microRNAs regulate β-catenin of the Wnt signaling pathway ...€¦ · microRNAs regulate β-catenin of the Wnt signaling pathway in early sea urchin development Nadezda Stepichevaa,

microRNAs regulate β-catenin of the Wnt signaling pathway in earlysea urchin development

Nadezda Stepicheva a, Priya A. Nigam a, Archana D. Siddam a, Chieh Fu Peng b,1,Jia L. Song a,n

a Department of Biological Sciences, University of Delaware, 323 Wolf Hall, Newark, DE 19716, USAb Department of Biology, University of Miami, Coral Gables, FL 33124, USA

a r t i c l e i n f o

Article history:Received 5 March 2014Received in revised form18 December 2014Accepted 9 January 2015

Keywords:EndodermMesodermLarval gutCircumesophageal musclesPMCsSea urchinTarget protectorsPost-transcriptional regulation

a b s t r a c t

Development of complex multicellular organisms requires careful regulation at both transcriptional andpost-transcriptional levels. Post-transcriptional gene regulation is in part mediated by a class of non-coding RNAs of 21–25 nucleotides in length known as microRNAs (miRNAs). β-catenin, regulated by thecanonical Wnt signaling pathway, has a highly evolutionarily conserved function in patterning earlymetazoan embryos, in forming the Anterior–Posterior axis, and in establishing the endomesoderm.Using reporter constructs and site-directed mutagenesis, we identified at least three miRNA binding siteswithin the 30 untranslated region (30UTR) of the sea urchin β-catenin. Further, blocking these threemiRNA binding sites within the β-catenin 30UTR to prevent regulation of endogenous β-catenin bymiRNAs resulted in a minor increase in β-catenin protein accumulation that is sufficient to induceaberrant gut morphology and circumesophageal musculature. These phenotypes are likely the result ofincreased transcript levels of Wnt responsive endomesodermal regulatory genes. This study demon-strates the importance of miRNA regulation of β-catenin in early development.

& 2015 Elsevier Inc. All rights reserved.

Introduction

β-catenin, the key effector molecule of the canonical Wnt pathway,has a highly conserved function in regulating cell proliferation,differentiation and fate decisions (Komiya and Habas, 2008; Moon,2005). Aberrant Wnt signaling has been associated with many humandiseases, including cancer, skeletal disorders, neuronal diseases, andcardiovascular diseases (Anastas and Moon, 2013; Clevers, 2006;Clevers and Nusse, 2012; Kim et al., 2013; MacDonald et al., 2009;Moon et al., 2004). In the absence of a Wnt ligand, β-catenin isphosphorylated at several N-terminal serine and threonine residues bycasein kinase I and Glycogen Synthase Kinase 3β (GSK3β). Phosphor-ylation of β-catenin occurs in a multiprotein complex composed ofGSK3β, a scaffolding protein Axin, and the tumor suppressor geneproduct Adenomatous Polyposis Coli protein (APC). Phosphorylationby GSK3β leads to the ubiquitination and proteasome-mediateddegradation of β-catenin. Upon binding of the Wnt ligand to theFrizzled and LRP5/6 receptors, activated Disheveled (Dvl) recruits Axinto cell membrane leading to the disassembly of the destruction

complex and inhibition of the degradation of β-catenin (Logan andNusse, 2004). Increased cytoplasmic levels of β-catenin leads to itsaccumulation in the nucleus, where β-catenin interacts with TCF/LEFtranscription factors and activates the transcription of target genesthat mediate body plan determination, tissue patterning, and endo-derm specification (Komiya and Habas, 2008; Moon, 2005; Peter andDavidson, 2010).

In addition to its essential role as a transcription coactivator, β-catenin is also a central structural component of the Cadherin/Catenin adhesion complex (Aberle et al., 1996; Nelson and Nusse,2004). The Cadherin/Catenin-based adhesion system is the majormechanism by which cells adhere to one another. The abundanceof β-catenin in the adhesion complex at the plasma membraneaffects its accumulation and function with the signaling complexin the nucleus. This is demonstrated with experiments in whichperturbation of cadherin complexes has an effect on Wnt/β-catenin regulated processes. For example, overexpression ofcadherins in Xenopus embryos inhibited dorsal axis formationwhich is known to be dependent on canonical Wnt signaling(Heasman et al., 1994). E-cadherin knockout embryonic stem cellsshowed accumulation of β-catenin/Lef1 in the nucleus and activa-tion of a Wnt reporter, which could be reversed by expression of E-cadherin (Orsulic et al., 1999).

Contents lists available at ScienceDirect

journal homepage: www.elsevier.com/locate/developmentalbiology

Developmental Biology

http://dx.doi.org/10.1016/j.ydbio.2015.01.0080012-1606/& 2015 Elsevier Inc. All rights reserved.

n Corresponding author. Fax: þ1 302 831 2281.E-mail address: [email protected] (J.L. Song).

1 Current address: Institute of Cellular and Organismic Biology, Academia Sinica,Taiwan, ROC.

Please cite this article as: Stepicheva, N., et al., microRNAs regulate β-catenin of the Wnt signaling pathway in early seaurchin development. Dev. Biol. (2015), http://dx.doi.org/10.1016/j.ydbio.2015.01.008i

Developmental Biology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

www.sciencedirect.com/science/journal/00121606

www.elsevier.com/locate/developmentalbiology

http://dx.doi.org/10.1016/j.ydbio.2015.01.008



mailto:[email protected]





The initial regionalization of β-catenin in the early embryocontributes to polarity establishment, patterning, and germ layerspecification (Logan et al., 1999; Petersen and Reddien, 2009). Innumerous deuterostome embryos, including amphibians, fish,chicks, ascidians and sea urchins, β-catenin becomes localized inthe nuclei of blastomeres at one pole of the cleavage stage embryo(Imai et al., 2000; Larabell et al., 1997; Logan et al., 1999; Roeseret al., 1999; Rowning et al., 1997; Schneider et al., 1996). In general,the pole of the embryo in which β-catenin is detected in thenucleus gives rise to endodermal and mesodermal tissues. Similarto many deuterostomes, the sea urchin β-catenin is required forthe specification of the endoderm and mesoderm. (Logan et al.,1999; Wikramanayake et al., 1998). Overexpression of proteinsthat interfere with nuclear localization and/or function of β-catenin such as cadherins, GSK3β, and dominant forms of TCF/LEF, lead to embryos with excess ectodermal tissues and a lack ofmesenchyme cells and gut (Emily-Fenouil et al., 1998; Logan et al.,1999; Vonica et al., 2000; Wikramanayake et al., 1998). Conversely,overexpression of β-catenin leads to embryos deprived of ecto-dermal tissue, consisting of mainly endodermal and mesodermalderivatives (Wikramanayake et al., 1998).

While the Wnt signaling pathway has been examined in the seaurchin (Emily-Fenouil et al., 1998; Logan et al., 1999; Vonica et al.,2000; Wikramanayake et al., 1998), the regulatory roles of micro-RNAs (miRNAs) in this developmental pathway have not beenexamined. miRNAs are a relatively novel class of 22-bp non-codingRNA molecules that fine tune gene expression by pairing to the 30

untranslated region (30UTR) of protein coding mRNAs to represstheir translation and/or induce mRNA degradation (Bartel, 2004;Rajewsky, 2006). They are pivotal regulators of nearly all biologicalprocesses, including cell fate specification and differentiation(Bartel, 2004; Mukherji et al., 2011).

The vast majority of miRNAs are transcribed by RNA polymer-ase II and initially processed by the enzyme Drosha and itscofactor DGCR8 into stem-loop structures which get transportedout from the animal nucleus to the cytoplasm (Lee et al., 2003).This stem-loop precursor is further processed into mature miRNAsby the riboendonuclease Dicer. The mature miRNA is loaded ontothe RNA Induced Silencing Complex (RISC) and used as a guide todirect the binding of miRNA 50 seed (nucleotides 2–8) and anchornucleotides to the 30UTR of target mRNAs to mediate translationalsilencing and promote targeted mRNA degradation (Baek et al.,2008; Bartel, 2009; Ghildiyal and Zamore, 2009; Guo et al., 2010;Hendrickson et al., 2009; Liu, 2008; Selbach et al., 2008). Theregulatory role of miRNAs in early development was demonstratedby deleting or knocking down Dicer, an essential enzyme inmiRNA processing, which causes either developmental defects orembryonic lethality in many animal systems (Bernstein et al.,2003; Giraldez et al., 2005; Saurat et al., 2013; Song et al., 2012).

Our laboratory has previously demonstrated that knockdownsof key enzymes in the miRNA biogenesis pathway in the sea urchinembryos lead to gastrulation failure and embryonic lethality (Songet al., 2012). Dicer knockdown embryos at the gastrula stageexpress significantly reduced endodermal and mesodermal anti-gens, suggesting a failure to properly specify these cell types. Thiscurrent study tests the hypothesis that the highly conservedcanonical Wnt/β-catenin pathway which is required for endome-sodermal specification is regulated by miRNAs and may in partcontribute to the previous Dicer knockdown phenotype. Thestrength of our study is to test miRNA regulation of β-catenin inthe context of a developing embryo at the systems level. Ourresults indicate that β-catenin is post-transcriptionally regulatedby at least two miRNAs at three binding sites. Removal of miRNAregulation using miRNA target protector morpholinos (miRNA TPs)specific to the β-catenin 30UTR resulted in a minor increase of theβ-catenin protein level that led to aberrant gut morphology,

endodermal differentiation, and less developed circumpharyngealmusculature. Further, at the molecular level, a greater than 2-foldincrease of Wnt responsive gene transcript levels, includingendodermal regulatory genes Krl (Howard et al., 2001), FoxA (de-Leon and Davidson, 2010; Oliveri et al., 2006), Eve (Peter andDavidson, 2010, 2011), Wnt8 (Wikramanayake et al., 2004), Bra(Gross and McClay, 2001), and ectodermal regulatory gene Nodal(Duboc et al., 2010; Yaguchi et al., 2008) was observed in β-cateninmiRNA TP-treated embryos. These results demonstrate the impor-tance of miRNA regulation on β-catenin in early development.

Materials and methods

Animals

Adult Strongylocentrotus purpuratus were obtained from Cali-fornia (Point Loma Marine Company) and cultured in an aquarium(Marineland, Moonpark, CA) with artificial sea water (InstantOcean). Gametes were obtained by intracoelomic injection of0.5 M KCl and embryos were cultured at 15 1C in filtered naturalsea water collected from the Indian River Inlet; University ofDelaware Lewes campus.

Microinjections

Control morpholino antisense oligonucleotides (MASO) 50

CCTCTTACCTCAGTTACAATTTATA 30, dicer MASO 50 GGACTC-GATGGTGGCTCATCCATTC 30 (Song et al., 2012), and miRNA targetprotector MASOs (miRNA TPs) were ordered from GeneTools(Philomath, OR). 1.5 mM of Dicer MASO stock injection solutionwas used. Three miRNA TPs were designed to protect onemiRDeep2-30364-35240 binding site and two miR-2007 bindingsites from respective miRNA binding to the β-catenin 30UTR. Themorpholino that blocks miR-2007 at position þ922 bp is 50

CTATTTCAGATATAATCTTGACGAG 30; the morpholino that blocksmiR-2007 at position þ2647 bp is 50 TTATTTCAGACATGAAAAATG-GAAG 30 and the morpholino that blocks miRDeep2-30364-35240is 50 TTATTGCACCTTTTTAAGAGGCATC 30. These miRNA targetprotectors were diluted to various stock injection solutions(3 nM to 3 mM). The estimated injected miRNA TPs were thefollowing: from the 30 mM stock of injection solution, approxi-mately 35 attomoles (35�10–18) was injected. From the 300 mMstock of injection solution, approximately 350 attomoles(350�10–18) was injected. The injected negative control morpho-lino contained the same molar concentration as the correspondingsum of injected miRNA TPs. 300 mM stock of each of the β-cateninmiRNA TPs were used in all real time, quantitative PCR, dualluciferase, Western blotting and phenotyping experiments.

