Embed Size (px)
Citation preview
Les macrophages alvéolaires et les cellules dendritiques, deux joueurs clés dans l’homéostasie
pulmonaire et la réponse asthmatique
Thèse
Jean-François Lauzon-Joset
Doctorat en Médecine Expérimentale
Philosophiae doctor (PhD)
Québec, Canada
© Jean-François Lauzon-Joset, 2014
III
Résumé
L’immunité pulmonaire est en constant équilibre entre le maintien de
l’homéostasie et le développement d’une réponse inflammatoire. Plusieurs acteurs
sont impliqués dans cette fine régulation, mais peu d’informations sont disponibles
sur les mécanismes qui régulent l’activation de l’un ou l’autre de ces mécanismes.
Différentes populations de cellules dendritiques sont activées lors de certaines
réponses immunitaires, tandis que les macrophages alvéolaires sont davantage
associés au maintien de l’homéostasie. De plus, lorsque l’homéostasie pulmonaire
est dérégulée, une réponse inflammatoire exagérée se développe, comme dans le
cas de l’asthme allergique. Cette thèse a pour objectif de mettre en lumière des
mécanismes impliqués dans l’homéostasie pulmonaire et, plus particulièrement,
d’identifier lesquels sont dérégulés dans l’asthme allergique.
Nous avons étudié l’activation des différentes populations de cellules
dendritiques pulmonaires lors d’une réponse tolérogène et asthmatique. Lors d’une
réponse tolérogène, nous avons observé l’activation spécifique des cellules
dendritiques myéloïdes de type 2, tandis que la réponse asthmatique est
accompagnée d’une augmentation de la maturation des cellules dendritiques
myéloïdes de type 1.
Par la suite, nous avons investigué l’interaction entre les macrophages
alvéolaires et les cellules dendritiques dans l’immunité pulmonaire. Dans cette
étude, nous avons démontré que les macrophages alvéolaires naïfs contrôlent la
capture de l’allergène par les cellules dendritiques, ce qui contribue au maintien de
l’homéostasie pulmonaire. Finalement, nous avons déterminé que l’expression du
CD200 (une protéine membranaire immunomodulatrice) présente sur les
macrophages alvéolaires est dérégulée dans l’asthme et qu’il est possible d’inhiber
certaines étapes de la cascade asthmatique en administrant de CD200
IV
recombinant. À cet effet, l’administration de CD200 interfère avec le
développement de l’hyperréactivité bronchique et réduit l’accumulation des cellules
dendritiques myéloïdes et des lymphocytes Th2 dans le poumon.
En conclusion, cette thèse a fait la lumière sur des mécanismes
immunologiques importants pour le maintien de l’homéostasie pulmonaire, en
particulier que les macrophages alvéolaires et la voie du CD200 régulent
l’activation des cellules dendritiques.
V
Abstract
Lung immunity is an ongoing equilibrium between homeostasis and
inflammation. Many immune cells are involved in lung homeostasis, but little
information is available on the mechanisms that regulate the development of either
responses. Studies suggest that subsets of dendritic cells are differentially
activated during a tolerogenic and asthmatic response, whereas alveolar
macrophages are associated with the preservation of homeostasis. On the other
hand, allergic asthma pathogenesis is triggered by the dysregulation of lung
immunity. Thus, this thesis aim was to identify mechanisms responsible to maintain
lung homeostasis and which ones are dysregulated in asthmatic response.
Hence, we investigated the activation of the multiple dendritic cell subsets in
a tolerogenic and asthmatic response. The activation of the myeloid dendritic cell
subset 2 was associated with tolerance, whereas the asthmatic response was
associated with an increased maturation of myeloid dendritic cell subset 1.
We subsequently studied the interaction between alveolar macrophages and
dendritic cell subsets in lung immunity. This study demonstrated that naïve alveolar
macrophages inhibit dendritic cell capture of allergens and migration to the draining
lymph nodes, which contributed to the restoration of lung homeostasis.
Furthermore, we showed that asthmatic alveolar macrophages expressed less
CD200, an immunomodulatory membrane protein, than naïve cells. The
administration of a recombinant CD200 protein to asthmatic rats inhibited the
development of airway hyperresponsiveness and reduced the accumulation of
myeloid dendritic cells and inflammatory Th2 cells in the lungs.
VI
In summary, this thesis identified multiple mechanisms that are crucial for
lung homeostasis and show that alveolar macrophages and the administration of
CD200 inhibit dendritic cell activation.
VII
Table des matières
Résumé .................................................................................................................. III
Abstract ................................................................................................................... V
Table des matières ................................................................................................ VII
Liste des tableaux ................................................................................................... X
Liste des figures ..................................................................................................... XI
Liste des abréviations .......................................................................................... XIII
Remerciements ..................................................................................................... XV
Avant-propos ....................................................................................................... XVII
CHAPITRE 1 : Introduction ..................................................................................... 1
1.1.Homéostasie pulmonaire................................................................................... 2
1.1.1. Cellules épithéliales ............................................................................. 2 1.1.2. Cellules dendritiques ........................................................................... 3 1.1.3. Sous populations de DC ...................................................................... 8
1.1.4. Macrophages alvéolaires ................................................................... 10
1.2.Le voie du CD200/CD200R ............................................................................. 14
1.3.Asthme allergique ........................................................................................... 16
1.3.1. Généralités ........................................................................................ 17
1.3.2. Physiopathologie ............................................................................... 20 1.3.3. Cascade inflammatoire ...................................................................... 21 1.3.4. Dichotomie du rôle des AM ............................................................... 27
1.3.5. Modèles animaux d’asthme expérimental ......................................... 29
CHAPITRE 2 : Problématiques, hypothèse et objectifs de recherche ................... 33
2.1.Mise en contexte ............................................................................................. 34
2.2.Hypothèse et objectifs ..................................................................................... 35
CHAPITRE 3 : Lung mDC1 and mDC2 are differentially activated during a tolerogenic and asthmatic response ...................................................................... 39
3.1.Page titre ......................................................................................................... 40
3.2.Résumé ........................................................................................................... 41
3.3.Abstract ........................................................................................................... 42
3.4.Introduction ..................................................................................................... 43
3.5.Material and methods ...................................................................................... 44
VIII
3.6.Results ............................................................................................................. 46
3.7.Discussion ....................................................................................................... 49
3.8.Acknowledgements ......................................................................................... 51
3.9.References ...................................................................................................... 52
3.10.Figure legends ............................................................................................... 54
3.11.Figures ........................................................................................................... 57
CHAPITRE 4 : Dysregulation of alveolar macrophages unleashes dendritic cell-mediated mechanisms of allergic airway inflammation .......................................... 63
4.1.Page titre ......................................................................................................... 64
4.2.Résumé ........................................................................................................... 65
4.3.Abstract ........................................................................................................... 66
4.4.Introduction ...................................................................................................... 67
4.5.Results ............................................................................................................. 69
4.6.Discussion ....................................................................................................... 73
4.7.Methods ........................................................................................................... 77
4.8.Disclosure ........................................................................................................ 79
4.9.Acknowledgements ......................................................................................... 79
4.10.References .................................................................................................... 80
4.11.Figure legends ............................................................................................... 84
4.12.Figures ........................................................................................................... 88
CHAPITRE 5 : Restoration of lung CD200 activity abrogates airway hyperresponsiveness in experimental asthma ....................................................... 97
5.1.Page titre ......................................................................................................... 98
5.2.Résumé ........................................................................................................... 99
5.3.Abstract ......................................................................................................... 100
5.4.Introduction .................................................................................................... 101
5.5.Materials and Methods .................................................................................. 103
5.6.Results ........................................................................................................... 105
5.7.Discussion ..................................................................................................... 107
5.8.Acknowledgements ....................................................................................... 111
5.9.References .................................................................................................... 112
5.10.Figure legends ............................................................................................. 116
5.11.Figures ......................................................................................................... 119
IX
CHAPITRE 6 : Discussion, conclusion et perspectives ....................................... 125
6.1.Activation des populations de DC dans l’immunité pulmonaire ..................... 126
6.2.Mécanismes de l’homéostasie pulmonaire.................................................... 127
6.3.Conclusions et perspectives.......................................................................... 132
CHAPITRE 7 : Bibliographie ............................................................................... 135
X
Liste des tableaux
CHAPITRE 1
Tableau 1.1 : Homologie des populations de DC. ................................................... 8
Tableau 1.2 : Modèles animaux utilisés pour l’asthme expérimental. .................... 30
XI
Liste des figures
CHAPITRE 1
Figure 1.1 : Orientation de la réponse immunitaire par les DC. .............................. 6
Figure 1.2 : La plasticité des AM dans l’immunité pulmonaire. ............................. 13
Figure 1.3 : Option de traitement de l’asthme par étape. ...................................... 19
Figure 1.4 : Biomarqueurs de l’asthme. ................................................................ 21
Figure 1.5 : Étapes importantes de la sensibilisation de l’asthme allergique. ....... 23
Figure 1.6 : Cascade inflammatoire de l’asthme allergique. .................................. 25
CHAPITRE 3
Figure 3.1 : The proportion of lung parenchyma mDC1 and mDC2 is different between naïve PVG and naïve BN. ....................................................................... 57
Figure 3.2 : Parenchymal mDC proportion is increased in both the tolerogenic and asthmatic response. .............................................................................................. 58
Figure 3.3 : The proportion of OVA+ mDC2 is increased in tolerogenic rats. ........ 59
Figure 3.4 : OVA+ DC migration to the dLN is enhanced in tolerogenic rats......... 60
Figure 3.5 : mDC1 maturation was increased in the dLN of asthmatic animals. ... 61
CHAPITRE 4
Figure 4.1 : Sensitization status of AM does not modulate early eosinophil recruitment in the airways ..................................................................................... 88
Figure 4.2 : DC recruitment in asthma is enhanced, but not modulated by AM .... 89
Figure 4.3 : DC allergen capture is decreased by AM from naïve rats .................. 90
Figure 4.4 : DC accumulation in draining lymph nodes is not modulated .............. 91
Figure 4.5 : OVA+ mDC accumulation in draining lymph nodes is inhibited by AM from naïve rats ...................................................................................................... 92
Figure 4.6 : Th2 polarized cell accumulation is enhanced locally after allergen challenge and modulated by AM transfer .............................................................. 93
Figure 4.7 : AM allergen capture is enhanced in asthma, but is not modulated by adoptive transfer ................................................................................................... 94
Figure 4.8 : MHC II and CD23 expression are not modulated on AM early on asthma development ............................................................................................. 95
Figure 4.9 : AM withdrawal from the asthmatic environment restores their protective functions ............................................................................................... 96
XII
CHAPITRE 5
Figure 5.1 : AM express the surface molecule CD200 and its expression is dysregulated in asthma ....................................................................................... 119
Figure 5.2 : rCD200 reduces AHR, but does not modulate cell recruitment in bronchoalveolar lavages ...................................................................................... 120
Figure 5.3 : mDC recruitment to the lung of asthmatic rats is inhibited by rCD200 ............................................................................................................................ 121
Figure 5.4 : rCD200 reduces the accumulation of Th2 cells in the lung of asthmatic animals ................................................................................................................ 122
Figure 5.5 : rCD200 does not alter dLN DC and T cell numbers ......................... 123
XIII
Liste des abréviations
AHR : Hyperactivité bronchique / Airway hyperresponsiveness AM : Alveolar macrophage / Macrophage alvéolaire ASM : Aiway smooth muscle B220 : Classe de CD45 BDCA : Blood dendritic cell antigen BN : Brown Norway cAM : Macrophage alvéolaire « cultivé » CCL : Chemokine C-C motif Ligand CCR : C-C chemokine receptor CD : Cluster of differenciation / Cluster de différenciation CMH / MHC : Complexe majeur d’histocompatibilité / Major histocompatibility
complex CXCL : Chemokine C-X-C motif Ligand CXCR : C-X-C chemokine receptor DALY : Disability-adjusted life year DC : Dendritic cells / Cellule dendritique DCImm : Cellule dendritique immature DCmat : Cellule dendritique mature dLN : Draining lymph node DOK : Downstream of tyrosine kinase ERK : Extracellular signal-Regulated kinases FcR : FC receptor / Récepteur à immunoglobuline – portion FC GM-CSF : Granulocyte macrophage colony stimulating factor ICOSL : Inducible T cell CO-Stimulator Ligand IFN : Interféron IgE : Immunoglobuline de type E IL : interleukine / interleukin ITIM : Immunoreceptor tyrosine-based inhibitory motif JNK : Jun N-terminal Kinase LBA / BAL : Lavage broncho-alvéolaire / Bronchoalveolar lavage LT : Leucotriène LyT : Lymphocyte T LPS : Lipopolysaccharides M1/M2 : Activation des macrophages de type 1/2 mDC : Cellule dendritique myéloide nAM : Macrophage alvéolaire de rats naïfs NO : Oxide nitrique / Nitric oxide OVA : Ovalbumine p38 MAPK : p38 Mitogen-Activated Protein Kinase PD-L : Programmed cell Death Ligand pDC : Cellule dendritique plasmacytoïde PG : Prostaglandine
XIV
PRR : Pattern recognition receptor / Récepteurs de reconnaissance de motifs moléculaires
PVG : Piebald Virol Glaxo rCD200 : CD200 recombinant sAM : Macrophage alvéolaire de rats sensibilisés
SIRP : Signal-regulatory protein alpha TCR : T-cell receptor / Récepteur des lymphocytes T TGF : Transforming growth factor Th : T helper / Lymphocyte T auxiliaire TLR : Toll-like receptor TNF : Tumor necrosis factor Treg : Lymphocyte T régulateur
XV
Remerciements
Le doctorat est une longue épreuve d’endurance qui n’aurait pu s’accomplir
sans le soutien de mes directeurs de recherche, de l’équipe du laboratoire, ainsi
que de ma famille et mes amis.
Tout d’abord, je voudrais remercier ma directrice de recherche Elyse
Bissonnette pour toutes ces belles années qui seront la fondation de mon post-
doctorat et de mes projets futurs. Merci d’avoir réussi à m’infuser un peu de ta
sagesse et de ton organisation. Je tiens également à remercier mon co-directeur
David Marsolais. Bien que ton arrivé au centre de recherche a presque coïncidé
avec le début de mon doctorat, ton savoir et ton expertise ont grandement
influencé la réalisation de mes études. Tes commentaires et tes conseils ont
toujours permis d’améliorer mes projets.
J’aimerais également dire un gros merci à toutes mes assistantes de
recherche, sans qui tout ce parcours n’aurait pu se réaliser. Je pense à Annie, à
Véronique et, la dernière mais non la moindre, à Anick. Merci de m’avoir enduré,
moi et mon désordre. Votre support et vos nombreux conseils m’ont permis de
faire avancer mes projets. Je n’aurais pu passer au travers de toutes ces années
sans les « sacrifices chantant », les diners sushi, les 5@7, sans oublier les
nombreux cafés/diners, tous davantage ressourçant que scientifiques.
Avec les années, l’équipe Bissonnette n’a pas grandi, mais deux équipes
sont venues s’y greffer, soit les équipes de Marie-Renée Blanchet et David
Marsolais. Merci à vous tous d’avoir été mes collègues d’adoption et
particulièrement, à EM pour toutes les pouliches / licornes / etc. qui ont rempli le
lab. Merci également à la grande famille de pneumologie, notamment à Annick
(ex), Marie-Josée, MEP, MET (ex) et Sophie. Merci à Laetitia pour ta bonne
XVI
humeur, ton support, tes « doux » et tes conversations toujours appréciées. Merci
également à Marc pour toutes ces heures passées avec moi devant le cytomètre
et à ces excellentes dégustations de bières. Merci également à mes
prédécesseurs et anciens collègues de bureau : François, Marc-André, Mathieu.
Vous avez été des modèles et sans vous, le bureau a perdu un peu de son âme.
Merci également à ma famille : mon père, ma mère et mon frère. Même si
vous ne compreniez pas toujours (et ne comprenez peut-être pas encore) mes
recherches, vous avez toujours été là pour moi. On se rend compte de
l’importance de la famille lorsqu’on en a besoin et vous avez toujours répondu
présent. Merci pour tout.
Finalement, je tiens à remercier mon amour, ma blonde et nouvellement, ma
fiancée. J’ai passé à tes côtés les plus beaux moments de ma vie et nous avons
traversé les pires épreuves. Sans toi, je n’aurais jamais réussi à être où j’en suis.
Merci d’être à mes côtés et de m’endurer. Merci pour tout.
Junior, David, Ti-pou, tu as été le plus beau cadeau que l’on puisse avoir,
mais tu nous as été enlevé beaucoup trop rapidement. Tu as été et tu seras
toujours notre petite étoile filante...
XVII
Avant-propos
Cette thèse est constituée de 3 articles scientifiques qui abordent les
mécanismes impliqués dans la régulation de l’immunité pulmonaire et l’asthme
allergique. Dans un premier temps, l’introduction abordera le thème général de
l’homéostasie pulmonaire, ainsi que celui de l’asthme allergique. Suivant cette
dernière, trois chapitres aborderont les thèmes plus spécifiques du rôle des
populations de cellules dendritiques dans l’immunité pulmonaire, celui des
macrophages alvéolaires dans le maintien de l’homéostasie et finalement
l’implication de la voie du CD200 dans la tolérance immunitaire.
Article 1 (chapitre 3) : Lung mDC1 and mDC2 are differentially activated during a
tolerogenic and asthmatic response
Cet article traite de l’activation différentielle des différentes populations de
cellules dendritiques dans le développement d’une réponse tolérogène et
asthmatique. Cette étude a été réalisée lors de mon stage doctoral dans le
laboratoire du Dr Patrick Holt au Telethon Institute for Child Health Research à
Perth, en Australie. Ce stage avait pour but d’apprendre de nouvelles techniques
que Dre Bissonnette voulait intégrer à ses projets de recherche. Cette étude a été
désignée et réalisée sous la supervision du Dr Patrick Holt. J’ai réalisé toutes les
expériences présentées dans cet article avec la collaboration du Dre Deborah
Strickland. Également, j’ai effectué l’analyse et l’interprétation des données avec la
collaboration Dre Elyse Bissonnette et du Dr David Marsolais. J’ai également
rédigé l’article avec leur collaboration. La Dre Anick Langlois a collaboré à la
révision de l’article. Ce manuscrit est en préparation pour être soumis
prochainement au journal Plos One.
XVIII
Article 2 (chapitre 4) : Dysregulation of alveolar macrophages unleashes dendritic
cell-mediated mechanisms of allergic airway inflammation
Cet article aborde l’interaction entre les macrophages alvéolaires et les
cellules dendritiques dans l’immunité pulmonaire. Cette étude a été réalisée sous
la direction du Dre Elyse Bissonnette. J’ai réalisé les expériences en collaboration
avec la Dre Anick Langlois. J’ai effectué l’analyse et l’interprétation des résultats
ainsi que la rédaction du manuscrit en collaboration avec Dre Bissonnette et Dr
David Marsolais. La Dre Anick Langlois a collaboré à la révision de l’article. Ce
manuscrit a été publié dans le journal Mucosal Immunology.
Article 3 (Chapitre 5) : Restoration of lung CD200 activity abrogates airway
hyperresponsiveness in experimental asthma
Cet article investigue le rôle de la voie du CD200 dans la résolution de
l’inflammation asthmatique allergique. Cette étude a été réalisée sous la direction
du Dre Elyse Bissonnette et du Dr David Marsolais. J’ai réalisé les expériences en
collaboration avec la Dre Anick Langlois. J’ai effectué l’analyse et l’interprétation
des résultats ainsi que la rédaction du manuscrit en collaboration avec Dre
Bissonnette et Dr Marsolais. La Dre Anick Langlois a collaboré à la révision de
l’article. Ce manuscrit est soumis dans le journal American Journal of Respiratory
Cell and Molecular Biology.
1
CHAPITRE 1 : Introduction
2
1.1. Homéostasie pulmonaire
Il est connu depuis longtemps qu’une réponse inflammatoire ne se
développe pas aussi facilement dans certains organes que dans d’autres (1). En
effet, il semble logique que le système immunitaire réponde rapidement à une
particule étrangère dans un organe a priori stérile, tandis qu’un organe
constamment exposé (tel que les intestins ou le poumon) n’ait pas le même seuil
d’activation. Le poumon est un organe immuno-privilégié, en ce sens qu’il est
constamment exposé aux antigènes présents dans l’air inspiré et que ces
antigènes n’induisent pas d’inflammation. L’homéostasie pulmonaire est maintenue
par deux grands mécanismes : l’ignorance immunitaire et la réponse tolérogène.
La majorité des antigènes sont éliminés de façon silencieuse (sans se rendre dans
les organes lymphoïdes secondaires pour activer une réponse immunitaire) (2).
Cela peut être accompli, entre autre, par des méthodes physiques (e.g. la toux) et
la dégradation de l’allergène (3). Le système immunitaire peut aussi développer
une réponse tolérogène à l’antigène. En effet, lorsqu’un antigène est présenté au
système immunitaire dans certaines conditions, les cellules immunitaires s’activent
et produisent des médiateurs qui empêchent toute activation subséquente du
système immunitaire envers cet antigène (2). Ceci s’explique en partie par une
spécialisation des cellules résidentes pulmonaires, telles que les cellules
épithéliales, les cellules dendritiques (DC) et les macrophages alvéolaires (AM).
1.1.1. Cellules épithéliales
Une des premières défenses de l’hôte contre son environnement est
effectuée par les cellules épithéliales pulmonaires. Selon leur localisation dans le
poumon, les cellules épithéliales bronchiques et alvéolaires ont des fonctions
distinctes. Les premières ont davantage un rôle de barrière physique afin
3
d’empêcher les allergènes et les autres particules d’activer les cellules du
parenchyme pulmonaire. De plus, l’épithélium bronchique sécrète du mucus et
possède des cils, ce qui piège les allergènes et les élimine via les expectorations.
De leur côté, les cellules épithéliales alvéolaires produisent une grande variété de
médiateurs antimicrobiens afin de défendre les voies aériennes distales contre les
infections (4). Toutes les cellules épithéliales expriment une grande quantité de
récepteurs de reconnaissance de motifs moléculaires (pattern recognition
receptors; PRR) afin de détecter la présence de microorganismes ou de
médiateurs endogènes de danger. En plus d’avoir un rôle de détection, les cellules
épithéliales jouent un rôle actif dans l’inhibition de la réponse inflammatoire (5, 6).
Les cellules épithéliales maintiennent les cellules immunitaires résidentes
du poumon en état de quiescence via plusieurs mécanismes (5, 7). Elles sécrètent,
entre autres, des protéines du mucus (les mucines) et des protéines du surfactant
qui réduisent l’activation des cellules immunitaires, dont les AM. Il est intéressant
de noter qu’à l’homéostasie, l’interaction entre les cellules épithéliales pulmonaires
et les AM favorise la réponse anti-inflammatoire de ces dernières (voir section
1.1.3). En effet, les cellules épithéliales produisent de grande quantité
d’interleukine (IL)-10 et de Transforming Growth Factor (TGF)- (5, 7) et expriment
plusieurs protéines membranaires anti-inflammatoires, dont le CD200 (voir section
1.2) (8). Les cellules épithéliales sont donc des joueurs importants pour le maintien
de l’homéostasie pulmonaire, ainsi que pour la surveillance pulmonaire.
(9)
1.1.2. Cellules dendritiques
La surveillance immunitaire du poumon est également assurée par les DC.
Les DC sont des cellules immunitaires résidentes de tissus principalement
retrouvées à l’interface entre le soi et l’environnement (e.g. la peau, les intestins et
les poumons). Puisque les DC pulmonaires sont situées sous la membrane basale,
4
ainsi qu’au travers de l’épithélium, elles peuvent étirer leurs dendrites dans la
lumière des voies aériennes et ainsi échantillonner les particules entrant dans le
poumon. Les DC sont les principales cellules présentatrices d’antigènes et
assurent le lien entre l’immunité innée (non spécifique) et l’immunité adaptative
(reconnaissance spécifique des antigènes) au niveau pulmonaire (10). Ainsi, les
DC forment un réseau de surveillance très étendu, dont les effectifs sont
étroitement contrôlés. En effet, le nombre de DC pulmonaires est contrôlé par des
cellules résidentes, telles les cellules épithéliales et les AM, et dépend de
l’historique des infections (nombre, diversité et temps depuis la résolution de
l’inflammation) (11, 12). Un autre facteur qui affecte leur fonction est leur
localisation dans les compartiments pulmonaires. En situation homéostatique, les
DC de la trachée ne se comportent pas comme les DC du poumon (ou des
alvéoles) (13). En autre, le renouvèlement des DC de la trachée est plus rapide
que celui des DC pulmonaires. Par contre, peu d’études se sont attardées à cette
différence en situation inflammatoire. Le rôle des DC dans l’activation du système
immunitaire est donc central, puisque celles-ci assurent la surveillance du poumon
aussi bien en situation homéostatique que lors d’infection.
Homéostasie
En situation normale, les DC migrent de façon ininterrompue vers les
ganglions lymphatiques afin d’assurer une surveillance immunitaire continue des
voies aériennes (14, 15). Cette migration s’effectue rapidement, de sorte que la
demi-vie des DC pulmonaires est de l’ordre de quelques jours. Le recrutement des
DC pulmonaires et leur migration vers les ganglions lymphatiques sont contrôlés
par de nombreuses chimiokines. Les cellules épithéliales pulmonaires et les AM
sont les plus importants producteurs de chimiokines présentes dans le poumon et
plusieurs d’entre elles sont reconnues pour affecter le recrutement des DC, dont le
CCL (Chemokine C-C motif Ligand) 2, CCL3, CCL5 et le CXCL (Chemokine C-X-C
motif Ligand) 15 (16). L’expression de plusieurs des récepteurs pour ces
chimiokines, dont le CCR (CCL receptor) 1, CCR5 et CXCR (CXCL receptor) 1, sur
5
les DC est nécessaire pour leur recrutement au poumon (17). Lorsqu’aucun PRR
n’est activé sur les DC avant la fin de leur « quart de travail », celles-ci migrent
vers les ganglions lymphatiques tout en conservant un phénotype immature (faible
expression des molécules de co-stimulation, telles que CD80 ou CD86) (18). La
redirection des DC vers les ganglions s’effectue par un changement d’expression
des récepteurs de chimiokines. En effet, les récepteurs assurant leur recrutement
dans les poumons diminuent et les récepteurs favorisant leur migration dans les
ganglions, comme le CCR7 et le CCR8, augmentent. (12, 17). Une fois dans les
ganglions lymphatiques, les DC immatures présentent les antigènes capturés dans
le poumon via les molécules du complexe majeur d’histocompatibilité (CMH) pour
induire une réponse tolérogène (Figure 1.1 – panneau du haut) (19, 20). Ainsi, les
DC immatures induisent, chez les lymphocytes T qui expriment le TCR (T Cell
Receptor) spécifique au complexe CMH/antigène, soit l’anergie des lymphocytes T
ou leur différentiation en lymphocytes T régulateurs (Treg). En revanche, lors d’une
infection, les DC sont rapidement activés.
Inflammation
En situation inflammatoire, le réseau de DC est fortement altéré. Le nombre
de DC pulmonaire augmente peu de temps après l’activation des PRR. En effet,
les DC sont recrutées aussi rapidement que les neutrophiles (les premiers
répondeurs du système immunitaire). L’origine de ces DC est encore matière à
débat, mais certaines études suggèrent qu’en condition inflammatoire des
monocytes circulants maturent en DC pulmonaires « inflammatoires » (17, 21). En
plus d’augmenter le nombre de DC pulmonaires, la réponse inflammatoire
pulmonaire module les fonctions et la production des précurseurs des DC dans la
moelle osseuse (21, 22). Ainsi, en situation inflammatoire, le recrutement de DC
débute rapidement avec l’arrivée de monocytes circulants et perdure sur une
longue période avec la différenciation des DC « inflammatoires» de la moelle
osseuse.
6
En plus d’affecter le renouvèlement des populations de DC, l’activation de
PRR à la surface d’une DC induit sa maturation. Ce phénotype mature se
caractérise par une réduction de sa capacité phagocytaire et une augmentation de
sa capacité à présenter les antigènes, afin d’activer les lymphocytes et d’initier une
réponse immune. Trois signaux émis par les DC sont nécessaires pour que les
lymphocytes des ganglions lymphatiques développent une réponse spécifique à
l’antigène (Figure 1.1 – panneau du bas) et augmentent leur expression de
DCimm
LyT
Treg
Treg
CMH TCR
LyT anergique
DCmat
Th1 Th2
Th17
Figure 1.1 : Orientation de la réponse immunitaire
par les DC.
Les DC immatures (panneau du haut) sont principalement
impliquées dans l’induction de l’anergie des lymphocytes T
(LyT) ou la polarisation en Treg. Lorsque matures, les DC
orientent la réponse immunitaire principalement vers une
réponse Th1, Th2, Th17 ou Treg.
DCimm : DC immatures; DCmat : DC matures; LyT :
lymphocytes T.
Modifié de Reis e Sousa et al (6).
7
récepteurs à chimiokines spécifiques pour leur migration vers le poumon (23). Les
DC commencent par surexprimer le CMH afin de faciliter la formation de synapses
immunologiques entre eux et les lymphocytes T spécifiques à l’antigène
échantillonné (signal 1). Ensuite, les molécules de co-stimulation (signal 2)
présentes à la surface des DC modulent l’activation des lymphocytes (23). En
effet, lors d’une réponse inflammatoire, les DC augmentent l’expression du CD80
et CD86, tandis qu’une réponse tolérogène est associée avec l’expression de
l’ICOSL (Inducible T cell CO-Stimulator Ligand) et de PD-L (Programmed cell
Death Ligand) (23). Finalement, les cytokines produites par les DC (signal 3), ainsi
que celles présentes dans l’environnement immédiat, déterminent la nature de la
réponse lymphocytaire (Figure 1.1 – panneau du bas). Malgré que les cytokines
aient souvent de multiples fonctions et que celles-ci soient interconnectées,
chaque réponse lymphocytaire est caractérisée par la présence d’une cytokine
prototypique. En simplifiant, les Treg sont induits par la présence d’interleukine
(IL)-10, tandis que l’IL-12, IL-4 et l’IL-23 polarisent vers des réponses
inflammatoires de type T helper (Th) 1, Th2 et Th17, respectivement (24). En plus
des signaux émis par les DC, la concentration d’antigènes présentée aux
lymphocytes influence la nature de la réponse immunitaire. Cependant, une
controverse existe à savoir si une réponse tolérogène est favorisée par une faible
dose d’antigènes ou si c’est plutôt une forte dose d’antigène qui induit la tolérance.
Aussi, certaines études suggèrent que la dose d’antigène à laquelle un individu est
exposé favorise le développement d’une réponse immune Th1 ou Th2 (25).
