulosusare ungulates,while those ofE. multilocularisare rodents. Both tapewormsare hermaphroditic organisms with an asexual proliferationto produce protoscoleces in the larval stage. This unique re-production process may be responsible for generating varia-tions in the genus.Smyth and Smyth (1964)suggested thatmutations are transmitted by self-fertilizing tapeworms andamplified by asexual proliferation in suitable intermediatehosts. On the other hand,Rausch (1967, 1985)argued thatthe tapeworms are normally cross-fertilizing and intraspe-cific variants arise by adaptation to various host species orby geographical isolation. Recent population genetic data in-dicate that outcrossing occurs rarely in populations of somegenetic variants ofE. granulosus(Lymbery et al., 1990,1997; Haag et al., 1999).

� Nucleotide sequence data reported in this paper are available in theDDBJ/EMBL/GenBank databases under the accession numbers AB100031and AB100032.

∗ Corresponding author. Tel.:+81-166-68-2422; fax:+81-166-68-2429.E-mail address:nakao@asahikawa-med.ac.jp (M. Nakao).

Molecular phylogenetic studies using mitochondrial DNA(mtDNA) sequences provide data on genetic variations at ahigher level inE. granulosusand a lower level inE. multi-locularis(Bowles et al., 1992; Bowles and McManus, 1993).The mtDNA-based genotyping is a useful tool for the epi-demiological study ofE. granulosus(Kamenetzky et al.,2002). However, the non-mendelian inheritance pattern ofmtDNA marker reduces its informative value in populationgenetics. The microsatellite DNA, short tandemly repeatedsequence (2–6 bp repetitive unit) widely dispersed in eu-karyotic genome, serves as an alternative DNA marker. Themicrosatellite polymorphism is due to the variable num-ber of short tandem repeats (Schlötterer, 2000). Amplifica-tion of microsatellite DNA by polymerase chain reaction(PCR) enables the analysis of allele length variation of in-dividuals within a population. In this study, we isolatedtwo microsatellite loci fromE. multilocularis, and evaluatedtheir usefulness in wild tapeworms collected from red foxes(Vulpes vulpes) in Hokkaido, Japan.

2. Materials and methods

2.1. Genome library, screening and sequencing

The larval stage ofE. multilocularisisolated from a natu-rally infected vole (Clethrionomys rufocanus) in Hokkaidohas been maintained in our laboratory by intraperitonealpassages using Mongolian gerbils (Meriones unguiculatus).

1567-1348/$ – see front matter © 2003 Elsevier Science B.V. All rights reserved.doi:10.1016/S1567-1348(03)00070-4

160 M. Nakao et al. / Infection, Genetics and Evolution 3 (2003) 159–163

Table 1Primer sequences and characteristics of two microsatellite loci inE. multilocularis tapeworms(N = 104)

Loci (accession no.) Sequences (5′–3′) of primer paira Repeat motifb No. of allelesobserved

Fragmentsizes (bp)

Heterozygosityobserved (%)

EMms1 (AB100031) F: ACATCGGTAGCCAATGCTGTGGT (CAC)2(CGC)2(CAC)15–(TAC)2(TAT)2

4 165, 168,171, 174

10.6

R: AGACGACTGATTCTAGTGGGAAGC

EMms2 (AB100032) F: AAGCAACTTCCACAGGCCTGACA (CAC)13 2 139, 142 7.7R: ACTTTTGTAATGATTTATGCCAG

a Forward (F) and reverse (R) primers.b Motif from original clone sequence.

Protoscoleces obtained from the intraperitoneal larval tissuewere used as a source for preparing DNA. Genomic DNAwas purified by a column kit (Genomic-tip 20/G; Qiagen,Hilden, Germany) and then cleaved withEcoRI (TakaraBiomedicals, Tokyo, Japan). Without size-fractionating,all cleaved fragments were ligated with dephosphorylated�gt10 arms (Takara Biomedicals). The recombinant DNAwas packaged with an in vitro packaging system (GigapackIII Gold; Stratagene, La Jolla, CA). The strain C600hfl ofEscherichia coliwas used as a host for the recombinantphages.