Microinjections were performed as previously described withmodifications (Cheers and Ettensohn, 2004; Song et al., 2012;Stepicheva and Song, 2014). MASO oligonucleotides were resus-pended in sterile water and heated for 10 min at 60 1C prior to use.Injection solutions contained 20% sterile glycerol, 2 mg/ml10,000 MW Texas Red lysine charged dextran (Molecular Probes,Carlsbad, CA, USA) and various concentrations of MASO. Approxi-mately 1–2 pl were injected into each newly fertilized egg. Eggsfrom S. purpuratus were collected and dejellied in acidic sea water(pH 5.15) for 10 min on ice, followed by two sea water washes.Dejellied eggs were rowed onto 60�15 mm Petri dishes that werepreviously coated with protamine sulfate (1% w/v). Eggs werefertilized with sperm in the presence of 1 mM 3-amino-1,2,4triazole (Sigma, St. Louis, MO). Injections were performed usingthe Femto Jet injection system (Eppendorf; Hamberg, Germany)(Stepicheva and Song, 2014). A vertical needle puller PL-10(Narishige, Tokyo, Japan) was used to pull the injection needles

N. Stepicheva et al. / Developmental Biology ∎ (∎∎∎∎) ∎∎∎–∎∎∎2





(1�90 mm glass capillaries with filaments) (Narashige; Tokyo,Japan).

Preparation of anti-β-catenin polyclonal antibodies

To investigate the level of the β-catenin protein, two affinity-purified anti-β-catenin polyclonal rabbit antibodies, β-catenin1 andβ-catenin55, were made against two short sequences (NH2-CYKKRISVELGNSLFRGDS-COOH) and (NH2-CHSLHSNHGEYRQPPPT-COOH) of the S. purpuratus β-catenin protein. Antibodies weregenerated by Bethyl Labs (Montgomery, TX). To test the specificityof the antibodies, a preabsorption assay was performed by incubat-ing the antibody with the peptide (provided by Bethyl labs) at a 10fold molar excess for one hour at room temperature prior toincubating with the samples for Western blot analysis (Fig. S2).30 mg of 32-cell embryonic extracts were loaded on to the SDS-PAGEgel. The S. purpuratus β-catenin protein is predicted to be 825 aminoacids in length, and the molecular size is estimated to be approxi-mately 90 kDa.

Real time, quantitative PCR (qPCR)

For Dicer morpholino, control morpholino, or β-catenin miRNATP experiments (stock of injection solution at 300 mM for eachmiRNA TP), 80–100 injected embryos were used. 200 uninjectedembryos were collected at various time points to determinetranscript levels of endonenous β-catenin throughout develop-ment. Total RNA was extracted using Qiagen microRNeasy kitaccording to manufacturer's instructions (Qiagen Inc., Valencia,CA, USA). cDNA was synthesized using TaqMan Reverse Transcrip-tion Reagents kit (Invitrogen, Carlsbald, CA, USA). qPCR wasperformed using 2.5 embryo equivalent for each reaction withthe Applied Biosystem power SYBER Green PCR Master Mix(Invitrogen) in the 7300 Real-Time PCR cycler system. Resultswere normalized to the mRNA expression of the housekeepinggene ubiquitin and shown as fold changes compared to controlembryos that were injected with the control morpholino using theΔΔCt method. The estimated numbers of β-catenin transcripts arecalculated based on the level of ubiquitin in various developmen-tal stages described previously (Materna and Davidson, 2012;Materna and Oliveri, 2008). Three to five biological replicates wereconducted. Primers used for qPCR analysis are listed in Table S1.

Western blotting

200 embryos injected with control MASO and miRNA TPs werepelleted by spinning them down at 15,000 RPM for 30 s andresuspended in 15 μl of 4� sample buffer (1 mM Tris–HCl, 0.1 mMsucrose, 4% SDS and 10 mM EDTA) prior to heating at 100 1C for10 min. Samples were stored at �80 1C until later use. 1 mM DTTwas added to the protein sample and heated at 100 1C for 10 minbefore loading samples onto Tris–Glycine 4–20% gradient gel (Bio-Rad, Hercules, CA). The proteins were electrophoresed at 120 V for1 h in Tris–glycine electrophoresis buffer (25 mM Tris, 250 mMglycine at pH 8.3, 0.1% SDS). Proteins were transferred ontonitrocellulose membranes (Pall Corporation, Pensacola, FL) using250 AMP for 2 h at 4 1C. Membranes were blocked with Blotto(0.05 mM Tris at pH 7.5, 0.18 M NaCl, 3% dry milk and 0.05% Tween20) for 2 h at RT or overnight at 4 1C and then incubated with β-catenin55 antibody at 1:250 in Blotto overnight at 4 1C, followedby three TBST (0.05 M Tris, 0.18 M NaCl, 0.05% Tween) washes. Theblot was incubated with secondary antibody goat anti-rabbit HRP(Jackson Immuno Research, West Grove, PA) diluted to 1:3000 inBlotto for 45 min at RT. The blots were washed 3 times with TBSTand signals were detected using SuperSignal West Femto Max-imum Sensitivity Substrate (Thermo Scientific, Rockford, IL)

according to the manufacturer's instructions. Blots were treatedwith Restore™ Western blot Stripping Buffer (Thermo Scientific,Rockford, IL) according to manufacturer's instructions andreprobed with the rabbit polyclonal actin antibody (Sigma-Aldrich,St. Louis, MO). Images were acquired with Fluorchem (TM) Qimaging system (Proteinsimple, Santa Clara, CA). Quantification ofbands was conducted using the Alpha view–FluorChem QSA,version 3.2.2.0.

Cloning of the reporter constructs

In order to test post-transcriptional regulation of β-catenin bymiRNAs and miRNA TPs, its 30UTR was cloned downstream of GFPcoding sequence (in pGEMT vector background) and Renilla lucifer-ase from psiCHECK vector (Promega, Madison, WI). The mCherrycoding region was cloned into the pSP6T4 vector flanked withXenopus β-globin UTRs (Gustafson and Wessel, 2010). Primers weredesigned using the Primer 3 program (Rozen and Skaletsky, 2000).Primers used for β-catenin 30UTR cloning are: Forward, 50 AACGCTC-GAGATCCAGATGTACCAAGCCAA 30 and Reverse 50 GGCACTAGTAG-GAACTACAAGAAAGTCTC 30. Restriction sites used for subcloning areunderlined. PCR products were purified with PromegaWizard SVgeland PCR cleanup kit (Promega, Madison, WI) prior to ligation. Theligated products were cloned into PCRII cloning kit dual promoter(Invitrogen, Carlsbad, CA) and transformed into DH5-α cells (Invi-trogen, Carlsbald, CA). β-catenin 30UTR positive clones (in pCRII)were sequenced (Genewiz, Inc., South Plainfield, NJ) and subcloneddownstream of eGFP coding region into a pGEMT vector backbone.Renilla luciferase was subcloned into the pGEMT vector to replacethe eGFP coding sequence. Firefly luciferase from psiCHECK vectorwas PCR amplified with primers Forward 50 GCATAGATCTATGGCCGATGCTAAGAACATT 30 and Reverse 50 ATAGCTCGAGATACCACATTTGTAGAGGTTTTA 30 with restriction enzyme sites underlined,and cloned into the pSP6T4 flanked by the Xenopus β-globin 30UTRs.Positive clones were sequenced to confirm cloning of the β-catenin30UTR downstream of the eGFP or Renilla luciferase reporters andthe Firefly luciferase construct in pSP6T4 (Genewiz, Inc., SouthPlainfield, NJ).

Site-directed mutagenesis

The miR-2007 seed sequence was identified to have twobinding sites within the β-catenin 30UTR. The miRDeep2-30364-35240 seed sequence was identified to have one binding sitewithin the β-catenin 30UTR. All seed sequences were mutated atpositions 3 and 5 within the miRNA seed sequence (Gregory et al.,2008). miR-2007 seed sequence 50 CTGAAAT 30 was modified to 50

CTCACAT 30, and miRDeep2-30364-35240 was modified from 50

GTGCAAT 30 to 50 GTCCTAT 30. Modified bases are underlined.Mutageneic primers were designed according to the primer

design program at www.agilent.com/genomics/qcpd. All mutationswere generated using the QuikChange Lightning kit according tomanufacturer’s instructions (Agilent Technologies, Santa Clara, CA).Primer sequences used for site-directed mutagenesis for miR-2007at position þ922 are 50 CAGGCCTCGTCAAGATTATATCTCACATAGA-TATCTCATGATTGGCTAC 30 and 50 GTAGCCAATCATGAGATATCTATGT-GAGATATAATCTTGACGAGGCCTG 30. The second set of primers formiR-2007 at position þ2647 (Fig. 2A) are 50 AATCTAAGCTACTTC-CATTTTTCATGTCTTAGATAAACTGAATACATTCTTTTAAGATTG 30 and 50

GCAATCTTAAAAGAATGTATTCAGTTTATCTAAGACATGAAAAATGGAA-GTAGCTTAGAT 30. The primers used for miRDeep2-30364-35240 are50 GCATATTGATGCCTCTTAAAAAGGTCCTATAAAGAGTACAATATGCAA-CAATC 30 and 50 GATTGTTGCATATTGTACTCTTTATAGGACCTTTTTAA-GAGGCATCAATATGC 30. Altered seed sequences are underlined.Positive clones were sequenced to validate the fidelity of themutagenesis (Genewiz, South Plainfield, NJ).

N. Stepicheva et al. / Developmental Biology ∎ (∎∎∎∎) ∎∎∎–∎∎∎ 3





In vitro transcription

All reporter constructs were linearized prior to in vitro tran-scription. mCherry was linearized with Sal1 enzyme; β-catenineGFP, Renilla luciferase and Firefly luciferase reporter constructswere linearized with Spe1 enzyme (Promega, Madison, WI).Linearized reporter constructs were in vitro transcribed usingmMessage machine kit (Invitrogen, Carlsbad, CA). The T7 RNApolymerase was used for generating the Renilla luciferase β-catenin mRNAs, and the Sp6 RNA polymerase was used forgenerating the Firefly luciferase and mCherry mRNAs accordingto the manufacturer’s instructions. mRNAs were purified by usingQiagen microRNeasy kit according to manufacturer’s instructions(Qiagen Inc., Valencia, CA) and purified mRNAs were loaded ontothe Millipore spin columns for further clean up (Millipore, Bill-erica, MA). For luciferase assays, the 2.5 ml of injection solutioncontained 100–500 ng of Renilla luciferase and 150 ng of Fireflyluciferase mRNA.

Quantitative microscopy analysis of GFP and mCherry signals

To test if miRNA TPs bind to the three functional miRNA siteswithin the β-catenin 30UTR, we tested the level of translated eGFPin the presence of all three β-catenin miRNA TPs. Injected embryoswere first treated with 2� sea water for 2 min to induce atemporary shedding of the cilia to immobilize the swimmingembryos (Ettensohn et al., 2004). They were washed with 1�sea water twice and imaged with Zeiss Observer Z1 microscope(Carl Zeiss Incorporation, Thorwood, NY) as living embryos at lowmagnification (total magnification at 100� ) to maximally capturefluorescent pixels. The imaging settings were determined with allsets of embryos prior to image acquisition to ensure that thesetting captures the GFP and the mCherry fluorescence within thelinear range. All embryos within an experiment were imagedunder the exact same conditions. The GFP and mCherry fluores-cence signals were quantified using Zeiss software (Axio vision SE64 Rel.4.8). The GFP signal in each embryo was normalized to themCherry signal to account for injection volume differences.Unpaired Student t-test was used to determine statistical signifi-cance (Fig. S1).

Dual luciferase quantitation

Dual luciferase quantitation was performed using the Pro-mega™ Dual-Luciferase™ Reporter (DLR™) Assay Systems withthe Promega™ GloMax™ 20/20 Luminometry System (Promega,Madision, WI). 50 embryos at the mesenchyme blastula stage(24 hours post fertilization; hpf) were collected in 22 ml of 1�Promega passive lysis buffer and vortexed for at least 5 min.Embryonic lysates were either stored at �80 1C or processedimmediately. Prior to luciferase readings, 100 ml of the LuciferaseActivating Reagent II (LAR-II) was added to the 96-well plate (BDFalcon, Franklin Lakes, NJ). 20 ml of the embryonic lysates was thenadded to the corresponding wells and luciferase reading for theFirefly was obtained. 100 ml of the Stop and Glow solution wasadded into the 96-well plate to quench Firefly luciferase while theRenilla luciferase readings were obtained.