En résumé, les DC jouent un rôle central dans la surveillance immunitaire
du poumon, aussi bien à l’homéostasie qu’en présence de pathogènes, via
l’éducation des lymphocytes soit vers une réponse anti-inflammatoire ou vers une
réponse inflammatoire appropriée. L’activation des DC dépend également de leur
localisation dans le poumon. En plus des nombreux signaux et facteurs, la nature
de la réponse immunitaire est également modulée par le type de DC impliqué.
8
1.1.3. Sous populations de DC
Pour assurer une surveillance efficace du poumon, les DC sont subdivisées
en plusieurs populations avec des fonctions distinctes, permettant ainsi d’activer
différentes voies de la réponse immunitaire. Dans les poumons, au moins deux
populations de DC ont été décrites, soit les DC myéloïdes (mDC; ou DC
conventionnelles) et les DC plasmacytoïdes (pDC) (28). Malgré la difficulté à
déterminer l’homologie des populations de DC humaines et murines via
l’expression de marqueur de surface (Tableau 1.1), l’étude de leurs fonctions a
permis de contourner ce problème. En effet, la comparaison des profils d’ARN
messagers, ainsi que la réponse des populations de DC à des stimuli de danger
ont permis d’identifier les populations orthologues (26, 29).
DC myéloïdes
Les mDC représentent la majorité des DC pulmonaires et sont distribuées
aussi bien dans les voies aériennes que dans le parenchyme pulmonaire (13, 30).
Elles expriment grandement les molécules impliquées dans la voie du CMH de
classe II (CMH II), ce qui leur permet d’activer les lymphocytes CD4+. De plus, la
diversité de PRR à leur surface, tel que les Toll like receptor (TLR)-1 à -4 et -8, leur
permet de détecter la présence d’une panoplie de bactéries et ainsi activer une
Tableau 1.1 : Homologie des populations de DC.
Humain Rat Souris
mDC1 BDCA1 (CD1c+) CD4+ CD11b+
mDC2 BDCA3 (CD141+) CD4– CD103+
pDC CD11b–
BDCA2 (CLEC4c+) CD45RA+ B220+
Identification simplifiée des différentes sous populations de cellules dendritiques à
l’aide de marqueurs de surfaces selon l’espèce étudiée (26, 27).
9
réponse immune (31). Les mDC se subdivisent en deux sous-populations, soit les
mDC1 et mDC2 (Tableau 1.1), chacune étant dotée d’un pouvoir d’activation
distinct et qui conduit à un éventail plus large de réponses immunes.
Les mDC1 ont une plus grande expression des protéines de la voie
phagocytaire que les mDC2, ce qui les spécialise dans la capture de particules
solubles. En effet, les mDC1 sont majoritairement responsables du transport des
allergènes du poumon vers les ganglions lymphatiques (11). De plus, les mDC1
sont importantes pour la défense contre les pathogènes extracellulaires en
induisant la réponse humorale des lymphocytes CD4+ (27, 32). Quant à elles, les
mDC2 sont spécialisées dans la présentation croisée (particules solubles
présentées via la voie du CMH I) et dans la présentation d’antigènes provenant de
cellules apoptotiques. Ainsi, les mDC2 activent aussi bien les lymphocytes CD4+
que CD8+ lorsqu’en présence de particules extracellulaires (e.g. virus libre ou
allergène) que lors d’infection avec des pathogènes intracellulaires (27, 33). Par
contre, la répartition des tâches pour induire une réponse tolérogène est encore
mal définie entre les mDC1 et mDC2 pulmonaires (34). En effet, aucune étude n’a
encore confirmé (ni infirmé) la capacité des mDC1 à polariser les lymphocytes T
en Treg. Pour ce qui est des mDC2, plusieurs études suggèrent que, dans le
poumon, elles aient un rôle actif dans l’activation des Treg. En effet, les mDC2
intestinaux sont importantes pour l’induction de Treg (35-37) et certaines
évidences suggèrent que les mêmes mécanismes sont présents dans le poumon
(11). Cependant, certains suggèrent que les pDC (voir plus bas) soient les DC
impliquées dans l’homéostasie (38, 39). En résumé, les mDC sont divisées en
deux sous-populations, mais leur implication dans le développement d’une
réponse tolérogène pulmonaire est encore matière à débat.
DC plasmacytoïdes
Les pDC représentent un faible pourcentage des DC pulmonaires, mais sont
très importantes pour combattre les infections virales (28, 40, 41). En effet, les
10
pDC ont tout d’abord été identifiées grâce à leur capacité à produire de grande
quantité d’interféron (IFN) en réponse à une infection virale, via l’activation des
PRR responsables de la reconnaissance des virus (TLR-7 et -9 ) (41). Pour ce qui
est de leur capacité à activer les lymphocytes, les pDC sont moins efficaces que
les mDC, mais peuvent activer aussi bien des lymphocytes CD4+ que CD8+ (42).
De plus, plusieurs études suggèrent que les pDC sont impliquées dans l’activation
d’une réponse Th17 (importante pour la défense contre les parasites). Du point de
vue de l’homéostasie pulmonaire, certaines études suggèrent que les pDC, et non
les mDC, jouent un rôle lors du développement d’une réponse tolérogène contre
un allergène (38, 39). Par contre, chez l’humain, une étude suggère que les pDC
sont incapables d’activer les Treg (43). Les pDC sont donc une sous-population
minoritaire de DC pulmonaire, dont le rôle est diversifié, mais aussi controversé,
allant de la réponse antivirale au combat des pathogènes extracellulaires.
En résumé, les DC sont des cellules clé de l’immunité pulmonaire, car elles
sont responsables de la détection et de la capture des éléments exogènes, ainsi
que de l’induction de la réponse immune appropriée. Par contre, l’implication des
différentes populations de DC pulmonaires dans la réponse tolérogène est encore
une question controversée.
1.1.4. Macrophages alvéolaires
Les AM sont des cellules immunitaires résidentes des alvéoles, ainsi que
des bronches et de la trachée, et sont les plus abondantes en situation non-
inflammatoire. Contrairement aux DC, les AM assurent la surveillance du poumon
sans pouvoir activer directement les lymphocytes. En effet, les AM sont de
mauvais présentateurs antigéniques, puisqu’ils expriment constitutivement de
faible niveau de CMH et de molécules de co-stimulation (44). Par contre, les AM
sont des phagocytes professionnels responsables d’éliminer aussi bien les cellules
11
apoptotiques que les pathogènes ou particules du non-soi (45). Pour ce faire, les
AM expriment de nombreux récepteurs (entre autres, les récepteurs à
immunoglobulines (FcR), à mannose et du complément) qui leur permettent de
phagocyter une multitude de particules opsonisées ou non (44). Par exemple,
lorsque des souris sont infectées avec des doses sublétales de Klebsiella
pneumonia, les AM phagocytent les bactéries et ce, sans déclencher de réponse
systémique (46). Inversement, lorsque les AM sont déplétés, les bactéries
s’accumulent aux poumons et dans le sang, ce qui entraine la mort rapide des
souris (46). De plus, les AM jouent un rôle important dans la détection de l’infection
et la mise en place de la réponse adéquate. En fonction de la quantité de
l’inoculum et de la nature de l’infection, soit les AM éliminent les bactéries de façon
silencieuse, soit ils libèrent des cytokines et des chimiokines pour activer les
cellules environnantes et recruter d’autres cellules immunitaires (comme les
neutrophiles) (45, 47). La déplétion des AM lors d’une infection à Pseudomonas
aeruginosa entraine une réduction de la neutrophilie et de l’inflammation
pulmonaire, mais cette absence d’inflammation induit une mortalité accrue, qui est
associée à une augmentation de la charge bactérienne (48). Donc, les AM sont
des cellules résidentes du poumon qui jouent un rôle important dans la défense
immunitaire pulmonaire.
Afin de surveiller l’environnement pulmonaire, les AM expriment de
nombreux PRR, principalement les TLR-2 et -4, et libèrent un grand nombre de
médiateurs inflammatoires (principalement le TNF (Tumor Necrosis Factor)- et le
leucotriène (LT) B4) et de chiomiokines pour activer et recruter des cellules
immunitaires (44, 45). De plus, l’activation des AM entraine la libération de
chimiokines pro-inflammatoires par les cellules épithéliales pulmonaires (49). La
pluralité des réponses immunes que peuvent mettre en place les AM est en parti
causée par sa grande plasticité (Figure 1.2). En effet, selon le signal de danger
perçu, les AM se polarisent en plusieurs phénotypes, ce qui s’accompagne de
profondes altérations de leur profil de médiateurs sécrétés, ainsi que de leurs
protéines de surface (50). Bien que la polarisation des macrophages s’effectue
12
généralement de façon homologue à celle des lymphocytes Th1/Th2 (M1 et M2),
plusieurs études suggèrent que cette identification ne s’applique pas parfaitement
aux AM (51). À défaut de meilleures alternatives et puisque de nombreuses études
emploient ce classement, ce sera celui utilisé dans cette thèse. L’activation
classique des macrophages (M1) est induite lors de réponse immunitaire de type
Th1, ainsi qu’en réponse à une infection bactérienne (52). Ainsi, les macrophages
M1 augmentent leur capacité à présenter des antigènes et produisent aussi une
grande quantité d’oxyde nitrique (NO), de TNF- et d’IFN afin de pouvoir
combattre les infections. L’activation « alternative » des macrophages (M2) est
connue depuis de nombreuses années, mais il est de plus en plus clair que cette
réponse est aussi bien constituée de phénotypes pro-inflammatoires (M2a et M2b)
qu’anti-inflammatoires (M2c) (52). Le phénotype M2a est induit par une réponse
immunitaire de type Th2, ce qui favorisent la réparation tissulaire et l’élimination
des parasites par les macrophages M2a (53). De son côté, la réponse pro-
inflammatoire M2b est induite par l’activation de PRR (entre autres par les
lipopolysaccharides (LPS)) et les complexes anticorps-antigène. Finalement, la
réponse anti-inflammatoire M2c est induite, entre autres, par l’IL-10 et les
corticostéroïdes (52). En résumé, les AM sont des cellules plastiques qui sont
impliquées aussi bien dans la défense antibactérienne que dans la réponse anti-
inflammatoire.
Plusieurs études démontrent que, malgré cette grande plasticité, les AM
favorisent de façon constitutive la régulation et la résolution de l’inflammation
pulmonaire (Figure 1.2) (48, 54). En effet, les AM sont essentiels pour inhiber le
développement d’une réponse inflammatoire pulmonaire excessive, aussi bien
contre des allergènes que des composés chimiques (55-58). De plus, les AM sont
les macrophages qui expriment le plus fortement le CD200R, une protéine de
surface anti-inflammatoire, dont l’activation est impliquée dans le maintien de
l’homéostasie pulmonaire (voir section 1.3) (59, 60). Le rôle des AM dans
l’homéostasie pulmonaire est également supportée par leur capacité à polariser les
lymphocytes T en Treg via la libération d’une panoplie de médiateurs anti-
13
inflammatoires, tels que les prostaglandines (PG) E2, l’IL-10 et le TGF- (61).
Finalement, les AM interfèrent avec le développement de la réponse humorale en
inhibant l’activation des DC, ainsi que celle des lymphocytes T et B (62, 63).
Quoique les mécanismes impliqués dans ces processus soient encore mal définis,
certaines évidences suggèrent que le NO et le TGF- soient impliqués (63, 64). En
résumé, les AM sont donc des phagocytes professionnels qui contrôlent l’activation
de plusieurs cellules pulmonaires, dont les DC. Bien que la régulation des DC par
les AM soit connue, peu d’information est disponible sur les mécanismes qui sont
responsables de cette interaction.
Homéostasie Inflammation
Ép
ith
éliu
m
AM
Figure 1.2 : La plasticité des AM dans l’immunité pulmonaire.
Les AM et l’épithélium pulmonaire interagissent afin de déterminer la
réponse immunitaire à mettre en place. En situation homéostatique, les
AM sont quiescents via les signaux émis par les cellules épithéliales
pulmonaires. Par contre, lorsqu’un signal de danger est détecté par les AM
via leurs PRR, les AM s’activent et ils initient une réponse inflammatoire.
Finalement, lorsque le signal de danger n’est plus détecté, l’inflammation
se résout et l’homéostasie se remet en place.
Modifié de Wissinger et al (4).
14
Plusieurs cellules pulmonaires agissent en synergie pour préserver
l’homéostasie pulmonaire et combattre l’entrée de pathogènes dans la circulation.
Entre autres, les cellules épithéliales agissent comme barrière physique, tandis
que les DC polarisent la réponse immunitaire et les AM préservent l’homéostasie
pulmonaire. De plus, la communication intercellulaire via les protéines
membranaires, dont la voie du CD200/CD200R, est essentielle dans la régulation
de l’immunité pulmonaire et fera en partie l’objet de la présente thèse.
1.2. Le voie du CD200/CD200R
L’homéostasie pulmonaire est maintenue via la libération de nombreux
médiateurs ainsi que par l’interaction de plusieurs cellules. Afin d’aviser les cellules
avoisinantes de la réponse à mettre en place, les cellules expriment un certain
nombre de protéines membranaires. Pour maintenir l’homéostasie pulmonaire et
mettre en place une réponse anti-inflammatoire, la voie du CD200/CD200R occupe
une place centrale. En effet, l’activation du CD200R par le CD200 inhibe
l’activation de plusieurs cellules pro-inflammatoires.
Le CD200 est une protéine membranaire de la superfamille des
immunoglobulines qui est impliquée dans l’induction d’une réponse anti-
inflammatoire. Contrairement à la plupart des autres protéines membranaires, le
CD200 ne possède pas de domaine de signalisation intracellulaire. Il induit donc
une réponse anti-inflammatoire en inhibant l’activation des cellules exprimant son
récepteur (le CD200R) (65).. Dans le poumon, le CD200 est présent à la surface
de nombreuses cellules, incluant des cellules structurales (les cellules épithéliales
et endothéliales) et des cellules immunitaires (les lymphocytes, les macrophages
et les DC) (66). Chez les DC pulmonaires, l’expression du CD200 varie selon la
sous-population étudiée. En effet, les mDC2 sont les DC ayant la plus forte
15
expression de CD200, suivi par les mDC1 et les pDC (67). De plus, l’expression du
CD200 est très modulable. Entre autres, la surexpression du CD200 est observée
sur des macrophages stimulés avec du LPS (68), ainsi qu’en réponse à certains
médiateurs pro-inflammatoires, e.g. le TNF ou l’IFN (69). De plus, l’expression du
CD200 est sous le contrôle de la voie des ERK (Extracellular signal-Regulated
kinases). En effet, une plus grande activité de ERK est liée à la surexpression de
CD200 dans certains types de tumeurs (70).
Le CD200R est, quant à lui, principalement exprimé par les cellules
immunitaires myéloïdes, dont les macrophages et les DC. Contrairement à la
plupart des récepteurs anti-inflammatoires, le CD200R ne possède pas de
domaine de signalisation ITIM (Immunoreceptor Tyrosine-base Inhibitory Motif).
Par contre, l’activation du CD200R entraine une cascade de phosphorylation
impliquant les molécules adaptatrices DOK1/2 (Downstream Of tyrosine Kinase)
(71, 72). Une fois les protéines DOK phosphorylés, il y a inhibition de plusieurs
voies de signalisation, dont celles de ERK, JNK (Jun N-terminal Kinase) et p38
MAPK (p38 Mitogen-Activated Protein Kinase). Chez le mastocyte, l’activation de
CD200R interfère avec la dégranulation, tandis que chez les macrophages, elle
entraine une diminution de la production de cytokines pro-inflammatoire (dont le
TNF, l’IFN et l’IL-8), tout en réduisant l’expression du CMH II (60, 71, 73, 74). De
plus, l’expression du CD200R chez les macrophages est associée au phénotype
anti-inflammatoire M2c (voir section 1.1.4) (65). L’expression du CD200R chez les
AM est beaucoup plus élevée que chez d’autres macrophages tissulaires, ce qui
suggère que les AM sont, par défaut, d’avantage orientés vers une réponse anti-
inflammatoire (60). Cette forte expression de CD200R est sous l’influence de
l’importante concentration locale d’IL-10 et de TGF-dans le poumon (8). Bien que
le CD200R soit le récepteur le plus étudié, certaines études ont démontré
l’existence de récepteurs homologues au CD200R (CD200RL), mais dont l’affinité
au CD200 est questionnée (75, 76).
16
Le CD200/CD200R est important pour le maintien de l’homéostasie. Sa
dérégulation est impliquée dans de nombreuses pathologies (69, 77). La
surexpression de la voie CD200/CD200R est associée à la progression de
plusieurs tumeurs, tandis qu’une faible expression de CD200 est impliquée dans
plusieurs maladies auto-immunes, telles que l’arthrite (65, 69, 78). Dans le
poumon, la perte de CD200 altère la réponse antivirale. En effet, des souris
déficientes en CD200 infectées par le virus de l’influenza présentent une plus
grande inflammation pulmonaire et une plus faible la charge virale, mais cela a
pour conséquence néfaste d’entrainer une plus grande perte de poids et une
morbidité plus sévère (60, 79). Quoiqu’aucune étude n’ait évalué l’expression de la
voie CD200/CD200R dans l’asthme allergique, l’activation des mastocytes (cellules
importantes dans la cascade asthmatique; voir section 1.3.3) est inhibée par le
CD200 (72). De plus, une étude génétique a associé une diminution de
l’expression de CD200 avec l’exacerbation de l’asthme (80).
En résumé, le CD200 et son récepteur sont impliqués dans le maintien de
l’homéostasie et particulièrement dans le poumon (8). Par contre, le rôle de la voie
du CD200/CD200R dans l’asthme allergique est encore inconnu.
1.3. Asthme allergique
L’homéostasie pulmonaire est importante afin de maintenir le statu quo face
aux particules exogènes qui entrent dans le poumon. Lorsque ce mécanisme est
défectueux, le seuil d’activation du système immunitaire est diminué et cela peut
conduire au développement de maladies inflammatoires, telles que l’asthme (81,
82). En effet, chez les asthmatiques, le système immunitaire réagit de façon
exagérée à un élément habituellement inoffensif. Bien que l’asthme ait plusieurs
étiologies (asthme à l’effort, asthme occupationnel, asthme allergique, etc.), une
17
grande proportion des asthmatiques sont allergiques. Pour cette raison, cette
thèse se concentre uniquement sur la pathologie de l’asthme allergique.
Chez les asthmatiques allergiques, les fonctions respiratoires sont
diminuées lors de l’exposition à un allergène. En outre, la pathologie de l’asthme
allergique se caractérise par une bronchoconstriction réversible, une inflammation
de type Th2, le développement d’une hyperactivité bronchique (AHR) et du
remodelage bronchique. Afin de mieux définir l’asthme allergique, cette section
sera divisée en trois parties, soit des informations générales, une description de la
pathologie et un survol de la réaction inflammatoire.
1.3.1. Généralités
L’asthme allergique est une maladie hétérogène débutant aussi bien chez
les enfants que les adultes et qui est présente dans les pays occidentaux et les
pays en voie de développement. Mondialement, il y a environ 235 millions
d’asthmatiques (83). Au Canada, la prévalence atteint presque les 10% (84). De
plus, dans certaines régions du monde, 30 % des enfants sont asthmatiques et les
deux tiers de ceux-ci le resteront à l’âge adulte (85). Malgré un indice DALY (indice
de la mortalité et la morbidité) faible (25e position en 2001) (86), l’asthme entraine
un fardeau économique important (les coûts associés à l’asthme sont d’environ
654 millions $ annuellement au Canada (87, 88)).
Bien que les facteurs induisant le développement de l’asthme ne soient pas
encore totalement élucidés, plusieurs facteurs de risque lui sont associés. Les
deux principales catégories de facteurs de risque sont les prédispositions
génétiques et l’exposition environnementale; ceux-ci agissant en synergie.
Beaucoup d’efforts ont été investis pour identifier des variations génétiques
associées à l’asthme (ou un de ces composants, e.g. l’AHR), ce qui a généré une
18
longue liste de gènes liés à la susceptibilité de développer de l’asthme (89, 90).
Malheureusement, plusieurs de ces gènes ont seulement été identifiés dans un
nombre limité d’études et la plupart de ces gènes expliquent une faible portion de
l’héritabilité de la maladie (89, 91). De plus, l’augmentation de la prévalence
observée lors des dernières décennies est vraisemblablement causée par des
facteurs environnementaux (ou l’interaction entre les gènes et l’environnement) et
non par une « dérive » génétique (92, 93). En autres, plusieurs études ont
démontré le rôle des infections virales (i.e. leur nature, fréquence et intensité) dans
le développement de l’asthme (94, 95). Par contre, les thérapies proposées sont
encore basées sur les connaissances classiques de l’asthme et tardent à inclure
(et/ou identifier) de nouvelles cibles thérapeutiques.
Deux catégories de médicaments sont utilisées pour traiter l’asthme : les
bronchodilatateurs et les anti-inflammatoires (96, 97). Leur utilisation a comme
objectif principal de prévenir l’apparition de symptômes, ainsi que de réduire le
risque d’exacerbation (Figure 1.3) (97). Les 2-agonistes (bronchodilatateur) à
action rapide ou à longue action ont simplement pour but de dilater les voies
aériennes et ainsi, de prévenir ou de stopper la bronchoconstriction lors de la
réaction immédiate (voir section 1.3.2). Si la fréquence des crises d’asthme est
élevée (plus de deux par semaine) ou si l’asthme s’exacerbe, il est recommandé
d’ajouter d’autres classes de médicaments (Figure 1.3). L’inhalation de
corticostéroïdes permet de réduire l’inflammation pulmonaire de façon non-
spécifique. L’utilisation d’antagonistes des LT peut être efficace chez les patients
sévères ou ceux présentant une forte éosinophilie, car les LT sont entre autre
impliqués dans le recrutement de ces cellules (Figure 1.3; étape 2). Une autre
option est l’utilisation d’anti-IgE (Immunoglobuline E) (98, 99). Cette classe de
médicament permet de bloquer la liaison des IgE avec leurs récepteurs, ce qui
interfère avec la réaction asthmatique et particulièrement l’étape de sensibilisation
(voir section 1.3.3). (97)
19
Malgré tout, une certaine portion d’asthmatiques n’arrive toujours pas à
contrôler leurs symptômes avec les différentes options disponibles (98, 100), ce
qui suggère que d’autres mécanismes sont impliqués dans l’immunité pulmonaire.
Une meilleure compréhension de ces mécanismes permettrait de cibler différentes
voies, telles que CD200/CD200R, pour mieux contrôler l’asthme. En somme,
l’asthme est une maladie inflammatoire très répandue qui est partiellement
contrôlée par l’utilisation de bronchodilatateurs et d’anti-inflammatoires.
Figure 1.3 : Option de traitement de l’asthme par
étape.
Shématisation simplifiées des étapes de traitements telles
que recommandé par le Global initiative for Asthma en 2011
(97). Selon le niveau de contrôle et d’exacerbation du
patient, il peut augmenter ou descendre d’une étape.
Étape 2 Étape 3 Étape 4 Étape 1
Corticostéroïdes inhalés
Antagonistes
des LT
Corticostéroïdes + β2-agonistes à longue
action
Antagonistes des LT
(si forte éosinophilie)
Bronchodilatateurs à action rapide (au besoin)
Cortico-stéroïdes
oraux
Anticorps
anti-IgE
20
1.3.2. Physiopathologie
L’asthme allergique est une maladie hétérogène qui possède plusieurs
phénotypes et tout autant d’étiologies (101-103). En effet, l’asthme est de plus en
plus considéré comme un syndrome regroupant plusieurs « sous pathologies ». La
grande famille de l’asthme se caractérise principalement par l’obstruction
réversible des voies aériennes, tandis que les sous-catégories sont distinguées à
l’aide d’une multitude de biomarqueurs. Plusieurs marqueurs sont de plus en plus
acceptés (tels que la concentration de NO exhalée et les niveaux d’éosinophiles
dans les lavages broncho-alvéolaire (LBA) ou les expectorations induites), tandis
que d’autres restent encore sous investigation (e.g. la concentration sérique d’IgE
et le profil de cytokines des LBA) (Figure 1.4) (104-106). Malgré tout, l’asthme
allergique est classiquement caractérisé par une contraction rapide, mais
réversible, des voies aériennes lorsqu’exposées à un allergène, le développement
d’une AHR, la mise en place d’une inflammation chronique de type Th2 et le
remodelage des voies aériennes (85, 107, 108).
Lorsqu’un asthmatique est exposé à un allergène (provocation), il y a une
réaction immédiate et une réaction tardive. La réaction immédiate se produit
quelques minutes après la provocation et entraine une contraction des voies
aériennes principalement causée par l’activation des mastocytes (109). La réaction
tardive n’est pas présente chez tous les asthmatiques, mais lorsque présente, elle
débute de 3 à 6 heures après la provocation et peut durer quelques jours si elle
n’est pas contrôlée (107). Lors de la réaction tardive, il y a un rétrécissement des
voies aériennes, mais celui-ci est principalement causé par une infiltration de
cellules inflammatoires de type Th2 dans la muqueuse bronchique (110).
Finalement, toutes les cellules inflammatoires ainsi que de nombreux médiateurs
déclenchent des modifications structurelles qui aboutissent au développement de
l’AHR, ainsi qu’au remodelage bronchique. Le remodelage bronchique est une
série de modifications structurelles qui incluent la désorganisation de l’épithélium,
l’épaississement de la membrane basale, l’hypersécrétion de mucus et la
21
prolifération des cellules musculaires lisses et des myofibroblastes (103). Bref,
l’asthme est une maladie hétérogène, regroupant un certain nombre de
caractéristiques communes, causée par l’activation d’une panoplie de cellules
inflammatoires.
1.3.3. Cascade inflammatoire
Plusieurs cellules immunitaires jouent un rôle important dans le
développement de l’asthme allergique. Comme son nom l’indique, l’asthme
allergique est une réponse immune contre un allergène, substance normalement
non-immunogène. L’inflammation observée chez les asthmatiques, aussi bien
Figure 1.4 : Biomarqueurs de l’asthme.
Afin de distinguer les différentes catégories d’asthme,
certains biomarqueurs sont acceptés (texte noire), en voie
d’être accepté (flanqué de *) et ceux qui sont encore sous
investigation (texte blanc).
LBA : Lavage broncho-alvéolaire; IgE : Immunoglobuline
E; LT : Leucotriène.
Modifié de Vijverberg et al (105).
* LTE4 *
Cytokines
* Oxide Nitrique * Cytokines Chimiokines LT
Cellules inflammatoires Protéines inflammatoires
Remodelage (biopsie) Éosinophilie Cytokines
Cytokines Chimiokines IgE Éosinophilie
Expectoration induite
LBA et Poumon
Sang périphérique
Air expiré
Salive
Urine
22
dans le LBA que les biopsies, se caractérise principalement par une accumulation
de lymphocytes, d’éosinophiles et de mastocytes (103, 110, 111). Il est important
de noter que plusieurs facteurs, mentionnés plus haut (section 1.2.1), sont
impliqués dans le développement de l’inflammation en réponse aux allergènes,
mais le rôle exact de chacun est encore mécompris. Néanmoins, l’activation du
système immunitaire dans l’asthme se divise en deux sections principales, soit
l’étape de sensibilisation et celle d’amplification de l’inflammation.
Sensibilisation
La sensibilisation survient lorsque les allergènes qui pénètrent dans les
voies aériennes sont capturés par une cellule présentatrice d’antigènes (Figure
1.5). Dans l’asthme, les DC sont les principales cellules présentatrices d’antigènes,
mais les cellules épithéliales, les lymphocytes B et les macrophages peuvent
également effectuer ce rôle (112). Plusieurs études suggèrent que les mDC sont
responsables d’échantillonner les voies aériennes à la recherche d’allergènes,
tandis que les pDC jouent un rôle secondaire en favorisant la mise en place d’un
environnement Th2 (11, 113-115). L’activation des DC via les PRR est nécessaire
pour leur maturation et leur migration vers les ganglions lymphatiques. Quoique
plusieurs allergènes activent directement les PRR (soit en liant directement le PRR
soit en libérant des ligands pour les PRR via leur activité protéolytique), certains
allergènes sont dépourvus de cette capacité (116, 117). Dans ces cas, il est
probable que la présence concomitante (ou préexistante) d’une infection virale ou
bactérienne, ou encore, simplement de composantes de paroi bactérienne, telles
les LPS, soit nécessaire pour activer pleinement les DC.
Les DC matures migrent ainsi vers les ganglions lymphatiques afin de
présenter l’allergène via le CMH II à des lymphocytes CD4+. Afin de polariser les
lymphocytes vers une réponse Th2, il faut que l’activation des lymphocytes soit
effectuée dans un microenvironnement riche en IL-4 (3e signal important pour
polariser les Th2). Contrairement à d’autres 3e signaux, l’IL-4 ne peut être produite
23
par les DC. Les basophiles/mastocytes ou les AM seraient des sources
alternatives (118, 119). Bref, les premières étapes de la sensibilisation sont
principalement effectuées par les DC qui capturent l’allergène.
Une fois les lymphocytes Th2 polarisés, ceux-ci vont à leur tour activer la
production d’IgE par les lymphocytes B (Figure 1.5). Pour ce faire, les lymphocytes
Th2 produisent deux signaux. Ils sécrètent des cytokines, dont l’IL-4, et expriment
des molécules de co-stimulations, telles que le CD40L (120). Les lymphocytes B
ainsi activés sécrètent des IgE qui se lient aux récepteurs à faible (CD23) et à
haute affinité (FcRI). Quoique le CD23 ait un rôle secondaire dans la réponse
allergique, il participe à l’activation de plusieurs leucocytes, tels que les MA, et
facilite la présentation antigénique (120, 121). Quant à lui, le FcRI est exprimé
principalement sur les basophiles et les mastocytes et a un rôle essentiel dans la
réaction allergique (122). En effet, la liaison d’IgE à la surface des mastocytes est
Figure 1.5 : Étapes importantes de la sensibilisation de
l’asthme allergique.
Interaction des principales cellules impliquées dans l’initiation de
la cascade inflammatoire dans l’asthme allergique. Les DC
capturent l’allergène et activent les lymphocytes T, qui à leur tour
activent les lymphocytes B. Les lymphocytes B s’activent et
sécrètent des IgE qui se lient aux mastocytes. Lorsqu’exposé de
nouveau à l’allergène, tout le système immunitaire est prêt à
induire la cascade inflammatoire.
Modifié de Holgate et al (103).
DC
Lymphocytes Th2
IL-4 IL-13
Lymphocytes B
Allergènes Mastocyte
s
IgE
24
un signal de survie et de production de cytokines et permet l’activation des
mastocytes lors d’une seconde rencontre avec l’allergène (123, 124).
Quoiqu’illustré en un processus continu et ponctuel dans le temps, la
sensibilisation s’effectue habituellement en plusieurs cycles. Ces cycles peuvent
être plus ou moins rapprochés dans le temps et se superposent partiellement avec
l’étape suivante, la cascade inflammatoire.