The genomic library was screened with a trinucleotidepolymer probe consisting of (CAC)12. An enhanced chemi-luminescence system (ECL 3′-oligolabeling and detectionsystem; Amersham Biosciences, Tokyo, Japan) was used forprobe labeling and plaque hybridization. Lambda DNAs,which were purified from positive clones by a column kit(Lambda mini kit; Qiagen), were directly sequenced. Forsequencing, we used a dye terminator cycle sequencingkit (DYEnamic ET terminator; Amersham Biosciences)and a fluorescent automated sequencer (ABI PRISM 377;PE Applied Biosystems, Foster City, CA). Both strandsof DNA were sequenced by primer walking. Sequencingreaction mixtures were primed with vector-encoded orcustom-synthesized primers.

2.2. Southern blot hybridization

Genomic DNA from protoscoleces ofE. multilocu-laris was digested withEcoRI, EcoRV, HindIII, PstI,StyI, BamHI or XbaI (Takara Biomedicals). ResultingDNA fragments were electrophoresed in 0.7% agarose gelwith Tris-acetate/EDTA buffer and transferred to a ny-lon membrane (Hybond-N+; Amersham Biosciences) bythe method ofSouthern (1975). DNA fragments immedi-ately upstream from CAC repeats (approximately 400 bpin length) were amplified by PCR and used as probes. Theprobes were labeled with an alkali phosphatase by usingan enhanced chemiluminescence system (AlkPhos directlabeling and detection system; Amersham Biosciences).Hybridization, subsequent washings and signal detection onautoradiographic films were done as recommended by themanufacturer.

2.3. Analysis of microsatellite alleles

Tapeworms ofE. multilocularis were provided by K.Takahashi, Hokkaido Institute of Public Health. These werecollected from 13 red foxes in 8 localities (Asahikawa,Iwamizawa, Nemuro, Furano, Yoichi, Imagane, Wakkanaiand Yakumo) of Hokkaido and preserved in 70% ethanoluntil use. Under a dissecting microscope, the tapewormspossessing three or four segments were selected and washedthree times with distilled water. Eight worms per each fox(total 104 worms) were used for analyzing microsatellitealleles. Each worm was lysed in 10�l of 0.02 N NaOH at95◦C for 10 min and the lysate was used as a template forPCR. Two sets of primer pair were designed from sequencesflanking CAC repeats (Table 1). The forward primer ofeach set was 5′-labeled with the fluorescence dye, 6-FAMor HEX (PE Applied Biosystems). PCR was carried outin a 25�l reaction mixture containing 1�l worm lysate,200�M of each dNTP, 0.2�M of each primer, 0.5 U ofTaq polymerase (ExTaq; Takara Biomedicals) and ExTaqreaction buffer. For PCR amplification, we employed 30thermal cycles with denaturing at 94◦C for 30 s, annealingat 55◦C for 30 s and extension at 72◦C for 30 s. PCR prod-ucts were diluted 1/10 in a loading dye (50% formamide,50 mg/ml blue dextran and 2 mM EDTA) containing a fluo-rescent size standard (Genescan 400HD (ROX); PE AppliedBiosystems). The loading cocktails were heated at 90◦Cfor 1 min and cooled on ice. Two microliter of each samplewas applied on a 36 cm long sequencing gel. Fluorescentsignals were detected using an ABI PRISM 377 sequencer.Based on the internal size standard, the length of each PCRproduct was determined with the 377 Genescan software(PE Applied Biosystems).

3. Results

Two microsatellite loci, designated EMms1 and EMms2,were isolated from the genomic library ofE. multilocularis(Table 1). Although the two clones of recombinant phagescontained 1.5 and 5.0 kb inserts, we partially sequencedthe flanking regions of microsatellites. The lengths of se-quences determined were 864 bp in EMms1 and 894 bp in

M. Nakao et al. / Infection, Genetics and Evolution 3 (2003) 159–163 161

Fig. 1. Southern blot hybridizations ofE. multilocularis genomic DNA digested with each of seven restriction enzymes. The blot was hybridized with(A) EMms1 and (B) EMms2 probes.