Immunofluorescence

For Endo1 and 1D5 immunolabeling, embryos were fixed in 4%paraformaldehyde (16% stock; EMS, Hatfield, PA) in artificial seawater for 10 min at room temperature. Four 10 min PhosphateBuffered Saline-Tween (PBST) washes were performed. For myosinimmunolabeling, embryos were fixed in 100% methanol at �20 1Cfor 30 min, followed by PBST washes. Embryos were blocked with

4% sheep serum (Sigma Aldrich, St. Louis, MO) for 1 h at roomtemperature. Primary antibody incubation was performed withEndo1 antibody (Wessel and McClay, 1985) at 1:200, 1D5 antibodyat 1:50 and myosin heavy chain antibody (Wessel et al., 1990) at1:100 overnight at 4 1C. Embryos were washed three times 15 minwith PBST followed by goat anti-mouse Alexa 488 or goat anti-rabbit Alexa 488 conjugated secondary antibody at 1:300 (Invitro-gen, Carlsbad, CA). Immunolabeled embryos were imaged using aZeiss LSM 780 scanning confocal microscope (Carl Zeiss Incorpora-tion, Thorwood, NY) and data were obtained and analyzed usingthe Zen software (Carl Zeiss Incorporation, Thorwood, NY).

Detection of endogenous alkaline phosphatase

The endogenous alkaline phosphatase was used to assay fordifferentiated endoderm of the larvae (Annunziata et al., 2013;Drawbridge, 2003; Hinman and Degnan, 1998; Kumano andNishida, 1998; Nishida and Kumano, 1997; Whittaker, 1990).Three-day-old larvae were fixed in MOPS–paraformaldehydebased fixative (4% paraformaldehyde, 100 mM MOPS pH 7.0,2 mM MgSO4, 1 mM EGTA, and 0.8 M NaCl) for 10 min at roomtemperature. Embryos were washed with alkaline phosphatasebuffer three times (100 mM Tris pH 9.5, 100 mM NaCl, 50 mMMgCl2, 0.1% Tween-20), followed by staining until desired colordevelopment with the staining solution (0.1 M Tris pH 9.5, 50 mMMgCl2, 0.1 M NaCl, 1 mM Levamisole, 10% Dimethylformamide,45 ml of 75 mg/mL NBT and 35 ml of 50 mg/mL BCIP per 10 ml ofsolution). The staining step was stopped with washes with MOPSbuffer (0.1 M MOPS pH 7.0, 0.5 M NaCl, and 0.1% Tween-20).Images were acquired with Nikon D90 digital camera connectedto a Zeiss Observer Z1 microscope.

Whole mount in situ hybridization

β-catenin, Krl, Blimp1b and FoxA were PCR-amplified from seaurchin embryonic cDNA. PCR primers used to clone the RNAprobes are listed in Table S1. Krl probe was made directly fromthe PCR product; Blimp1b, FoxA and β-catenin were cloned intoBlunt-TOPO, PGEMT and PCRII vectors, respectively. The plasmidscontaining β-catenin, Blimp1b, FoxA were linearized with Not1,EcoR1 and Pst1, respectively (Promega, Madison, WI). Antisenseprobes were labeled with digoxigenin with the DIG RNA LabelingKit (Roche Diagnostics Corporation, Indianapolis, IN, USA). 0.1 mgprobe/mL was used to detect native transcript in embryos accord-ing to previously published protocols (Minokawa et al., 2004).

Results

β-catenin transcripts are destabilized by miRNAs

To determine if β-catenin was potentially regulated by miRNAs,we examined its transcript levels in control morpholino (MASO)and Dicer MASO-injected embryos with real time, quantitative PCR(qPCR). Newly fertilized eggs were microinjected with Dicer MASOto perturb the miRNA biogenesis pathway, leading to globalmiRNA depletion (Song et al., 2012). Embryos were collected atthe 32-cell stage (5–6 hpf), early blastula (15 hpf), and mesench-yme blastula (24 hpf) stages. Transcript levels of β-catenin at allstages were increased in Dicer knockdown embryos (Fig. 1A). Atthe mesenchyme blastula stage, β-catenin transcript level wassignificantly increased (Fig. 1A), suggesting that miRNAs regulateβ-catenin mRNA stability at 24 hpf.

We tested the possibility that miRNAs may play a role in thepost-transcriptional regulation of β-catenin by analyzing the 30UTRof β-catenin for potential miRNA regulatory sites. The miRNA






prediction tools that perform best according to high-throughputvalidation all scan 30UTRs for short motifs complementary to themiRNA seed sequences (Baek et al., 2008; Selbach et al., 2008).However, current miRNA prediction programs such as PicTar andTargetScan rely heavily on conservation information, which is notyet available for the S. purpuratus genome. Therefore, the best tool

we have now is to search for 100% miRNA seed matches within30UTRs. We searched for 100% miRNA seed matches within the30UTR of β-catenin and found that of the 16 bioinformaticallyidentified miRNA predicted sites, only spu-miRDeep2-30364-35240 and spu-miR-2007 have greater than 1000 normalized deepsequence reads during early developmental stages of the seaurchin (Table S2) (Song et al., 2012).

Next, we examined the mRNA expression profile of endogenousβ-catenin and their potential miRNA regulators, spu-miRDeep2-30364-35240 and spu-miR-2007, at various developmental stages.Results indicate that the levels of β-catenin mRNA changes overtime throughout development (Fig. 1B). The level of β-cateninmRNA peaks at early blastula stage (15 hpf), followed by adecrease at the mesenchyme blastula stage (24 hpf) and stabiliza-tion from the gastrula to larval stages. Coinciding with thisdecrease and stabilization of β-catenin mRNA from 24 hpf to larvalstages, spu-miRDeep2-30364-35240 and spu-miR-2007 haveincreased sequence reads from 24 hpf to the larval stage (Fig. 1B)(Song et al., 2012). This inverse expression pattern of β-catenin andthese two miRNAs is consistent with the possibility that β-cateninmRNA may be regulated by these miRNAs (Baek et al., 2008;Bartel, 2009; Brodersen and Voinnet, 2009; Hendrickson et al.,2009; Liu, 2008; Selbach et al., 2008).

β-catenin is directly regulated by miRNAs

To test if β-catenin is directly regulated by miRNAs, we clonedthe β-catenin 30UTR downstream of Renilla luciferase (Rluc) toanalyze post-transcriptional regulation of β-catenin by spu-miRDeep2-30364-35240 and spu-miR-2007 (Fig. 2A). The 30UTRof β-catenin was amplified with PCR based on 30UTR sequencesidentified from previous analyses (Samanta et al., 2006; Sodergrenet al., 2006). miR-2007 has two binding sites (at positionsþ922 bp and þ2647 bp downstream of the stop codon atþ1 bp) and miRDeep2-30364-35240 has one binding site (atposition þ2401 bp downstream of the stop codon) within the β-catenin 30UTR. We used site-directed mutagenesis to alter the thirdand fifth base pairs of the seed sequences to disrupt the miRNA totarget recognition to test its direct regulation by miRNAs (Gregoryet al., 2008). Firefly luciferase reporter construct was fused to theXenopus β-globin 30UTR and used as a control for Rluc luciferasenormalization.

Newly fertilized eggs were co-injected with in vitro transcribedmRNAs of Renilla reporter constructs fused to the β-catenin 30UTRand the Firefly reporter construct fused to the Xenopus β-globin30UTR. We collected mesenchyme blastula stage embryos, when β-catenin mRNA is significantly increased in Dicer knockdownembryos, to measure miRNA regulation on β-catenin using thedual luciferase assay. Results indicate that miR-2007 regulatesboth binding sites of β-catenin, although only the miR-2007mutated at 922 bp reached statistical significance (Fig. 2B). miR-2007 regulation at these two sites are likely to be redundant, sincethe normalized luciferase reading of miR-2007 double mutant wasnot significantly different than the normalized luciferase readingof miR-2007 single mutants (Student T-test, p¼0.6). The Renillaluciferase reporter construct with triple mutants abolishing bind-ing and regulation by both miR-2007 and miR-Deep2-30364-35240 resulted in additional increase in luciferase protein levels,indicating additive regulation by miRNAs. The relatively smallchange in the luciferase expression caused by the removal ofmiRNA regulation is consistent with the previous studies (Nicolas,2011; Pelosi et al., 2013; Selbach et al., 2008; Wang et al., 2014).Overall, these results indicate that β-catenin 30UTR contains atleast three functional miRNA regulatory sites.

0.00.51.01.52.02.53.03.54.04.55.0

6 15 24

p=0.005p=0.34

p=0.053

Control MASODicer MASO

hpf:

32-cell early blastula

mesenchyme blastula

0

400

800

1200

1600

2000

0

2000

4000

6000

8000

10000

0 12 24 36 48 60 72

miR-2007 miRDeep2-30364-35240

-cat

enin

tran

scrip

ts p

er e

mbr

yo

Hours post fertilization (hpf)

average

normalized m

iRN

A sequence reads

-cat

enin

mR

NA

leve

lsFo

ld d

iffer

ence

of

��

Fig. 1. Real time, quantitative PCR (qPCR) of β-catenin transcript levels. (A) Thetranscript levels of β-catenin were measured in control MASO and Dicer MASO-injected embryos (1.5 mM stock injection solution). Results were normalized to themRNA expression of the housekeeping gene ubiquitin and shown as fold changescompared to control embryos that were injected with the control MASO using theΔΔCt method. The transcript level of β-catenin was significantly more abundant inDicer MASO than in the control MASO-injected embryos at the mesenchymeblastula stage. Standard error bars are graphed. At least three independentbiological replicates with 80–100 embryos per replicate were tested. Hpf¼hourspost fertilization. *Student’s T-test, p¼0.005. (B) Time course expression profile ofβ-catenin mRNA. The transcript levels of β-catenin were measured in uninjectedembryos collected at various developmental stages. Results were normalized to themRNA expression of the housekeeping gene ubiquitin. The estimated numbers ofβ-catenin transcripts are calculated based on the level of ubiquitin in variousdevelopmental stages described previously (Materna and Davidson, 2012; Maternaand Oliveri, 2008). At least three independent biological replicates with 200embryos per replicate were tested. 2.5 embryo equivalents were used. Individualdata points are shown and the average is graphed as a line. β-catenin transcripts aremost abundant between the 32-cell and early blastula stages. Its level decreasesand stabilizes from the mesenchyme blastula stage to the larval stage. Normalizedsequence reads of miR-2007 and miRDeep2-30364-35240 from our previous studyare plotted (Song et al., 2012). β-catenin mRNAs and these miRNAs have inverseexpression patterns.






β-catenin miRNA target protector morpholinos (miRNA TPS)modulate β-catenin mRNA and protein levels

Once we identified the three functional miRNA sites within theβ-catenin 30UTR, we designed miRNA target protector morpholinos(miRNA TPs) against these three sites to compete with theendogenous miRNAs for β-catenin regulation (Staton andGiraldez, 2011). These miRNA TP sequences are unique to the β-catenin 30UTR, as BLASTN searches in the sea urchin genome onlyidentified these sequences to be located within the β-catenin30UTR. To test if miRNA TPs bind to the three functional miRNAbinding sites within the β-catenin 30UTR, we cloned β-catenin30UTR downstream of eGFP and tested the level of translated eGFPin the presence of miRNA TP morpholino treatments at the earlyblastula stage (Fig. S1A). We determined that blocking functionalspu-miRDeep2-30364-35240 and spu-miR-2007 miRNA sites with

miRNA TPs resulted in significant increase in translated eGFPprotein, indicating that miRNA TPs are able to compete withendogenous miRNAs for binding and block endogenous miRNA-mediated translational repression (Fig. S1A). The amount of miRNATP injected was designed to be a 1000� molar excess of theamount of TPs calculated to block the injected amount of eGFPreporter construct and did not seem to be toxic to the blastulaembryos at the morphological level (Fig. S1B).

We tested the effect of miRNA TPs on β-catenin mRNA level(Fig. 3A). Introducing β-catenin miRNA TPs caused an increase inendogenous β-catenin mRNA levels at 15 and 24 hpf; however, thisdifference was not statistically significant (Fig. 3A). Further, toexamine if the removal of miRNA regulation on β-catenin wouldlead to a change in its protein levels, we used S. purpuratus specificβ-catenin antibodies for detection. Preabsorption studies indicatedthe specificity of the β-catenin antibodies (Fig. S2). We determined

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

5’ β-Globin UTR RLuc CDS

β-Globin 3’ UTRFirefly CDS5’ -Globin UTR

CTGAAAT CTGAAATGTGCAAT

miR-2007 miR-2007miRDeep2-35240

+922 +2401 +2647

5’ -Globin UTR RLuc CDS+922

miR-2007

5’ -Globin UTR RLuc CDSmiR-2007

+2647

5’ -Globin UTR RLuc CDSmiR-2007 miR-2007

+922 +2647CTCACAT

5’ -Globin UTR RLuc CDS GTCCTAT

miRDeep2-35240

+2401

AAAAAA (8)

AAAAAA (8)

AAAAAA (8)

AAAAAA (8)

AAAAAA (8)

AAAAAA (8)

RLuc β-catenin-WT3’UTR

RLuc β-catein-miR-2007 mutation at 922 bp

RLuc β-catenin miR-2007 mutation at 2647bp

RLuc β-catenin miR-2007 double mutant

RLuc β-catenin miR-Deep 2-30364-35240 mutation at 2401 bp

5’ -Globin UTR RLuc CDSmiRDeep2-35240

+2401AAAAAA (8)RLuc β-catenin triple

mutant

+2647

miR-2007 miR-2007

+922 +2647

Firefly

β

β

β

β

β

β

+1

norm

alize

d to

wild

type

*

Blastula (24 hpf) p=0.08

miR-20

07 m

utatedW

T

miR-20

07 m

utated

miR-20

07 w

ith do

uble

miR-D

eep2

-3036

4-352

40

Triple

mutatio

ns

p=0.02

N.S.