Cascade inflammatoire
Une fois la sensibilisation établie, i.e. lorsque le système immunitaire est
suffisamment activé par les expositions à l’allergène, la prochaine exposition à
l’allergène entraine une réponse immunitaire rapide et multifactorielle (Figure 1.6).
La cascade inflammatoire est divisée en deux grandes étapes, soit la réaction
immédiate et la réaction tardive (voir section 1.2.2). (125)
La réaction immédiate est déclenchée par l’activation des mastocytes et
d’autres cellules inflammatoires résidentes des poumons (120). Les mastocytes
sont dispersés dans le parenchyme pulmonaire, aussi bien au travers de
l’épithélium bronchique que parmi les cellules musculaires lisses. L’activation des
mastocytes s’effectue par la multimérisation des FCRI par l’allergène, ce qui induit
la dégranulation des mastocytes. Donc, les mastocytes s’activent rapidement
après l’entrée de l’allergène dans le poumon et libèrent principalement de
l’histamine, des protéases, ainsi que certaines cytokines emmagasinées dans
leurs granules (e.g. du TNF et un peu d’IL-4). L’histamine a comme principal effet
d’induire la contraction des cellules musculaires lisses (ce qui induit la
bronchoconstriction) et augmente également la perméabilité de l’endothélium et la
sensibilité des terminaisons nerveuses. Quant à elles, les protéases sont
impliquées dans la désorganisation de l’épithélium et favorisent la
bronchoconstriction. En plus de libérer le contenu de leurs granules, les
mastocytes synthétisent rapidement des médiateurs lipidiques, tels que le LTC4 et
25
la PGD2, qui participent à la bronchoconstriction, ainsi qu’au recrutement et à
l’activation de nombreuses cellules inflammatoires (103).
En plus de leur rôle dans la réaction immédiate, les mastocytes participent
également à la réaction tardive. Ils produisent une panoplie de médiateurs
inflammatoires, tels que l’IL-4, l’IL-5 et le TNF (126). Ces cytokines participent,
entre autre, au recrutement des lymphocytes Th2 et des éosinophiles, ainsi qu’à
Figure 1.6 : Cascade inflammatoire de l’asthme allergique.
Représentations schématiques des principaux évènements impliqués
dans le développement de la réponse inflammatoire asthmatique. Suite à
la sensibilisation, l’exposition à l’allergène entraine l’activation des
mastocytes qui dégranulent et libèrent plusieurs médiateurs Th2. De
plus, les DC capturent l’allergène et activent les lymphocytes dans le
poumon et dans les ganglions. Cette cascade induit une inflammation
pulmonaire éosinophilique et initie le remodelage pulmonaire.
Modifié de Lambrecht et al (125).
DC matures
Mucus
Épithélium bronchique
Contraction du muscle-
lisse
Activation de
l’endothélium et extravasation de
leucocytes
Polarisation des lymphocytes vers une
réponse Th2
Production
d’IgE
Vaisseau sanguin
Ganglion lymphatique
Th2
DC mature
DC immature
Mastocyte
Allergènes
Lymphocyte B
26
leur activation. En plus des mastocytes, les DC sont essentielles pour la mise en
place de l’inflammation pulmonaire (112, 127). En effet, la déplétion des DC chez
des souris sensibilisées inhibe le développement d’AHR et d’inflammation
pulmonaire, tandis que l’injection de DC rend les animaux de nouveau suceptibles
au dévelopement de l’asthme (128). Tout comme dans l’étape de sensibilisation,
les DC sont importantes pour échantillonner les allergènes présents dans les voies
aériennes. Par contre, à cette étape, les DC activent les lymphocytes aussi bien
dans le poumon qu’aux ganglions lymphatiques (129, 130). Ces rôles sont
davantage associés aux mDC, mais les pDC peuvent également participer à cette
étape. En effet, le nombre de pDC augmente dans l’asthme suite à une exposition
à l’allergène (131, 132), mais leur rôle est controversé (voir section 1.1.3) (38, 43,
114). Donc, les DC jouent un rôle important dans cette étape en capturant
l’allergène et amplifiant la réponse Th2 (120). Cependant, il existe une controverse
à savoir quelle population de DC est impliquée dans la cascade inflammatoire de
l’asthme allergique.
L’activation des lymphocytes Th2 est la pierre angulaire de la cascade
inflammatoire asthmatique et la sévérité de la maladie corrèle avec le niveau de
lymophocytes Th2 (117). De plus, ceux-ci sont impliqués dans toutes les facettes
de la maladie, aussi bien dans le maintien de l’AHR, que dans l’inflammation
chronique et le remodelage bronchique (117, 120, 133). En effet, les lymphocytes
sont la principale source d’IL-4, ainsi que d’IL-5, d’IL-9 et d’IL-13, des cytokines
prototypiques de l’asthme allergique (117, 134). Tous ces médiateurs participent
entre autres à la désorganisation de l’épithélium et de l’endothélium, ainsi qu’à
l’activation des cellules musculaires lisses. De plus, les lymphocytes Th2 sont très
importants pour le recrutement des autres cellules inflammatoires au poumon, dont
les éosinophiles. L’association de l’éosinophile dans l’asthme allergique est
connue depuis presque 100 ans, mais son rôle est encore débattu. L’éosinophilie
est typiquement associée au développement d’AHR (110), mais de récentes
études suggèrent que chez certains type d’asthme, l’AHR n’est pas associé au
nombre d’éosinophiles (135-138). Malgré tout, les éosinophiles sont considérés
27
comme les cellules effectrices principales de la réaction inflammatoire asthmatique
(139, 140). Une fois recrutés au poumon (via les éotaxines et l’IL-5), les
éosinophiles libèrent le contenu de leurs granules (103, 126, 140). Les différentes
protéines libérées activent les cellules musculaires lisses et les cellules nerveuses,
tout en endommageant les cellules endothéliales et épithéliales (126). De plus, ces
protéines favorisent la production d’histamine par les mastocytes et la sécrétion de
mucus dans les voies aériennes. En plus de dégranuler, les éosinophiles sont
capables de produire un large éventail de médiateurs impliqués aussi bien dans
leur propre recrutement et activation (par exemple les éotaxines et IL-5), que des
médiateurs impliqués dans l’inflammation (dont que les LT, l’IL-4 et l’IL-13) et le
remodelage. En résumé, les lymphocytes Th2 et les éosinophiles jouent un rôle
important dans la réaction inflammatoire de l’asthme allergique.
Plusieurs cellules immunitaires sont importantes dans la cascade
inflammatoire de l’asthme, dont les éosinophiles, les lymphocytes Th2 et les DC.
Cependant, l’implication des différentes populations de DC dans le développement
de la cascade inflammatoire est encore matière à débat. De plus, peu
d’informations sont disponibles sur les facteurs responsables du bris de
l’homéostasie pulmonaire en réponse à l’exposition à un allergène.
1.3.4. Dichotomie du rôle des AM
Les AM sont une cellule centrale pour l’immunité pulmonaire, mais leur rôle
dans la cascade inflammatoire asthmatique est encore débattu (141, 142). Cela
est en partie causé par la capacité des AM à produire aussi bien une réponse pro-
inflammatoire qu’anti-inflammatoire (54, 61, 143). En effet, les AM de patients
asthmatiques sont polarisés vers un phénotype pro-inflammatoire M2a (voir
section 1.1.4) et favorisent une réponse inflammatoire (augmentation de la
production de médiateurs Th2 et réduction de leur capacité à phagocyter) (50, 144,
28
145). Ces résultats suggèrent donc que chez les patients asthmatiques, les AM
sont néfastes pour l’homéostasie pulmonaire.
Afin de mieux comprendre le rôle des AM dans la cascade asthmatique,
plusieurs équipes ont investigué l’implication des AM dans des modèles animaux.
Certaines équipes ont démontré que l’élimination des AM de souris asthmatiques
réduit l’AHR et la production de TNF 143(143, 146), ce qui suggère que les AM ont
un rôle délétère. Par contre, plusieurs études démontrent que l’élimination des AM
augmente l’inflammation pulmonaire induite par une exposition allergénique, et ce,
aussi bien chez des animaux naïfs (147(147, 148) qu’ayant de l’asthme
expérimental (56, 57, 149). Pour ajouter à la controverse, l’équipe du Dre
Bissonnette a démontré que la déplétion des AM de rats asthmatiques n’affecte
pas l’AHR et l’inflammation pulmonaire (55, 138), tandis que le transfert de AM de
rats asthmatiques n’est pas suffisant pour induire l’asthme à des rats naïfs (138).
Aussi, l’élimination des AM chez de rats résistants au développement de l’asthme
entraine le développement d’AHR (55), ce qui supporte que les AM jouent un rôle
protecteur. Malgré la grande divergence de ces résultats (qui souligne le rôle
controversé des AM dans l’asthme allergique), plusieurs études ont, quant à elles,
démontré que le rôle « par défaut » des AM est de maintenir l’homéostasie
pulmonaire et de protéger contre le développement de l’asthme.
La confirmation du rôle protecteur des AM a été obtenue lorsque des AM
d’animaux naïfs injectés chez des animaux asthmatiques ont inhibé plusieurs
caractéristiques de la réaction inflammatoire. Entre autres, l’étude de Bang et al
(57) démontre que les AM naïfs réduisent grandement l’éosinophilie chez des
souris asthmatiques, tandis que l’équipe du Dre Bissonnette a démontré que le
transfert de AM naïfs dans des rats asthmatiques inhibent l’AHR et interfère avec
la production de cytokines pro-inflammatoires, dont le TNF (55, 58, 138). En
résumé, ces études démontrent le rôle anti-inflammatoire des AM, mais peu
d’informations sont disponibles sur les mécanismes impliqués dans cette
régulation de l’immunité pulmonaire.
29
La conversion d’un phénotype protecteur à un rôle davantage pro-
inflammatoire peut s’expliquer, en partie, par la grande plasticité des AM. En effet,
l’induction d’un phénotype inflammatoire (M2a) peut être induit par la simple
administration d’IL-33 (150). À l’inverse, les AM peuvent réacquérir un phénotype
protecteur. Par exemple, lorsque retirés du microenvironnement inflammatoire
asthmatique, des AM pro-inflammatoires redeviennent anti-inflammatoires (151).
Bref, l’environnement pulmonaire, ainsi que la présence de stimuli influence la
plasticité des AM (51), ce qui contribue à maintenir un voile d’incertitude sur leur
implication dans la pathogénèse de l’asthme.
En résumé, les AM sont des cellules immunitaires impliquées dans l’asthme
allergique et dans le maintien de l’homéostasie pulmonaire. Il semble évident que
les AM sont impliqués dans le contrôle du développement d’une réponse
immunitaire, mais les mécanismes qu’ils emploient sont encore peu définis.
1.3.5. Modèles animaux d’asthme expérimental
L’asthme est une maladie complexe qui a besoin d’être étudiée plus en
profondeur afin de pouvoir la traiter adéquatement. Plusieurs médiateurs, cellules
immunitaires et facteurs génétiques sont impliqués dans cette maladie (voir
sections précédentes), mais il est impossible de les décortiquer en profondeur en
utilisant des sujets humains (152, 153). Pour des raisons évidentes d’éthique, il
n’est possible d’obtenir que des données fonctionnelles (spirométrie en réponse à
différents stimuli) et, dans les « meilleurs » cas, quelques échantillons biologiques
(LBA, expectorations induites, sang/plasma et biopsies pulmonaires). De plus,
chaque sujet a un bagage génétique, ainsi qu’un historique d’exposition (aux
allergènes et aux virus) différent, ce qui introduit un facteur confondant. Bien qu’il
soit possible d’obtenir certaines informations à partir d’études in vitro en utilisant
des lignées cellulaires primaires, l’extrapolation de ces données in vivo est limitée.
30
En effet, ces systèmes isolent habituellement un ou quelques (2 ou 3) types
cellulaires et les exposent à un stimulus. Bien que ces études permettent d’éclairer
le mécanisme d’action d’un stimulus sur une cellule, il est difficile, voire impossible,
de reproduire la complexité de l’environnement pulmonaire.
Pour ces raisons, il est donc très avantageux d’utiliser un modèle animal.
Pour choisir un bon modèle animal, plusieurs facteurs sont à considérer, mais
aucun n’est parfait et chacun possède des avantages distincts (Tableau 1.2) (153).
Bien que l’utilisation de la souris comme modèle d’asthme allergique soit de plus
en plus répandue, les premières études furent effectuées chez le rat. L’utilisation
d’un modèle de rat apporte une limitation technique notable, le nombre de réactifs
et d’outils génétiques disponibles pour le rat est plus limité que pour la souris,
quoique leur nombre a beaucoup augmenté ces dernières années. Également, il
semble que les études génétiques effectuées chez les patients asthmatiques ne
Tableau 1.2 : Modèles animaux utilisés pour l’asthme expérimental.
Avantages Désavantages
Souris
- Réponse allergique - Disponibilité des réactifs - Outils génétiques
- Absence de réaction tardive - Différences anatomiques
Rats - Réponse allergique - Réponse immédiate/tardive/AHR
- Faible disponibilités des réactifs - Différences anatomiques
Singes
- Développement naturel d’allergie - Anatomie semblable à l’humain
- Coûteux et difficile à héberger
Principaux avantages et inconvénients des modèles animaux d’asthme allergique les plus utilisés, soit la souris, le rat et le singe (153).
31
correspondent pas à celles effectuées avec des modèles murins (154). D’un autre
côté, les modèles d’asthme chez le rat présentent toutes les étapes de la cascade
asthmatique humaine, soit la réaction immédiate, la réaction tardive, ainsi que le
remodelage bronchique et le développement d’AHR (155-157). De plus, le
système immunitaire du rat (et particulièrement le compartiment des DC) est très
similaire à celui humain.
Pour notre étude, deux souches de rats seront utilisées. La souche de rat
Brown Norway (BN) est la plus utilisée pour les modèles d’asthme. Les rats BN,
lorsque sensibilisés et exposés à un allergène, présentent les trois phases de
bronchoconstrictions (soit la réponse immédiate, tardive et le développement
d’AHR) (155-157). De plus, il présente une inflammation principalement composée
d’éosinophiles et une forte réponse Th2 (grande concentration d’IgE et forte
expression des cytokines prototypiques Th2). La deuxième souche de rats est le
rat Piebald Virol Glaxo (PVG). La principale différence avec les rats BN est que les
rats PVG développent une réponse asthmatique transitoire qui est suivie par le
développement d’une réponse tolérogène (158). Ce modèle est donc idéal pour
étudier le développement d’une réponse Treg. Ainsi, ces deux modèles
permettront de mieux comprendre l’immunité pulmonaire et tout particulièrement,
l’implication des AM et des différentes sous populations de DC dans le
développement d’une réponse tolérogène et asthmatique allergique.
33
1.
CHAPITRE 2 : Problématiques, hypothèse et
objectifs de recherche
34
2.1. Mise en contexte
L’homéostasie pulmonaire est contrôlée par l’interaction de nombreuses
cellules pulmonaires qui maintiennent l’équilibre entre la tolérance et
l’inflammation. La tolérance s’effectue soit de façon silencieuse pour éliminer les
éléments exogènes sans impliquer le recrutement de cellules immunitaires, soit via
la mise en place d’une réponse tolérogène avec l’activation de Treg. Par contre,
lorsque ces mécanismes sont dérégulés, des pathologies peuvent se développer,
dont l’asthme allergique. En effet, l’asthme allergique est causé par une réponse
immunitaire excessive contre un allergène (particule exogène inoffensive) (81, 82).
Il est intéressant de noter que les DC sont des acteurs importants aussi bien pour
la mise en place d’une réponse anti-inflammatoire que pour le développement de
l’asthme (9). Par contre, les mécanismes qui dictent le type de réponse
immunitaire que les DC doivent favoriser sont mal compris. Une théorie
généralement acceptée est que des sous-populations de DC distinctes activent
différentes voies de la réponse immunitaire. D’autres suggèrent que l’activation
des DC varie plutôt selon leur localisation dans l’arbre bronchique, i.e. les DC des
voies aériennes supérieures vs celles du parenchyme pulmonaire (13). En résumé,
le paradigme actuel veut que les DC soient cruciales pour la polarisation de la
réponse immunitaire. Nous avons donc investigué la réponse des sous-
populations de DC, présentes à différents niveaux de l’arbre respiratoire,
dans le contexte d’une réponse immune pulmonaire allergique.
Une autre cellule immune clé du poumon est le AM, car il est parmi les
premières cellules à être en contact avec les éléments exogènes qui pénètrent
dans le poumon. Dre Bissonnette (55, 58, 138), ainsi que d’autres équipes (57,
145, 149, 159), ont démontré que, de façon constitutive, le rôle des AM est de
maintenir l’homéostasie pulmonaire et que leur fonction altère la réponse
inflammatoire de l’asthme allergique (55, 58, 62). De plus, des évidences in vitro
montrent que les AM influencent la chaine d’évènements menant à l’initiation d’une
35
réponse induite par les DC (62, 63). Toutefois, il existe une incertitude à savoir
quelle étape du processus d’activation des DC (capture de l’allergène, maturation
ou migration) est modulée par les AM et si ce contrôle est dérégulé dans le
contexte de la réponse asthmatique allergique. Notre étude s’est donc
concentrée sur la régulation de différentes fonctions des DC par les AM in
vivo.
Finalement, la modulation du système immunitaire pulmonaire est effectuée
via plusieurs mécanismes, dont l’expression de protéines membranaires anti-
inflammatoires. Parmi celles-ci, la voie de signalisation du CD200 et de son
récepteur (CD200R) occupe une place importante. En effet, la dérégulation de la
voie du CD200/CD200R est impliquée dans plusieurs pathologies, dont l’arthrite et
le cancer (69). Dans le poumon, la réponse antivirale implique la voie du
CD200/CD200R, puisque sans celle-ci, l’inflammation et la morbidité sont plus
importantes (60). Le rôle de CD200/CD200R n’a jamais été étudié dans l’asthme
allergique, mais une étude génétique a démontré que lors d’exacerbations, les
monocytes circulants d’asthmatiques expriment moins de CD200 que ceux de
sujets sains (80). De plus, le CD200 et le CD200R sont exprimés par de
nombreuses cellules immunitaires pulmonaires (les DC, AM, etc.) (66), ce qui
suggère que, lors d’exposition aux allergènes, la tolérance est, au moins en partie,
médiée par cette voie de signalisation. Nous avons donc caractérisé
l’expression du CD200 dans un modèle d’asthme et avons étudié les effets
d’un agoniste des récepteurs du CD200 dans le contexte de l’asthme.
2.2. Hypothèse et objectifs
Cette thèse a pour objectif général de mieux comprendre les mécanismes
immunitaires impliqués dans l’homéostasie pulmonaire et surtout, comment ceux-ci
36
sont dérégulés dans l’asthme allergique. Ainsi, trois mécanismes seront abordés
dans le contexte d’une exposition allergénique : l’activation des populations de DC
dans une réponse tolérogène et asthmatique, le rôle protecteur des AM dans
l’immunité pulmonaire et l’interférence de la voie CD200/CD200R dans la réponse
asthmatique. Ainsi, notre hypothèse générale est que la pathogénèse de
l’asthme est associée avec la dérégulation des fonctions des AM et des DC.
Le but est donc de disséquer certains mécanismes de régulation de ces sous-
types cellulaires, ainsi que leur interaction dans des modèles validés d’asthme
allergique. Pour cette fin, trois projets de recherche ont été poursuivis :
Objectif 1 : Comparer l’activation de populations de DC de la trachée et du
poumon lors d’une réponse immune pulmonaire tolérogène et asthmatique.
1.1. Quantifier l’activation des mDC1 et mDC2 lors d’une réponse
tolérogène et asthmatique.
1.2. Mesurer la capture de l’antigène par les différentes populations de
DC en situation tolérogène et asthmatique.
1.3. Évaluer l’activation des sous populations de DC trachéales et
pulmonaires dans la tolérance immunitaire et asthmatique.
Objectif 2 : Déterminer si l’interaction entre les AM et les DC interfère avec
l’activation des DC dans la réponse asthmatique.
2.1. Mesurer la capture de l’antigène et l’activation des populations de DC
dans l’asthme allergique.
2.2. Évaluer quelle étape de l’activation des DC est modulée par les AM
dans l’immunité pulmonaire.
Objectif 3 : Évaluer la dérégulation de la voie du CD200/CD200R dans la
pathogénèse de l’asthme allergique
3.1. Mesurer l’expression du CD200 dans le poumon en réponse à une
exposition allergénique.
37
3.2. Évaluer si l’administration de CD200 recombinant protège contre le
développement de la réponse asthmatique allergique.
39
2.
CHAPITRE 3 : Lung mDC1 and mDC2 are
differentially activated during a tolerogenic
and asthmatic response
Article en préparation pour
Plos One
40
3.1. Page titre
Lung mDC1 and mDC2 are differentially activated during a tolerogenic and asthmatic response
Lauzon-Joset, JF1,2; Strickland, DH1; Marsolais, D2; Langlois, A2; Bissonnette, EY2; Holt, PG1.
1: Division of Cell Biology, Telethon Institute for Child Health Research (TICHR), and Centre for Child Health Research, The University of Western Australia , Perth , Western Australia, Australia. 2: Centre de recherche de l’Institut universitaire de cardiologie et de pneumologie de Québec (CRIUCPQ), Université Laval, Québec, Québec, Canada.
41
3.2. Résumé
Les cellules dendritiques (DC) jouent un rôle important dans l’immunité
pulmonaire. Elles peuvent aussi bien induire une réponse tolérogène
qu’asthmatique. Plusieurs études suggèrent que les différentes populations de DC
(DC myéloïdes (mDC)1-2 et les DC plasmacytoïdes (pDC)), ainsi que les DC des
différents compartiments pulmonaires (la trachée et le parenchyme pulmonaire),
ont des rôles distincts. Par contre, l’implication des différentes populations de DC
dans la tolérance et l’asthme allergique est encore matière à débat. Donc, nous
avons investigué l’activation des populations de DC dans une réponse
tolérogénique et asthmatique. Des rats Piebald Virol Glaxo (PVG) and Brown
Norway (BN) ont été sensibilisés et exposés plusieurs fois à l’ovalbumine (OVA).
Chez les rats PVG, ce traitement induit une réponse tolérogène, tandis que les rats
BN développent une réponse asthmatique. Ainsi, nous avons étudié la contribution
des différentes populations de DC lors de ces réponses. Après de multiples
expositions à l’allergène, davantage de mDC2 pulmonaires ont capturé des
allergènes et migré vers les ganglions lymphatiques chez les rats PVG tolérogènes
que chez les rats BN. Chez les rats asthmatiques, nous n’avons pas observé de
modulation de la capture de l’allergène, ainsi que la migration vers les ganglions
lymphatiques, par les différentes populations de DC. Par contre, la maturation des
mDC1 des ganglions lymphatiques de rats asthmatiques était augmentée par
rapport à celle des rats tolérogènes. De façon surprenante, aucune modulation de
l’activation des DC de la trachée n’a été observée dans les deux réponses. Bref,
nos données suggèrent que les mDC2 pulmonaires sont activées lors de la
tolérance, tandis que la réponse asthmatique est associée avec une augmentation
de la maturation des mDC1.
42
3.3. Abstract
Dendritic cells (DC) play a crucial role in lung immunity. They can induce
either a tolerogenic response or initiate an asthmatic cascade. It is suggested that
DC in the different lung compartment (trachea and lung parenchyma), as well as
the DC subsets (myeloid DC (mDC) 1-2 and plasmacytoid DC (pDC)), have distinct
role. However, little information is available on the role of these subsets in
tolerance and asthma. We investigated the activation of the DC subsets in a
tolerogenic and asthmatic response. Piebald Virol Glaxo (PVG) and Brown Norway
(BN) rats were sensitized and exposed to multiple OVA challenges. In PVG rats,
this treatment induced a tolerogenic response, whereas BN rats developed an
asthmatic response. Then, we investigated the respective contribution of each DC
subsets in these responses. In tolerogenic rats, we observed an increased allergen
sampling by mDC2 from the lung parenchyma compared to asthmatic BN rats. This
was translated by an increased migration of OVA+ mDC2 to the draining lymph
node (dLN) of PVG rats after multiple challenges. In asthmatic rats, the allergen
capture, as well as the migration to the dLN, of the DC subsets was not modified
after asthma development. However, MHC II expression (a maturation marker) on
mDC1 in dLN was increased in BN asthmatic group compared with PVG rats.
Surprisingly, no alteration in the response of tracheal DC was observed. Thus, our
data suggest that lung mDC2 activation is associated with the tolerogenic response
in PVG rats, whereas an increased maturation of dLN mDC1 was observed in the
asthmatic response of BN rats.
43
3.4. Introduction
Lung immunity is a complex balance between tolerance and inflammation
and little information is available on the determinants that skew these immune
responses. The immune outcome is modulated by the allergen dose, but a
controversy still exists whether a low or a high allergen dose is linked with asthma
development (1). Moreover, it is suggested that various immune responses are
mediated by distinct dendritic cell (DC) populations, but no study was able to
clearly delineate the role of each DC subset (2, 3). Finally, the maturation status of
DC can also alter the immune response. Indeed, immature DC express low level of
MHC II and favour tolerance, whereas mature DC can induce either an
inflammatory or anti-inflammatory response (4). Thus, DC biology is critical to the
outcome of allergen exposure.
In the lungs, myeloid DC (mDC) represents the majority of DC, whereas
plasmacytoid DC (pDC) are scarcer (5). mDC population can be further divided in
two subsets, mDC1 and mDC2. mDC1 are specialized in soluble particle uptake
and mDC2 are more efficient than mDC1 to activate CD8 T cells (3, 6). As for pDC,
they are specialized in viral defence and are also involved in allergen tolerance (7),
but this finding is still controversial as human pDC cannot induce Treg (8). Yet, the
role of DC subsets in the development of an asthmatic response and tolerance
remains unclear (3, 7, 9, 10).
Functions of lung DC subsets differ depending on their location, tracheal
mucosa vs lung parenchyma. In naïve animal, tracheal DC have a shorter half-life
and phagocyte more antigens than their lung counterpart (11). Whether or not
these compartments are differentially regulated in the context of tolerance and
asthmatic inflammation is unknown.
44
Given that DC are central in the allergen response and that they can induce
both asthma inflammation and tolerance, we examined how tracheal and
pulmonary DC subset are modulated during a tolerogenic response and an
asthmatic reaction following allergen exposure. The present study shows, for the
first time, that in a tolerogenic response, lung mDC2 increases their capacity to
capture allergen. On the other hand, the asthmatic response was associated with
an increased maturation of mDC1, while not affecting their capacity to capture
allergens.
3.5. Material and methods
Animals, treatments, and allergen exposures.
The 8- to 12-week-old specified-pathogen-free Piebald Virol Glaxo (PVG)
and Brown Norway (BN) rats were used. All experimental protocols were approved
by the Institutional Animal Ethics Committee of the TICHR (WA, Australia).
Ovalbumin (OVA) sensitization was performed by intraperitoneal inoculation of
100 μg OVA/200 μl aluminum hydroxide and rats were challenged 14–21 days
later. The challenge was done by daily aerosol exposition carried out over a 60-min
period using 1% OVA in phosphate-buffered saline for 6 consecutive days (12). For
in situ uptake studies, the last aerosol was replaced with intranasal instillation of
50 μg of OVA-Alexa647 in 75 μl. The naïve group was not sensitized nor
challenged daily, but received an intranasal instillation of fluorescent OVA. Tissues
were harvested 2 h after the last exposure.
45
Media and reagents.
Culture medium and isolation reagents including monoclonal antibodies and
immunostaining reagents were used as previously reported (12). Briefly,
monoclonal antibodies directed against cell surface antigens to identify dendritic
cells (CD4, CD11b, and MHC Class II) were purchased from BD Pharmingen
(Western Australia, Australia). OVA (grade V essentially lipopolysaccharide-free),
collagenase type IV, and DNase were purchased from Sigma (St Louis, MO).
Cell preparations.
Lymph nodes, tracheal mucosa, and lung parenchyma were digested with
collagenase to obtain single-cell suspensions (12). Briefly, tissues were digested
with Collagenase IV and DNase I to obtain single cell suspension. These
preparations were stained with monoclonal antibodies to identify the DC subsets.
Data were acquired on an LSRII flow cytometer (BD Biosciences, San Jose, CA)
and analyzed using the Flowjo software (version 8.8.6; Tree Star Inc., Stanford,
CA).
Statistics
Prism (GraphPad Software, La Jolla, CA) was used for all statistical
analyses, which includes one-way and two-way ANOVAs with Bonferroni post hoc
test. Data are presented as mean ± SEM and p values < 0.05 were considered
significant.
46
3.6. Results
Allergen induces an accumulation of mDC in the lung parenchyma, but not
in tracheal mucosa
In order to understand the implication of each DC subsets in tolerance
versus allergic airway inflammation, sensitized PVG (allergy tolerant) and BN
(allergy susceptible) rats were exposed to 6 antigen challenges (once a day for six
days). Sensitized PVG rats who received multiple allergen challenges develop a
tolerogenic response (13), whereas sensitized BN rats develop asthma prototypic
features, including eosinophilia, airway hyperresponsiveness (AHR), and T cell
polarization (12, 14). DC subsets were identified in trachea and lung parenchyma
using fluorochome-labeled antibodies raised against MHC II, CD11b and CD4
fluorochrome labelled antibodies coupled with FACS analysis. Myeloid DC (mDC)
are MHC IIhigh/CD11b+ and can be divided in two populations according to CD4
expression (mDC1 are CD4+ and mDC2 are CD4–) and plasmacytoid DC (pDC)
are MHC IIint/CD11b–/CD4+ (Figure 3.1A). In both compartments of the lung, the
vast majority of DC were mDC, whereas the pDC subset accounted for less than
10% of the DC population. In PVG lung parenchyma, the majority of DC were
mDC1 (30 ± 5%), whereas in BN, there was an almost equal proportion of mDC1
and mDC2 (Figure 3.1B). In tracheal mucosa, the majority of DC were mDC1 for
both PVG and BN rats (respectively, 66 ± 3% and 58 ± 5%) (Figure 3.1C). Thus,
mDC1 are more represented in naïve PVG lung DC subsets, whereas mDC2 are
more frequent in naïve BN lungs.
After multiple allergen challenges, mDC1 and mDC2 accumulate in the lung
parenchyma of both BN and PVG rats, whereas the pDC subset was not
modulated (Figure 3.2A). The accumulation of mDC subsets was not different in
tolerogenic and asthmatic responses. Surprisingly, in tracheal mucosa, there was
no accumulation of mDC or pDC in either strain of rats after multiple challenges
47
(Figure 3.2B). Therefore, both the asthmatic and tolerogenic responses are
associated with an increased accumulation of mDC in the lung parenchyma,
without any alteration of the proportion of DC in the tracheal mucosa.