EMms2. The BLAST homology search of DNA databases(http://blast.genome.ad.jp) showed no similarities in thesesequences. The microsatellite sequences consisted of thetandem repeat of CAC-trinucleotide. Transitional substitu-tions occurred in the repetitive units of EMms1. Southernblot hybridizations using probes flanking the CAC repeatswere performed to examine whether the sequenced regionis a single locus (Fig. 1). The probes were hybridized witha single DNA fragment digested with each of seven restric-tion enzymes. TheStyI-digested DNA blot, which was hy-bridized with EMms2 probe, showed two bands becausethe probe-binding region includes aStyI site. These results

Table 2Frequencies of microsatellite alleles ofE. multilocularis tapeworms collected from individual foxes in eight localities of Hokkaido

Fox no. Localities No. of wormsexamined

No. of worms identified (%)

Allele of EMms1 Allele of EMms2

Homo 165 Homo 168 Hetero 165+ 168 Hetero 171+ 174 Homo 142 Hetero 139+ 142

F1 Asahikawa 8 0 (0) 0 (0) 0 (0) 8 (100) 8 (100) 0 (0)F2a Asahikawa 8 0 (0) 7 (87.5) 1 (12.5) 0 (0) 8 (100) 0 (0)F3a Asahikawa 8 6 (75.0) 2 (25.0) 0 (0) 0 (0) 8 (100) 0 (0)F4a Asahikawa 8 6 (75.0) 1 (12.5) 1 (12.5) 0 (0) 8 (100) 0 (0)F5 Iwamizawa 8 0 (0) 8 (100) 0 (0) 0 (0) 8 (100) 0 (0)F6a Iwamizawa 8 0 (0) 7 (87.5) 1 (12.5) 0 (0) 8 (100) 0 (0)F7 Nemuro 8 8 (100) 0 (0) 0 (0) 0 (0) 0 (0) 8 (100)F8 Nemuro 8 0 (0) 8 (100) 0 (0) 0 (0) 8 (100) 0 (0)F9 Furano 8 0 (0) 8 (100) 0 (0) 0 (0) 8 (100) 0 (0)F10a Yoichi 8 1 (12.5) 7 (87.5) 0 (0) 0 (0) 8 (100) 0 (0)F11 Imagane 8 0 (0) 8 (100) 0 (0) 0 (0) 8 (100) 0 (0)F12 Wakkanai 8 8 (100) 0 (0) 0 (0) 0 (0) 8 (100) 0 (0)F13 Yakumo 8 0 (0) 8 (100) 0 (0) 0 (0) 8 (100) 0 (0)

Total 104 29 (27.9) 64 (61.5) 3 (2.9) 8 (7.7) 96 (92.3) 8 (7.7)

a Mixed infections ofE. multilocularisprobably occurred.

strongly suggest that both EMms1 and EMms2 loci are sin-gle in the genome ofE. multilocularis.

The usefulness of these loci was examined by PCR usingthe wild tapeworms ofE. multilocularis(N = 104) collectedfrom foxes in Hokkaido. Patterns of homozygote and het-erozygote could be differentiated by the electropherogramsof PCR products (Fig. 2). We found four alleles of EMms1locus and two alleles of EMms2 locus. The heterozygosi-ties observed were 10.6% in EMms1 and 7.7% in EMms2.The allele frequencies of tapeworms collected from individ-ual foxes(N = 13) are summarized inTable 2. No corre-lation was observed between the allele frequencies and the

162 M. Nakao et al. / Infection, Genetics and Evolution 3 (2003) 159–163

Fig. 2. Electropherograms of microsatellite loci depicted by the 377Genescan software. Closed peaks were signals of PCR products. Openpeaks were fragments of internal size standard. PCR-amplifications ofindividual tapeworms with the primer set of (A) EMms1 and (B) EMms2.

localities of infected foxes, suggesting that the geographicfoci of the parasite are unstable due to the long-distancemovement of foxes. Tapeworms collected from each of eightfoxes showed the same allelic pattern; however, tapewormspossessing different alleles coexisted in five foxes. We be-lieve that mixed infections of the tapeworm occur in thesefoxes by multiple ingestions of infected rodents.