N.S.

N.S. N.S.

at 92

2 bp

at 26

47 bp

seed

muta

tions

mutated

at 24

01 bp

CTCACAT

CTCACAT

CTCACAT

GTCCTATCTCACAT CTCACAT

Fig. 2. Mutagenesis analysis of potential miRNA binding site within the β-catenin 30UTR. 30UTR of β-catenin was cloned downstream of the Renilla luciferase (RLuc) constructfor testing miRNA regulation. (A) Schematic of various reporter constructs with wild type (WT) or mutated miRNA binding sites within the β-catenin 30UTR is depicted. TheFirefly luciferase reporter construct is flanked with Xenopus β-globin UTRs and used as a microinjection control for normalization. Newly fertilized eggs were coinjected withmRNAs of either RLuc CDS fused with the wild type β-catenin 30UTR or fused with the β-catenin with miRNA seed mutations at miR-2007 and/or miRDeep2-30364-35240sites and Firefly luciferase. (B) The embryos were collected at mesenchyme blastula stage (24 hpf). The RLuc readings were normalized to the Firefly luciferase readings.These RLuc/Firefly luciferase ratios of the mutated constructs were normalized to the control. miR-2007 at 922 bp and miRDeep2-30364-35240 contain functional miRNAbinding sites (3 biological replicates with 50 embryos each). nStudent’s T-test is used to analyze the significance between the constructs with wild type β-catenin 30UTR andβ-catenin 30UTR with mutated miRNA seeds. N.S.¼not significant.






that the microinjection of 300 mM of each miRNA TP (injectionstock concentration) was able to elicit on average a 1.5 foldincrease in β-catenin protein compared to the MASO control at32-cell and mesenchyme blastula stages, indicating that blockingmiRNA mediated regulation in vivo is sufficient to cause a minorincrease in β-catenin protein level (Fig. 3B). Because this β-cateninantibody does not work in whole mount immunolabeling, we arenot able to address the spatial distribution of β-catenin or if thisincrease in β-catenin is of the cytoplasmic or nuclear β-cateninpopulations.

Removal of miRNA regulation of β-catenin does not affect spiculeformation in the sea urchin embryos

Since the specification of mesodermally-derived PMCs is down-stream of the Wnt/β-catenin signaling pathway (Oliveri et al.,2003), we examined PMCs and skeleton formation in β-cateninmiRNA TPs-treated embryos. Results indicate that removal ofmiRNA regulation of β-catenin resulted in reduced PMC (1D5)staining but did not affect PMC patterning or the spicule lengths(Fig. 4). Thus, the change in β-catenin protein levels induced bymiRNA TPs is not sufficient to perturb PMC specification, pattern-ing, or skeleton formation.

Treatment of β-catenin miRNA TPs resulted in aberrant gutmorphology

Next, we examined the effect of this minor increase in β-catenin protein accumulation induced by the removal of miRNAregulation of β-catenin on gut development. We injected β-cateninmiRNA TPs and examined the morphology of the gut. The larvaldigestive system has a tripartite structure, consisting of a muscularesophagus (foregut), a large stomach (midgut), and a short tubularintestine (hindgut) (Burke, 1981; Burke and Alvarez, 1988). Agastrula embryo has a straight tubular gut that is lined with singleepithelial cells (Burke, 1981). The β-catenin miRNA TP-treatedembryos had a significantly narrower gut at the gastrula stagethan the control embryos (Fig. 5A,B vs. Fig. 5C,D). We tested avariable amount of β-catenin miRNA TPs, ranging from stocks of

injection solutions from 3 nM to 3 mM (Fig. 5G and data notshown), and only 300 mM and 3 mM β-catenin miRNA TP-treatedembryos had statistically significantly smaller midgut widthscompared to the control (Fig. 5G). However, at the 3 mM stockconcentration, the control embryos had less than 60% healthyembryos, indicating non-specific toxic response to the morpho-lino, so these data were not included in our analysis. In addition,18% of the β-catenin miRNA TP-treated embryos (in 2 replicatesout of 4) have aberrant intestine (hindgut) morphology (Fig. 5Eand F). In β-catenin miRNA TP-treated embryos, the shape of theirintestine (hindgut) is trapezoidally shaped instead of a cylindricalstructure (Fig. 5A,B vs. Fig. 5E,F).

Since we observed gut morphological difference in β-cateninmiRNA TP-treated embryos, we tested if endodermal differentia-tion was affected. Alkaline phosphatase is a digestive enzymeexpressed in the guts of most animals. In sea urchin pluteus larvae,alkaline phosphatase is expressed only in the gut epithelium andserves as a marker for differentiated endoderm (Drawbridge,2003; Kumano and Nishida, 1998; Nishida and Kumano, 1997;Whittaker, 1990). Although the β-catenin miRNA TP treatedembryos expressed alkaline phosphatase in the gut, it seems tobe at a reduced level as compared to the control (Fig. 5H and I).Further, a significant number of β-catenin miRNA TP-treatedembryos have little or no alkaline phosphatase present in theintestine (hindgut) as compared to the control (Fig. 5I). Thus, β-catenin miRNA TP treated embryos may have defects in endoder-mal differentiation.

β-catenin miRNA TP-treated embryos have normal sphincters but lesswell developed circumesophageal musculature

We further examined the circumesophageal muscles of meso-dermal origin and the sphincters of endodermal origin with theantibody against the sea urchin myosin heavy chain (MHC)(Wessel et al., 1990). In sea urchin embryos, a set of muscle cellspartition the various compartments of the digestive system. Thecardiac sphincter, a constriction made from a simple striatedmyoephithelium with myofibrils, separates the esophagus (fore-gut) and the stomach (midgut) (Burke, 1981; Wessel et al., 1990).

6 15 24hpf:


mesenchyme blastula

6 15 24hpf:


mesenchyme blastula

0.00.20.40.60.81.01.21.41.61.82.0

β-ca

teni

n pr

otei

n le

vels

TP Western

0.00.51.01.52.02.53.03.54.04.55.05.56.0

Control MASOmiRNA TPs

p=0.49

p=0.3replicate 1replicate 2replicate 3average

Fold

diff

eren

ce o

f

Fold

diff

eren

ce o

f

�-ca

teni

n m

RN

A le

vels

Fig. 3. β-catenin miRNA TP induced increased β-catenin protein and mRNA levels. (A) qPCR was used to measure the transcript levels of β-catenin in the embryos injectedwith control and miRNA TP MASOs against the three functional miRNA binding sites. 100 embryos were collected at the 32-cell (6 hpf), early blastula (15 hpf) andmesenchyme blastula (24 hpf) stages. The mRNA level of β-catenin was increased at early blastula and mesenchyme blastula stages when miRNA regulation of β-catenin wasabolished. However, these increases were not significant in β-catenin miRNA TP and control MASO-treated embryos (Student’s T-test). Hpf¼hours post fertilization.(B) Western blot of 200 embryos injected with control or miRNA TPs. The embryos were collected at the 32-cell (6 hpf), early blastula (15 hpf) and mesenchyme blastula(24 hpf) stages. Compared to control embryos, embryos injected with miRNA TPs accumulated on average 1.5 times more β-catenin protein at the 32-cell and mesenchymeblastula stages. β-catenin protein levels are normalized to actin (3 biological replicates). Individual data points were indicated by the different icons. The average is graphedas a black bar.






Separating the stomach (or midgut) and the intestine (hindgut) isthe pyloric sphincter. The digestive tract ends with an analsphincter. All these sphincters are endodermally derived andcontain myosin heavy chain (Annunziata et al., 2013; Burke,1981; Wessel et al., 1990). These constrictions give the overallgut structure an hourglass-like shape in the larva. The β-cateninmiRNA TP-treated embryos have normal pyloric and anal sphinc-ters (Fig. 6A,B vs. Fig. 6D,E). However, in general, embryos treatedwith the β-catenin miRNA TPs had a less well developed circume-sophageal musculature as compared to the control (Fig. 6C vs.Fig. 6F). Further, the diameter of the muscle fibers is significantlylarger in control than in the β-catenin miRNA TP-treated embryos(Fig. 6G). These results indicate that blocking miRNA regulation ofβ-catenin impacted mesodermally-derived circumesophagealmusculature.

Removal of miRNA regulation of β-catenin resulted in increasedtranscripts of endodermal regulatory genes

The sea urchin endoderm is derived from two layers of cellsthat are specified early in development: Veg2 and Veg1 cells(Logan and McClay, 1997; Ransick and Davidson, 1998). The Veg2cells give rise to the non-skeletogenic mesodermal cells, theforegut and ventral/oral midgut, while the Veg1 cells give rise tothe ectoderm, the dorsal/aboral midgut and hindgut (Logan andMcClay, 1997; Ransick and Davidson, 1998). Nuclearization ofβ-catenin was shown to play a critical role in differentiation ofboth Veg2 and Veg1 cells. Previous studies demonstrated that β-catenin protein localizes into the nucleus of specific cells accordingto the developmental stage (Fig. 7A): at the 32-cell stage (6 hpf) itis mostly restricted to the micromeres, by 128-cell stage (10 hpf) itextends to the Veg2 cells, and by early blastula stage (15 hpf) itsexpression begins to fade from the PMCs but remains in the Veg2cells. By mesenchyme blastula stage (24 hpf) nuclear β-cateninclears from the Veg2 region and shifts to the Veg1 region.Interestingly, small micromeres always contain high amounts ofnuclear β-catenin (Logan et al., 1999). Wnt/β-catenin signalingalong with Otx induce Veg2 cells to become endoderm byactivating endodermal regulatory genes such as Blimp1b, Krl, Eve,

and Hox11/13b (Arenas-Mena et al., 2006; Howard et al., 2001;Peter and Davidson, 2010, 2011; Smith et al., 2008). Activationof these genes in turn activates more endodermal regulators,including Brachyury, FoxA, and GataE, thus promoting endodermdifferentiation (Fig. 7A) (Peter and Davidson, 2011; Smith et al.,2008).

To dissect the molecular mechanism of the observed endome-sodermal morphological defects, we examined if increase in β-catenin protein induced by removal of its miRNA regulation has animpact on the spatial distribution of endodermal genes. First weperformed whole mount in situ hybridization of β-catenin itself totest if the expression domains of its mRNA would be affected uponremoval of miRNA regulation (Fig. 7B). Results indicate that theubiquitous spatial distribution of β-catenin mRNA was not alteredupon β-catenin miRNA TP treatment. However, a noticeableincrease in the mRNA levels of β-catenin in all blastomeres ofmiRNA TP-treated embryos at 6 hpf and 10 hpf was observed. Thisobserved increased level of β-catenin mRNA may be translated tothe protein that would become either cytoplasmic protein where itassociates with the adherens junctions or acting as a nucleartranscriptional activator (Logan et al., 1999). Because the β-cateninantibody does not work in whole mount immunolabeling, wecannot address the potential domain expansion of β-cateninprotein in the cytoplasmic or the nuclear β-catenin population.

We also examined the spatial localization of known Wnt/β-catenin downstream targets, including Krl, Blimp1b, and FoxA(Fig. 7). Krl is a transcriptional repressor containing a Zn-fingerDNA-binding domain that was shown to be important for β-catenin-mediated endoderm specification (Howard et al., 2001;Peter and Davidson, 2010, 2011). In S. purpuratus, knockdown ofKrl resulted in the lack of endoderm (Howard et al., 2001). Theexpression of Krl mRNA (Fig. 7C and D) is similar to the expressionof nuclear β-catenin (Fig. 7A) (Logan et al., 1999). It is initiallyrestricted to the micromere descendants at the 32-cell stage,followed by shifting to the Veg2 region upon hatching (Howardet al., 2001; Peter and Davidson, 2011). However, unlike thenuclear β-catenin, Krl clears from the small micromeres by earlyblastula stage (Livi and Davidson, 2006). We did not observenoticeable difference in spatial localization of Krl.