The tolerogenic response is associated with an increased allergen capture by lung
mDC2
We investigated the capacity of DC subsets to sample allergens. Thus, the
last challenge was done with intranasal administration of fluorescent OVA. In the
lung parenchyma of naïve rats, a significant proportion of mDC1 and mDC2 were
OVA+ in both PVG and BN rats (respectively, 10 ± 3% and 4 ± 2% for mDC1;
5 ± 2% and 3 ± 1% for mDC2) (Figure 3.3A). Interestingly, multiple allergen
challenges of PVG rats did not alter the percent of lung OVA+ mDC1, whereas the
proportion of lung OVA+ mDC2 significantly increased by 4 fold (20 ± 2% vs
5 ± 2%). In contrast, the proportion of OVA+ mDC1 and mDC2 was unchanged in
the lung parenchyma of BN rats after multiple challenges. Less than 1% of pDC
were positive for allergens in lungs of BN and PVG rats (Figure 3.3).
In tracheal mucosa of both naïve and challenged PVG, mDC1 allergen
capture represented 1 ± 1% of the mDC1 population, whereas 8 ± 2% and 6 ± 1%
mDC2 were OVA+, respectively (Figure 3.3B). In BN trachea, around 1% of mDC1
and mDC2 captured allergens, independently of the group studied. Overall, the
tolerogenic response was marked by a strong increase in allergen capture by lung
parenchyma mDC2, while no modulation of OVA+ DC was observed in the allergic
response.
The tolerogenic response is characterized by a strong accumulation of OVA+
mDC2 to the draining lymph nodes
48
After sampling allergens in the lungs, DC migrate to the draining lymph
nodes (dLN) to stimulate reactive T cells. This step is crucial to mount an immune
response, either inflammatory or tolerogenic. Thus, we evaluated the type of OVA+
DC that migrated from the lung to dLN 2 h after a fluorescent OVA challenge. In
naïve PVG rats, 76 ± 11% of the dLN OVA+ DC were mDC1, whereas OVA+ mDC2
and pDC represented respectively, 24 ± 11% and 1 ± 1%. Multiple challenged PVG
rats had a drastic increase in the number of dLN OVA+ DC by more than 40-fold.
The greatest increase was observed for mDC2, which reached 478 ± 53 x103
OVA+ cells per dLN, whereas OVA+ mDC1 and pDC reached, respectively,
62 ± 11 x103 and 13 ± 4 x103 OVA+ cells per dLN (Figure 3. 4). In dLN of naïve BN
animals, the proportion of OVA+ DC favored slightly mDC1 over mDC2 (64 ± 15%
vs 35 ± 15%), whereas 1 ± 1% of dLN pDC were OVA+. Moreover, the amount of
OVA+ DC in the dLN did not increase in BN rats after multiple challenges
compared with the naïve group. Therefore, the hallmark of the tolerogenic
response is a strong migration of OVA+ mDC2 to the dLN, while in asthmatic
animals mDC OVA+ migration to the dLN was not altered.
mDC1 maturation is increased in the dLN of asthmatic rats
To further investigate the implication of the DC subsets in immune response,
we evaluated the activation status of DC subsets in the dLN using the expression
of MHC II. In PVG rats, MHC II expression by dLN DC subsets was similar
between naïve and multiple challenged rats (Figure 3.5). In BN animals, multiple
allergen challenges induce a significant 2-fold increase of MHC II expression on
mDC1, whereas no difference was observed in mDC2 and pDC. Thus, no increase
of DC maturation was observed in tolerogenic rats, whereas BN inflammatory
response was associated with an enhanced maturation of dLN mDC1.
49
3.7. Discussion
Lung homeostasis involves a complex interplay between immune cells.
Depending on the insult perceived, the immune system normally mounts a
response to contain the threat. In allergic asthma, the homeostasis is breached
and an exaggerated immune response is triggered by usually innocuous particles
(allergens). Interestingly, DC play a key role in both homeostasis and allergic
response, but the role of specific DC subsets in tolerance and inflammation
remains poorly understood. Thus, we investigated the contribution of each DC
subset in the development of a tolerogenic and asthmatic responses. Our results
show that these two immune responses are associated with divergent activation of
specific DC subsets. Indeed, the tolerogenic response involves an increased
capture of allergens by lung parenchymal mDC2 and their rapid migration to the
dLN. In contrast, allergen capture by parenchymal mDC subsets was not increased
in asthmatic BN rats. In these rats, the weak allergen sampling and migration to the
dLN was counterbalanced by an increased maturation of their dLN mDC1. Overall,
these data support that mDC2 have a role in inducing a tolerogenic response to
inhaled allergens, whereas the asthmatic response may be mediated by mDC1.
Previous reports have shown that multiple challenges of sensitized animals,
including PVG rats (13) as well as various mouse strains (15, 16), attenuate
asthma prototypic features through enhanced Treg numbers and functions. Our
current results suggest that this phenotype is associated with an increased
sampling of the allergens by lung parenchymal mDC2 and their migration to the
dLN. These findings support a previous study that linked mouse mDC2 (identified
as CD103+ mDC) activity with Treg activation in pulmonary and intestinal
experimental settings (17, 18). The present study is in contradiction with that of
Fear et al (5) who showed that tolerogenic mice have a reduced number of OVA+
mDC in the lungs. This discrepancy suggests that tolerance can be achieved either
with a low allergen dose (i.e. amount of OVA capture by lung DC) (5) or with a high
50
DC allergen sampling (as observed in the present study and elsewhere (12)).
Furthermore, these differences could be variations between mice (5) and rat
immune tolerogenic response (12). Thus, in PVG rats, the tolerance is associated
with an increase in allergen sampling by mDC2.
To further investigate the role of DC subsets in lung immunity, we
investigated the DC response to allergens in BN asthmatic rats. The allergen
burden is linked to the polarization of the immune response, but no consensus
emerged whether high or low DC migration favors a Th2 response (1, 12, 19-21)..
In the present study, DC allergen capture was much smaller after multiple
challenges in the tracheal mucosa and in the lung parenchyma of BN rats
compared with PVG rats, supporting that a low OVA+ DC migration induced Th2
immunity. This is in agreement with Strickland et al (12) who demonstrated that the
allergic response of BN rats was associated with a low allergen capture by DC,
whereas high allergen exposure can reinstate homeostasis. Furthermore, in the
present study, we show that the asthmatic response of BN rats is associated with
enhanced maturation of dLN mDC1, supporting previous finding that mDC1 are
essential for Th2 polarization (22). More mature mDC1, even with low allergen
capture, are likely more effective to present antigen and activate Th2 cells. Overall,
the allergic response of BN rats is likely linked to a low allergen sampling (or low
allergen dose) and with increased maturation of mDC1.
Our study suggests that parenchymal, and not tracheal, DC are involved in
lung immunity or at least in tolerance induction. This observation is in contradiction
with the data of von Garnier et al (11), who showed an increased phagocytic
capacity of tracheal mDC compared to parenchymal mDC. This discrepancy could
be due to difference in species immune response or because they only
investigated the baseline response, whereas we induced an immune response via
sensitization and multiple allergen exposures. Thus, multiple challenges of
sensitized rats seem to activate parenchymal instead of tracheal mDC.
51
Overall, these findings shed some light on the activation of the different DC
subsets in the induction of tolerance and asthma. Indeed, we showed that
increased allergen sampling by parenchymal mDC2 and their migration to the dLN
is associated with tolerance induction, whereas asthma response is linked with a
low allergen sampling in conjunction with an increase of mDC1 maturation. Current
studies in our laboratory are performed to investigate whether mDC1 and mDC2
functions can be specifically altered in order to blunt the asthmatic reaction or to
favour a tolerogenic response.
3.8. Acknowledgements
This work was supported by the Canadian Institutes of Health Research
(MOP-84346), the National Health and Medical Research Council of Australia and
the Fondation JD Bégin. JFLJ was supported by Fonds de Recherche du Québec
– Santé (FRQS) and the Réseau en santé respiratoire du FRQS. DM is a FRQS
Junior 1 salary awardee. We thank Jenny Thomas (TICHR, Perth AU) for technical
help.
52
3.9. References
1. Platts-Mills TA, Woodfolk JA. Allergens and their role in the allergic immune response. Immunological reviews 2011;242(1):51-68. 2. Guilliams M, Lambrecht BN, Hammad H. Division of labor between lung dendritic cells and macrophages in the defense against pulmonary infections. Mucosal immunology 2013;6(3):464-473. 3. Desch AN, Henson PM, Jakubzick CV. Pulmonary dendritic cell development and antigen acquisition. Immunol Res 2013;55(1-3):178-186. 4. Reis e Sousa C. Dendritic cells in a mature age. Nat Rev Immunol 2006;6(6):476-483. 5. Fear VS, Burchell JT, Lai SP, Wikstrom ME, Blank F, von Garnier C, Turner DJ, Sly PD, Holt PG, Strickland DS, et al. Restricted aeroallergen access to airway mucosal dendritic cells in vivo limits allergen-specific CD4+ T cell proliferation during the induction of inhalation tolerance. J Immunol 2011;187(9):4561-4570. 6. Jakubzick C, Helft J, Kaplan TJ, Randolph GJ. Optimization of methods to study pulmonary dendritic cell migration reveals distinct capacities of DC subsets to acquire soluble versus particulate antigen. Journal of immunological methods 2008;337(2):121-131. 7. de Heer HJ, Hammad H, Soullie T, Hijdra D, Vos N, Willart MA, Hoogsteden HC, Lambrecht BN. Essential role of lung plasmacytoid dendritic cells in preventing asthmatic reactions to harmless inhaled antigen. The Journal of experimental medicine 2004;200(1):89-98. 8. Hubo M, Jonuleit H. Plasmacytoid dendritic cells are inefficient in activation of human regulatory T cells. PloS one 2012;7(8):e44056. 9. Li X, Yang A, Huang H, Zhang X, Town J, Davis B, Cockcroft DW, Gordon JR. Induction of type 2 T helper cell allergen tolerance by IL-10-differentiated regulatory dendritic cells. American journal of respiratory cell and molecular biology 2010;42(2):190-199. 10. Charbonnier AS, Hammad H, Gosset P, Stewart GA, Alkan S, Tonnel AB, Pestel J. Der p 1-pulsed myeloid and plasmacytoid dendritic cells from house dust mite-sensitized allergic patients dysregulate the T cell response. Journal of leukocyte biology 2003;73(1):91-99. 11. von Garnier C, Filgueira L, Wikstrom M, Smith M, Thomas JA, Strickland DH, Holt PG, Stumbles PA. Anatomical location determines the distribution and function of dendritic cells and other APCs in the respiratory tract. J Immunol 2005;175(3):1609-1618. 12. Strickland DH, Thomas JA, Mok D, Blank F, McKenna KL, Larcombe AN, Sly PD, Holt PG. Defective aeroallergen surveillance by airway mucosal dendritic cells as a determinant of risk for persistent airways hyper-responsiveness in experimental asthma. Mucosal immunology 2012;5(3):332-341. 13. Strickland DH, Stumbles PA, Zosky GR, Subrata LS, Thomas JA, Turner DJ, Sly PD, Holt PG. Reversal of airway hyperresponsiveness by induction of
53
airway mucosal CD4+CD25+ regulatory T cells. The Journal of experimental medicine 2006;203(12):2649-2660. 14. Careau E, Sirois J, Bissonnette EY. Characterization of lung hyperresponsiveness, inflammation, and alveolar macrophage mediator production in allergy resistant and susceptible rats. American journal of respiratory cell and molecular biology 2002;26(5):579-586. 15. Burchell JT, Wikstrom ME, Stumbles PA, Sly PD, Turner DJ. Attenuation of allergen-induced airway hyperresponsiveness is mediated by airway regulatory T cells. American journal of physiology Lung cellular and molecular physiology 2009;296(3):L307-319. 16. Swirski FK, D'Sa A, Kianpour S, Inman MD, Stampfli MR. Prolonged ovalbumin exposure attenuates airway hyperresponsiveness and T cell function in mice. Int Arch Allergy Immunol 2006;141(2):130-140. 17. del Rio ML, Bernhardt G, Rodriguez-Barbosa JI, Forster R. Development and functional specialization of CD103+ dendritic cells. Immunological reviews 2010;234(1):268-281. 18. Khare A, Krishnamoorthy N, Oriss TB, Fei M, Ray P, Ray A. Cutting Edge: Inhaled Antigen Upregulates Retinaldehyde Dehydrogenase in Lung CD103+ but Not Plasmacytoid Dendritic Cells To Induce Foxp3 De Novo in CD4+ T Cells and Promote Airway Tolerance. J Immunol 2013;191(1):25-29. 19. Boonstra A, Asselin-Paturel C, Gilliet M, Crain C, Trinchieri G, Liu YJ, O'Garra A. Flexibility of mouse classical and plasmacytoid-derived dendritic cells in directing T helper type 1 and 2 cell development: dependency on antigen dose and differential toll-like receptor ligation. The Journal of experimental medicine 2003;197(1):101-109. 20. Hosken NA, Shibuya K, Heath AW, Murphy KM, O'Garra A. The effect of antigen dose on CD4+ T helper cell phenotype development in a T cell receptor-alpha beta-transgenic model. The Journal of experimental medicine 1995;182(5):1579-1584. 21. von Garnier C, Wikstrom ME, Zosky G, Turner DJ, Sly PD, Smith M, Thomas JA, Judd SR, Strickland DH, Holt PG, et al. Allergic airways disease develops after an increase in allergen capture and processing in the airway mucosa. J Immunol 2007;179(9):5748-5759. 22. Plantinga M, Guilliams M, Vanheerswynghels M, Deswarte K, Branco-Madeira F, Toussaint W, Vanhoutte L, Neyt K, Killeen N, Malissen B, et al. Conventional and Monocyte-Derived CD11b(+) Dendritic Cells Initiate and Maintain T Helper 2 Cell-Mediated Immunity to House Dust Mite Allergen. Immunity 2013;38(2):322-335.
54
3.10. Figure legends
Figure 3.1: The proportion of lung parenchyma mDC1 and mDC2 is different
between naïve PVG and BN.
Single cell suspensions of lung parenchyma and tracheal mucosa were prepared
from naïve PVG and BN rats. DC were identified by flow cytometry using MHC II,
CD11b and CD4 expression in whole cell suspensions. A) Gating strategy used to
identify mDC1, mDC2, and pDC. The proportion of DC subsets in the lung
parenchyma and in the tracheal mucosa of PVG and BN rats is depicted in,
respectively, B) and C). Lung parenchymal mDC1 were overrepresented in PVG
compared with BN, whereas mDC2 were overrepresented in BN compared with
PVG. Frequencies of DC subsets in the trachea were similar between the two
strains of rats. pDC represented a minor fraction in the tissues tested. *: indicates
significant differences (p < 0.05). Mean SEM; n = 3-4 per group.
Figure 3.2: Parenchymal mDC proportion is increased in both tolerogenic and
asthmatic response.
Single cell suspensions of lung parenchyma and tracheal mucosa were prepared
from PVG and BN rats 2 h after OVA challenge. DC were identified by flow
cytometry using MHC II, CD11b and CD4 expression in whole cell suspensions.
mDC1, mDC2, and pDC proportion of the lung parenchyma are shown in (A;B;C),
whereas tracheal mDC1, mDC2, and pDC are shown in (D;E;F). mDC1 and mDC2
were increased in lung parenchyma of tolerogenic and asthmatic rats compared
with their respective naïve group. No modulation of DC proportion was observed in
the trachea mucosa. *: indicates significant differences (p < 0.05). Mean SEM; n
= 3-4 per group.
55
Figure 3.3: The proportion of OVA+ mDC2 is increased in tolerogenic rats.
Single cell suspensions of lung parenchyma and tracheal mucosa were prepared
from PVG and BN rats 2 h after challenge with OVA-AlexaFluor647. Allergen
capture was assessed by measuring the frequency of AlexaFluor647+ cells on DC
subsets, using flow cytometry. mDC1, mDC2, and pDC allergen capture in the lung
parenchymal is shown in (A;B;C) and in the tracheal mucosa in (D;E;F). Compared
with naïve PVG, the allergen uptake by lung mDC2 is significantly increased in
tolerogenic rats, whereas the others subsets OVA+ frequencies were not altered.
In BN, the allergen sampling of DC was not altered in any subset after multiple
challenges. *: indicates significant differences (p < 0.05). Mean SEM; n = 3-4 per
group.
Figure 3.4: OVA+ DC migration to the dLN is enhanced is tolerogenic rats.
Single cell suspensions of dLN were prepared from PVG and BN rats 2 h after
challenge with OVA-AlexaFluor647. Allergen capture was assessed by measuring
the frequency of AlexaFluor647+ cells on DC subsets, using flow cytometry. The
migration of OVA+ mDC1, mDC2, and pDC to the dLN is shown in (A;B;C).
Compared with naïve PVG, the migration of all the OVA+ DC subsets were
significantly increased after multiple allergen challenge. In asthmatic BN, the
migration of OVA+ DC was not altered in any subset compared with naïve rats. *:
indicates significant differences (p < 0.05). Mean SEM; n = 3-4 per group.
Figure 3.5: mDC1 maturation was increased in the dLN of asthmatic animals.
Single cell suspensions of dLN were prepared from PVG and BN rats 2 h after
OVA challenge. The maturation of the DC subsets was assessed by MHC II
expression, using flow cytometry. The MHC II expression on mDC1, mDC2, and
pDC in the dLN is shown in (A;B;C). In PVG rats, the expression of MCH II by the
56
DC subsets was unchanged between the naïve and the multiple challenged
groups. MHC II expression on dLN mDC1 was significantly increased in asthmatic
BN compared with naïve animals. *: indicates significant differences (p < 0.05).
Mean SEM; n = 3-4 per group.
57
3.11. Figures
Figure 3.1 : The proportion of lung parenchyma mDC1 and mDC2 is different
between naïve PVG and naïve BN.
A)
B) C)
58
Figure 3.2 : Parenchymal mDC proportion is increased in both the tolerogenic and
asthmatic response.
A)
B)
C)
D)
E)
F)
59
Figure 3.3 : The proportion of OVA+ mDC2 is increased in tolerogenic rats.
A)
B)
C)
D)
E)
F)
60
Figure 3.4 : OVA+ DC migration to the dLN is enhanced in tolerogenic rats.
A)
B)
C)
61
Figure 3.5 : mDC1 maturation was increased in the dLN of asthmatic animals.
A)
B)
C)
63
3.
CHAPITRE 4 : Dysregulation of alveolar
macrophages unleashes dendritic cell-
mediated mechanisms of allergic airway
inflammation
Article pulbié dans Musocal Immunology
Lauzon-Joset, JF; Marsolais D; Langlois, A; Bissonnette, EY; Dysregulation of alveolar macrophages unleashes dendritic cell-mediated mechanisms of allergic airway inflammation, Mucosal immunology, Jan;7(1):155-64, 2014.
64
4.1. Page titre
Dysregulation of alveolar macrophages unleashes dendritic cell-mediated
mechanisms of allergic airway inflammation
Jean-Francois Lauzon-Joset, MSc; David Marsolais, PhD; Anick Langlois, PhD;
Elyse Y Bissonnette, PhD.
Centre de recherche de l’Institut universitaire de cardiologie et de pneumologie de Québec (CRIUCPQ), Université Laval, Québec, QC, Canada. Running head: Alveolar macrophages control dendritic cells
Key Words: Homeostasis, Allergic asthma, Allergen uptake, Lung inflammation,
Th2 lymphocytes
Subjects: Pulmonary tract; Macrophages; Dendritic cells.
Corresponding author: Dr. Elyse Bissonnette
2725, chemin Ste-Foy, CRIUCPQ
Quebec, QC
Canada G1V 4G5
Phone: 418-656-4760
FAX: 418-656-4509
Jean-François Lauzon-Joset: [email protected]
David Marsolais: [email protected]
Anick Langlois: [email protected]
Elyse Bissonnette: [email protected]
Disclosure: The authors declare no conflict of interest.
65
4.2. Résumé
L’asthme allergique est une maladie chronique inflammatoire caractérisée
par une éosinophilie et l’activation de lymphocytes Th2. Cependant, peu
d’informations sont disponibles sur les mécanismes qui initient cette maladie. Des
études précédentes de notre laboratoire ont démontré que les macrophages
alvéolaires (AM) de rats asthmatiques perdent leur capacité de prévenir le
développement de l’asthme. Afin de comprendre le rôle des AM dans l’immunité
pulmonaire, nous avons investigué l’influence de la sensibilisation des AM sur
l’activation des cellules dendritiques en réponse à une exposition allergénique in
vivo. Des rats sensibilisés à l’ovalbumine développent de l’inflammation
pulmonaire (éosinophile et lymphocytes Th2) et démontrent une plus grande
activation des cellules dendritiques myéloïdes (mDC) en réponse à l’exposition à
l’allergène. Le remplacement des AM d’un rat sensibilisé par ceux d’un animal naïf
n’affecte pas l’éosinophilie, mais inhibe complètement la capture de l’allergène par
les mDC pulmonaires, ainsi que leur migration vers les ganglions lymphatiques et
la polarisation de lymphocytes Th2. De plus, les fonctions anti-inflammatoires des
AM sont associées à une faible phagocytose de l’allergène et sans altération de
leur expression de MHC II et CD23. De façon intéressante, les AM sensibilisés
regagnent leurs fonctions homéostatiques, lorsqu’ils ne sont plus dans un
environnement pro-inflammatoire. Bref, ces résultats sont les premières évidences
in vivo qui démontrent que la dérégulation des fonctions des AM est suffisante
pour induire l’activation des DC et la réponse asthmatique.
66
4.3. Abstract
Allergic asthma is a chronic inflammatory disorder characterized by
eosinophilia and Th2 cell activation. However, little information is available on the
mechanisms leading to this pathology. We previously showed that alveolar
macrophages (AM) from rats with experimental asthma lose their ability to prevent
asthma symptoms. To understand the implication of AM in lung immunity, we
investigated the influence of AM sensitization status on lung dendritic cell (DC)
activation induced by allergen challenge in vivo. Rat sensitized to ovalbumin
developed airway inflammation (eosinophils and Th2 cells) and demonstrated
myeloid DC (mDC) activation following allergen exposure. The replacement of AM
of sensitized animals by AM from naïve animals did not affect allergen-triggered
eosinophilia, but completely abolished lung mDC allergen capture and migration to
the lymph nodes, as well as Th2 cell polarisation. Moreover, immunosuppressive
functions of naïve AM occurred in conjunction with low engulfment of allergens, but
without variation of MHC II and CD23 expression. Interestingly, sensitized AM that
were withdrawn from the inflammatory environment regained their
immunosuppressive functions when transferred to sensitized rats. Thus, these are
the first in vivo evidences showing that dysregulation of AM functions is sufficient to
induce DC-triggered allergic response.
67
4.4. Introduction
Lung homeostasis is achieved by complex interactions between resident
and infiltrating immune cells, leading to either immune ignorance or tolerance
toward innocuous antigens. Dysregulation of these processes induces inadequate
immune response leading to pathologies, such as asthma. Chronic T helper (Th)2
inflammatory response, airway hyperresponsiveness (AHR), and remodelling are
hallmarks of allergic asthma1, 2. Although the roles of dendritic cells (DC), mast
cells, eosinophils, and lymphocytes in asthma pathogenesis are extensively
documented, the implication of alveolar macrophages (AM) is still misunderstood3.
This lack of information is surprising given that AM are the first immune cells
in contact with inhaled particles4. Strikingly, our laboratory5-7 and others'8-11 showed
that AM are essential to maintain lung homeostasis and dampen airway
inflammation. For instance, AM depletion causes inflammation in naïve mice12,
increases inflammation in animals with experimental asthma8-10, 13, and causes
asthma symptoms in a strain of rat resistant to asthma7. Although AM functions are
by default protective, multiple studies showed that AM from chronic asthmatic
patients have shifted towards a pro-inflammatory phenotype14, suggesting that AM
homeostatic functions are altered in asthma. Interestingly, replacing AM of
asthmatic animals with AM from naïve animals, but not from sensitized rats, inhibits
AHR and reduces inflammatory cytokines in bronchoalveolar lavage (BAL),
independently of eosinophilia5, 6. Moreover, the protective capacities of AM can be
restored. Indeed, AM from rats with experimental asthma can be reprogrammed to
a naïve phenotype, when withdrawn from the asthmatic microenvironment15.
Hence, AM in asthma lose their capacity to prevent immunopathological
responses. Yet, the mechanisms used by AM to maintain lung homeostasis remain
poorly understood.
68
DC are likely targets for AM to maintain lung homeostasis. Indeed, DC are
sentinels of the airways and critical activators of immune responses. They are
found throughout the lung epithelium and play a central role in allergic airway
inflammation. At least two DC subsets are found in the lung, myeloid DC (mDC)
and plasmacytoid DC (pDC), but their respective role in immunity is poorly
delineated. Although pDC are scarcer than mDC in lung mucosa16, both subsets
are recruited to the lung and BAL of asthmatic subjects after allergen exposure17,
18. In asthma pathogenesis, DC activation plays a central role as they capture and
present antigens locally and in draining lymph nodes (dLN)19, 20. In addition, DC
produce soluble mediators that polarise and induce chemotaxis of Th2 cells21.
Thus, inhibition of DC represents a potential mechanism by which AM could
prevent the development of allergic disease.
Circumstantial as well as in vitro evidences suggest that AM may be central
to positively and negatively modulate DC activation22, 23. Indeed, AM are in close
proximity with DC22 and, in asthma, AM produce soluble mediators involved in DC
activation24. Conversely, AM reduce the number of DC into the airway lumen of
naïve animals25 and inhibit DC-induced proliferation of T cells in vitro22. In addition,
a recent study showed that local environment, for which AM are significant
contributors, is essential to control allergen uptake by DC26. Given that DC are
central in allergic asthma pathogenesis19, 20 and that asthma can be prevented by
grafting naïve AM (nAM) into sensitized rats5, our general hypothesis is that the
ability of AM to prevent DC activation is impaired in the context of allergic airway
inflammation.
Our goal was thus to determine whether restoration of AM functions would
interfere with DC activation and DC-associated mechanisms of pulmonary T cell
response in the early events following allergen exposure. To reach this goal, we
used an extensively validated model of asthma26, i.e. ovalbumin-induced allergic
airway inflammation in Brown Norway rats. This model reflects many features of
human asthma, including lung eosinophilia, IgE response, airway inflammation,
69
and AHR27-29. In addition, rat DC subsets are similar to those observed in human30.
To look into AM functions in lung allergic airway inflammation, we took advantage
of an experimental system enabling in vivo replacement of AM of sensitized
animals with AM from either naïve or sensitized rats. The present study shows, for
the first time, that AM dysregulation in asthma is sufficient to induce DC-mediated
antigenic allergic response. Most importantly, we determined that AM withdrawn
from the asthmatic environment could regain those homeostatic functions,
supporting that they could be targeted to interfere with lung inflammation. As a
whole, our study supports that AM are dysregulated in asthma pathogenesis, which
enables mDC activation. Thus, the restoration of AM regulatory functions could be
a promising strategy to interfere with allergic airway inflammation.
4.5. Results
Frequency of eosinophils is not affected by the sensitization status of AM
The influence of AM sensitization status on the inflammatory response
induced by allergen challenge was first determined. We collected BAL cells 2 h
following allergen challenge in four different groups of animals: naïve animals
(Control), sensitized animals (Asthmatic), and sensitized animals depleted of AM
and reconstituted with AM derived from either sensitized (Asthma+sAM) or naïve
animals (Asthma+nAM). Naïve rats displayed a homeostatic response, whereas
asthmatic animals showed airway inflammation and AHR in response to
aerosolized OVA27. The total number of cells and the differential cell counts in the
BAL were then characterized (Figure 4.1). Total cell count was similar in all groups
(Figure 4.1a), which is consistent with the early time point after challenge used in
this study27, 31. While there was no difference in total cell count, the percentage of
eosinophils was significantly increased in the asthmatic group (13.3 ± 3.9%)
70
compared with the control group (0.4 ± 0.3%) (Figure 4.1b). nAM and sAM transfer
did not alter eosinophil recruitment compared with the asthmatic group (Figure
4.1b). In addition, more neutrophils were observed in the transfer groups (Figure
4.1b), but the difference was not significant and was independent of AM
sensitization status, as previously documented32. Therefore, AM did not affect early
eosinophil influx.
Naïve AM control mDC allergen uptake, but not their recruitment
Before addressing the modulation of DC functions, we enumerated lung DC
subsets, given that both mDC and pDC are recruited in the airways of asthmatic
patients17. MHCIIhigh/CD11b+ mDC represented around 90% (ranging from 87 to
94%) of the total MHCIIhigh/autoflorescence– DC in naïve rats, whereas MHC
II+/CD11b–/CD4+ pDC accounted for the other 10% (ranging from 6 to 13%) (Figure
4.2). When compared with the control group, allergen challenge induced more than
a 2 fold increase of mDC number in the asthmatic group, reaching 1.6 ± 0.4 x 106
cells/g of lung (Figure 4.2a-b), whereas pDC number was not affected in any
condition, with approximately 0.14 ± 0.02 x 106 cells/g of lung (Figure 4.2c-d). nAM
and sAM transfer did not alter the recruitment of DC in the lungs, when compared
with the asthmatic group (Figure 4.2). Thus, the sensitization status of AM did not
affect early DC recruitment in this model of asthma.
We then studied the capacity of DC to capture allergen in vivo with i.n.
delivery of florescent OVA. mDC were the main DC population capturing allergen.
Indeed, in naïve rats, 13 ± 6 x 103 mDC/g of lung were OVA+, compared with 0.23
± 0.09 x 103 for OVA+ pDC (Figure 4.3). Furthermore, mDC allergen capture was
enhanced by 3.9 fold in the asthmatic group (51 ± 18 x 103 OVA+ mDC/g of lung)
compared with naïve rats. Asthmatic and Asthma+sAM groups had similar number
and frequency of OVA+ mDC, whereas transfer of nAM completely abolished the
increase of OVA uptake by mDC, bringing it back to baseline level (Figure 4.3a-b).
In contrast, the frequency of OVA+ pDC remained at the control level, averaging
71
0.25 ± 0.08 x 103 OVA+ pDC/g of lung tissue in all conditions. These data suggest
that mDC is the major DC subset sampling lung antigen in this asthma model and
that the dysregulation of AM functions can profoundly affect antigen uptake by
mDC.
Transfer of nAM to rats with experimental asthma reduces accumulation of
antigen-bearing DC in draining lymph nodes
Activated DC migrate from lungs to draining lymph nodes (dLN) to activate T
cells. To confirm that reduced antigen uptake in the lungs correlates with a lower
accumulation of antigen-loaded DC in the dLN, we characterized OVA+ DC subsets
in dLN. In contrast to the lungs, dLN mDC and pDC subsets were almost equally
represented in naïve rats, and their number remained the same in all groups
(Figure 4.4). However, allergen-loaded DC that migrated from lungs to dLN were
mainly mDC. Indeed, less than 5% of OVA+ DC were OVA+ pDC in all conditions
tested and this frequency was not modulated between any group (data not shown).