4. Discussion

As compared with a genetic diversity ofE. granulosusstrains, few variabilities within mitochondrial and nuclearDNA sequences have been found inE. multilocularis(Bowles et al., 1992; Bowles and McManus, 1993; Haag

et al., 1997; Rinder et al., 1997). More sensitive geneticmarkers are required to analyzeE. multilocularis popula-tions. In this study, we isolated two microsatellites from agenomic library ofE. multilocularis. Our results show thateach of them is a single locus and is useful for assessingthe population-level polymorphism even in a limited regionof Hokkaido. In this region, mtDNA markers were of novalue to detect genetic variations ofE. multilocularis (M.Nakao, unpublished data). Using a microsatellite upstreamfrom the coding region of U1 snRNA gene,Bretagne et al.(1996) examined the genetic diversity ofE. multilocularisisolates from Europe, Japan (Hokkaido) and North Amer-ica, and divided them into three groups. The groups were inbetter agreement with the geographic distribution; howeverno variations were found in Japanese isolates. Electro-pherograms of the PCR-amplified microsatellite showedcomplicated patterns involving seven or eight peaks becauseU1 snRNA gene belongs to multigene families (Bretagneet al., 1991). Thus, the multilocus microsatellite is usefulfor genotyping but unsuitable for population genetics.

In this study, we found the heterozygosity of microsatellitealleles, indicating thatE. multilocularishas a diploid genomeand cross-fertilization occurs in the tapeworm. Moreover,our data strongly suggest that mixed infections of the tape-worm occur in foxes. In Hokkaido, the prevalence ofE.multilocularis in foxes is more than 50% in highly endemicareas and the heavily infected foxes harbor more than100,000 tapeworms (Yimam et al., 2002). The tapewormspossessing different alleles may accumulate in foxes be-cause the red fox is an excellent hunter of wild rodents andrepeatedly feeds on them (Yoneda, 1982). The mixed infec-tion and outcrossing may cause an effective gene flow inE. multilocularispopulations. However, the heterozygosityobserved was relatively low in both loci. The high rates ofhomozygosity may be associated with an asexual prolifer-ation of protoscoleces in the larval stage. In general, foxesare infected withE. multilocularisby ingesting rodents con-taining a large number of clonal protoscoleces. The major-ity of tapeworms developed, therefore, is clonal.Lymberyet al. (1997)suggested that self-fertilization ofEchinococ-cus can be achieved by a process in which an ovum isfertilized by a sperm of the same individual (autogamy)or other clonal individual (geitonogamy). An increase inhomozygosity within populations ofEchinococcusis wellexplained by the autogamy and geitonogamy. Althoughthe species of tapeworm examined is different, our resultssupport those ofLymbery et al. (1990, 1997)and Haaget al. (1999)suggesting that both selfing and outcrossingoccur inE. granulosuspopulations. A crossing experimentusing strains ofE. multilocularis possessing different mi-crosatellite alleles is necessary to confirm the mendelianinheritance of microsatellite markers in the progenies. Therate of self-fertilization due to autogamy and geitonogamywill be estimated as a consequence of the experiment.

The present study reinforces the usefulness of mi-crosatellites as genetic markers forE. multilocularis.

M. Nakao et al. / Infection, Genetics and Evolution 3 (2003) 159–163 163

More identification of microsatellites is necessary for re-solving the genetic structure ofE. multilocularis popula-tions. An expanded panel of microsatellites will be usefulfor the linkage analyses to find pathologically importantgenes.