Con

trol M

AS

Om

iRN

A T

P

Scale bar is 50 μm

0

5

10

15

20

25

30

35

ControlMASO miRNA TP

N=6

0

N=5

8

p =0.6624

Leng

th o

f D-V

spi

cule

(μm

)

DIC PMCs Overlay

N.S.

β-cateninβ-ca

teni

n

Fig. 4. Removal of miRNA regulation of β-catenin does not affect skeletogenesis. Gastrula stage embryos (48 hpf) were immunolabeled with the 1D5 antibody againstprimary mesenchyme cell (PMC)-specific membrane protein (McClay et al., 1983) and imaged with an LSM 780 scanning confocal microscope. Z-stacks were reconstructedinto a single projected image. (A) Removal of miRNA regulation of β-catenin did not affect PMC patterning. (B) The length of Dorsal-Ventral connecting spicule (D-V spicule)measured from the triradiate skeletal primordium to the anterior end of the embryo was not significantly changed in the miRNA TP-injected gastrula embryos compared tocontrol. Student’s T-test, p¼0.662. N is the total number of dorsal-ventral spicules measured. N.S.¼not significant.






Blimp1b is a member of the SET domain family of proteins(which are directly involved in histone modifications) that wasshown to promote specification of endodermal cells from the Veg1tier (Livi and Davidson, 2006). Blimp1b MASO resulted in blastulaembryos lacking Veg1 descendants and gastrula embryos withshort truncated archenteron or gut invagination defects (Livi andDavidson, 2006). Similar to the nuclear β-catenin and Krl, theexpression of Blimp1b mRNA begins in large micromere descen-dants at 10 hpf, then shifts to Veg2 tier of cells by 18 hpf (Fig.7E)(Livi and Davidson, 2006). By 24 hpf, Krl is expressed in the Veg2endoderm (Peter and Davidson, 2010, 2011), as well as in the Veg1tier (Livi and Davidson, 2006). However, unlike the nuclearβ-catenin and Krl, Blimp1b mRNA was never observed to beexpressed in small micromeres (Livi and Davidson, 2006). We

did not detect noticeable difference in the expression domain ofBlimp1b mRNA upon miRNA TP treatment (Fig. 7F).

FoxA is an evolutionarily conserved forkhead transcriptionfactor ortholog that specifies endoderm in many bilaterians andcnidarians (Boyle and Seaver, 2008; Burtscher and Lickert, 2009;Friedman and Kaestner, 2006; Hiruta et al., 2005; Oliveri et al.,2006). Knockdown of FoxA resulted in severe defects in arch-enteron formation with truncated gut, missing foregut or entiregut, and a lack of stomadaeum (Oliveri et al., 2006). Even thoughFoxA is a direct downstream target of β-catenin, its expressionpattern does not completely mimic the pattern of β-cateninnuclearization (Fig. 7A and G). At 18 hpf FoxA mRNA was reportedto be restricted to Veg2 endomesoderm followed by its expressionin Veg2-derived endodermal ring by 21 hpf. The oral side of the

Con

trol M

AS

Om

iRN

A T

Pm

iRN

A T

P

DIC Endo 1

0

5

10

15

20

25

30

35

40

Control MASO miRNA TP Control MASO miRNA TP30 μM 300 μM

Wid

th o

f the

mid

gut (

μm)

p < 0.0001

N=56 N=29 N=74 N=72

18%Scale bar is 50 μm

N.S. *

Control miRNA TP

Alk

alin

e P

hosp

hata

se

Scale bar is 100 μm

0102030405060708090

100

no stainingweak staining

N=37 N=24

Per

cent

of e

mbr

yos

with

hin

dgut

sta

inin

g

p<0.0001

strong staining

*

ControlMASO miRNA TP

�-catenin

�-catenin

�-ca

teni

n�-

cate

nin

Fig. 5. Removal of miRNA regulation on β-catenin results in aberrant gut morphology. Gastrulae were immunolabeled with Endo1, an antigen expressed in the midgut andhindgut of the embryo (Wessel et al., 1990), and imaged with an LSM 780 scanning confocal microscope. (A-B) Gastrulae injected with control MASO had a straight tubulargut that is lined with a single layer of epithelial cells. (C–F) β-catenin miRNA TP treatment resulted in embryos with narrower gut structure. (E-F) 18% of the 97 embryosmiRNA TP injected embryos had an aberrant hindgut structure (black arrow) (2 out of 4 biological replicates). (G) The width of the midgut was measured with embryosinjected with either 30 mM or 300 mM stock of β-catenin miRNA TP (white arrows). Only the 300 mM miRNA TP treated embryos had a significantly narrower gut than thecontrol. *Student’s T-test, po0.0001. N is the total number of embryos imaged and phenotyped. N.S.¼not significant. (H) The alkaline phosphatase staining was used toassess endodermal differentiation of the larvae. Control MASO-injected embryos have more intense alkaline phosphate staining than the β-catenin miRNA TP treatedembryos. Many of the embryos exposed to the β-catenin miRNA TP lack alkaline phosphatase staining in the intestine (hindgut) (arrows). (I) The percentage of embryos withhindgut staining in the miRNA TP treatment group is significantly lower than in the control embryos. *Fisher’s Exact Test (no hindgut staining vs. hindgut staining,po0.0001). N is the total number of embryos examined.






endodermal ring was shown to express more FoxA compared tothe aboral side (Oliveri et al., 2006). FoxA is initially expressed inVeg2 tier of cells at 15 hpf and is restricted to Veg2U that gives riseexclusively to the endoderm (Oliveri et al., 2006). We did notobserve changes in FoxA mRNA spatial distribution in β-cateninmiRNA TP-treated embryos compared to the control (Fig. 7H).

Using qPCR, we assayed for transcript level changes in Wnttargeted transcription factors and signaling molecules involved incell fate specification (Fig. 8). Transcript levels in the miRNA TP-treated embryos were normalized to the control MASO-treatedembryos. Results indicated that transcript levels of endodermalregulators, Krl, Eve, Wnt8, Bra and, FoxA and ectodermal regulator,Nodal, were increased on average of at least 2-fold in embryostreated with β-catenin miRNA TPs as compared to embryos treatedwith the control MASO in mesenchyme blastulae, suggesting thatpost-transcriptional regulation by miRNAs on β-catenin may con-tribute to endodermal cell specification and differentiation(Fig. 8C). Consistent with the in situ data, Krl mRNA had thehighest transcript increase upon β-catenin miRNA TP treatment(Figs. 7D and 8C).

Discussion

Our results for the first time demonstrated that miRNAsmodulate β-catenin in the canonical Wnt signaling pathway inthe early sea urchin embryo. We identified at least three miRNAregulatory sites in the sea urchin β-catenin 30UTR, as supportedby the luciferase reporter data (Fig. 2) and by our observationthat blocking miRNA regulation of β-catenin resulted in anincrease of the β-catenin mRNA and protein levels (Fig. 3).Importantly, this miRNA TP-induced increase in β-catenin proteinis sufficient to cause transcriptional changes in downstreamWnt responsive endodermal and mesodermal regulatory genes(Fig. 8), potentially impacting endodermal specification/

differentiation, gut development, and circumesophageal musclestructure in vivo (Figs. 5 and 6).

Across species from fruit fly to zebrafish to human, miRNAshave been found to regulate various components of the Wnt/β-catenin pathway (Hashimi et al., 2009; Kennell et al., 2008; Saydamet al., 2009; Silver et al., 2007; Thatcher et al., 2008; Wang and Xu,2010; Xia et al., 2010). Recently 38 miRNAs were identified toregulate the canonical Wnt pathway in human HEK293 cells,including miR-25 which inhibits human β-catenin by targeting itscoding sequence (Anton et al., 2011). Interestingly, miRDeep2-30364-35240 that we found to regulate sea urchin β-catenin hasthe same seed sequence as miR-25, suggesting that miRDeep2-30364-35240 may play a potential conserved role as the mammalianmiR-25 in regulating β-catenin. We also found β-catenin to be post-transcriptionally regulated by miR-2007 in the early embryo. miR-2007 is conserved within Eleutherozoa that is shared by Stronylo-centrotus (Echinoidea) and Henricia (Asteroidea) (Wheeler et al.,2009).

Of note is that the mammalian β-catenin gene is regulated bymiR-200a (Saydam et al., 2009; Xia et al., 2010). Even though asingle miR-200 exists in the sea urchin, we did not bioinformati-cally identify any miR-200 seed sequences within the sea urchin β-catenin 30UTR. Interestingly, the miR-200n does have one predictedbinding site within the β-catenin 30UTR (Table S2). It is likely thatusing seed sequence as the only criterion for bioinformaticidentification of miRNA binding sites is insufficient in predictingall the functional miRNA regulatory sites. Additional miRNAs mayalso regulate the β-catenin 30UTR, even though they are not highlyexpressed in the embryo (Table S2) (Song et al., 2012). miRNAswith conserved seed sequences may share conserved gene targets,as in the case of sea urchin miRDeep2-30364-35240 and themammalian miR-25 in mediating post-transcriptional regulationof the β-catenin gene.

Our results indicate that the removal of miRNA regulation ofβ-catenin by using miRNA TP MASO is able to induce an increase in

Con

trol

miR

NA

TP

DIC MHCMHC

Scale bar is 50 μm

es

es

st

st

in

in

0

10

20

30

40

50*

p=0.0001

N=1

7

N=1

3

Fig. 6. β-catenin miRNA TP-treated embryos have normal sphincters but less well developed circumesophageal musculature. Three-day-old larvae were immunolabeled withthe myosin heavy chain antibody (MHC) (Wessel et al., 1990) to detect circumpharyngeal muscle fibers and sphincters (red arrow—pyloric sphincter; white arrow—analsphincter) that compartmentalize the larval gut. (A) DIC image of the control larva. (B) Control larva immunolabeled with MHC. (C) Zoomed in view of a normal larvalcircumpharyngeal muscles. (D) DIC of the β-catenin miRNA TP-treated embryo. (E) β-catenin miRNA TP-treated embryo immunolabeled with MHC. (F) Zoomed in view of thelarval circumpharyngeal muscles from β-catenin miRNA TP-injected larvae. es¼esophagus/foregut; st¼stomach/midgut; in¼ intestine/hindgut. (G) The diameter of thecircumesophageal muscle fibers is significantly smaller in the β-catenin miRNA TP-treated embryos compared to the control embryos. N is the number of embryos examined.*Student T-test (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)






β-catenin protein level by the 32-cell stage (6 hpf) and in bothmRNA and protein levels by mesenchyme blastula stage (Fig. 3).The change in β-catenin protein level upon miRNA TP treatment atthe mesenchyme blastula stage (24 hpf) coincides with increasedlevels of miRDeep2-30364-35240 and miR-2007 sequence readsreported from our previous study (Song et al., 2012) (Fig. 1B).Removing miRNA regulation of β-catenin at the early blastula stage(15 hpf) did not result in changes in the transcript levels ofendomesodermal regulators (Fig. 8B), consistent with the datathat these miRNAs have relatively low sequence reads prior to theblastula stage (Fig. 1B). miRNA regulation of β-catenin is alsosupported by the Dicer knockdown experiments where the mRNAlevel of β-catenin was significantly increased at the mesenchymeblastula stage (24 hpf) but not by early blastula stage (15 hpf)(Fig. 1A). One caveat is that in the complex background of Dicer

knockdown, the change in β-catenin mRNA would be a result ofglobal depletion of all miRNAs and the effect of their target geneexpression changes.