In asthmatic rats, OVA+ mDC number increased 3.4 fold compared to naïve rats,
reaching 8.2 ± 2.3 x 104 cells per dLN (Figure 4.5). While the transfer of sAM did
not reduce the number of OVA-bearing DC when compared with asthmatic rats,
nAM transfer reduced the number of OVA+ mDC in the dLN to the level of naïve
rats (Figure 4.5). Thus, nAM transfer inhibited the accumulation of OVA+ DC in dLN
of asthmatic rats, in agreement with reduced OVA uptake in the lungs.
AM from sensitized rats fail to dampen Th2 cell polarization in the lungs
A critical step in allergic airway inflammation is the establishment of a Th2
response. The control of local T cell activation is mainly orchestrated by DC31, but
is also influenced by other immune cells, including AM33. Thus, lymphocyte
populations were quantified in the lungs. Total lung Th cell (CD3+/CD4+) number
was not modulated in the four groups studied, neither was the number of anti-
inflammatory Foxp3+/CD25+ Treg (data not shown). However, the numbers of
72
IL4+/STAT6+ Th2 cells increased by 2.4 and 1.8 fold in asthmatic and Asthma+sAM
rats, respectively, compared with naïve animals (Figure 4.6), supporting an early
local polarization of T cells toward a Th2 phenotype. Strikingly, nAM transfer
reduced Th2 cell number to control level. These data suggest that AM inhibit local
polarization of Th2 cells in the lung, either directly or via DC modulation.
Reduced antigen uptake by DC is not caused by AM elimination of antigens
Since AM are the first professional phagocytes to encounter allergens, we
evaluated whether the reduction of DC allergen capture observed in Asthma+nAM
group could be explained by antigen scavenging by AM in vivo. AM were identified
as high autofluorescence and CD172α+ (ED9) cells. The number of AM was not
affected in any condition (data not shown), but allergen uptake was modulated.
Indeed, AM phagocytosis capacity in vivo was enhanced in the asthmatic group
(2.2 ± 0.3 x 105 OVA+ AM) compared with naïve rats (0.8 ± 0.2 x 105 OVA+ AM)
(Figure 4.7). Expectedly, sAM or nAM transfer groups had similar level of AM
allergen capture compared with asthmatic and naïve AM, respectively (Figure 4.7).
Hence, low allergen uptake by AM correlates with reduced DC activation (data not
shown) and thus, AM allergen scavenging cannot explain the reduced allergen
uptake by DC observed in Asthma+nAM group.
AM dysregulation in asthma is not associated with the modulation of MHC II
and CD23
AM activation is well known in asthma. Previous studies reported that
treatment of AM with granulocyte macrophage colony-stimulating factor (GM-CSF)
was associated with an increased MHC II expression and an induction of DC-
triggered T cell activation34, 35. Given that AM homeostatic functions are altered in
our model of asthma, we investigated whether the GM-CSF/MHC II axis is
modified. At this early time point after allergen exposure, GM-CSF levels in lung
homogenate were similar between naïve and asthmatic rats (2.0 ± 1.7 vs 2.5 ± 0.7
73
ng of GM-CSF/g of lung, respectively) and the expression of MHC II on AM was
not modulated 2 h after allergen challenge in any of the condition (Figure 4.8a). In
addition, similar expression of the low IgE receptor CD23, which is involved in
allergen uptake, was measured on AM (Figure 4.8). These data suggest that AM
dysregulation in acute airway inflammation is independent of GM-CSF, MHC II,
and CD23 expression.
AM homeostatic functions can be restored ‘ex vivo’
We previously demonstrated that sAM can be reprogrammed by withdrawal
from the asthmatic environment, and that those AM could reinstate lung
homeostasis15. As a follow-up to these observations, we investigated the
modulation of DC functions by replacing AM of sensitized rats with sAM withdrawn
from the asthmatic environment for 24 h (Asthma+cAM). Strikingly, mDC allergen
capture in Asthma+cAM animals was markedly decreased compared to asthmatic
controls (Figure 4.9a). Furthermore, allergen uptake by AM (Figure 4.9b) as well as
lung Th2 cell number (Figure 4.9c) returned to baseline values in animals
transferred with cAM. Thus, AM withdrawn from the asthmatic environment showed
properties similar to that of AM from naïve animals, suggesting that AM functions
can be targeted to restore the homeostatic balance of the lung.
4.6. Discussion
AM are often forgotten in lung immunity even though they have enhanced
anti-inflammatory capacities compared to resident macrophages elsewhere11, 36.
AM are central to lung homeostasis and their depletion in asthma-resistant rats
results in increased AHR and airway inflammation7. Interestingly, depletion of AM
74
in rats with established asthma does not worsen the disease, suggesting that the
homeostatic functions of AM are lost in the course of asthma pathogenesis. In
accordance with this idea, the transfer of AM from naïve rats into asthmatic rats
reinstates homeostasis by reducing AHR and restoring a naïve cytokine profile5.
Here, we show for the first time that AM are able to control mDC allergen capture
in vivo and that the dysregulation of AM functions in asthma is sufficient to induce
DC-triggered allergen inflammatory cascade. Indeed, AM abrogate DC allergen
uptake and blunt the accumulation of Th2-polarized cells in the lungs. This is in
agreement with the theory that AM insure the lack of response against innocuous
antigen by increasing the immune activation threshold. Importantly, we determined
that the control of DC functions could be restored by AM withdrawn from the
asthmatic environment, supporting that AM could be targeted to short-circuit the
early events following allergen exposure. In addition, we found that mDC, not pDCs
are the prominent lung DC subset and that they are the first DC subtype uptaking
and carrying the allergen to draining lymph nodes. This supports their critical
involvement in allergic airway disease.
Our data strongly argue for a central role of AM to maintain lung
homeostasis by limiting DC allergen uptake. This in vivo study design allowed the
validation of previous findings obtained in vitro that suggested that AM can inhibit T
cell proliferation induced by DC22. However, this is in contradiction to the recent
report of Bedoret et al37, which showed that interstitial macrophages (IM), and not
AM, play an important role in lung homeostasis in allergic asthma. This
discrepancy could be explained, at least in part, by the experimental design of their
study. Instead of challenging animal with nebulized or instilled allergens, they
administered allergen-loaded DC (bone marrow DC primed with LPS and OVA) to
induce asthma, which bypasses many immunological processes, including DC
allergen capture. Given that naïve AM reduced allergen uptake by DC, this could
explain why their study overlooked AM immunosuppressive functions.
Furthermore, IM mechanisms of action are likely different from the ones used by
AM. Indeed, IM produce IL-10 in a TLR4-dependent fashion37, whereas our study
75
used an LPS-free model of allergy, and no increase of IL-10 level is detected in the
BAL of Asthma+nAM rats compared with Asthma+sAM and asthmatic animal5.
Thus, the protective effects of AM in the current model are likely independent of IL-
10.
To further investigate the mechanisms involved in AM regulation of mDC,
we explored a likely mechanism described under generic inflammatory condition
(LPS exposition), i.e. the alteration of AM phenotype by GM-CSF34, 35. Indeed, the
increase of GM-CSF in LPS exposed lungs blunted the protective functions of AM
on DC activation and increased AM expression of MHC II34, 35. The current model
addresses early steps of asthma, and no modulation of GM-CSF level was
observed, even though increased production is observed in adult patients with a
history of asthma38. Given that no modulation of GM-CSF in lung tissue nor MHC II
expression on AM was observed, it is unlikely that the AM dysregulation is caused
by GM-CSF at this early stage of the disease. Furthermore, CD23 (pro-
inflammatory) involvement may also be discarded to explain AM dysregulation, as
it was not modulated in the conditions studied here. Thus, our asthma model
enabled the study of early steps involved in asthma exacerbation, including natural
DC activation, which allowed the identification of a novel role of AM in lung
homeostasis: the early inhibition of allergen uptake by mDC.
Our study shows for the first time that, rapidly after allergen exposure, mDC
are the main DC subset capturing allergens in the lung and that this capacity is
drastically increased in asthmatic animals. This observation is in agreement with
the preferential uptake of house dust mite by lung mDC in a mouse model of
inflammation39. However, the capacity of pDC to capture allergens is somewhat
more controversial. A first study showed a strong accumulation of OVA+ pDC in
dLN 36 h after allergen challenge40, whereas another study showed no lung or dLN
pDC positive for house dust mite 3 days after exposition41. The different type of
allergens could explain this discrepancy, but in our hand pDC did not capture
allergens. Given that allergen capture is a rapid process16, 42 and that allergen can
76
be transferred between DC populations43, this discrepancy is more likely to be the
result of timing. Thus, our data support that, early after allergen exposure, resident
mDC, but not pDC, quickly sample allergens from the airways and then, migrate to
the dLN.
In previous work5, we reported the dissociation between eosinophilia and
AHR, as observed in several experimental models, as well as in humans44-46.
Interestingly, the present study showed that Th2 cell accumulation, rather than
eosinophilia, could be linked with AHR. These observations are in agreement with
Venkayya et al47 who showed that Th2 cell-conditioned media can induce AHR via
IL-4 and/or IL-13. The present study thus unravels that AM could control allergic
airway disease-associated AHR by interfering with the Th2 cellular response.
Secondarily, our study strengthens the observation that AM can shift between
different phenotypes15, 48, 49. Indeed, we showed that the plasticity of AM allows the
restoration of the homeostatic functions of sAM, when they are withdrawn for the
inflammatory environment. AM plasticity is an interesting point for future
therapeutic options, but complicates the identification of key mechanisms using in
vitro studies.
Overall, these findings are the first to show in vivo that AM are dysregulated
in asthma, which is sufficient to unleash mDC allergen sampling and Th2 cell
accumulation in the lungs. Thus, AM immunomodulatory functions are essential to
short-circuit the pathogenesis of allergic airway diseases. We showed that AM
protective functions are mediated, at least in part, by effects on mDC (not pDCs),
rather than by their ability to scavenge allergens. In addition, asthmatic AM lose
their capacity to inactivate DC, but AM plasticity enables them to regain their
homeostatic functions, making AM an interesting target for novel therapies. Current
studies in our laboratory are performed to evaluate how AM functions could be
controlled to reduce DC activation and asthma pathogenesis in patients.
77
4.7. Methods
Animals, treatments, and allergen exposure.
Eight- to 12-week-old pathogen-free Brown Norway rats from Harlan
Laboratory (Indianapolis, IN) were used. They were maintained at the animal
facility of the IUCPQ on a 12 h light/dark cycle in filter top cages to ensure
virus/pathogen-free conditions. Food and water were given ad libitum. The protocol
was approved by Laval University Animal Care Committee. Ovalbumin (OVA;
Sigma Chemical, St. Louis, MO) sensitization was performed once by
intraperitoneal (i.p.) injection of 1 mg OVA/10 mg aluminum hydroxide (Sigma
Chemical) and rats were challenged 21 days later by intranasal instillation of 75 μg
of OVA-Alexa647 (Invitrogen, Grand Island, NY) in 100 μl of saline. All groups were
challenged with OVA and tissues were harvested 2 h after exposure.
AM elimination and grafting.
AM depletion was achieved by Clodronate liposome (Clodrosome;
Encapsula, Nashville, TN) administration as previously described6. Briefly, 17 days
after sensitization, 100 ml of 5 mg/ml Clodrosome was instilled in each lobe (right
and left). At the maximal depletion time, 3 days later (day 20), these animals
received AM intratracheally, which were obtained from sensitized (Asthma+sAM) or
naïve (Asthma+nAM) rats. Also, in some experiments, AM depleted rats received
sAM kept ex vivo in serum free complete RPMI medium (Gibco BRL, Burlington,
Canada) in non adherent tubes for 24 h (Asthma+cAM)15.
Cell isolation and preparation.
78
To identify cell types and to measure AM allergen capture, BAL were
performed as previously described6, with 50 mL of PBS-EDTA. Cell types were
identified using cytospins stained with Diff-Quik (Gibco BRL). Lung tissue and
draining lymph nodes (dLN) were prepared as previously reported26. Briefly,
tissues were digested with Collagenase IV and DNase I (Worthington Biochemical
Corp, Lakewood, NJ) to obtain single cell suspension. Identification of cell
populations was performed using monoclonal antibodies (Biolegend, San Diego,
CA; BD Pharmingen, San Diego, CA; R&D, Minneapolis, MN) directed against cell
surface antigens and intracellular markers. mDC are CD11b+/MHC IIhigh, pDC are
CD11b–/MHC II+/CD4+ and AM are CD172α+(ED9)/autofluorescencehigh. T cell
populations were identified using CD4, CD3, IL-4, FoxP3, STAT6, and CD25
expression. Allergen capture was measured by AlexaFluor647 fluorescence and
AM activation was assessed with MHC II and CD23 expression. Data were
acquired on a BD FACS Aria II (Becton Dickinson, Franklin Lakes, NJ) and
analyzed using Flowjo software (Tree star inc, Ashland, OR).
Lung digestion and ELISA.
To measure cytokine level in lung tissue, approximately 10 mg of lung tissue
was placed in ice-cold PBS supplemented with protease and phosphastase
inhibitor cocktail (Roche, Mannheim, Germany) and homogenized with a Polytron
homogenizer. ELISA were performed with DuoSet kit (R&D Systems) to measure
GM-CSF level and results are expressed per gram of tissue.
Statistics.
GraphPad Prism (La Jolla, CA) was used for all statistical analysis, which
includes one-way and two-way ANOVA with Bonneferonni post hoc test. Data are
presented as mean ± SEM and p values < 0.05 were considered significant.
79
4.8. Disclosure
The authors declare no conflict of interest.
4.9. Acknowledgements
This work was supported by Canadian Institutes of Health Research (MOP-
84346) and Fondation JD Bégin. JFLJ was supported by Fonds de Recherche du
Québec - Santé. We thank Emilie Bernatchez and Marc Veillette for technical help.
We also thank Dr Ynuk Bossé and Dr Yvon Cormier for critical review of the
manuscript.
80
4.10. References
1. Elias JA, Lee CG, Zheng T, Ma B, Homer RJ, Zhu Z. New insights into the pathogenesis of asthma. The Journal of clinical investigation 2003; 111(3): 291-297. 2. Holgate ST. Pathogenesis of asthma. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2008; 38(6): 872-897. 3. Peters-Golden M. The alveolar macrophage: the forgotten cell in asthma. American journal of respiratory cell and molecular biology 2004; 31(1): 3-7. 4. Lambrecht BN. Alveolar macrophage in the driver's seat. Immunity 2006; 24(4): 366-368. 5. Careau E, Proulx LI, Pouliot P, Spahr A, Turmel V, Bissonnette EY. Antigen sensitization modulates alveolar macrophage functions in an asthma model. American journal of physiology Lung cellular and molecular physiology 2006; 290(5): L871-879. 6. Careau E, Turmel V, Lauzon-Joset JF, Bissonnette EY. Alveolar macrophages reduce airway hyperresponsiveness and modulate cytokine levels. Experimental lung research 2010; 36(5): 255-261. 7. Careau E, Bissonnette EY. Adoptive transfer of alveolar macrophages abrogates bronchial hyperresponsiveness. American journal of respiratory cell and molecular biology 2004; 31(1): 22-27. 8. Thepen T, McMenamin C, Oliver J, Kraal G, Holt PG. Regulation of immune response to inhaled antigen by alveolar macrophages: differential effects of in vivo alveolar macrophage elimination on the induction of tolerance vs. immunity. European journal of immunology 1991; 21(11): 2845-2850. 9. Bang BR, Chun E, Shim EJ, Lee HS, Lee SY, Cho SH et al. Alveolar macrophages modulate allergic inflammation in a murine model of asthma. Experimental & molecular medicine 2011; 43(5): 275-280. 10. Tang C, Inman MD, van Rooijen N, Yang P, Shen H, Matsumoto K et al. Th type 1-stimulating activity of lung macrophages inhibits Th2-mediated allergic airway inflammation by an IFN-gamma-dependent mechanism. J Immunol 2001; 166(3): 1471-1481. 11. Naessens T, Vander Beken S, Bogaert P, Van Rooijen N, Lienenklaus S, Weiss S et al. Innate imprinting of murine resident alveolar macrophages by allergic bronchial inflammation causes a switch from hypoinflammatory to hyperinflammatory reactivity. The American journal of pathology 2012; 181(1): 174-184. 12. Thepen T, Van Rooijen N, Kraal G. Alveolar macrophage elimination in vivo is associated with an increase in pulmonary immune response in mice. The Journal of experimental medicine 1989; 170(2): 499-509. 13. Thepen T, Kraal G, Holt PG. The role of alveolar macrophages in regulation of lung inflammation. Annals of the New York Academy of Sciences 1994; 725: 200-206.
81
14. Byers DE, Holtzman MJ. Alternatively activated macrophages and airway disease. Chest 2011; 140(3): 768-774. 15. Pouliot P, Spahr A, Careau E, Turmel V, Bissonnette EY. Alveolar macrophages from allergic lungs are not committed to a pro-allergic response and can reduce airway hyperresponsiveness following ex vivo culture. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2008; 38(3): 529-538. 16. Fear VS, Burchell JT, Lai SP, Wikstrom ME, Blank F, von Garnier C et al. Restricted aeroallergen access to airway mucosal dendritic cells in vivo limits allergen-specific CD4+ T cell proliferation during the induction of inhalation tolerance. J Immunol 2011; 187(9): 4561-4570. 17. Bratke K, Lommatzsch M, Julius P, Kuepper M, Kleine HD, Luttmann W et al. Dendritic cell subsets in human bronchoalveolar lavage fluid after segmental allergen challenge. Thorax 2007; 62(2): 168-175. 18. Jahnsen FL, Moloney ED, Hogan T, Upham JW, Burke CM, Holt PG. Rapid dendritic cell recruitment to the bronchial mucosa of patients with atopic asthma in response to local allergen challenge. Thorax 2001; 56(11): 823-826. 19. Holt PG. Dendritic cells as sentinel cells in asthma. Clinical & Experimental Allergy Reviews 2001; 1(2): 77-79. 20. van Rijt LS, Jung S, Kleinjan A, Vos N, Willart M, Duez C et al. In vivo depletion of lung CD11c+ dendritic cells during allergen challenge abrogates the characteristic features of asthma. The Journal of experimental medicine 2005; 201(6): 981-991. 21. Soumelis V, Reche PA, Kanzler H, Yuan W, Edward G, Homey B et al. Human epithelial cells trigger dendritic cell mediated allergic inflammation by producing TSLP. Nature immunology 2002; 3(7): 673-680. 22. Holt PG, Oliver J, Bilyk N, McMenamin C, McMenamin PG, Kraal G et al. Downregulation of the antigen presenting cell function(s) of pulmonary dendritic cells in vivo by resident alveolar macrophages. The Journal of experimental medicine 1993; 177(2): 397-407. 23. Kim JY, Sohn JH, Choi JM, Lee JH, Hong CS, Lee JS et al. Alveolar Macrophages Play a Key Role in Cockroach-Induced Allergic Inflammation via TNF-alpha Pathway. PloS one 2012; 7(10): e47971. 24. Moreira AP, Hogaboam CM. Macrophages in allergic asthma: fine-tuning their pro- and anti-inflammatory actions for disease resolution. Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research 2011; 31(6): 485-491. 25. Jakubzick C, Tacke F, Llodra J, van Rooijen N, Randolph GJ. Modulation of dendritic cell trafficking to and from the airways. J Immunol 2006; 176(6): 3578-3584. 26. Strickland DH, Thomas JA, Mok D, Blank F, McKenna KL, Larcombe AN et al. Defective aeroallergen surveillance by airway mucosal dendritic cells as a determinant of risk for persistent airways hyper-responsiveness in experimental asthma. Mucosal immunology 2012; 5(3): 332-341. 27. Careau E, Sirois J, Bissonnette EY. Characterization of lung hyperresponsiveness, inflammation, and alveolar macrophage mediator production
82
in allergy resistant and susceptible rats. American journal of respiratory cell and molecular biology 2002; 26(5): 579-586. 28. Tschernig T, Neumann D, Pich A, Dorsch M, Pabst R. Experimental bronchial asthma - the strength of the species rat. Current drug targets 2008; 9(6): 466-469. 29. Martin JG, Tamaoka M. Rat models of asthma and chronic obstructive lung disease. Pulmonary pharmacology & therapeutics 2006; 19(6): 377-385. 30. Sung SS, Bolton WK. Editorial: Are men rats? Dendritic cells in autoimmune glomerulonephritis. Journal of leukocyte biology 2010; 88(5): 831-835. 31. Out TA, Wang SZ, Rudolph K, Bice DE. Local T-cell activation after segmental allergen challenge in the lungs of allergic dogs. Immunology 2002; 105(4): 499-508. 32. Berg JT, Lee ST, Thepen T, Lee CY, Tsan MF. Depletion of alveolar macrophages by liposome-encapsulated dichloromethylene diphosphonate. J Appl Physiol 1993; 74(6): 2812-2819. 33. Strickland DH, Thepen T, Kees UR, Kraal G, Holt PG. Regulation of T-cell function in lung tissue by pulmonary alveolar macrophages. Immunology 1993; 80(2): 266-272. 34. Bilyk N, Holt PG. Inhibition of the immunosuppressive activity of resident pulmonary alveolar macrophages by granulocyte/macrophage colony-stimulating factor. The Journal of experimental medicine 1993; 177(6): 1773-1777. 35. Stampfli MR, Wiley RE, Neigh GS, Gajewska BU, Lei XF, Snider DP et al. GM-CSF transgene expression in the airway allows aerosolized ovalbumin to induce allergic sensitization in mice. The Journal of clinical investigation 1998; 102(9): 1704-1714. 36. Snelgrove RJ, Goulding J, Didierlaurent AM, Lyonga D, Vekaria S, Edwards L et al. A critical function for CD200 in lung immune homeostasis and the severity of influenza infection. Nature immunology 2008; 9(9): 1074-1083. 37. Bedoret D, Wallemacq H, Marichal T, Desmet C, Quesada Calvo F, Henry E et al. Lung interstitial macrophages alter dendritic cell functions to prevent airway allergy in mice. The Journal of clinical investigation 2009; 119(12): 3723-3738. 38. Woolley KL, Adelroth E, Woolley MJ, Ellis R, Jordana M, O'Byrne PM. Granulocyte-macrophage colony-stimulating factor, eosinophils and eosinophil cationic protein in subjects with and without mild, stable, atopic asthma. The European respiratory journal : official journal of the European Society for Clinical Respiratory Physiology 1994; 7(9): 1576-1584. 39. Lewkowich IP, Lajoie S, Clark JR, Herman NS, Sproles AA, Wills-Karp M. Allergen uptake, activation, and IL-23 production by pulmonary myeloid DCs drives airway hyperresponsiveness in asthma-susceptible mice. PloS one 2008; 3(12): e3879. 40. de Heer HJ, Hammad H, Soullie T, Hijdra D, Vos N, Willart MA et al. Essential role of lung plasmacytoid dendritic cells in preventing asthmatic reactions to harmless inhaled antigen. The Journal of experimental medicine 2004; 200(1): 89-98. 41. Plantinga M, Guilliams M, Vanheerswynghels M, Deswarte K, Branco-Madeira F, Toussaint W et al. Conventional and Monocyte-Derived CD11b(+)
83
Dendritic Cells Initiate and Maintain T Helper 2 Cell-Mediated Immunity to House Dust Mite Allergen. Immunity 2013; 38(2): 322-335. 42. Huh JC, Strickland DH, Jahnsen FL, Turner DJ, Thomas JA, Napoli S et al. Bidirectional interactions between antigen-bearing respiratory tract dendritic cells (DCs) and T cells precede the late phase reaction in experimental asthma: DC activation occurs in the airway mucosa but not in the lung parenchyma. The Journal of experimental medicine 2003; 198(1): 19-30. 43. Knight SC, Iqball S, Roberts MS, Macatonia S, Bedford PA. Transfer of antigen between dendritic cells in the stimulation of primary T cell proliferation. European journal of immunology 1998; 28(5): 1636-1644. 44. Bradley BL, Azzawi M, Jacobson M, Assoufi B, Collins JV, Irani AM et al. Eosinophils, T-lymphocytes, mast cells, neutrophils, and macrophages in bronchial biopsy specimens from atopic subjects with asthma: comparison with biopsy specimens from atopic subjects without asthma and normal control subjects and relationship to bronchial hyperresponsiveness. The Journal of allergy and clinical immunology 1991; 88(4): 661-674. 45. Wardlaw AJ, Dunnette S, Gleich GJ, Collins JV, Kay AB. Eosinophils and mast cells in bronchoalveolar lavage in subjects with mild asthma. Relationship to bronchial hyperreactivity. The American review of respiratory disease 1988; 137(1): 62-69. 46. Birrell MA, Battram CH, Woodman P, McCluskie K, Belvisi MG. Dissociation by steroids of eosinophilic inflammation from airway hyperresponsiveness in murine airways. Respiratory research 2003; 4: 3. 47. Venkayya R, Lam M, Willkom M, Grunig G, Corry DB, Erle DJ. The Th2 lymphocyte products IL-4 and IL-13 rapidly induce airway hyperresponsiveness through direct effects on resident airway cells. American journal of respiratory cell and molecular biology 2002; 26(2): 202-208. 48. Korf JE, Pynaert G, Tournoy K, Boonefaes T, Van Oosterhout A, Ginneberge D et al. Macrophage reprogramming by mycolic acid promotes a tolerogenic response in experimental asthma. American journal of respiratory and critical care medicine 2006; 174(2): 152-160. 49. Johnston LK, Rims CR, Gill SE, McGuire JK, Manicone AM. Pulmonary macrophage subpopulations in the induction and resolution of acute lung injury. American journal of respiratory cell and molecular biology 2012; 47(4): 417-426.
84
4.11. Figure legends
Figure 4.1) Sensitization status of AM does not modulate early eosinophil
recruitment in the airways
Asthmatic rats were sensitized i.p. with OVA/Alum. AM were depleted and replaced
with AM from sensitized rats (Asthma+sAM) or naïve rats (Asthma+nAM). BAL
were performed 2 h after OVA challenge. Total cell counts (a) and cellularity (b)
were measured after Trypan blue and DiffQuick stainings, respectively. Total cell
numbers were similar in all groups and eosinophilia was present in asthmatic,
Asthma+sAM and Asthma+nAM groups. *: indicate significant differences (p <
0.05) compared with the naïve group. Mean SEM; n = 4-7 per group.
Figure 4.2) DC recruitment in asthma is enhanced, but not modulated by AM
Single cell suspensions were prepared from lungs 2 h after OVA challenge. DC
were identified by flow cytometry using MHC II and CD11b expression in either
whole cell suspensions for the mDC; or after gating on CD4+ cells for the pDC.
mDC and pDC fractions are shown in (a; c) and number per g of lung in (b; d).
mDC numbers were increased in asthmatic, Asthma+sAM, and Asthma+nAM
groups compared with the naïve, whereas pDC population was not affected in any
condition. *: indicate significant differences (p < 0.05) compared with the naïve
group. Mean SEM; n = 4-7 per group.
Figure 4.3) DC allergen capture is decreased by AM from naïve rats
Single cell suspensions were prepared from lungs 2 h after instillation of OVA-
AlexaFluor647 challenge. Allergen capture was assessed by measuring the
frequency of AlexaFluor647+ cells on DC subsets, using flow cytometry. mDC and
85
pDC OVA+ frequency are shown in (a; c) and number per g of lung in (b; d).
Compared with naïve rats, allergen uptake was increased in asthmatic and
Asthma+sAM groups, but not in Asthma+nAM group. Allergen uptake was also
significantly lower in Asthma+nAM group compared with the Asthma+sAM group.
pDC allergen uptake was low in all groups tested. *: p < 0.05. Mean SEM; n = 4-7
per group.
Figure 4.4) DC accumulation in draining lymph nodes is not modulated
Single cell suspensions were prepared from dLN 2 h after OVA challenge. mDC
and pDC were identified by flow cytometry using MHC II and CD11b expression.
Proportion of mDC and pDC in dLN was similar and their numbers were not
modulated in any group. *: p < 0.05. Mean SEM; n = 4-7 per group.
Figure 4.5) OVA+ mDC accumulation in draining lymph nodes is inhibited by AM
from naïve rats
Single cell suspensions were prepared from dLN 2 h after instillation of OVA-
AlexaFluor647. Allergen capture was assessed by measuring the frequency of
AlexaFluor647+ cells on mDC subsets, using flow cytometry. The OVA+ mDC/dLN
frequency is shown in (a) and number in (b). Allergen uptake was increased in the
asthmatic group compared with naïve rats. Allergen uptake was similar between
asthmatic and Asthma+sAM groups, but was strongly reduced in the Asthma+nAM
group. *: p < 0.05. Mean SEM; n = 4-7 per group.
Figure 4.6) Th2 polarized cell accumulation is enhanced locally after allergen
challenge and modulated by AM transfer
Single cell suspensions were prepared from lungs 2 h after OVA challenge. Th2
cells were identified by flow cytometry using CD4, CD3, STAT6, and IL-4
86
expression. Th2 cell frequency (a) and number per g of lung (b) were higher in
asthmatic and Asthma+sAM groups compared with naïve and Asthma+nAM
groups, respectively. *: p < 0.05. Mean SEM; n = 4-7 per group.
Figure 4.7) AM allergen capture is enhanced in asthma, but is not modulated by
adoptive transfer
BAL were performed 2 h after instillation of OVA-AlexaFluor647. Allergen capture
was assessed by measuring the frequency of AlexaFluor647+ cells in
autofluoresent+/CD172+ AM, using flow cytometry. AM OVA+ frequency is shown
in (a) and number in (b). Allergen capture was higher in asthmatic and
Asthma+sAM groups compared with naïve and Asthma+nAM groups. *: p < 0.05.
Mean SEM; n = 4-7 per group.
Figure 4.8) MHC II and CD23 expression are not modulated on AM early on
asthma development
BAL were performed 2 h after instillation of OVA. MHC II and CD23 expression
was measured on autofluoresent+/CD172+ AM, using flow cytometry. AM
expression of MHC II (a) and CD23 (b) is depicted as the ratio of mean
fluorescence intensity (MFI) over naïve rats. No modulation was observed. *: p <
0.05. Mean SEM; n = 3-5 per group.
Figure 4.9) AM withdrawal from the asthmatic environment restores their
protective functions
Asthmatic rats were sensitized i.p. with OVA/Alum and AM were replaced with ex
vivo cultured sAM (Asthma+cAM). The effect of sAM on allergen capture by mDC
(a) and AM (b), as well as on Th2 response (c) were measured 2 h after instillation
of OVA-AlexaFluor647. (a) Frequency (left panel) and number (right panel) of
87
OVA+ mDC/g of lung was lower in Asthma+cAM group compared with asthmatic
rats. (b) OVA+ AM in BAL were less frequent in Asthma+cAM than in asthmatic
rats. (c) cAM transfer reduced considerably the number of Th2 cells in the lung
compared with asthmatic animals. *: p < 0.05. Mean SEM; n = 3-5 per group.