Acknowledgements

We would like to thank Dr. Kenichi Takahashi, HokkaidoInstitute of Public Health for supplying tapeworms ofE. mul-tilocularis. This study was supported in part by grants-in-aidfrom the Japan Society of Promotion of Science (12557024and 14256001) and by the NIH (1R01TW01565-01; princi-pal investigator, P.S. Craig) to A. Ito.

References

Bowles, J., McManus, D.P., 1993. NADH dehydrogenase 1 gene sequencescompared for species and strains of the genusEchinococcus. Int. J.Parasitol. 23, 969–972.

Bowles, J., Blair, D., McManus, D.P., 1992. Genetic variants within thegenusEchinococcusidentified by mitochondrial DNA sequencing. Mol.Biochem. Parasitol. 54, 165–174.

Bretagne, S., Robert, B., Vidaud, D., Goossens, M., Houin, R., 1991.Structure of theEchinococcus multilocularisU1 snRNA gene repeat.Mol. Biochem. Parasitol. 46, 285–292.

Bretagne, S., Assouline, B., Vidaud, D., Houin, R., Vidaud, M.,1996.Echinococcus multilocularis: microsatellite polymorphism in U1snRNA genes. Exp. Parasitol. 82, 324–328.

Haag, K.L., Zaha, A., Araujo, A.M., Gottstein, B., 1997. Reduced geneticvariability within coding and non-coding regions of theEchinococcusmultilocularis genome. Parasitology 115, 521–529.

Haag, K.L., Araujo, A.M., Gottstein, B., Siles-Lucas, M., Thompson,R.C.A., Zaha, A., 1999. Breeding systems inEchinococcus granulosus(Cestoda Taeniidae): selfing or outcrossing? Parasitology 118, 63–71.

Kamenetzky, L., Gutierrez, A.M., Canova, S.G., Haag, K.L., Guarnera,E.A., Parra, A., Garcia, G.E., Rosenzvit, M.C., 2002. Several strainsof Echinococcus granulosusinfect livestock and humans in Argentina.Infect. Genet. Evol. 2, 129–136.

Lymbery, A.J., Thompson, R.C.A., Hobbs, R.P., 1990. Genetic diversityand genetic differentiation inEchinococcus granulosus(Batsch, 1786)from domestic and sylvatic hosts on the mainland of Australia.Parasitology 101, 283–289.

Lymbery, A.J., Constantine, C.C., Thompson, R.C.A., 1997. Self-fertilization without genomic or population structuring in a parasitictapeworm. Evolution 51, 289–294.

Rausch, R.L., 1967. A consideration of intraspecific categories in thegenusEchinococcusRudolphi, 1801 (Cestoda: Taeniidae). J. Parasitol.53, 484–491.

Rausch, R.L., 1985. Parasitology: retrospect and prospect. J. Parasitol.71, 139–151.

Rinder, H., Rausch, R.L., Takahashi, K., Kopp, H., Thomschke, A.,Löscher, T., 1997. Limited range of genetic variation inEchinococcusmultilocularis. J. Parasitol. 83, 1045–1050.

Schlötterer, C., 2000. Evolutionary dynamics of microsatellite DNA.Chromosoma 109, 365–371.

Smyth, J.D., Smyth, M.M., 1964. Natural and experimental hosts ofEchinococcus granulosusand E. multilocularis, with comments onthe genetics of speciation in the genusEchinococcus. Parasitology 54,493–514.

Southern, E.M., 1975. Detection of specific sequence among DNAfragments separated by gel electrophoresis. J. Mol. Biol. 98, 503–517.

Yimam, A.E., Nonaka, N., Oku, Y., Kamiya, M., 2002. Prevalence andintensity of Echinococcus multilocularisin red foxes (Vulpes vulpesschrencki) and raccoon dogs (Nyctereutes procyonoides albus) in OtaruCity, Hokkaido, Japan. Jpn. J. Vet. Res. 49, 287–296.

Yoneda, M., 1982. Influence of red fox predation on a local populationof small rodents. I. Population fluctuation in small rodents. Appl.Entomol. Zool. 17, 8–19.