β-catenin is highly regulated at the transcriptional, post-tran-scriptional, translational, and post-translational levels (Huanget al., 2010; Zhao et al., 2011). We propose that the type ofregulatory mechanism that controls β-catenin is dependent onthe developmental stage of the embryo. The most well understoodregulatory mechanism of β-catenin is mediated by Wnt ligandbinding that leads to the disassembly of the destruction complexand inhibition of the degradation of β-catenin (Logan and Nusse,2004). The binding interactions of β-catenin is also regulated bythe transforming growth factor β (TGFβ), epidermal growth factorreceptor (EGFR), hepatocyte growth factor, erythroblastic leukemiaviral oncogene-2 and Janus Kinase 2 (JAK2)-mediated signaling

Control miRNA TP Control miRNA TP15 hpf 24 hpf


miRNA TPControl miRNA TP Control15 hpf 24 hpf

Control miRNA TP10 hpf

late

ral

vege

tal

nucl

ear β

-cat

enin

Krl

mR

NA

Blim

p1b

mR

NA

�-c

aten

in m

RN

A K

rl m

RN

AB

limp1

b m

RN

AFo

xA m

RN

A

FoxA

mR

NA




late

ral

vege

tal

128-cell early mesenchyme

6 hpf32-cell blastula

10 hpf 15 hpfblastula24hpf

late

ral

vege

tal

late

ral

vege

tal

late

ral

vege

tal

late

ral

vege

tal

late

ral

late

ral

Fig. 7. Removal of miRNA regulation of β-catenin does not affect the spatial localization of Wnt responsive genes. (A) Schematic depicts the localization of nuclear β-catenin(Logan et al., 1999). (C) Schematic depicts the localization of Krl mRNA (Howard et al., 2001; Minokawa et al., 2004; Peter and Davidson, 2010). (E) Schematic depicts thelocalization of Blimp1b mRNA (Livi and Davidson, 2006; Peter and Davidson, 2010, 2011; Smith et al., 2007). (G) Schematic depicts the localization of FoxA mRNA (Oliveriet al., 2006; Peter and Davidson, 2010). SM¼small micromeres, LM¼ large micromeres, V1¼Veg1 tier, V2¼Veg2 tier, V2U¼Veg2 upper region, V2L¼Veg2 lower region,PMCs¼primary mesenchyme cells. Whole mount in situ hybridization was performed to address the spatial localization of (B) β-catenin and Wnt responsive genes, including(D) Krl, (F) Blimp1b and (H) FoxA as a result of β-catenin miRNA TP treatment. Embryos were collected at various developmental stages. Spatial localizations of Krl, Blimp1band FoxA transcripts were not affected by removal of miRNA regulation of β-catenin.






pathways (Blume-Jensen et al., 1998; Gonzalez and Medici, 2014;Incassati et al., 2010; Liu et al., 2010; Paul et al., 2013; Zeng et al.,2006). Early in development, β-catenin may be predominantlyregulated by activated Disheveled that disrupts the targeteddegradation of β-catenin in the vegetal blastomeres (Peng andWikramanayake, 2013), while miRNAs may facilitate the clearingof β-catenin later at and after the blastula stage.

β-catenin may be crucial for activating signals that patternectoderm (Wikramanayake et al., 1998). Previous studies demon-strate that an overexpression of β-catenin in the animal halves ofthe sea urchin embryos (through microinjection of 0.01–0.02 pg ofβ-catenin mRNA into the newly fertilized eggs followed by isola-tion of animal halves) could induce ectoderm patterning along thedorsal/ventral (oral–aboral) axis, as supported by morphologicaland molecular alterations (Wikramanayake et al., 1998). Ectodermpatterning is mediated by FoxQ2 and Nodal which are importantfor the formation of the anterior neuroectoderm territory and theprimary (anterior–posterior) and secondary (dorsal–ventral) axes(Angerer et al., 2011; Yaguchi et al., 2008). Recently it was shownthat the nuclear β-catenin dependent signal indirectly restrictsFoxQ2 expression to the animal plate, allowing Nodal signaling toincrease through autoregulation to initiate dorsal–ventral pattern-ing (Angerer et al., 2011; Range et al., 2013; Yaguchi et al., 2008).To examine if ectodermal specification regulators were affected byβ-catenin miRNA TP treatment, we tested the transcript levels ofFoxQ2 and Nodal. The transcript of FoxQ2 was not altered but theNodal transcript is increased in the presence of increased β-cateninby mesenchyme blastula stage (Fig. 8C). Thus, Nodal is likely to beregulated by the Wnt/β-catenin pathway, independent fromFoxQ2. The exact molecular mechanism of how this regulationoccurs still needs to be explored.

The Wnt/β-catenin signaling is important for the skeletogen-esis of the sea urchin embryos (Fig. 8A). PMCs arise from the largemicromere lineage in response to the canonical Wnt signaling thatleads to the activation of the transcriptional repressor Pmar1(paired class homeodomain repressor) in the large micromeres(Oliveri et al., 2003). Activation of Pmar1 results in transcriptionalinhibition of an ubiquitous transcriptional repressor HesC (Revilla-I-Domingo et al., 2007), leading to the activation of skeletogenictranscription factors which regulate various differentiation effec-tor genes that are essential for PMC patterning and spiculeformation (Damle and Davidson, 2011; Koga et al., 2010;Kurokawa et al., 1999; Sharma and Ettensohn, 2010, 2011; Wahlet al., 2009). Our data indicate that removal of miRNA regulation ofβ-catenin did not affect skeletogenesis of the sea urchin embryos(Fig. 4). In contrast to the specification of endomesoderm, which isregulated by multiple genes that are directly activated by the Wnt/β-catenin pathway, PMCs are specified indirectly through a singleβ-catenin-responsive gene Pmar1 (Fig.8A). Thus, a relatively smallaccumulation of β-catenin protein observed in the miRNA TP-treated embryos is not sufficient to alter PMC development.

We then examined whether endodermal structures wereaffected by the removal of β-catenin regulation by miRNAs. TheWnt/β-catenin signaling pathway plays a central role in endome-soderm formation and it was shown that overexpression of β-catenin (0.05–0.1 pg RNA) in the sea urchin embryos led to strongvegetalization of an embryo, including formation of excessiveendoderm and mesoderm (Wikramanayake et al., 1998). However,the effect of low level of β-catenin overexpression on gut devel-opment in whole embryos is not known. Our data indicate that β-catenin miRNA TP treatment led to a significantly narrower gut(Fig. 5A,B vs. Fig. 5C,D), reduced alkaline phosphatase staining(Fig. 5H and I), and at least 2-fold increase in the levels ofendodermal regulators Krl, Eve, Wnt8 and Bra mRNAs in thevegetal pole (Figs.7 and 8C). A relatively minor increase in β-catenin protein level resulted in 2-fold increase in the expression

Nod

al

FoxQ

2

24 hpf miRNA TP

Krl

Eve

Wnt

8

Blim

p1b

Bra

FoxA

Nod

al

Del

ta

GC

M

FoxQ

2

norm

aliz

ed to

con

trol M

AS

Om

RN

A fo

ld c

hang

es

0.0

1.0

2.0

3.0

4.0

5.0

6.0

0.0

0.5

1.0

1.5

2.0

2.5

3.015 hpf miRNA TP

norm

aliz

ed to

con

trol M

AS

Om

RN

A fo

ld c

hang

es

GC

M

Del

ta

FoxABra

Blim

p1b

Wnt

8

EveKrl

Fig. 8. Removal of miRNA regulation of β-catenin results in the transcript changesof Wnt responsive genes. (A) Simplified gene regulatory network activated by Wnt/β-catenin signaling pathway. Skeletogenesis (red) is indirectly regulated by β-catenin through a single transcriptional repressor Pmar1 (Oliveri et al., 2003).Endoderm (orange) and mesoderm (purple) formation is regulated by multipledirect targets of β-catenin such as Krl (Howard et al., 2001; Minokawa et al., 2004;Peter and Davidson, 2011), FoxA (Oliveri et al., 2006), Blimp1b (Livi and Davidson,2006; Smith et al., 2007), Eve (Peter and Davidson, 2010, 2011), Wnt8(Wikramanayake et al., 2004) and Bra (Gross and McClay, 2001). In addition, β-catenin regulates ectoderm differentiation through indirect regulation of FoxQ2(Angerer et al., 2011; Range et al., 2013; Yaguchi et al., 2008). (B) qPCR was used tomeasure the transcript levels of genes involved in the specification of endoderm,mesoderm, and ectoderm in control and β-catenin miRNA TP-injected embryos atthe early blastula stage (15 hpf). (C) qPCR was used to measure the transcript levelsof genes involved in the specification of endoderm, mesoderm, and ectoderm incontrol and β-catenin miRNA TP-injected embryos at the mesenchyme blastulastage (24 hpf). Most of the endomesodermal regulatory genes have Z2-foldincrease in transcript levels in miRNA TP-treated embryos in comparison to thecontrol embryos at mesenchyme blastula stage but not at early blastula stage (3–5biological replicates). The box plot represents the third quartile (purple) and thefirst quartile (green). Median is the junction between the first and the thirdquartile. The whiskers represent the maximum and the minimum of the data. Theaverage of the data is shown by the black line. Red line indicates the 2-fold changes.(For interpretation of the references to color in this figure legend, the reader isreferred to the web version of this article.)






of endodermal regulators (Figs. 3 and 8). This result can potentiallybe explained by restricted spatial expression of β-catenin regula-tory miRNAs in a fraction of cells in the embryo. Since wemeasured the total levels of β-catenin protein, whereas onlychanges in the nuclear β-catenin would affect the expression ofits downstream targets, the actual effect on β-catenin in endo-dermal cells may be larger than the average effect measured forthe entire embryo. Although we do not understand how increasedlevels of these essential endodermal transcription factors mayresult in gut developmental defects, we speculate that a combina-tion of downstream targets of these transcription factors that arecritical for proper endodermal specification/differentiation andgut development result in the β-catenin miRNA TP-inducedphenotypes.

We also tested the expression of mesodermal regulatory genes,Delta and GCM, in β-catenin miRNA TP-treated embryos (Fig. 8).The Delta/Notch signaling pathway is known to be important formesodermal specification which targets GCM at the top of theearly mesoderm gene regulatory hierarchy (Croce and McClay,2010; Ransick and Davidson, 2006; Sherwood and McClay, 1999;Sweet et al., 1999, 2002). Our data indicate that both Delta andGcm mRNAs are not altered by β-catenin miRNA TP treatment.However, we observed a noticeable and significant difference inthe structure of the circumesophageal musculature (Fig. 4).Recently a set of genes were identified in the sea urchin myoblaststhat appear in the late gastrula stage, including MyoD2, FoxF, FoxC,FoxL1, Myocardin, Twist, and Tbx6 (Andrikou et al., 2013). It is notclear if any of these molecules are directly regulated by thecanonical Wnt signaling pathway. In vertebrates, the Wnt pathwayregulates myogenic regulatory factors such as MyoD and Myf5(Borello et al., 2006; Tajbakhsh et al., 1998; von Maltzahn et al.,2012). Thus, the canonical Wnt pathway may regulate the struc-ture of mesodermally-derived circumesophageal musculature(Figs. 5 and 8C).

Conclusions

In summary, our results identified specific miRNAs that reg-ulate β-catenin and demonstrated that blocking endogenousmiRNA regulation of β-catenin resulted in increased transcriptlevels of Wnt responsive endodermal regulatory genes in the seaurchin, revealing potential molecular mechanism to β-cateninmiRNA TP induced phenotypes. This study demonstrates thatmiRNA regulation of β-catenin at the post-transcriptional level inthe developing embryo has an important impact on the develop-ment of the larval gut and the structure of circumesophagealmusculature.

Acknowledgments

We thank the two anonymous reviewers for their comments.We thank Athula Wikramanayake for helpful discussions, readingof the manuscript, and the β-catenin antibodies. We thank DavidMcClay for his 1D5 antibody against the PMCs. We thank GaryWessel for his Endo1 and MHC antibodies. We also thank Dr. JohnMcDonald for his consultation in statistics. We thank SantiagoSuarez in cloning the β-catenin in situ probe. This work is fundedby the University of Delaware Research Fund (Grant no.11A00773), the NIH NIGMS 5P20GM103653-02, and NIH NIGMS8P20GM103446-12. CFP was supported by an NSF grant (IOS0754323) to Athula Wikramanayake.

Appendix A. Supporting information

Supplementary data associated with this article can be found inthe online version at: http://dx.doi.org/10.1016/j.ydbio.2015.01.008.

References

Aberle, H., Schwartz, H., Kemler, R., 1996. Cadherin–catenin complex: proteininteractions and their implications for cadherin function. J. Cell. Biochem. 61,514–523.

Anastas, J.N., Moon, R.T., 2013. WNT signalling pathways as therapeutic targets incancer. Nat. Rev. Cancer 13, 11–26.

Andrikou, C., Iovene, E., Rizzo, F., Oliveri, P., Arnone, M.I., 2013. Myogenesis in thesea urchin embryo: the molecular fingerprint of the myoblast precursors.Evodevo 4, 33.

Angerer, L.M., Yaguchi, S., Angerer, R.C., Burke, R.D., 2011. The evolution of nervoussystem patterning: insights from sea urchin development. Development 138,3613–3623.

Annunziata, R., Perillo, M., Andrikou, C., Cole, A.G., Martinez, P., Arnone, M.I., 2013.Pattern and process during sea urchin gut morphogenesis: the regulatorylandscape. Genesis.

Anton, R., Chatterjee, S.S., Simundza, J., Cowin, P., DasGupta, R., 2011. A systematicscreen for micro-RNAs regulating the canonical Wnt pathway. Plos One, 6.