88
4.12. Figures
Figure 4.1 : Sensitization status of AM does not modulate early eosinophil
recruitment in the airways
89
Figure 4.2 : DC recruitment in asthma is enhanced, but not modulated by AM
90
Figure 4.3 : DC allergen capture is decreased by AM from naïve rats
91
Figure 4.4 : DC accumulation in draining lymph nodes is not modulated
92
Figure 4.5 : OVA+ mDC accumulation in draining lymph nodes is inhibited by AM
from naïve rats
93
Figure 4.6 : Th2 polarized cell accumulation is enhanced locally after allergen
challenge and modulated by AM transfer
94
Figure 4.7 : AM allergen capture is enhanced in asthma, but is not modulated by
adoptive transfer
95
Figure 4.8 : MHC II and CD23 expression are not modulated on AM early on
asthma development
96
Figure 4.9 : AM withdrawal from the asthmatic environment restores their
protective functions
97
4.
CHAPITRE 5 : Restoration of lung CD200
activity abrogates airway
hyperresponsiveness in experimental asthma
Article soumis au
American Journal of Respiratory Cell and Molecular Biology
98
5.1. Page titre
Restoration of lung CD200 activity abrogates airway hyperresponsiveness in
experimental asthma
Jean-Francois Lauzon-Joset; Anick Langlois; David Marsolais; Elyse Y
Bissonnette.
Centre de recherche de l’Institut universitaire de cardiologie et de pneumologie de
Québec (CRIUCPQ), Université Laval, Québec, QC, Canada.
Running head: CD200 inhibit pathognomonic features of allergic asthma
Corresponding author: Dr. Elyse Bissonnette 2725, chemin Ste-Foy, CRIUCPQ Quebec, QC Canada G1V 4G5 Phone: 418-656-4760
FAX: 418-656-4509 Jean-François Lauzon-Joset: [email protected] Anick Langlois: [email protected] David Marsolais: [email protected] Elyse Bissonnette: [email protected]
Disclosure: The authors declare no conflict of interest.
This work was supported by Canadian Institutes of Health Research (MOP-84346)
and Fondation J.D. Bégin. JFLJ was supported by Fonds de Recherche du
Québec - Santé.
99
5.2. Résumé
Le système immunitaire du poumon contrôle étroitement l’inflammation afin
d’assurer sa protection tout en maintenant des échanges gazeux efficaces.
Cependant, dans l’asthme allergique, cet équilibre est renversé et une réponse
immunitaire est déclenchée envers des antigènes normalement inoffensifs. Une
étude récente a démontré que l’expression de la molécule anti-inflammatoire
CD200 est diminuée dans les monocytes de patients asthmatiques. Toutefois,
aucune information n’est disponible quant à savoir si cette dérégulation s’étend au
poumon et si cela contribue à la cascade asthmatique. Nous avons donc étudié
l’expression du CD200 par les macrophages alvéolaires (AM) en réaction à une
exposition allergénique et l’effet de l’administration locale de la protéine
recombinée CD200 (rCD200) sur les caractéristiques pathognomoniques de
l’asthme chez des rats Brown Norway sensibilisés et exposés à un allergène
(l’ovalbumine). En réponse à l’allergène, les AM des rats naïfs surexpriment le
CD200, tandis que les AM asthmatiques en sont incapables. L’administration de
rCD200 24 h avant l’exposition allergénique a complètement inhibé
l’hyperréactivité bronchique (AHR) en comparaison avec les animaux
asthmatiques contrôles. Également, le rCD200 a largement réduit l’accumulation
de cellules dendritiques myéloïdes et de cellules Th2 dans les poumons, alors que
l’éosinophilie et l’accumulation de mDC et de cellules T dans les ganglions
lymphatiques ont persisté. Par conséquent, cette étude suggère que
l’administration rCD200 est suffisante pour inhiber l’AHR et le recrutement de mDC
et de cellules Th2 chez les rats asthmatiques. De plus, ces données suggèrent un
nouveau mécanisme de la pathogenèse de l’asthme et pourrait mener à une
thérapie alternative de cette maladie.
Mots clés : Asthme allergique, CD200R, hyperactivité bronchique, macrophage
alvéolaire, homéostasie pulmonaire.
100
5.3. Abstract
The lung immune system tightly regulates inflammation in order to ensure
protection while maintaining efficient gas exchange. However, in allergic asthma,
this balance is shifted, and an inappropriate immune response is triggered toward
normally innocuous antigens. A recent study showed that the anti-inflammatory
molecule CD200 is downregulated in blood cells of asthmatic patients. Yet, it is
unknown whether CD200 expression is altered in the lung and whether it
contributes to asthma pathogenesis. We thus investigated CD200 expression on
alveolar macrophages (AM) in response to antigen challenge and the effect of local
delivery of recombinant CD200 (rCD200) on pathognomonic features of asthma in
Brown Norway rats sensitized and challenged with ovalbumin (allergen). AM of
asthmatic animals failed to upregulate CD200 in response to allergen exposure,
which was not the case for naïve rats. Compared with sham-treated asthmatic
animals, lung delivery of rCD200 24 h before allergen challenge abolished airway
hyperresponsiveness (AHR). rCD200 also strongly reduced the accumulation of
myeloid dendritic cells (mDC) and Th2 cells in the lung of asthmatic animals,
whereas lung eosinophilia and draining lymph nodes accumulation of mDC and T
cells persisted. Thus, experimental asthma is linked with alteration of CD200
expression on AM, and lung delivery of rCD200 is sufficient to inhibit AHR and lung
recruitment of mDC and Th2 cells in asthmatic rats. Overall, these data suggest a
new mechanism of asthma pathogenesis and might lead to an alternative therapy
for asthma.
Key Words: Allergic asthma, CD200, Regulatory, Airway hyperresponsiveness, Alveolar
Macrophages.
101
5.4. Introduction
Allergic asthma is an inflammatory disease characterized by excessive
immune activation toward normally innocuous antigens. Although many cell types
are involved in asthma pathogenesis, the activation of dendritic cell (DC), mainly
myeloid DC (mDC), is sufficient to induce the asthmatic cascade (1, 2). Indeed,
mDC sample allergens from the airways and induce T cells to develop an antigen-
specific Th2 response. Th2 cells then produce chemokines and cytokines that
attract and activate eosinophils, B cells, and mast cells. Furthermore, Th2 cells are
central for the development of airway remodeling and hyperresponsiveness (AHR)
(3). This inflammatory cascade is enabled by the dysregulation of homeostatic
pathways that limit airway inflammation (4, 5). Indeed, lungs must withstand a
perpetual stimulation by exogenous particles by expressing high level of anti-
inflammatory molecules (6). Thus, identification of mechanisms determining
immunological homeostasis of the lung might contribute to a better understanding
of asthma pathogenesis.
Recent studies support that the interaction between CD200 and its receptor
(CD200R) plays an important role in the regulation of immune responses (7).
CD200 is a highly conserved membrane molecule present on many cells, including
epithelial cells, lymphocytes, and some myeloid cells. CD200 is deprived of
intracellular signaling domain, but it induces anti-inflammatory cascades by
activating CD200R. Previous reports showed that high CD200 expression induces
immune ignorance that enables cancer progression and viral persistence (8).
Conversely, low level of CD200 is associated with autoimmune disease
progression, such as arthritis and neurodegenerative disorders (8). Interestingly,
peripheral blood cells of asthmatic patients have reduced expression of CD200 (9),
suggesting a dysregulation of this molecule in asthma. However, no information is
available on pulmonary expression of CD200 in asthma.
102
Alveolar macrophages (AM) are important players in lung immunity (10).
These immune cells, residing in airways and alveoli, express higher basal level of
anti-inflammatory molecules than do their counterparts in other organs (11). They
are among the first immune cell types to encounter particles entering the lumen of
airways and produce a plethora of mediators to initiate or resolve immune
responses (12). By default, the role of AM is to maintain homeostasis and induce
tolerance (13), as supported by numerous studies showing that AM depletion
induces or enhances pulmonary inflammatory responses (14-16). In asthmatic
subjects, AM functions are altered and skewed toward an inflammatory response
(17). Thus, AM have pro-inflammatory functions in asthma (14, 18, 19), and these
dysregulations could be sufficient to induce an asthma-like phenotype. However
the exact nature of AM alterations in asthma remains misunderstood.
Given the potent anti-inflammatory effects of CD200, its documented roles in
several inflammatory diseases, and the inflammatory nature of asthma, our general
hypothesis is that pulmonary CD200 dysregulation contributes to the pathogenesis
of asthma. Using a model of allergic asthma in Brown Norway rats, we show for the
first time that in response to allergens, AM from asthmatic animals (aAM) fail to
upregulate CD200. Furthermore, local delivery of recombinant CD200 (rCD200)
completely abrogates AHR, which is associated with alleviation of mDC and Th2
cell recruitment into the lungs, but not with reduction of eosinophil numbers in
bronchoalveolar lavage (BAL) fluids. Thus, our study reveals a local role for CD200
in Th2 cell accumulation and AHR in experimental asthma.
103
5.5. Materials and Methods
Animals and allergen exposure
Brown Norway SSN rats were bred and maintained in the animal facility of
the IUCPQ. The protocol was approved by Laval University Animal Care
Committee in accordance with the guidelines of the Canadian Council on Animal
Care. Eight- to 12-weeks-old males were used. Ovalbumin (OVA) grade V (Sigma
Chemical, St. Louis, MO) sensitization was performed by i.p. injection of 1 mg
OVA/10 mg aluminum hydroxide (Sigma Chemical). On day 20 after sensitization,
groups of animals received intratracheal (i.t.) administration of either 100 mol of
recombinant mouse CD200 Fc Chimera (rCD200; R&D, Minneapolis, MN) or
recombinant human IgG1 Fc (Sham; R&D). On day 21, all groups were challenged
by intranasal instillation of 75 μg of OVA-AlexaFluor647 (Invitrogen, Grand Island,
NY) in 100 μl of saline and tissues were harvested 24 h later.
CD200 expression
AM were obtained by BAL of normal Brown Norway rats and purified by
adherence on plastic for 2 h. RNA was extracted by Trizol according to
manufacturer’s protocol. Then, RT-PCR was performed using One-Step RT-PCR
from Invitrogen according to standard protocol with 50 ng of RNA and amplified
with CGCTGAGCACAGCTCAAGTGGA forward primer and
AGGAGATGGCAGGGGCT-GGG reverse primer.
Analysis of responsiveness to methacholine
Lung functions were measured as previously described (20). Briefly, rats
were anaesthetized with ketamine-xylazine, tracheotomized and connected to a
104
small animal ventilator (FX4; FlexiVent, SCIREQ, Inc., Montreal, QC, Canada).
Animals were then paralyzed with pancuronium bromide (0.05 mg/kg) and
ventilated with 10 ml/kg at a frequency of 90 breaths/min with a positive end
expiratory pressure (PEEP) of 3 cm H2O. Increasing doses of methacholine were
nebulized for 30 s and lung resistance (RL) was assessed using Sinusoidal single-
frequency oscillation waveform. After each dose, the maximal response was
compiled and compared between groups.
Cell isolation and preparation
BAL were performed as previously described (14). Cell types were identified
using cytospins stained with Diff-Quick (Gibco BRL, Burlington, ON, Canada). Lung
tissue and draining lymph nodes (dLN) were prepared as previously reported (21).
Briefly, tissues were digested with Collagenase IV and DNase I (Worthington
Biochemical Corp, Lakewood, NJ) to obtain single cell suspension. Identification of
cell populations was performed using monoclonal antibodies (Biolegend, San
Diego, CA; BD Pharmingen, San Diego, CA; R&D) directed against cell-surface
antigens and intracellular markers. mDC are CD11b+/MHC IIhigh, pDC are CD11b–
/MHC II+/CD4+ and AM are CD172α+(ED9)/autofluorescencehigh. T cell populations
were identified using CD4, CD3, IL-4, and STAT6 expression. Data were acquired
on a BD FACS Aria II (Becton Dickinson, Franklin Lakes, NJ) and analyzed using
Flowjo software (Tree star inc, Ashland, OR).
Statistics
Prism (GraphPad Software, La Jolla, CA) was used for all statistical
analyses, which includes one-way and two-way ANOVAs with Bonferroni post hoc
test. Data are presented as mean ± SEM and p values < 0.05 were considered
significant.
105
5.6. Results
CD200 is expressed by AM and is dysregulated in experimental asthma
The expression of CD200 is classically associated with structural cells and
lymphocytes, but few studies support that myeloid lineage cells express CD200
(22-24). We first investigated AM expression of CD200 using RT-PCR analysis.
AM isolated from naïve rats expressed CD200 mRNA (Figure 5.1A). Then, we
used a well-described model of experimental asthma (25, 26) to investigate
allergen-induced modulation of CD200 expression on AM in vivo. Before allergen
challenge, AM from naïve (nAM) and asthmatic (aAM) animals had comparable
protein expression of CD200 (Figure 5.1B-C). Surprisingly, CD200 expression on
nAM drastically increased by 258 ± 52% following allergen challenge, whereas
expression of CD200 remained stable on aAM (Figure 5.1B-C). These data
suggest that CD200 upregulation on nAM might be involved in the protection
against asthma development. Therefore, we evaluated whether local delivery of
CD200 could inhibit key features of asthma.
Local administration of CD200 reverses AHR, but not lung eosinophilia
AHR is an important criterion for asthma identification and a good indicator
of poor asthma control. Thus, we evaluated lung resistance in response to
methacholine (MCh) in naïve and asthmatic animals treated with either a soluble
CD200 recombinant Fc chimera (rCD200) or an isotype-matched recombinant Fc
(Sham), 24 h before allergen exposure. Asthmatic rats showed an increased
response to incremental doses of MCh, compared with naïve animals (Figure 5.2A;
50 mg/ml of MCh increased lung resistance by 15 ± 4 and 4 ± 1 fold, respectively),
whereas the level of MCh responsiveness after lung delivery of rCD200, but not of
the sham molecule, was identical to naïve rats (Figure 5.2A).
106
We next investigated whether rCD200 effect on lung resistance was
associated with a modulation of leukocyte recruitment. Total cell count in the BAL
was increased in the asthmatic group compared with naïve animals (Figure 5.2B),
mainly because of eosinophil recruitment (Figure 5.2C). However, no modulation
was observed between asthmatic animals treated or not with either sham or
rCD200, for both total cell count and eosinophil number (Figure 5.2B-C). Therefore,
rCD200 treatment inhibited AHR in asthmatic animals independently of eosinophil
accumulation.
DC and Th2 cell recruitment in the lung is inhibited by rCD200
Airway inflammation in asthma is characterized by an important
accumulation of DC and Th2 cells in the lung. Thus, we measured the modulation
of lung DC subsets and lymphocyte populations by rCD200 treatment. DC (MHC
IIhigh/autofluorescencelow) were divided into myeloid DC (mDC; CD11b+) and
plasmacytoid DC (pDC; CD11b-/CD4+). As previously reported (4, 18), mDC is the
major lung DC subset in both naïve and asthmatic rats (Figure 5.3). The number of
lung mDC significantly increased following allergen challenge in asthmatic animals,
whereas no variation of pDC number was observed (Figure 5.3B). After rCD200
treatment, mDC number returned to the level of the naïve group while sham
treatment did not alter mDC accumulation compared with asthmatic animals
(Figure 5.3B).
The analysis of lung T cell populations (Figure 5.4) showed that asthmatic
lungs had more than twice the number of CD3+/CD4+ lymphocytes (CD4+ T cells)
(Figure 5.4B), as well as IL4+/Stat6+ Th2 cells (Figure 5.4D), compared with naïve
animals. In rCD200–treated animals, CD4+ T cell and Th2 cell numbers were
reduced by 42 and 49%, respectively, compared to the sham group (Figure 5.4B-
D). Thus, rCD200 treatment inhibits allergen-induced mDC recruitment, as well as
Th2 cell accumulation to the lungs of asthmatic animals.
107
rCD200 does not alter allergen-induced Th2 accumulation in draining lymph
nodes of asthmatic animals
mDC migrate from the lungs to the draining lymph nodes (dLN) to induce the
expansion of antigen-specific T cells. Given that rCD200 treatment reduced lung
accumulation of inflammatory Th2 cells, we investigated whether rCD200 interfered
with the migration of allergen-loaded DC to the dLN. In asthmatic animals, there
was an increased number of OVA+ mDC compared with naïve rats, whereas OVA+
pDC number remained the same (Figure 5.5A-B). However, no modulation of
allergen-loaded DC in the dLN was observed after rCD200 treatment compared
with asthmatic and sham groups. Accordingly, there was no modulation of dLN
CD4+ T cells (Figure 5.5C-D) nor Th2 cells (Figure 5.5E-F) in sham or rCD200
treated animals compared with the asthmatic group. Therefore, rCD200 treatment
did not alter DC and T cells in the dLN. Thus, lung rCD200 delivery abrogated AHR
and this protective effect was associated with local control of the Th2 response.
5.7. Discussion
CD200-CD200R interaction is a central immune mechanism that controls
the activation of subsets of myeloid cells (27). Treatment with CD200 was shown to
reduce the development of experimental multiple sclerosis (28) and collagen-
induced arthritis (29). This pathway is also the object of a new clinical trial for
chronic leukemia (30). Although asthma is characterized by myeloid cell activation
and that CD200 acts on myeloid cells, no report addressed the local role of CD200
in the context of asthma. Strikingly, we show here that allergen challenge induced
a strong upregulation of CD200 in AM of naïve animals, but not in AM of asthmatic
rats. The impact of CD200 dysregulation in asthma was further confirmed by
replenishing CD200 into the lung of asthmatic rats. Indeed, the local administration
of rCD200 completely inhibited AHR and drastically reduced lung accumulation of
108
mDC and Th2 cells. Hence, CD200 plays a critical role in lung immunity and local
administration of CD200 is sufficient to inhibit AHR and lung T cell accumulation.
CD200 is an immunomodulatory molecule expressed by a variety of cells,
but few reports addressed its expression on myeloid cells (23, 24). In the airways,
AM are the predominant immune cells and uniformly express CD200R (11). Here,
we show that AM also express the CD200R ligand, CD200. Furthermore, CD200
mRNA expression was confirmed in AM of non-asthmatic subjects (data not
shown), suggesting that CD200 expression by AM is also involved in human lung
homeostasis. These data contradict the study of Jiang-Shieh et al (31) showing
that CD200 expression is present on epithelial cells, but absent on AM. However,
they based their identification of AM as “cells found in the airway lumen” of tissue
slices, a technique that hinders the identification of AM. On the other hand, we
specifically looked at AM retrieved by BAL (high yield) and identified them with
macrophage markers using flow cytometry (high specificity). Also, the intensity of
CD200 expression seems to vary among AM subsets (from low to high expression;
Figure 5.1B), which would limit the identification of CD200+ within the small number
of AM found on each tissue slice. Nevertheless, it is possible that AM and epithelial
cells express different magnitude of CD200, which could have “hidden” CD200+
AM in tissue slices. However, in our hands, we observed similar labeling between
ex vivo purified epithelial cells and AM from naïve rats (data not shown). Thus,
using strictly identified AM, we demonstrated that AM express CD200 mRNA and
that CD200 protein is present at their surface.
In the present paper, we showed a dysregulation of CD200 on AM in
experimental asthma, confirming the altered expression of CD200 by asthmatic
peripheral blood cells observed by Aoki et al (9). However, this is in contradiction
with a genetic study that did not find a modulation of AM CD200 expression in an
asthma cohort (32). This discrepancy could be explained by their comparison of
AM from asthmatic and non-asthmatic subjects without any allergen challenge; two
groups for which our study predicts comparable level of CD200. Indeed, we
109
showed that CD200 levels are similar on AM of naïve and asthmatic animals
before allergen challenge. Hence, our study is the first to specifically address the
effect of allergen challenge on AM from naïve and sensitized animals. Strikingly,
CD200 expression on AM was greatly upregulated following allergen challenge in
naïve animals, but not in asthmatic rats. Our results suggest that the homeostatic
response to allergens can be obliterated in asthmatic animals due to the lack of
CD200 regulation in AM, and this could be involved in the development of AHR.
Our data also demonstrated that treatment with rCD200 inhibits a key
feature of asthma; AHR. Indeed, AHR is a defining characteristic of asthma and
causes serious limitations to asthmatic patient’s quality of life (33). Interestingly,
rCD200 treatment abrogates AHR in asthmatic animals. AHR reduction by rCD200
is probably mediated through multiple mechanisms, given that many cells express
CD200R. However, there is no report showing CD200R expression on airway
smooth muscle (ASM) cells, suggesting that AHR inhibition by rCD200 does not
involve direct alteration of ASM contractility. Furthermore, rCD200 does not
modulate the MCh-contraction of isolated trachea (data not shown), supporting an
indirect mechanism. Yet, many mechanisms are known to influence AHR
development.
Th2 cells are deemed to be sufficient to induce asthma pathogenesis,
including AHR (34, 35), and their cell products can increase respiratory system
responsiveness to acetylcholine (36). Interestingly, rCD200 treatment reduces lung
Th2 cell number which could contribute to the inhibition of AHR observed in our
model. Although CD200 was never studied in asthma, Snelgroove et al observed a
similar effect in an influenza model (11). Indeed, CD200–/– mice infected with
influenza virus have an increased accumulation of DC and CD4+ T cells, compared
with wild type animals. Also, in agreement with our observation, Li et al (24)
showed that rCD200 stimulation reduces DC migration and T cell activation in vitro.
Thus, it suggests that CD200 is critical to maintain homeostasis by limiting the
recruitment of mDC and CD4+ T cells to the lungs. Alternatively, AHR reduction by
110
rCD200 may also be a consequence of mast cell inhibition. Indeed, mast cell
degranulation contributes to the hypercontractility of ASM cells (37, 38) and is
inhibited by CD200R activation (39). Also, our group showed that AM functions are
altered in asthmatic animals and can be reprogrammed to protect against AHR
development (14, 18, 40). Given that CD200 inhibits inflammatory macrophages
(41) and that AM express high level of CD200R (11), CD200 treatment may target
aAM to reinstate homeostasis. Thus, CD200 inhibition of AHR is probably
downstream of one or multiple targets, including Th2 cell, mast cell, and AM
inhibition.
While reducing AHR and Th2 cell accumulation, rCD200 administration did
not alter eosinophil accumulation. Even though asthma was first described as an
eosinophilic disease and there is a correlation between eosinophilia and severity of
the disease (42), it seems that asthma is much more heterogeneous than originally
thought. Some phenotypes are not dependent on eosinophil activation and
eosinophils might be more important for severe asthma/exacerbation (43). Indeed,
treatment with anti–IL-5 (a chemotactic cytokine for eosinophils) reduces
exacerbation and improves lung function in a subset of eosinophilic-asthma (44),
whereas it only reduces eosinophilia in another subset of asthma (43, 45).
Furthermore, one can inhibit eosinophil recruitment without altering Th2
recruitment and AHR development (46). On the other hand, T cell activation is
sufficient to induce asthma pathognomonic features (34, 47), suggesting that under
specific circumstances, T cells are sufficient targets to disrupt the asthmatic
cascade. Thus, eosinophilia is not altered by local administration of rCD200, but
central mechanisms of asthmatic pathogenesis, i.e. AHR and T cell recruitment,
are inhibited by rCD200 treatment.
Overall, this study is the first to demonstrate that AM express CD200 and
that treatment with rCD200 abrogates AHR in experimental asthma, in association
with a reduction of mDC and Th2 cell recruitment to the lungs. Also, it seems that
the inability of AM to upregulate the expression of CD200 in response to allergen
111
challenge may be critical for asthma development. Therefore, rCD200 treatment
might be a novel avenue for asthma therapy. Current studies in our lab are
performed to better understand the cellular mechanisms involved in CD200
protective effects on asthma pathogenesis.
5.8. Acknowledgements
We thank Emilie Bernatchez and Marc Veillette for technical help, and Dr
Ynuk Bossé for investigating the effect of rCD200 on tracheal contraction. We also
thank Dr Ynuk Bossé and Dr Yvon Cormier for critical review of the manuscript.
112
5.9. References
1. Lewkowich IP, Lajoie S, Clark JR, Herman NS, Sproles AA, Wills-Karp M. Allergen uptake, activation, and IL-23 production by pulmonary myeloid DCs drives airway hyperresponsiveness in asthma-susceptible mice. PloS one 2008;3(12):e3879. 2. Plantinga M, Guilliams M, Vanheerswynghels M, Deswarte K, Branco-Madeira F, Toussaint W, Vanhoutte L, Neyt K, Killeen N, Malissen B, Hammad H, Lambrecht BN. Conventional and Monocyte-Derived CD11b(+) Dendritic Cells Initiate and Maintain T Helper 2 Cell-Mediated Immunity to House Dust Mite Allergen. Immunity 2013;38(2):322-335. 3. Murdoch JR, Lloyd CM. Chronic inflammation and asthma. Mutat Res 2010;690(1-2):24-39. 4. Umetsu DT, Dekruyff RH. Immune dysregulation in asthma. Curr Opin Immunol 2006;18(6):727-732. 5. Lipscomb MF, Wilder JA. Immune dysregulation as a cause for allergic asthma. Curr Opin Pulm Med 1999;5(1):10-20. 6. Wissinger E, Goulding J, Hussell T. Immune homeostasis in the respiratory tract and its impact on heterologous infection. Semin Immunol 2009;21(3):147-155. 7. Holt PG, Strickland DH. The CD200-CD200R axis in local control of lung inflammation. Nature immunology 2008;9(9):1011-1013. 8. Holmannova D, Kolackova M, Kondelkova K, Kunes P, Krejsek J, Ctirad A. CD200/CD200R paired potent inhibitory molecules regulating immune and inflammatory responses; Part II: CD200/CD200R potential clinical applications. Acta medica 2012;55(2):59-65. 9. Aoki T, Matsumoto Y, Hirata K, Ochiai K, Okada M, Ichikawa K, Shibasaki M, Arinami T, Sumazaki R, Noguchi E. Expression profiling of genes related to asthma exacerbations. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2009;39(2):213-221. 10. Lambrecht BN. Alveolar macrophage in the driver's seat. Immunity 2006;24(4):366-368. 11. Snelgrove RJ, Goulding J, Didierlaurent AM, Lyonga D, Vekaria S, Edwards L, Gwyer E, Sedgwick JD, Barclay AN, Hussell T. A critical function for CD200 in lung immune homeostasis and the severity of influenza infection. Nature immunology 2008;9(9):1074-1083. 12. Lohmann-Matthes M, Steinmuller C, Franke-Ullmann G. Pulmonary macrophages. European Respiratory Journal 1994;7(9):1678-1689. 13. Coleman MM, Ruane D, Moran B, Dunne PJ, Keane J, Mills KH. Alveolar Macrophages Contribute to Respiratory Tolerance by Inducing FoxP3 Expression in Naive T Cells. American journal of respiratory cell and molecular biology 2013;48(6):773-780. 14. Careau E, Turmel V, Lauzon-Joset JF, Bissonnette EY. Alveolar macrophages reduce airway hyperresponsiveness and modulate cytokine levels. Experimental lung research 2010;36(5):255-261.
113
15. Valstar D, Schijf M, Arts JE, Kuper CF, Nijkamp F, Storm G, Bloksma N, Henricks PJ. Alveolar macrophages suppress non-specific inflammation caused by inhalation challenge with trimellitic anhydride conjugated to albumin. Arch Toxicol 2006;80(9):561-571. 16. Bang BR, Chun E, Shim EJ, Lee HS, Lee SY, Cho SH, Min KU, Kim YY, Park HW. Alveolar macrophages modulate allergic inflammation in a murine model of asthma. Experimental & molecular medicine 2011;43(5):275-280. 17. Yang M, Kumar RK, Foster PS. Interferon-γ and pulmonary macrophages contribute to the mechanisms underlying prolonged airway hyperresponsiveness. Clinical & Experimental Allergy 2010;40(1):163-173. 18. Lauzon-Joset JF, Marsolais D, Langlois A, Bissonnette EY. Dysregulation of alveolar macrophages unleashes dendritic cell-mediated mechanisms of allergic airway inflammation. Mucosal immunology 2013. 19. Careau E, Proulx LI, Pouliot P, Spahr A, Turmel V, Bissonnette EY. Antigen sensitization modulates alveolar macrophage functions in an asthma model. American journal of physiology Lung cellular and molecular physiology 2006;290(5):L871-879. 20. Labonte I, Hassan M, Risse PA, Tsuchiya K, Laviolette M, Lauzon AM, Martin JG. The effects of repeated allergen challenge on airway smooth muscle structural and molecular remodeling in a rat model of allergic asthma. American journal of physiology Lung cellular and molecular physiology 2009;297(4):L698-705. 21. Strickland DH, Thomas JA, Mok D, Blank F, McKenna KL, Larcombe AN, Sly PD, Holt PG. Defective aeroallergen surveillance by airway mucosal dendritic cells as a determinant of risk for persistent airways hyper-responsiveness in experimental asthma. Mucosal immunology 2012;5(3):332-341. 22. Holmannova D, Kolackova M, Kondelkova K, Kunes P, Krejsek J, Andrys C. CD200/CD200R paired potent inhibitory molecules regulating immune and inflammatory responses; Part I: CD200/CD200R structure, activation, and function. Acta medica 2012;55(1):12-17. 23. Darmochwal-Kolarz D, Serafin A, Tabarkiewicz J, Kolarz B, Rolinski J, Oleszczuk J. The expressions of co-stimulatory molecules are altered on putative antigen-presenting cells in cord blood. American journal of reproductive immunology 2013;69(2):180-187. 24. Li Y, Zhao LD, Tong LS, Qian SN, Ren Y, Zhang L, Ding X, Chen Y, Wang YX, Zhang W, Zeng XF, Zhang FC, Tang FL, Zhang X, Ba DN, He W, Cao XT, Lipsky PE. Aberrant CD200/CD200R1 expression and function in systemic lupus erythematosus contributes to abnormal T-cell responsiveness and dendritic cell activity. Arthritis research & therapy 2012;14(3):R123. 25. Tschernig T, Neumann D, Pich A, Dorsch M, Pabst R. Experimental bronchial asthma - the strength of the species rat. Current drug targets 2008;9(6):466-469. 26. Martin JG, Tamaoka M. Rat models of asthma and chronic obstructive lung disease. Pulmonary pharmacology & therapeutics 2006;19(6):377-385. 27. Minas K, Liversidge J. Is the CD200/CD200 receptor interaction more than just a myeloid cell inhibitory signal? Crit Rev Immunol 2006;26(3):213-230.