Arenas-Mena, C., Cameron, R.A., Davidson, E.H., 2006. Hindgut specification andcell-adhesion functions of Sphox11/13b in the endoderm of the sea urchinembryo. Dev. Growth Differ. 48, 463–472.

Baek, D., Villen, J., Shin, C., Camargo, F.D., Gygi, S.P., Bartel, D.P., 2008. The impact ofmicroRNAs on protein output. Nature 455, 64–71.

Bartel, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell116, 281–297.

Bartel, D.P., 2009. MicroRNAs: target recognition and regulatory functions. Cell 136,215–233.

Bernstein, E., Kim, S.Y., Carmell, M.A., Murchison, E.P., Alcorn, H., Li, M.Z., Mills, A.A.,Elledge, S.J., Anderson, K.V., Hannon, G.J., 2003. Dicer is essential for mousedevelopment. Nat. Genet. 35, 215–217.

Blume-Jensen, P., Janknecht, R., Hunter, T., 1998. The kit receptor promotes cellsurvival via activation of PI 3-kinase and subsequent Akt-mediated phosphor-ylation of Bad on Ser136. Curr. Biol. 8, 779–782.

Borello, U., Berarducci, B., Murphy, P., Bajard, L., Buffa, V., Piccolo, S., Buckingham,M., Cossu, G., 2006. The Wnt/beta-catenin pathway regulates Gli-mediatedMyf5 expression during somitogenesis. Development 133, 3723–3732.

Boyle, M.J., Seaver, E.C., 2008. Developmental expression of foxA and gata genesduring gut formation in the polychaete annelid, Capitella sp. I. Evol. Dev. 10,89–105.

Brodersen, P., Voinnet, O., 2009. Revisiting the principles of microRNA targetrecognition and mode of action. Nat. Rev. Mol. Cell Biol. 10, 141–148.

Burke, R., 1981. Structure of the digestive tract of thepluteus larva of Dendrasterexcentricus (Echinodermata: Echinoida). Zoomorphology 98, 209-225.

Burke, R.D., Alvarez, C.M., 1988. Development of the esophageal muscles inembryos of the sea urchin Strongylocentrotus purpuratus. Cell Tissue Res. 252,411–417.

Burtscher, I., Lickert, H., 2009. Foxa2 regulates polarity and epithelialization in theendoderm germ layer of the mouse embryo. Development 136, 1029–1038.

Cheers, M.S., Ettensohn, C.A., 2004. Rapid microinjection of fertilized eggs. MethodsCell Biol. 74, 287–310.

Clevers, H., 2006. Wnt/beta-catenin signaling in development and disease. Cell 127,469–480.

Clevers, H., Nusse, R., 2012. Wnt/beta-catenin signaling and disease. Cell 149,1192–1205.

Croce, J.C., McClay, D.R., 2010. Dynamics of Delta/Notch signaling on endomeso-derm segregation in the sea urchin embryo. Development 137, 83–91.

Damle, S., Davidson, E.H., 2011. Precise cis-regulatory control of spatial andtemporal expression of the alx-1 gene in the skeletogenic lineage ofS. purpuratus. Dev. Biol. 357, 505–517.

de-Leon, S.B., Davidson, E.H., 2010. Information processing at the foxa node of thesea urchin endomesoderm specification network. Proc. Natl. Acad. Sci. USA 107,10103–10108.

Drawbridge, J., 2003. The color purple: analyzing alkaline phosphatase expressionin experimentally manipulated sea urchin embryos in an undergraduatedevelopmental biology course. Int. J. Dev. Biol. 47, 161–164.

Duboc, V., Lapraz, F., Saudemont, A., Bessodes, N., Mekpoh, F., Haillot, E., Quirin, M.,Lepage, T., 2010. Nodal and BMP2/4 pattern the mesoderm and endodermduring development of the sea urchin embryo. Development 137, 223–235.

Emily-Fenouil, F., Ghiglione, C., Lhomond, G., Lepage, T., Gache, C., 1998. GSK3beta/shaggy mediates patterning along the animal–vegetal axis of the sea urchinembryo. Development 125, 2489–2498.

Ettensohn, C.A., Wessel, G.M., Wray, G.A., 2004. Methods in cell biology. In:Ettensohn, C.A., Wessel, G.M., Wray, G.A. (Eds.), Development of Sea Urchins,Ascidians, and other Invertebrate Deuterostomes: Experimental Approaches.Elsevier Academic Press, San Diego, pp. 1–13.

Friedman, J.R., Kaestner, K.H., 2006. The Foxa family of transcription factors indevelopment and metabolism. Cell. Mol. Life Sci. 63, 2317–2328.




http://refhub.elsevier.com/S0012-1606(15)00016-0/sbref1












































































Ghildiyal, M., Zamore, P.D., 2009. Small silencing RNAs: an expanding universe. Nat.Rev. Genet. 10, 94–108.

Giraldez, A.J., Cinalli, R.M., Glasner, M.E., Enright, A.J., Thomson, J.M., Baskerville, S.,Hammond, S.M., Bartel, D.P., Schier, A.F., 2005. MicroRNAs regulate brainmorphogenesis in zebrafish. Science 308, 833–838.

Gonzalez, D.M., Medici, D., 2014. Signaling mechanisms of the epithelial-mesenchymal transition. Sci. Signal. 7, re8.

Gregory, P.A., Bert, A.G., Paterson, E.L., Barry, S.C., Tsykin, A., Farshid, G., Vadas, M.A.,Khew-Goodall, Y., Goodall, G.J., 2008. The miR-200 family and miR-205 regulateepithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat. Cell Biol.10, 593–601.

Gross, J.M., McClay, D.R., 2001. The role of Brachyury (T) during gastrulationmovements in the sea urchin Lytechinus variegatus. Dev. Biol. 239, 132–147.

Guo, H., Ingolia, N.T., Weissman, J.S., Bartel, D.P., 2010. Mammalian microRNAspredominantly act to decrease target mRNA levels. Nature 466, 835–840.

Gustafson, E.A., Wessel, G.M., 2010. Exogenous RNA is selectively retained in thesmall micromeres during sea urchin embryogenesis. Mol. Reprod. Dev. 77, 836.

Hashimi, S.T., Fulcher, J.A., Chang, M.H., Gov, L., Wang, S., Lee, B., 2009. MicroRNAprofiling identifies miR-34a and miR-21 and their target genes JAG1 and WNT1in the coordinate regulation of dendritic cell differentiation. Blood 114,404–414.

Hendrickson, D.G., Hogan, D.J., McCullough, H.L., Myers, J.W., Herschlag, D., Ferrell,J.E., Brown, P.O., 2009. Concordant regulation of translation and mRNAabundance for hundreds of targets of a human microRNA. PLoS Biol. 7,e1000238.

Hinman, V.F., Degnan, B.M., 1998. Retinoic acid disrupts anterior ectodermal andendodermal development in ascidian larvae and postlarvae. Dev. Genes Evol.208, 336–345.

Hiruta, J., Mazet, F., Yasui, K., Zhang, P., Ogasawara, M., 2005. Comparativeexpression analysis of transcription factor genes in the endostyle of inverte-brate chordates. Dev. Dyn. 233, 1031–1037.

Howard, E.W., Newman, L.A., Oleksyn, D.W., Angerer, R.C., Angerer, L.M., 2001.SpKrl: a direct target of beta-catenin regulation required for endodermdifferentiation in sea urchin embryos. Development 128, 365–375.

Huang, K., Zhang, J.-X., Han, L., You, Y.-P., Jiang, T., Pu, P.-Y., Kang, C.-S., 2010.MicroRNA roles in beta-catenin pathway. Mol. Cancer, 9.

Imai, K., Takada, N., Satoh, N., Satou, Y., 2000. (beta)-catenin mediates thespecification of endoderm cells in ascidian embryos. Development 127,3009–3020.

Incassati, A., Chandramouli, A., Eelkema, R., Cowin, P., 2010. Key signaling nodes inmammary gland development and cancer: beta-catenin. Breast Cancer Res. 12,213.

Kennell, J.A., Gerin, I., MacDougald, O.A., Cadigan, K.M., 2008. The microRNA miR-8is a conserved negative regulator of Wnt signaling. Proc. Natl. Acad. Sci. USA105, 15417–15422.

Kim, W., Kim, M., Jho, E.H., 2013. Wnt/beta-catenin signalling: from plasmamembrane to nucleus. Biochem. J. 450, 9–21.

Koga, H., Matsubara, M., Fujitani, H., Miyamoto, N., Komatsu, M., Kiyomoto, M.,Akasaka, K., Wada, H., 2010. Functional evolution of Ets in echinoderms withfocus on the evolution of echinoderm larval skeletons. Dev. Genes Evol. 220,107–115.

Komiya, Y., Habas, R., 2008. Wnt signal transduction pathways. Organogenesis 4,68–75.

Kumano, G., Nishida, H., 1998. Maternal and zygotic expression of the endoderm-specific alkaline phosphatase gene in embryos of the ascidian, Halocynthiaroretzi. Dev. Biol. 198, 245–252.

Kurokawa, D., Kitajima, T., Mitsunaga-Nakatsubo, K., Amemiya, S., Shimada, H.,Akasaka, K., 1999. HpEts, an ets-related transcription factor implicated inprimary mesenchyme cell differentiation in the sea urchin embryo. Mech.Dev. 80, 41–52.

Larabell, C.A., Torres, M., Rowning, B.A., Yost, C., Miller, J.R., Wu, M., Kimelman, D.,Moon, R.T., 1997. Establishment of the dorso-ventral axis in Xenopus embryosis presaged by early asymmetries in beta-catenin that are modulated by theWnt signaling pathway. J. Cell Biol. 136, 1123–1136.

Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Radmark, O., Kim,S., Kim, V.N., 2003. The nuclear RNase III Drosha initiates microRNA processing.Nature 425, 415–419.

Liu, J., 2008. Control of protein synthesis and mRNA degradation by microRNAs.Curr. Opin. Cell Biol. 20, 214–221.

Liu, Y.C., Lai, W.C., Chuang, K.A., Shen, Y.J., Hu, W.S., Ho, C.H., Chen, Y.B., Hsu, M.F.,Hsu, H.C., Lieu, C.H., 2010. Blockade of JAK2 activity suppressed accumulation ofbeta-catenin in leukemic cells. J. Cell. Biochem. 111, 402–411.

Livi, C.B., Davidson, E.H., 2006. Expression and function of blimp1/krox, analternatively transcribed regulatory gene of the sea urchin endomesodermnetwork. Dev. Biol. 293, 513–525.

Logan, C.Y., McClay, D.R., 1997. The allocation of early blastomeres to the ectodermand endoderm is variable in the sea urchin embryo. Development 124,2213–2223.

Logan, C.Y., Miller, J.R., Ferkowicz, M.J., McClay, D.R., 1999. Nuclear beta-catenin isrequired to specify vegetal cell fates in the sea urchin embryo. Development126, 345–357.

Logan, C.Y., Nusse, R., 2004. The Wnt signaling pathway in development anddisease. Annu. Rev. Cell Dev. Biol. 20, 781–810.

MacDonald, B.T., Tamai, K., He, X., 2009. Wnt/beta-catenin signaling: components,mechanisms, and diseases. Dev. Cell 17, 9–26.

Materna, S.C., Davidson, E.H., 2012. A comprehensive analysis of Delta signaling inpre-gastrular sea urchin embryos. Dev. Biol. 364, 77–87.

Materna, S.C., Oliveri, P., 2008. A protocol for unraveling gene regulatory networks.Nat. Protoc. 3, 1876–1887.

McClay, D.R., Cannon, G.W., Wessel, G.M., Fink, R.D., Marchase, R.B., 1983. Patternsof antigenic expression in early sea urchin development. In: Jeffery, W.R., Raff,R.A. (Eds.), Time, Space, and Pattern in Embryonic Development. A.R. Liss, NewYork, pp. 157–169.

Minokawa, T., Rast, J.P., Arenas-Mena, C., Franco, C.B., Davidson, E.H., 2004.Expression patterns of four different regulatory genes that function duringsea urchin development. Gene Expr. Patterns 4, 449–456.

Moon, R.T., 2005. Wnt/beta-catenin pathway. Sci. STKE, 2005 (cm1).Moon, R.T., Kohn, A.D., De Ferrari, G.V., Kaykas, A., 2004. WNT and beta-catenin

signalling: diseases and therapies. Nat. Rev. Genet. 5, 691–701.Mukherji, S., Ebert, M.S., Zheng, G.X., Tsang, J.S., Sharp, P.A., van Oudenaarden, A.,

2011. MicroRNAs can generate thresholds in target gene expression. Nat. Genet.43, 854–859.

Nelson, W.J., Nusse, R., 2004. Convergence of Wnt, beta-catenin, and cadherinpathways. Science 303, 1483–1487.