114
28. Liu Y, Bando Y, Vargas-Lowy D, Elyaman W, Khoury SJ, Huang T, Reif K, Chitnis T. CD200R1 agonist attenuates mechanisms of chronic disease in a murine model of multiple sclerosis. The Journal of neuroscience : the official journal of the Society for Neuroscience 2010;30(6):2025-2038. 29. Gorczynski RM, Chen Z, Yu K, Hu J. CD200 immunoadhesin suppresses collagen-induced arthritis in mice. Clinical immunology 2001;101(3):328-334. 30. Mahadevan D, Lanasa MC, Whelden M, Faas SJ, Ulery TL, Kukreja A, Li L, Bedrosian CL, Heffner T. First-In-Human Phase I Dose Escalation Study of a Humanized Anti-CD200 Antibody (Samalizumab) in Patients with Advanced Stage B Cell Chronic Lymphocytic Leukemia (B-CLL) or Multiple Myeloma (MM). ASH Annual Meeting abstract 2010;116:2465. 31. Jiang-Shieh YF, Chien HF, Chang CY, Wei TS, Chiu MM, Chen HM, Wu CH. Distribution and expression of CD200 in the rat respiratory system under normal and endotoxin-induced pathological conditions. Journal of anatomy 2010;216(3):407-416. 32. Madore AM, Perron S, Turmel V, Laviolette M, Bissonnette EY, Laprise C. Alveolar macrophages in allergic asthma: an expression signature characterized by heat shock protein pathways. Human immunology 2010;71(2):144-150. 33. Porsbjerg C, Rasmussen L, Nolte H, Backer V. Association of airway hyperresponsiveness with reduced quality of life in patients with moderate to severe asthma. Annals of allergy, asthma & immunology : official publication of the American College of Allergy, Asthma, & Immunology 2007;98(1):44-50. 34. Mishima H, Hojo M, Watanabe A, Hamid QA, Martin JG. CD4+ T cells can induce airway hyperresponsiveness to allergen challenge in the brown norway rat. American journal of respiratory and critical care medicine 1998;158(6):1863-1870. 35. Gavett SH, Chen X, Finkelman F, Wills-Karp M. Depletion of murine CD4+ T lymphocytes prevents antigen-induced airway hyperreactivity and pulmonary eosinophilia. American journal of respiratory cell and molecular biology 1994;10(6):587-593. 36. Venkayya R, Lam M, Willkom M, Grunig G, Corry DB, Erle DJ. The Th2 lymphocyte products IL-4 and IL-13 rapidly induce airway hyperresponsiveness through direct effects on resident airway cells. American journal of respiratory cell and molecular biology 2002;26(2):202-208. 37. Berger P, Compton SJ, Molimard M, Walls AF, N'Guyen C, Marthan R, Tunon-De-Lara JM. Mast cell tryptase as a mediator of hyperresponsiveness in human isolated bronchi. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 1999;29(6):804-812. 38. Page S, Ammit AJ, Black JL, Armour CL. Human mast cell and airway smooth muscle cell interactions: implications for asthma. American journal of physiology Lung cellular and molecular physiology 2001;281(6):L1313-1323. 39. Zhang S, Cherwinski H, Sedgwick JD, Phillips JH. Molecular mechanisms of CD200 inhibition of mast cell activation. J Immunol 2004;173(11):6786-6793. 40. Pouliot P, Spahr A, Careau E, Turmel V, Bissonnette EY. Alveolar macrophages from allergic lungs are not committed to a pro-allergic response and can reduce airway hyperresponsiveness following ex vivo culture. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2008;38(3):529-538.
115
41. Gorczynski RM. CD200 and its receptors as targets for immunoregulation. Curr Opin Investig Drugs 2005;6(5):483-488. 42. Bousquet J, Chanez P, Lacoste JY, Barneon G, Ghavanian N, Enander I, Venge P, Ahlstedt S, Simony-Lafontaine J, Godard P, Michel FB. Eosinophilic inflammation in asthma. The New England journal of medicine 1990;323(15):1033-1039. 43. Wenzel SE. Eosinophils in asthma--closing the loop or opening the door? The New England journal of medicine 2009;360(10):1026-1028. 44. Castro M, Mathur S, Hargreave F, Boulet LP, Xie F, Young J, Wilkins HJ, Henkel T, Nair P, Res-5- Study G. Reslizumab for poorly controlled, eosinophilic asthma: a randomized, placebo-controlled study. American journal of respiratory and critical care medicine 2011;184(10):1125-1132. 45. Flood-Page P, Swenson C, Faiferman I, Matthews J, Williams M, Brannick L, Robinson D, Wenzel S, Busse W, Hansel TT, Barnes NC, International Mepolizumab Study G. A study to evaluate safety and efficacy of mepolizumab in patients with moderate persistent asthma. American journal of respiratory and critical care medicine 2007;176(11):1062-1071. 46. Fattouh R, Al-Garawi A, Fattouh M, Arias K, Walker TD, Goncharova S, Coyle AJ, Humbles AA, Jordana M. Eosinophils are dispensable for allergic remodeling and immunity in a model of house dust mite-induced airway disease. American journal of respiratory and critical care medicine 2011;183(2):179-188. 47. Siegle JS, Hansbro N, Herbert C, Yang M, Foster PS, Kumar RK. Airway hyperreactivity in exacerbation of chronic asthma is independent of eosinophilic inflammation. American journal of respiratory cell and molecular biology 2006;35(5):565-570.
116
5.10. Figure legends
Figure 5.1: AM express the surface molecule CD200 and its expression is
dysregulated in asthma
AM were harvested by BAL and purified by adherence. mRNA was extracted with
Trizol reagent and CD200 expression was assessed with one-step RT-PCR. A)
CD200 (arrow) and -actin (arrowhead) mRNA expression in AM. B-C) Asthmatic
rats were sensitized i.p. with ovalbumin (OVA)/Alum and BAL were performed 24 h
after OVA challenge. AM from naïve (nAM) and asthmatic (aAM) rats were
harvested before (pre) or after (post) allergen challenge, and identified as
CD172+/autofluorescent+ cells by FACS. B) Representative histogram of FACS
analysis and C) mean fluorescence intensity (MFI) percentage over control (nAM
pre-allergen challenge) are depicted. n = 4-7. Asterisk indicates significant
differences (P<0.05) compared with the naïve group.
Figure 5.2: rCD200 reduces AHR, but does not modulate cell recruitment in
bronchoalveolar lavages
Asthmatic rats were sensitized i.p. with ovalbumin (OVA)/Alum and received
recombinant IgG (Sham) or CD200 chimera (rCD200) i.t. 24 h before allergen
challenge. Lung resistance (RL) and BAL were analyzed 24 h after OVA challenge.
A) RL was assessed after nebulisation with incremental doses of MCh. B) Total cell
counts and C) cellularity were measured after Trypan blue and DiffQuick stainings,
respectively. AM: alveolar macrophages; Eos: eosinophils; Neutro: neutrophils. n =
4-7. Asterisk indicates significant differences (P<0.05) compared with the naïve
group.
117
Figure 5.3: mDC recruitment to the lung of asthmatic rats is inhibited by
rCD200
Asthmatic rats were sensitized i.p. with ovalbumin (OVA)/Alum and received
recombinant IgG (Sham) or CD200 chimera (rCD200) i.t. 24 h before allergen
challenge. Single cell suspensions were prepared from lungs 24 h after OVA
challenge and analyzed by FACS. Myeloid DC (mDC) were gated on non-
autofluorescent cells and identified as CD11b+ and major histocompatibility
complex (MHC) II+ cells, whereas plasmacytoid DC (pDC) were gated on non-
autofluorescent CD4+ cells and identified as CD11b–, CD4+ and MHC II+ cells.
mDC and pDC A) frequencies of total lung cells and B) number per g of lung were
measured. n = 4-7. Asterisk indicates significant differences (P<0.05).
Figure 5.4: rCD200 reduces the accumulation of Th2 cells in the lung of
asthmatic animals
Asthmatic rats were sensitized i.p. with ovalbumin (OVA)/Alum and received
recombinant IgG (Sham) or CD200 chimera (rCD200) i.t. 24 h before allergen
challenge. Single cell suspensions were prepared from lungs 24 h after OVA
challenge and analyzed by flow cytometry. CD4+ T cell (CD3+) and IL-4+/Stat6+ Th2
cell frequencies of total lung cells (A;C, respectively) and number per g of lung
(B;D, respectively) were measured. n = 4-7. Asterisk indicates significant
differences (P<0.05).
Figure 5.5: rCD200 does not alter dLN DC and T cell numbers
Asthmatic rats were sensitized i.p. with ovalbumin (OVA)/Alum and received
recombinant IgG (Sham) or CD200 chimera (rCD200) i.t. 24 h before OVA-
AlexaFluor647 challenge. Single cell suspensions were prepared from draining
lymph node (dLN) 24 h after OVA exposure and OVA+ DC was assessed by
118
measuring the frequency of AlexaFluor647+ DC, using flow cytometry. A) OVA+
mDC and pDC frequencies of total dLN cells and B) OVA+ mDC and pDC number
in dLN were measured. CD4+ T cell and IL-4+/Stat6+ Th2 frequencies of total dLN
cells (C;E, respectively) and number per dLN (D;F, respectively). n = 4-7. Asterisk
indicates significant differences (P<0.05) compared with the naïve group.
119
5.11. Figures
Figure 5.1 : AM express the surface molecule CD200 and its expression is
dysregulated in asthma
120
Figure 5.2 : rCD200 reduces AHR, but does not modulate cell recruitment in
bronchoalveolar lavages
121
Figure 5.3 : mDC recruitment to the lung of asthmatic rats is inhibited by rCD200
122
Figure 5.4 : rCD200 reduces the accumulation of Th2 cells in the lung of asthmatic
animals
123
Figure 5.5 : rCD200 does not alter dLN DC and T cell numbers
125
CHAPITRE 6 : Discussion, conclusion et
perspectives
126
6.1. Activation des populations de DC dans l’immunité
pulmonaire
L’immunité pulmonaire est composée de plusieurs types de cellules ayant
des fonctions spécifiques, dont les DC. Les DC sont des cellules clés pour orienter
la réaction immune à un allergène vers une réponse asthmatique ou tolérogène.
En effet, les DC peuvent aussi bien polariser les lymphocytes T en Th2 qu’en Treg.
Bien que plusieurs populations de DC soient présentes dans le poumon, peu
d’informations sont disponibles quant à savoir l’implication de ces différentes
populations dans les multiples réponses immunes.
Pour éclaircir ce point, nous nous sommes intéressés à l’activation des DC
dans une réponse tolérogène et asthmatique. Dans cette étude, nous avons
démontré que l’activation des mDC2 pulmonaires est associée avec le
développement d’une réponse tolérogène, tandis que la réponse inflammatoire
asthmatique est liée avec l’activation des mDC1. Des résultats similaires ont été
observés dans d’autres modèles tolérogènes et inflammatoires chez la souris (35,
37, 160). Donc, les mDC2 de rats et les DC CD103+ de souris ont des fonctions
tolérogènes homologues (26, 29). En résumé, nos résultats supportent pour la
première fois que la mise en place d’une réponse tolérogène et asthmatique sont,
respectivement, associées à l’activation des mDC2 et mDC1 pulmonaires.
Également, cette étude a mis en lumière la relation entre la dose
d’allergènes et l’initiation de la réponse immunitaire. En effet, bien que les rats
PVG et BN aient été exposés à la même quantité d’allergène, la quantité d’OVA
transportée par les mDC dans les ganglions lymphatiques est très différente entre
les deux espèces. Cela confirme donc les observations de Strickland et al (161)
qu’une faible capture de l’OVA par les DC est associée à une réponse asthmatique
Th2, tandis qu’une forte capture des allergènes favorise la tolérance.
127
L’implication des différents compartiments pulmonaires lors d’une réponse
tolérogène et asthmatique a également été le sujet de cette étude. Contrairement à
ce que von Garnier et al (13) ont observé, notre étude n’a identifié aucune
modulation des fonctions des DC de la trachée lors d’une réponse tolérogène et
asthmatique chez les rats PVG et BN. Cette divergence pourrait s’expliquer par
l’utilisation de modèles différents. Tout d’abord, von Garnier et al (13) ont étudié la
capture de l’allergène chez des souris naïves, tandis que nous avons utilisé des
modèles de rats impliquant une sensibilisation et plusieurs expositions à un
allergène. Bien qu’il soit possible que le système immun des différentes espèces
présente des différences intrinsèques, les modèles utilisés dans notre étude ont
l’avantage de mieux représenter la « réalité ». En effet, les rats ont été exposés à
l’allergène sur une longue période, contrairement à l’injection d’un bolus
d’allergène intranasale ou intratrachéale. De plus, l’exposition répétée (1 fois par
jour durant 6 jours) est davantage représentative de ce qui peut arriver chez un
patient asthmatique. Bref, nos données supportent que les DC pulmonaires, et non
celles de la trachée, sont impliquées dans la mise en place d’une réponse
tolérogène et asthmatique. Ainsi, pour la suite des études, nous nous sommes
concentrés sur l’activation des DC pulmonaires dans la réponse asthmatique et
particulièrement, comment leur activation est régulée.
6.2. Mécanismes de l’homéostasie pulmonaire
Grâce à la meilleure compréhension des fonctions des DC dans l’immunité
pulmonaire, il a été possible d’approfondir des mécanismes qui contrôlent
l’homéostasie pulmonaire. Pour ce faire, deux principaux thèmes ont été abordés
dans cette thèse, soit le rôle des AM et celui de la voie CD200/CD200R dans
l’homéostasie pulmonaire. Ces études avaient pour but de mieux comprendre les
128
mécanismes qui contrôlent l’activation des DC et plus particulièrement, lesquels
sont dérégulés lors de la réponse asthmatique.
Les macrophages alvéolaires
Les AM sont les cellules immunitaires pulmonaires les plus abondantes.
Leurs fonctions permettent aussi bien la mise en place d’une réponse
inflammatoire qu’anti-inflammatoire. Bien que chez des sujets asthmatiques, les
AM ont un phénotype pro-inflammatoire (50, 144, 145), plusieurs études ont
démontré que, de façon constitutive, les AM ont des fonctions anti-inflammatoires
(48, 54). En effet, plusieurs études in vitro ont démontré que les AM interfèrent
avec l’activation des DC (62, 63) et peuvent même induire l’activation des Treg
(61). De plus, le transfert de AM naïfs dans des rats asthmatiques est suffisant
pour empêcher le développement d’AHR et pour altérer la cascade inflammatoire
observée chez les rats asthmatiques (55, 57, 58, 138, 145, 149, 159). Cela
suggère donc que les AM pourraient interférer avec la réponse asthmatique en
modulant l’activation des DC, mais les mécanismes impliqués dans cette
régulation sont encore mécompris.
Notre étude avait donc comme objectif de déterminer l’interaction des AM et
des DC dans l’homéostasie pulmonaire. Nous avons démontré pour la première
fois que les AM naïfs modulent l’activation des mDC in vivo en inhibant leur
capacité à capturer des allergènes. De plus, nos résultats montrent que les AM
naïfs inhibent aussi bien l’activation des mDC1 que les mDC2 (données non
publiés) et n’induisent pas de réponse Treg. Ces résultats suggèrent que,
contrairement à la réponse tolérogène observée dans les rats PVG, les AM naïfs
de rats BN maintiennent l’homéostasie pulmonaire via l’ignorance immunitaire. Il
est possible que la discordance entre ces deux réponses soit liée au nombre
d’exposition à l’allergène. En effet, le modèle de transfert de AM dans les rats BN
est exposé seulement une fois à l’allergène, tandis que la réponse tolérogène des
rats PVG est induite après des expositions allergéniques multiples. Il est donc
129
possible qu’un faible nombre d’exposition favorise l’ignorance, tandis que
l’exposition répétée entraine une réponse tolérogène. En effet, la tolérance
implique le développement de Treg qui circule afin de contrôler l’activation du
système immunitaire. Par contre, il serait trop « coûteux » pour le système
immunitaire de mettre un place une réponse tolérogène contre tous les allergènes
et antigènes auxquels nous sommes exposés. Pour ce faire, les mécanismes
d’ignorance permettent d’éliminer rapidement et silencieusement la majorité des
éléments exogènes inoffensifs, afin de permettre le développement de réponses
tolérogènes lorsque requis. En résumé, cette étude a démontré pour la première
fois que les AM participent à l’ignorance immunitaire en limitant la capture de
l’allergène par les DC.
Malgré l’altération de l’activation des DC, les AM n’affectent pas
l’accumulation des éosinophiles au poumon, mais interfèrent avec le
développement de l’AHR (58, 138). Quoique plusieurs études ont déjà remarqué
une dissociation entre l’AHR et l’éosinophilie (135-137, 162), notre étude suggère
que les mécanismes qui contrôlent l’éosinophilie sont distincts de ceux qui
contrôlent l’activation des DC. Quoique peu d’évidences directes sont disponibles
sur les étapes du recrutement des éosinophiles, plusieurs études ont démontré
que les cellules épithéliales pulmonaires sont les principales productrices
d’éotaxine (chimiokine des éosinophiles) (163-165). Il est donc probable que le
transfert de AM n’affecte pas la production de chimiokines par les cellules
épithéliales et donc le recrutement d’éosinophiles.
Afin de mieux comprendre l’homéostasie pulmonaire et le rôle des AM dans
cette réponse, il est important d’identifier les mécanismes impliqués dans
l’interaction entre les AM et les DC. Dans cette étude, nous avons démontré que le
transfert de AM naïfs réduit la capture d’OVA par les DC et que ce n’est pas induit
par une plus grande élimination (ou phagocytose) de l’OVA par les AM, ni par une
altération du profil de cytokines des LBA. En effet, les AM naïfs phagocytent moins
d’OVA que ceux asthmatiques et la concentration d’IL-10 (une cytokine anti-
130
inflammatoire) et de GM-CSF (Granulocyte macrophage colony-stimulating factor;
un facteur impliqué dans l’activation des DC) n’est pas modulée (64, 166, 167).
Pour ces raisons, nous nous sommes intéressés à une voie homéostatique
nouvellement décrite, celle du CD200/CD200R.
La voie du CD200/CD200R
Le CD200 et le CD200R sont des protéines de surfaces exprimées par une
panoplie de cellules immunitaires et structurales. L’interaction du CD200 avec son
récepteur modulent plusieurs processus inflammatoires, dont la réponse antivirale
et l’inflammation arthritique (65, 69, 78). L’activation de CD200R par le CD200
inhibe la dégranulation des mastocytes, tandis qu’elle diminue la production de
cytokines pro-inflammatoires par les macrophages (60, 71, 73, 74). Le CD200R est
davantage exprimé par les AM que par ses homologues résidents des autres
tissus (60), suggérant un rôle important dans l’immunité pulmonaire. Bien
qu’aucune étude n’ait investigué le rôle de cette voie dans la réaction asthmatique
pulmonaire, une étude génétique a mis en évidence une réduction de l’expression
du CD200 sur les monocytes circulants chez les patients asthmatiques en
exacerbation (80). Toutes ces informations suggèrent que, dans l’asthme, la voie
du CD200/CD200R est dérégulée.
Nous avons donc évalué la dérégulation de cette voie de signalisation dans
la pathogénèse de l’asthme allergique. Nous sommes la première équipe qui a
démontré que les AM expriment le CD200 (en plus du CD200R), ce qui suggère
que les AM modulent les fonctions des cellules exprimant le CD200R, incluant
elles-mêmes. Aussi, nous avons démontré que l’expression du CD200 par les AM
augmente en réponse à une exposition allergénique chez des rats naïfs, tandis
que chez les rats asthmatiques, aucune modulation n’est observée. Puisque la
voie du CD200/CD200R est dérégulée dans l’asthme, nous avons testé si
l’administration d’une protéine recombinante de CD200 (rCD200) pouvait altérer la
réponse asthmatique et l’activation des DC.
131
Notre étude est la première étude qui démontre que l’administration du
CD200 interfère avec la cascade asthmatique. En effet, l’administration de rCD200
chez des rats asthmatiques a complètement inhibé l’AHR, sans toutefois affecter
l’éosinophilie. Il est intéressant de noter que le transfert de AM sains et le rCD200
inhibent les mêmes composantes de la réaction asthmatique, ce qui supporte que
l’inhibition de l’AHR par les AM pourrait être médiée via le CD200. De plus, si les
cellules épithéliales sont bel et bien responsables du recrutement des éosinophiles
(voir plus haut; (135-137, 162)), il est normal que le rCD200 n’affecte pas les
fonctions de l’épithélium, puisque celui est dépourvu de CD200R. Par contre, il est
possible que le rCD200 compense pour la dérégulation du CD200 sur d’autres
cellules pulmonaires, dont les DC et les cellules épithéliales. En effet, des résultats
préliminaires de notre laboratoire suggèrent que l’expression du CD200 sur les
cellules épithéliales bronchiques est également diminuée dans l’asthme.
L’axe DC/lymphocytes Th2 est également modulé par le traitement avec
rCD200. En effet, l’accumulation des mDC, ainsi que des lymphocytes Th2, au
poumon de rats asthmatiques est inhibée par le rCD200. Par contre, le rCD200 ne
module pas la migration des mDC OVA+ vers les ganglions lymphatiques. Ces
résultats suggèrent donc que le contrôle de l’immunité par les AM ne s’effectue
pas seulement via la voie du CD200, puisque le transfert de AM, contrairement au
rCD200, réduit la capture d’allergènes par les mDC pulmonaires, ainsi que leur
accumulation aux ganglions lymphatiques.
En résumé, nous sommes les premiers à avoir démontré que les AM
expriment le CD200 et que, dans l’asthme, son expression est dérégulée dans le
poumon. De plus, nos résultats démontrent pour la première fois que
l’administration de rCD200 est efficace pour moduler plusieurs éléments de la
cascade asthmatique, dont l’AHR et la réponse Th2. Finalement, les AM et le
CD200 contrôlent l’homéostasie pulmonaire, entre autre, via la modulation des
fonctions des DC, mais les fonctions anti-inflammatoires des AM incluent
probablement d’autres mécanismes en plus du CD200.
132
6.3. Conclusions et perspectives
Nous avons mis en évidence la modulation différentielle de l’activation des
mDC1 et mDC2 dans les réponses asthmatique et tolérogène. Si les DC
trachéales semblent jouer un rôle mineur, les mDC2 pulmonaires sont
préférentiellement activées en condition tolérogène. Au point de vue mécanistique,
il serait intéressant de confirmer ces observations à l’aide du transfert de mDC1 et
mDC2. De plus, l’identification du ou des facteurs qui permettent aux mDC1 et
mDC2 d’induire des réponses immunes différentielles seraient un atout majeur afin
de pouvoir moduler la réponse immune. Bien que les AM semblent contrôler
l’activation des mDC, ils ne semblent pas agir différemment sur l’une ou l’autre des
sous-populations.
Nous avons également démontré que les AM régulent l’activation des mDC.
L’identification du ou des mécanismes de communication intercellulaire employé
par les AM pour maintenir l’homéostasie pulmonaire est encore mal défini.
Toutefois, nous avons démontré que le rCD200 duplique certaines des fonctions
des AM naïfs, ce qui suggère que l’expression du CD200 par les AM pourrait
contrôler l’homéostasie pulmonaire. En effet, l’administration de rCD200 est
suffisante pour moduler dans le poumon l’accumulation des DC et des
lymphocytes Th2. Par contre, ce traitement ne semble pas affecter la réponse
immunitaire périphérique (i.e. dans les ganglions lymphatiques), ce qui pourrait
permettre d’entretenir l’activation de la cascade inflammatoire. Afin de mieux
comprendre l’immunobiologie du CD200, il serait important de déterminer les
cibles du rCD200 et si le rCD200 altère directement les fonctions des DC et/ou des
lymphocytes Th2. En autre, il serait possible de déterminer si la présence des AM
est nécessaire pour l’effet du rCD200 en déplétant les AM avant d’administrer le
rCD200. De plus, afin de mieux comprendre le rôle des AM dans l’homéostasie
133
pulmonaire, l’investigation de la contribution du CD200 présent à la surface des
AM serait importante. Pour ce faire, il serait possible d’éliminer l’expression du
CD200 sur les AM avant de les transférer par interférence à l’ARN (e.g. en utilisant
des small interference RNA; siRNA), mais cela impliquerait probablement d’utiliser
des lignées cellulaires (e.g. les NR8383) au lieu de AM ex vivo. En effet, les AM
sont des cellules particulièrement résistantes à ce genre de traitement et
l’utilisation de lignée stable facilite le processus (168, 169).
En conclusion, les différentes populations de DC sont activées pour mettre
en place une réponse tolérogène et inflammatoire. De plus, les AM jouent un rôle
important dans l’homéostasie pulmonaire via l’interaction avec les DC. La perte
des capacités homéostatiques des AM dans le contexte de l’asthme pourrait
s’expliquer, du moins en partie, par la dérégulation de la voie du CD200. Toutefois
les multiples cibles potentielles du rCD200 restent à déterminer. Ainsi, nos études
ont éclairci certains mécanismes impliqués dans l’immunité pulmonaire et sera la
base d’études futures dans le laboratoire du Dre Bissonnette.
135
CHAPITRE 7 : Bibliographie
136
1. Green DR, Ferguson TA. The role of Fas ligand in immune privilege. Nat Rev Mol Cell Biol 2001;2(12):917-924. 2. Tournoy KG, Provoost S, Van Hove C, Joos G. The role of immune tolerance in asthma pathogenesis. Curr Allergy Asthma Rep 2006;6(5):437-443. 3. Miyata R, van Eeden SF. The innate and adaptive immune response induced by alveolar macrophages exposed to ambient particulate matter. Toxicology and applied pharmacology 2011;257(2):209-226. 4. Sanders CJ, Doherty PC, Thomas PG. Respiratory epithelial cells in innate immunity to influenza virus infection. Cell Tissue Res 2011;343(1):13-21. 5. Hussell T, Goulding J. Structured regulation of inflammation during respiratory viral infection. The Lancet infectious diseases 2010;10(5):360-366. 6. Guillot L, Nathan N, Tabary O, Thouvenin G, Le Rouzic P, Corvol H, Amselem S, Clement A. Alveolar epithelial cells: master regulators of lung homeostasis. Int J Biochem Cell Biol 2013;45(11):2568-2573. 7. Wissinger E, Goulding J, Hussell T. Immune homeostasis in the respiratory tract and its impact on heterologous infection. Semin Immunol 2009;21(3):147-155. 8. Holt PG, Strickland DH. The CD200-CD200R axis in local control of lung inflammation. Nature immunology 2008;9(9):1011-1013. 9. Reis e Sousa C. Dendritic cells in a mature age. Nat Rev Immunol 2006;6(6):476-483. 10. Hansel TT, Johnston SL, Openshaw PJ. Microbes and mucosal immune responses in asthma. Lancet 2013;381(9869):861-873. 11. Desch AN, Henson PM, Jakubzick CV. Pulmonary dendritic cell development and antigen acquisition. Immunol Res 2013;55(1-3):178-186. 12. Jakubzick C, Tacke F, Llodra J, van Rooijen N, Randolph GJ. Modulation of dendritic cell trafficking to and from the airways. J Immunol 2006;176(6):3578-3584. 13. von Garnier C, Filgueira L, Wikstrom M, Smith M, Thomas JA, Strickland DH, Holt PG, Stumbles PA. Anatomical location determines the distribution and function of dendritic cells and other APCs in the respiratory tract. J Immunol 2005;175(3):1609-1618. 14. Holt PG, Haining S, Nelson DJ, Sedgwick JD. Origin and steady-state turnover of class II MHC-bearing dendritic cells in the epithelium of the conducting airways. J Immunol 1994;153(1):256-261. 15. Hahn I, Klaus A, Maus R, Christman JW, Welte T, Maus UA. Dendritic cell depletion and repopulation in the lung after irradiation and bone marrow transplantation in mice. American journal of respiratory cell and molecular biology 2011;45(3):534-541. 16. Vermaelen K, Pauwels R. Pulmonary dendritic cells. American journal of respiratory and critical care medicine 2005;172(5):530-551. 17. Cook DN, Bottomly K. Innate immune control of pulmonary dendritic cell trafficking. Proc Am Thorac Soc 2007;4(3):234-239. 18. Mahnke K, Schmitt E, Bonifaz L, Enk AH, Jonuleit H. Immature, but not inactive: the tolerogenic function of immature dendritic cells. Immunology and cell biology 2002;80(5):477-483. 19. Cools N, Van Tendeloo VF, Smits EL, Lenjou M, Nijs G, Van Bockstaele DR, Berneman ZN, Ponsaerts P. Immunosuppression induced by immature
137
dendritic cells is mediated by TGF-beta/IL-10 double-positive CD4+ regulatory T cells. Journal of cellular and molecular medicine 2008;12(2):690-700. 20. Gad M, Kristensen NN, Kury E, Claesson MH. Characterization of T-regulatory cells, induced by immature dendritic cells, which inhibit enteroantigen-reactive colitis-inducing T-cell responses in vitro and in vivo. Immunology 2004;113(4):499-508. 21. Lambrecht BN, Carro-Muino I, Vermaelen K, Pauwels RA. Allergen-induced changes in bone-marrow progenitor and airway dendritic cells in sensitized rats. American journal of respiratory cell and molecular biology 1999;20(6):1165-1174. 22. Fear VS, Burchell JT, Lai SP, Wikstrom ME, Blank F, von Garnier C, Turner DJ, Sly PD, Holt PG, Strickland DS, et al. Restricted aeroallergen access to airway mucosal dendritic cells in vivo limits allergen-specific CD4+ T cell proliferation during the induction of inhalation tolerance. J Immunol 2011;187(9):4561-4570. 23. Hubo M, Trinschek B, Kryczanowsky F, Tuettenberg A, Steinbrink K, Jonuleit H. Costimulatory molecules on immunogenic versus tolerogenic human dendritic cells. Frontiers in immunology 2013;4:82. 24. de Jong EC, Smits HH, Kapsenberg ML. Dendritic cell-mediated T cell polarization. Springer seminars in immunopathology 2005;26(3):289-307. 25. Boonstra A, Asselin-Paturel C, Gilliet M, Crain C, Trinchieri G, Liu YJ, O'Garra A. Flexibility of mouse classical and plasmacytoid-derived dendritic cells in directing T helper type 1 and 2 cell development: dependency on antigen dose and differential toll-like receptor ligation. The Journal of experimental medicine 2003;197(1):101-109. 26. Hochrein H, O'Keeffe M. Dendritic cell subsets and toll-like receptors. Handbook of experimental pharmacology 2008(183):153-179. 27. Crozat K, Guiton R, Guilliams M, Henri S, Baranek T, Schwartz-Cornil I, Malissen B, Dalod M. Comparative genomics as a tool to reveal functional equivalences between human and mouse dendritic cell subsets. Immunological reviews 2010;234(1):177-198. 28. Demedts IK, Brusselle GG, Vermaelen KY, Pauwels RA. Identification and characterization of human pulmonary dendritic cells. American journal of respiratory cell and molecular biology 2005;32(3):177-184. 29. Robbins SH, Walzer T, Dembele D, Thibault C, Defays A, Bessou G, Xu H, Vivier E, Sellars M, Pierre P, et al. Novel insights into the relationships between dendritic cell subsets in human and mouse revealed by genome-wide expression profiling. Genome biology 2008;9(1):R17. 30. Jahnsen FL, Moloney ED, Hogan T, Upham JW, Burke CM, Holt PG. Rapid dendritic cell recruitment to the bronchial mucosa of patients with atopic asthma in response to local allergen challenge. Thorax 2001;56(11):823-826. 31. Demedts IK, Bracke KR, Maes T, Joos GF, Brusselle GG. Different roles for human lung dendritic cell subsets in pulmonary immune defense mechanisms. American journal of respiratory cell and molecular biology 2006;35(3):387-393. 32. Jakubzick C, Helft J, Kaplan TJ, Randolph GJ. Optimization of methods to study pulmonary dendritic cell migration reveals distinct capacities of DC subsets to acquire soluble versus particulate antigen. Journal of immunological methods 2008;337(2):121-131.
138
33. Coquerelle C, Moser M. DC subsets in positive and negative regulation of immunity. Immunological reviews 2010;234(1):317-334. 34. GeurtsvanKessel CH, Lambrecht BN. Division of labor between dendritic cell subsets of the lung. Mucosal immunology 2008;1(6):442-450. 35. Khare A, Krishnamoorthy N, Oriss TB, Fei M, Ray P, Ray A. Cutting Edge: Inhaled Antigen Upregulates Retinaldehyde Dehydrogenase in Lung CD103+ but Not Plasmacytoid Dendritic Cells To Induce Foxp3 De Novo in CD4+ T Cells and Promote Airway Tolerance. J Immunol 2013;191(1):25-29. 36. Matteoli G, Mazzini E, Iliev ID, Mileti E, Fallarino F, Puccetti P, Chieppa M, Rescigno M. Gut CD103+ dendritic cells express indoleamine 2,3-dioxygenase which influences T regulatory/T effector cell balance and oral tolerance induction. Gut 2010;59(5):595-604. 37. del Rio ML, Bernhardt G, Rodriguez-Barbosa JI, Forster R. Development and functional specialization of CD103+ dendritic cells. Immunological reviews 2010;234(1):268-281. 38. de Heer HJ, Hammad H, Soullie T, Hijdra D, Vos N, Willart MA, Hoogsteden HC, Lambrecht BN. Essential role of lung plasmacytoid dendritic cells in preventing asthmatic reactions to harmless inhaled antigen. The Journal of experimental medicine 2004;200(1):89-98. 39. Oriss TB, Ostroukhova M, Seguin-Devaux C, Dixon-McCarthy B, Stolz DB, Watkins SC, Pillemer B, Ray P, Ray A. Dynamics of dendritic cell phenotype and interactions with CD4+ T cells in airway inflammation and tolerance. J Immunol 2005;174(2):854-863. 40. Holt PG, Stumbles PA. Characterization of dendritic cell populations in the respiratory tract. Journal of aerosol medicine : the official journal of the International Society for Aerosols in Medicine 2000;13(4):361-367. 41. Fitzgerald-Bocarsly P, Dai J, Singh S. Plasmacytoid dendritic cells and type I IFN: 50 years of convergent history. Cytokine & growth factor reviews 2008;19(1):3-19. 42. Guery L, Hugues S. Tolerogenic and activatory plasmacytoid dendritic cells in autoimmunity. Frontiers in immunology 2013;4:59. 43. Hubo M, Jonuleit H. Plasmacytoid dendritic cells are inefficient in activation of human regulatory T cells. PloS one 2012;7(8):e44056. 44. Gordon SB, Read RC. Macrophage defences against respiratory tract infections. British medical bulletin 2002;61:45-61. 45. Marriott HM, Dockrell DH. The role of the macrophage in lung disease mediated by bacteria. Experimental lung research 2007;33(10):493-505. 46. Broug-Holub E, Toews GB, van Iwaarden JF, Strieter RM, Kunkel SL, Paine R, 3rd, Standiford TJ. Alveolar macrophages are required for protective pulmonary defenses in murine Klebsiella pneumonia: elimination of alveolar macrophages increases neutrophil recruitment but decreases bacterial clearance and survival. Infection and immunity 1997;65(4):1139-1146. 47. Lohmann-Matthes M, Steinmuller C, Franke-Ullmann G. Pulmonary macrophages. European Respiratory Journal 1994;7(9):1678-1689. 48. Kooguchi K, Hashimoto S, Kobayashi A, Kitamura Y, Kudoh I, Wiener-Kronish J, Sawa T. Role of alveolar macrophages in initiation and regulation of
139
inflammation in Pseudomonas aeruginosa pneumonia. Infection and immunity 1998;66(7):3164-3169. 49. Westphalen K, Gusarova GA, Islam MN, Subramanian M, Cohen TS, Prince AS, Bhattacharya J. Sessile alveolar macrophages communicate with alveolar epithelium to modulate immunity. Nature 2014. 50. Moreira AP, Hogaboam CM. Macrophages in allergic asthma: fine-tuning their pro- and anti-inflammatory actions for disease resolution. Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research 2011;31(6):485-491. 51. Hussell T, Bell TJ. Alveolar macrophages: plasticity in a tissue-specific context. Nat Rev Immunol 2014;14(2):81-93. 52. Benoit M, Desnues B, Mege JL. Macrophage polarization in bacterial infections. J Immunol 2008;181(6):3733-3739. 53. Mantovani A, Sica A, Sozzani S, Allavena P, Vecchi A, Locati M. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol 2004;25(12):677-686. 54. Balhara J, Gounni AS. The alveolar macrophages in asthma: a double-edged sword. Mucosal immunology 2012;5(6):605-609. 55. Careau E, Bissonnette EY. Adoptive transfer of alveolar macrophages abrogates bronchial hyperresponsiveness. American journal of respiratory cell and molecular biology 2004;31(1):22-27. 56. Valstar D, Schijf M, Arts JE, Kuper CF, Nijkamp F, Storm G, Bloksma N, Henricks PJ. Alveolar macrophages suppress non-specific inflammation caused by inhalation challenge with trimellitic anhydride conjugated to albumin. Arch Toxicol 2006;80(9):561-571. 57. Bang BR, Chun E, Shim EJ, Lee HS, Lee SY, Cho SH, Min KU, Kim YY, Park HW. Alveolar macrophages modulate allergic inflammation in a murine model of asthma. Experimental & molecular medicine 2011;43(5):275-280. 58. Careau E, Turmel V, Lauzon-Joset JF, Bissonnette EY. Alveolar macrophages reduce airway hyperresponsiveness and modulate cytokine levels. Experimental lung research 2010;36(5):255-261. 59. Goulding J, Godlee A, Vekaria S, Hilty M, Snelgrove R, Hussell T. Lowering the threshold of lung innate immune cell activation alters susceptibility to secondary bacterial superinfection. The Journal of infectious diseases 2011;204(7):1086-1094. 60. Snelgrove RJ, Goulding J, Didierlaurent AM, Lyonga D, Vekaria S, Edwards L, Gwyer E, Sedgwick JD, Barclay AN, Hussell T. A critical function for CD200 in lung immune homeostasis and the severity of influenza infection. Nature immunology 2008;9(9):1074-1083. 61. Coleman MM, Ruane D, Moran B, Dunne PJ, Keane J, Mills KH. Alveolar Macrophages Contribute to Respiratory Tolerance by Inducing FoxP3 Expression in Naive T Cells. American journal of respiratory cell and molecular biology 2013;48(6):773-780. 62. Strickland DH, Thepen T, Kees UR, Kraal G, Holt PG. Regulation of T-cell function in lung tissue by pulmonary alveolar macrophages. Immunology 1993;80(2):266-272.
140
63. Holt PG, Oliver J, Bilyk N, McMenamin C, McMenamin PG, Kraal G, Thepen T. Downregulation of the antigen presenting cell function(s) of pulmonary dendritic cells in vivo by resident alveolar macrophages. The Journal of experimental medicine 1993;177(2):397-407. 64. Bilyk N, Holt PG. Inhibition of the immunosuppressive activity of resident pulmonary alveolar macrophages by granulocyte/macrophage colony-stimulating factor. The Journal of experimental medicine 1993;177(6):1773-1777. 65. Holmannova D, Kolackova M, Kondelkova K, Kunes P, Krejsek J, Andrys C. CD200/CD200R paired potent inhibitory molecules regulating immune and inflammatory responses; Part I: CD200/CD200R structure, activation, and function. Acta medica 2012;55(1):12-17. 66. Vaine CA, Soberman RJ. The CD200-CD200R1 Inhibitory Signaling Pathway: Immune Regulation and Host-Pathogen Interactions. Advances in immunology 2014;121:191-211. 67. Schutz F, Hackstein H. Identification of novel dendritic cell subset markers in human blood. Biochemical and biophysical research communications 2013. 68. Mukhopadhyay S, Pluddemann A, Hoe JC, Williams KJ, Varin A, Makepeace K, Aknin ML, Bowdish DM, Smale ST, Barclay AN, et al. Immune inhibitory ligand CD200 induction by TLRs and NLRs limits macrophage activation to protect the host from meningococcal septicemia. Cell host & microbe 2010;8(3):236-247. 69. Gorczynski RM. CD200:CD200R-Mediated Regulation of Immunity. ISRN Immunology 2012;2012:18. 70. Petermann KB, Rozenberg GI, Zedek D, Groben P, McKinnon K, Buehler C, Kim WY, Shields JM, Penland S, Bear JE, et al. CD200 is induced by ERK and is a potential therapeutic target in melanoma. The Journal of clinical investigation 2007;117(12):3922-3929. 71. Mihrshahi R, Barclay AN, Brown MH. Essential roles for Dok2 and RasGAP in CD200 receptor-mediated regulation of human myeloid cells. J Immunol 2009;183(8):4879-4886. 72. Zhang S, Cherwinski H, Sedgwick JD, Phillips JH. Molecular mechanisms of CD200 inhibition of mast cell activation. J Immunol 2004;173(11):6786-6793. 73. Pietila M, Lehtonen S, Tuovinen E, Lahteenmaki K, Laitinen S, Leskela HV, Natynki A, Pesala J, Nordstrom K, Lehenkari P. CD200 positive human mesenchymal stem cells suppress TNF-alpha secretion from CD200 receptor positive macrophage-like cells. PloS one 2012;7(2):e31671. 74. Jenmalm MC, Cherwinski H, Bowman EP, Phillips JH, Sedgwick JD. Regulation of myeloid cell function through the CD200 receptor. J Immunol 2006;176(1):191-199. 75. Hatherley D, Cherwinski HM, Moshref M, Barclay AN. Recombinant CD200 protein does not bind activating proteins closely related to CD200 receptor. J Immunol 2005;175(4):2469-2474. 76. Gorczynski R, Chen Z, Kai Y, Lee L, Wong S, Marsden PA. CD200 is a ligand for all members of the CD200R family of immunoregulatory molecules. J Immunol 2004;172(12):7744-7749. 77. Holmannova D, Kolackova M, Kondelkova K, Kunes P, Krejsek J, Ctirad A. CD200/CD200R paired potent inhibitory molecules regulating immune and
141
inflammatory responses; Part II: CD200/CD200R potential clinical applications. Acta medica 2012;55(2):59-65. 78. Simelyte E, Alzabin S, Boudakov I, Williams R. CD200R1 regulates the severity of arthritis but has minimal impact on the adaptive immune response. Clinical and experimental immunology 2010;162(1):163-168. 79. Rygiel TP, Rijkers ES, de Ruiter T, Stolte EH, van der Valk M, Rimmelzwaan GF, Boon L, van Loon AM, Coenjaerts FE, Hoek RM, et al. Lack of CD200 enhances pathological T cell responses during influenza infection. J Immunol 2009;183(3):1990-1996. 80. Aoki T, Matsumoto Y, Hirata K, Ochiai K, Okada M, Ichikawa K, Shibasaki M, Arinami T, Sumazaki R, Noguchi E. Expression profiling of genes related to asthma exacerbations. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2009;39(2):213-221. 81. Umetsu DT, Dekruyff RH. Immune dysregulation in asthma. Curr Opin Immunol 2006;18(6):727-732. 82. Lipscomb MF, Wilder JA. Immune dysregulation as a cause for allergic asthma. Curr Opin Pulm Med 1999;5(1):10-20. 83. ISAAC, TheUnion. The Global asthma report 2011. The International Union Agaisnt Tuberculosis and Lung Disease 2011(Paris, France). 84. Boulet LP, Dorval E, Labrecque M, Turgeon M, Montague T, Thivierge RL. Towards Excellence in Asthma Management: final report of an eight-year program aimed at reducing care gaps in asthma management in Quebec. Canadian respiratory journal : journal of the Canadian Thoracic Society 2008;15(6):302-310. 85. Braman SS. The global burden of asthma. Chest 2006;130(1 Suppl):4S-12S. 86. Masoli M, Fabian D, Holt S, Beasley R. The global burden of asthma: executive summary of the GINA Dissemination Committee report. Allergy 2004;59(5):469-478. 87. Bahadori K, Doyle-Waters MM, Marra C, Lynd L, Alasaly K, Swiston J, FitzGerald JM. Economic burden of asthma: a systematic review. BMC pulmonary medicine 2009;9:24. 88. Ismaila AS, Sayani AP, Marin M, Su Z. Clinical, economic, and humanistic burden of asthma in Canada: a systematic review. BMC pulmonary medicine 2013;13(1):70. 89. March ME, Sleiman PM, Hakonarson H. Genetic polymorphisms and associated susceptibility to asthma. International journal of general medicine 2013;6:253-265. 90. von Mutius E, Hartert T. Update in asthma 2012. American journal of respiratory and critical care medicine 2013;188(2):150-156. 91. Bosse Y, Hudson TJ. Toward a comprehensive set of asthma susceptibility genes. Annu Rev Med 2007;58:171-184. 92. Custovic A, Simpson A. What are we learning from genetic cohort studies? Paediatric respiratory reviews 2006;7 Suppl 1:S90-92. 93. von Mutius E. Gene-environment interactions in asthma. The Journal of allergy and clinical immunology 2009;123(1):3-11; quiz 12-13.
142
94. Holt PG, Sly PD. Non-atopic intrinsic asthma and the 'family tree' of chronic respiratory disease syndromes. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2009;39(6):807-811. 95. Gavala ML, Bashir H, Gern JE. Virus/allergen interactions in asthma. Curr Allergy Asthma Rep 2013;13(3):298-307. 96. Boulet LP, Becker A, Berube D, Beveridge R, Ernst P. Canadian Asthma Consensus Report, 1999. Canadian Asthma Consensus Group. CMAJ 1999;161(11 Suppl):S1-61. 97. O'Byrne PM. Global guidelines for asthma management: summary of the current status and future challenges. Polskie Archiwum Medycyny Wewnetrznej 2010;120(12):511-517. 98. Peters SP, Ferguson G, Deniz Y, Reisner C. Uncontrolled asthma: a review of the prevalence, disease burden and options for treatment. Respiratory medicine 2006;100(7):1139-1151. 99. van den Berge M, Arshad SH, Ind PW, Magnussen H, Hamelmann E, Kanniess F, Postma DS. Similar efficacy of ciclesonide versus prednisolone to treat asthma worsening after steroid tapering. Respiratory medicine 2009;103(8):1216-1223. 100. McIvor RA, Boulet LP, FitzGerald JM, Zimmerman S, Chapman KR. Asthma control in Canada: no improvement since we last looked in 1999. Can Fam Physician 2007;53(4):673-677, 672. 101. Moore WC, Meyers DA, Wenzel SE, Teague WG, Li H, Li X, D'Agostino R, Jr., Castro M, Curran-Everett D, Fitzpatrick AM, et al. Identification of asthma phenotypes using cluster analysis in the Severe Asthma Research Program. American journal of respiratory and critical care medicine 2010;181(4):315-323. 102. Wenzel SE. Asthma: defining of the persistent adult phenotypes. Lancet 2006;368(9537):804-813. 103. Holgate ST. Pathogenesis of asthma. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2008;38(6):872-897. 104. Wadsworth S, Sin D, Dorscheid D. Clinical update on the use of biomarkers of airway inflammation in the management of asthma. Journal of asthma and allergy 2011;4:77-86. 105. Vijverberg SJ, Hilvering B, Raaijmakers JA, Lammers JW, Maitland-van der Zee AH, Koenderman L. Clinical utility of asthma biomarkers: from bench to bedside. Biologics : targets & therapy 2013;7:199-210. 106. Szefler SJ, Wenzel S, Brown R, Erzurum SC, Fahy JV, Hamilton RG, Hunt JF, Kita H, Liu AH, Panettieri RA, Jr., et al. Asthma outcomes: biomarkers. The Journal of allergy and clinical immunology 2012;129(3 Suppl):S9-23. 107. Bousquet J, Jeffery PK, Busse WW, Johnson M, Vignola AM. Asthma. From bronchoconstriction to airways inflammation and remodeling. American journal of respiratory and critical care medicine 2000;161(5):1720-1745. 108. Global Initiative for Asthma (GINA). Global Strategy for Asthma Management and Prevention. 2008. 109. Wills-Karp M. Immunologic basis of antigen-induced airway hyperresponsiveness. Annu Rev Immunol 1999;17:255-281.
143
110. Naik SR, Wala SM. Inflammation, allergy and asthma, complex immune origin diseases: mechanisms and therapeutic agents. Recent patents on inflammation & allergy drug discovery 2013;7(1):62-95. 111. Smith H. Asthma, inflammation, eosinophils and bronchial hyperresponsiveness. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 1992;22(2):187-197. 112. van Rijt LS, Lambrecht BN. Dendritic cells in asthma: a function beyond sensitization. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2005;35(9):1125-1134. 113. Vermaelen KY, Carro-Muino I, Lambrecht BN, Pauwels RA. Specific migratory dendritic cells rapidly transport antigen from the airways to the thoracic lymph nodes. The Journal of experimental medicine 2001;193(1):51-60. 114. Charbonnier AS, Hammad H, Gosset P, Stewart GA, Alkan S, Tonnel AB, Pestel J. Der p 1-pulsed myeloid and plasmacytoid dendritic cells from house dust mite-sensitized allergic patients dysregulate the T cell response. Journal of leukocyte biology 2003;73(1):91-99. 115. Jahnsen FL, Strickland DH, Thomas JA, Tobagus IT, Napoli S, Zosky GR, Turner DJ, Sly PD, Stumbles PA, Holt PG. Accelerated antigen sampling and transport by airway mucosal dendritic cells following inhalation of a bacterial stimulus. J Immunol 2006;177(9):5861-5867. 116. Duez C, Gosset P, Tonnel AB. Dendritic cells and toll-like receptors in allergy and asthma. Eur J Dermatol 2006;16(1):12-16. 117. Murdoch JR, Lloyd CM. Chronic inflammation and asthma. Mutat Res 2010;690(1-2):24-39. 118. Pouliot P, Turmel V, Gelinas E, Laviolette M, Bissonnette EY. Interleukin-4 production by human alveolar macrophages. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2005;35(6):804-810. 119. Paul WE, Zhu J. How are T(H)2-type immune responses initiated and amplified? Nat Rev Immunol 2010;10(4):225-235. 120. Verstraelen S, Bloemen K, Nelissen I, Witters H, Schoeters G, Van Den Heuvel R. Cell types involved in allergic asthma and their use in in vitro models to assess respiratory sensitization. Toxicol In Vitro 2008;22(6):1419-1431. 121. Acharya M, Borland G, Edkins AL, Maclellan LM, Matheson J, Ozanne BW, Cushley W. CD23/FcepsilonRII: molecular multi-tasking. Clinical and experimental immunology 2010;162(1):12-23. 122. Kinet JP. The high-affinity IgE receptor (Fc epsilon RI): from physiology to pathology. Annu Rev Immunol 1999;17:931-972. 123. Cruse G, Cockerill S, Bradding P. IgE alone promotes human lung mast cell survival through the autocrine production of IL-6. BMC Immunol 2008;9:2. 124. Kalesnikoff J, Huber M, Lam V, Damen JE, Zhang J, Siraganian RP, Krystal G. Monomeric IgE stimulates signaling pathways in mast cells that lead to cytokine production and cell survival. Immunity 2001;14(6):801-811. 125. Lambrecht BN, Hammad H. Taking our breath away: dendritic cells in the pathogenesis of asthma. Nat Rev Immunol 2003;3(12):994-1003.
144
126. Bloemen K, Verstraelen S, Van Den Heuvel R, Witters H, Nelissen I, Schoeters G. The allergic cascade: review of the most important molecules in the asthmatic lung. Immunol Lett 2007;113(1):6-18. 127. Lewkowich IP, Lajoie S, Clark JR, Herman NS, Sproles AA, Wills-Karp M. Allergen uptake, activation, and IL-23 production by pulmonary myeloid DCs drives airway hyperresponsiveness in asthma-susceptible mice. PloS one 2008;3(12):e3879. 128. van Rijt LS, Jung S, Kleinjan A, Vos N, Willart M, Duez C, Hoogsteden HC, Lambrecht BN. In vivo depletion of lung CD11c+ dendritic cells during allergen challenge abrogates the characteristic features of asthma. The Journal of experimental medicine 2005;201(6):981-991. 129. Constant SL, Brogdon JL, Piggott DA, Herrick CA, Visintin I, Ruddle NH, Bottomly K. Resident lung antigen-presenting cells have the capacity to promote Th2 T cell differentiation in situ. The Journal of clinical investigation 2002;110(10):1441-1448. 130. Julia V, Hessel EM, Malherbe L, Glaichenhaus N, O'Garra A, Coffman RL. A restricted subset of dendritic cells captures airborne antigens and remains able to activate specific T cells long after antigen exposure. Immunity 2002;16(2):271-283. 131. Bratke K, Lommatzsch M, Julius P, Kuepper M, Kleine HD, Luttmann W, Christian Virchow J. Dendritic cell subsets in human bronchoalveolar lavage fluid after segmental allergen challenge. Thorax 2007;62(2):168-175. 132. Matsuda H, Suda T, Hashizume H, Yokomura K, Asada K, Suzuki K, Chida K, Nakamura H. Alteration of balance between myeloid dendritic cells and plasmacytoid dendritic cells in peripheral blood of patients with asthma. American journal of respiratory and critical care medicine 2002;166(8):1050-1054. 133. Venkayya R, Lam M, Willkom M, Grunig G, Corry DB, Erle DJ. The Th2 lymphocyte products IL-4 and IL-13 rapidly induce airway hyperresponsiveness through direct effects on resident airway cells. American journal of respiratory cell and molecular biology 2002;26(2):202-208. 134. Jin D, Zhang L, Zheng J, Zhao Y. The inflammatory Th 17 subset in immunity against self and non-self antigens. Autoimmunity 2008;41(2):154-162. 135. Bradley BL, Azzawi M, Jacobson M, Assoufi B, Collins JV, Irani AM, Schwartz LB, Durham SR, Jeffery PK, Kay AB. Eosinophils, T-lymphocytes, mast cells, neutrophils, and macrophages in bronchial biopsy specimens from atopic subjects with asthma: comparison with biopsy specimens from atopic subjects without asthma and normal control subjects and relationship to bronchial hyperresponsiveness. The Journal of allergy and clinical immunology 1991;88(4):661-674. 136. Wardlaw AJ, Dunnette S, Gleich GJ, Collins JV, Kay AB. Eosinophils and mast cells in bronchoalveolar lavage in subjects with mild asthma. Relationship to bronchial hyperreactivity. The American review of respiratory disease 1988;137(1):62-69. 137. Birrell MA, Battram CH, Woodman P, McCluskie K, Belvisi MG. Dissociation by steroids of eosinophilic inflammation from airway hyperresponsiveness in murine airways. Respiratory research 2003;4:3. 138. Careau E, Proulx LI, Pouliot P, Spahr A, Turmel V, Bissonnette EY. Antigen sensitization modulates alveolar macrophage functions in an asthma model.
145
American journal of physiology Lung cellular and molecular physiology 2006;290(5):L871-879. 139. Hamid Q, Tulic M. Immunobiology of asthma. Annu Rev Physiol 2009;71:489-507. 140. Kay AB. The role of eosinophils in the pathogenesis of asthma. Trends Mol Med 2005;11(4):148-152. 141. Lambrecht BN. Alveolar macrophage in the driver's seat. Immunity 2006;24(4):366-368. 142. Peters-Golden M. The alveolar macrophage: the forgotten cell in asthma. American journal of respiratory cell and molecular biology 2004;31(1):3-7. 143. Kim JY, Sohn JH, Choi JM, Lee JH, Hong CS, Lee JS, Park JW. Alveolar Macrophages Play a Key Role in Cockroach-Induced Allergic Inflammation via TNF-alpha Pathway. PloS one 2012;7(10):e47971. 144. Byers DE, Holtzman MJ. Alternatively activated macrophages and airway disease. Chest 2011;140(3):768-774. 145. Naessens T, Vander Beken S, Bogaert P, Van Rooijen N, Lienenklaus S, Weiss S, De Koker S, Grooten J. Innate imprinting of murine resident alveolar macrophages by allergic bronchial inflammation causes a switch from hypoinflammatory to hyperinflammatory reactivity. The American journal of pathology 2012;181(1):174-184. 146. Yang M, Kumar RK, Foster PS. Interferon-γ and pulmonary macrophages contribute to the mechanisms underlying prolonged airway hyperresponsiveness. Clinical & Experimental Allergy 2010;40(1):163-173. 147. Thepen T, Kraal G, Holt PG. The role of alveolar macrophages in regulation of lung inflammation. Annals of the New York Academy of Sciences 1994;725:200-206. 148. Thepen T, Van Rooijen N, Kraal G. Alveolar macrophage elimination in vivo is associated with an increase in pulmonary immune response in mice. The Journal of experimental medicine 1989;170(2):499-509. 149. Tang C, Inman MD, van Rooijen N, Yang P, Shen H, Matsumoto K, O'Byrne PM. Th type 1-stimulating activity of lung macrophages inhibits Th2-mediated allergic airway inflammation by an IFN-gamma-dependent mechanism. J Immunol 2001;166(3):1471-1481. 150. Kurowska-Stolarska M, Stolarski B, Kewin P, Murphy G, Corrigan CJ, Ying S, Pitman N, Mirchandani A, Rana B, van Rooijen N, et al. IL-33 amplifies the polarization of alternatively activated macrophages that contribute to airway inflammation. J Immunol 2009;183(10):6469-6477. 151. Pouliot P, Spahr A, Careau E, Turmel V, Bissonnette EY. Alveolar macrophages from allergic lungs are not committed to a pro-allergic response and can reduce airway hyperresponsiveness following ex vivo culture. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2008;38(3):529-538. 152. Zosky GR, Sly PD. Animal models of asthma. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 2007;37(7):973-988. 153. Shin YS, Takeda K, Gelfand EW. Understanding asthma using animal models. Allergy, asthma & immunology research 2009;1(1):10-18.
146
154. Mullane K, Williams M. Animal models of asthma: Reprise or reboot? Biochemical pharmacology 2013. 155. Laberge S, Rossi P, Yang XX, Martin JG. Antigen-induced airway inflammation and hyper-responsiveness does not enhance airway responses to a subsequent antigen challenge in rats. Respiratory medicine 2000;94(1):44-50. 156. Martin JG, Tamaoka M. Rat models of asthma and chronic obstructive lung disease. Pulmonary pharmacology & therapeutics 2006;19(6):377-385. 157. Sapienza S, Du T, Eidelman DH, Wang NS, Martin JG. Structural changes in the airways of sensitized brown Norway rats after antigen challenge. The American review of respiratory disease 1991;144(2):423-427. 158. Strickland DH, Stumbles PA, Zosky GR, Subrata LS, Thomas JA, Turner DJ, Sly PD, Holt PG. Reversal of airway hyperresponsiveness by induction of airway mucosal CD4+CD25+ regulatory T cells. The Journal of experimental medicine 2006;203(12):2649-2660. 159. Thepen T, McMenamin C, Oliver J, Kraal G, Holt PG. Regulation of immune response to inhaled antigen by alveolar macrophages: differential effects of in vivo alveolar macrophage elimination on the induction of tolerance vs. immunity. European journal of immunology 1991;21(11):2845-2850. 160. Plantinga M, Guilliams M, Vanheerswynghels M, Deswarte K, Branco-Madeira F, Toussaint W, Vanhoutte L, Neyt K, Killeen N, Malissen B, et al. Conventional and Monocyte-Derived CD11b(+) Dendritic Cells Initiate and Maintain T Helper 2 Cell-Mediated Immunity to House Dust Mite Allergen. Immunity 2013;38(2):322-335. 161. Strickland DH, Thomas JA, Mok D, Blank F, McKenna KL, Larcombe AN, Sly PD, Holt PG. Defective aeroallergen surveillance by airway mucosal dendritic cells as a determinant of risk for persistent airways hyper-responsiveness in experimental asthma. Mucosal immunology 2012;5(3):332-341. 162. Fattouh R, Al-Garawi A, Fattouh M, Arias K, Walker TD, Goncharova S, Coyle AJ, Humbles AA, Jordana M. Eosinophils are dispensable for allergic remodeling and immunity in a model of house dust mite-induced airway disease. American journal of respiratory and critical care medicine 2011;183(2):179-188. 163. Mattoli S, Stacey MA, Sun G, Bellini A, Marini M. Eotaxin expression and eosinophilic inflammation in asthma. Biochemical and biophysical research communications 1997;236(2):299-301. 164. Ying S, Robinson DS, Meng Q, Rottman J, Kennedy R, Ringler DJ, Mackay CR, Daugherty BL, Springer MS, Durham SR, et al. Enhanced expression of eotaxin and CCR3 mRNA and protein in atopic asthma. Association with airway hyperresponsiveness and predominant co-localization of eotaxin mRNA to bronchial epithelial and endothelial cells. European journal of immunology 1997;27(12):3507-3516. 165. Lloyd C. Chemokines in allergic lung inflammation. Immunology 2002;105(2):144-154. 166. Bedoret D, Wallemacq H, Marichal T, Desmet C, Quesada Calvo F, Henry E, Closset R, Dewals B, Thielen C, Gustin P, et al. Lung interstitial macrophages alter dendritic cell functions to prevent airway allergy in mice. The Journal of clinical investigation 2009;119(12):3723-3738.
147
167. Stampfli MR, Wiley RE, Neigh GS, Gajewska BU, Lei XF, Snider DP, Xing Z, Jordana M. GM-CSF transgene expression in the airway allows aerosolized ovalbumin to induce allergic sensitization in mice. The Journal of clinical investigation 1998;102(9):1704-1714. 168. Carralot JP, Kim TK, Lenseigne B, Boese AS, Sommer P, Genovesio A, Brodin P. Automated high-throughput siRNA transfection in raw 264.7 macrophages: a case study for optimization procedure. Journal of biomolecular screening 2009;14(2):151-160. 169. Rozema DB, Lewis DL. siRNA delivery technologies for mammalian systems. TARGETS 2003;2(6):253-260.