Nicolas, F.E., 2011. Experimental validation of microRNA targets using a luciferasereporter system. Methods Mol. Biol. 732, 139–152.

Nishida, H., Kumano, G., 1997. Analysis of the temporal expression of endoderm-specific alkaline phosphatase during development of the ascidian Halocynthiaroretzi. Dev. Growth Differ. 39, 199–205.

Oliveri, P., Davidson, E.H., McClay, D.R., 2003. Activation of pmar1 controlsspecification of micromeres in the sea urchin embryo. Dev. Biol. 258, 32–43.

Oliveri, P., Walton, K.D., Davidson, E.H., McClay, D.R., 2006. Repression of meso-dermal fate by foxa, a key endoderm regulator of the sea urchin embryo.Development 133, 4173–4181.

Orsulic, S., Huber, O., Aberle, H., Arnold, S., Kemler, R., 1999. E-cadherin bindingprevents beta-catenin nuclear localization and beta-catenin/LEF-1-mediatedtransactivation. J. Cell Sci. 112 (Part 8), 1237–1245.

Paul, I., Bhattacharya, S., Chatterjee, A., Ghosh, M.K., 2013. Current understandingon EGFR and Wnt/beta-Catenin signaling in glioma and their possible crosstalk.Genes Cancer 4, 427–446.

Pelosi, A., Careccia, S., Lulli, V., Romania, P., Marziali, G., Testa, U., Lavorgna, S., Lo-Coco, F., Petti, M.C., Calabretta, B., Levrero, M., Piaggio, G., Rizzo, M.G., 2013.miRNA let-7c promotes granulocytic differentiation in acute myeloid leukemia.Oncogene 32, 3648–3654.

Peng, C.J., Wikramanayake, A.H., 2013. Differential regulation of disheveled in anovel vegetal cortical domain in sea urchin eggs and embryos: implications forthe localized activation of canonical Wnt signaling. PLoS One 8, e80693.

Peter, I.S., Davidson, E.H., 2010. The endoderm gene regulatory network in seaurchin embryos up to mid-blastula stage. Dev. Biol. 340, 188–199.

Peter, I.S., Davidson, E.H., 2011. A gene regulatory network controlling theembryonic specification of endoderm. Nature 474, 635–639.

Petersen, C.P., Reddien, P.W., 2009. Wnt signaling and the polarity of the primarybody axis. Cell 139, 1056–1068.

Rajewsky, N., 2006. microRNA target predictions in animals. Nat. Genet. 38 (Suppl.),S8–S13.

Range, R.C., Angerer, R.C., Angerer, L.M., 2013. Integration of canonical andnoncanonical Wnt signaling pathways patterns the neuroectoderm along theanterior–posterior axis of sea urchin embryos. PLoS Biol. 11, e1001467.

Ransick, A., Davidson, E.H., 1998. Late specification of Veg1 lineages to endodermalfate in the sea urchin embryo. Dev. Biol. 195, 38–48.

Ransick, A., Davidson, E.H., 2006. cis-regulatory processing of Notch signaling inputto the sea urchin glial cells missing gene during mesoderm specification. Dev.Biol. 297, 587–602.

Revilla-I-Domingo, R., Oliver, P., Davidson, E.H., 2007. A missing link in the seaurchin embryo gene regulatory network: hesC and the double-negativespecification of micromeres. Proc. Natl. Acad. Sci. USA 104, 12383–12388.

Roeser, T., Stein, S., Kessel, M., 1999. Nuclear beta-catenin and the development ofbilateral symmetry in normal and LiCl-exposed chick embryos. Development126, 2955–2965.

Rowning, B.A., Wells, J., Wu, M., Gerhart, J.C., Moon, R.T., Larabell, C.A., 1997.Microtubule-mediated transport of organelles and localization of beta-cateninto the future dorsal side of Xenopus eggs. Proc. Natl. Acad. Sci. USA 94,1224–1229.

Rozen, S., Skaletsky, H., 2000. Primer3 on the WWW for general users and forbiologist programmers. Methods Mol. Biol. 132, 365–386.

Samanta, M.P., Tongprasit, W., Istrail, S., Cameron, R.A., Tu, Q., Davidson, E.H., Stolc,V., 2006. Report – The transcriptome of the sea urchin embryo. Science 314,960–962.

Saurat, N., Andersson, T., Vasistha, N.A., Molnar, Z., Livesey, F.J., 2013. Dicer isrequired for neural stem cell multipotency and lineage progression duringcerebral cortex development. Neural Dev. 8, 14.

Saydam, O., Shen, Y., Wurdinger, T., Senol, O., Boke, E., James, M.F., Tannous, B.A.,Stemmer-Rachamimov, A.O., Yi, M., Stephens, R.M., Fraefel, C., Gusella, J.F.,Krichevsky, A.M., Breakefield, X.O., 2009. Downregulated microRNA-200a inmeningiomas promotes tumor growth by reducing E-cadherin and activatingthe Wnt/beta-catenin signaling pathway. Mol. Cell Biol. 29, 5923–5940.

Schneider, S., Steinbeisser, H., Warga, R.M., Hausen, P., 1996. Beta-catenin translo-cation into nuclei demarcates the dorsalizing centers in frog and fish embryos.Mech. Dev. 57, 191–198.















































































































































































Selbach, M., Schwanhaeusser, B., Thierfelder, N., Fang, Z., Khanin, R., Rajewsky, N.,2008. Widespread changes in protein synthesis induced by microRNAs. Nature455, 58–63.

Sharma, T., Ettensohn, C.A., 2010. Activation of the skeletogenic gene regulatorynetwork in the early sea urchin embryo. Development 137, 1149–1157.

Sharma, T., Ettensohn, C.A., 2011. Regulative deployment of the skeletogenic generegulatory network during sea urchin development. Development 138,2581–2590.

Sherwood, D.R., McClay, D.R., 1999. LvNotch signaling mediates secondarymesenchyme specification in the sea urchin embryo. Development 126,1703–1713.

Silver, S.J., Hagen, J.W., Okamura, K., Perrimon, N., Lai, E.C., 2007. Functionalscreening identifies miR-315 as a potent activator of Wingless signaling. Proc.Natl. Acad. Sci. USA 104, 18151–18156.

Smith, J., Kraemer, E., Liu, H., Theodoris, C., Davidson, E., 2008. A spatially dynamiccohort of regulatory genes in the endomesodermal gene network of the seaurchin embryo. Dev. Biol. 313, 863–875.

Smith, J., Theodoris, C., Davidson, E.H., 2007. A gene regulatory network subcircuitdrives a dynamic pattern of gene expression. Science 318, 794–797.

Sodergren, E., Weinstock, G.M., Davidson, E.H., Cameron, R.A., Gibbs, R.A., Angerer, R.C.,Angerer, L.M., Arnone, M.I., Burgess, D.R., Burke, R.D., Coffman, J.A., Dean, M.,Elphick, M.R., Ettensohn, C.A., Foltz, K.R., Hamdoun, A., Hynes, R.O., Klein, W.H.,Marzluff, W., McClay, D.R., Morris, R.L., Mushegian, A., Rast, J.P., Smith, L.C.,Thorndyke, M.C., Vacquier, V.D., Wessel, G.M., Wray, G., Zhang, L., Elsik, C.G.,Ermolaeva, O., Hlavina, W., Hofmann, G., Kitts, P., Landrum, M.J., Mackey, A.J.,Maglott, D., Panopoulou, G., Poustka, A.J., Pruitt, K., Sapojnikov, V., Song, X.,Souvorov, A., Solovyev, V., Wei, Z., Whittaker, C.A., Worley, K., Durbin, K.J., Shen, Y.,Fedrigo, O., Garfield, D., Haygood, R., Primus, A., Satija, R., Severson, T., Gonzalez-Garay, M.L., Jackson, A.R., Milosavljevic, A., Tong, M., Killian, C.E., Livingston, B.T.,Wilt, F.H., Adams, N., Belle, R., Carbonneau, S., Cheung, R., Cormier, P., Cosson, B.,Croce, J., Fernandez-Guerra, A., Geneviere, A.-M., Goel, M., Kelkar, H., Morales, J.,Mulner-Lorillon, O., Robertson, A.J., Goldstone, J.V., Cole, B., Epel, D., Gold, B., Hahn,M.E., Howard-Ashby, M., Scally, M., Stegeman, J.J., Allgood, E.L., Cool, J., Judkins, K.M., McCafferty, S.S., Musante, A.M., Obar, R.A., Rawson, A.P., Rossetti, B.J., Gibbons,I.R., Hoffman, M.P., Leone, A., Istrail, S., Materna, S.C., Samanta, M.P., Stolc, V.,Tongprasit, W., Tu, Q., Bergeron, K.-F., Brandhorst, B.P., Whittle, J., Berney, K.,Bottjer, D.J., Calestani, C., Peterson, K., Chow, E., Yuan, Q.A., Elhaik, E., Graur, D.,Reese, J.T., Bosdet, I., Heesun, S., Marra, M.A., Schein, J., Anderson, M.K., Brockton,V., Buckley, K.M., Cohen, A.H., Fugmann, S.D., Hibino, T., Loza-Coll, M., Majeske, A.J.,Messier, C., Nair, S.V., Pancer, Z., Terwilliger, D.P., Agca, C., Arboleda, E., Chen, N.,Churcher, A.M., Hallbook, F., Humphrey, G.W., Idris, M.M., Kiyama, T., Liang, S.,Mellott, D., Mu, X., Murray, G., Olinski, R.P., Raible, F., Rowe, M., Taylor, J.S., Tessmar-Raible, K., Wang, D., Wilson, K.H., Yaguchi, S., Gaasterland, T., Galindo, B.E.,Gunaratne, H.J., Juliano, C., Kinukawa, M., Moy, G.W., Neill, A.T., Nomura, M.,Raisch, M., Reade, A., Roux, M.M., Song, J.L., Su, Y.-H., Townley, I.K., Voronina, E.,Wong, J.L., Amore, G., Branno, M., Brown, E.R., Cavalieri, V., Duboc, V., Duloquin, L.,Flytzanis, C., Gache, C., Lapraz, F., Lepage, T., Locascio, A., Martinez, P., Matassi, G.,Matranga, V., Range, R., Rizzo, F., Rottinger, E., Beane, W., Bradham, C., Byrum, C.,Glenn, T., Hussain, S., Manning, G., Miranda, E., Thomason, R., Walton, K.,Wikramanayke, A., Wu, S.-Y., Xu, R., Brown, C.T., Chen, L., Gray, R.F., Lee, P.Y.,Nam, J., Oliveri, P., Smith, J., Muzny, D., Bell, S., Chacko, J., Cree, A., Curry, S.,Davis, C., Dinh, H., Dugan-Rocha, S., Fowler, J., Gill, R., Hamilton, C., Hernandez, J.,Hines, S., Hume, J., Jackson, L., Jolivet, A., Kovar, C., Lee, S., Lewis, L., Miner, G.,Morgan, M., Nazareth, L.V., Okwuonu, G., Parker, D., Pu, L.-L., Thorn, R., Sea,Wright, R., Urchin Genome Sequencing, C., 2006. The genome of the sea urchinStrongylocentrotus purpuratus. Science (New York, N.Y.) 314, 941–952.

Song, J.L., Stoeckius, M., Maaskola, J., Friedlander, M., Stepicheva, N., Juliano, C.,Lebedeva, S., Thompson, W., Rajewsky, N., Wessel, G.M., 2012. Select microRNAsare essential for early development in the sea urchin. Dev. Biol. 362, 104–113.

Staton, A.A., Giraldez, A.J., 2011. Use of target protector morpholinos to analyze thephysiological roles of specific miRNA–mRNA pairs in vivo. Nat. Protoc. 6,2035–2049.

Stepicheva, N.A., Song, J.L., 2014. High throughput microinjections of sea urchinzygotes. J. Vis. Exp.

Sweet, H.C., Gehring, M., Ettensohn, C.A., 2002. LvDelta is a mesoderm-inducingsignal in the sea urchin embryo and can endow blastomeres with organizer-likeproperties. Development 129, 1945–1955.

Sweet, H.C., Hodor, P.G., Ettensohn, C.A., 1999. The role of micromere signaling inNotch activation and mesoderm specification during sea urchin embryogenesis.Development 126, 5255–5265.

Tajbakhsh, S., Borello, U., Vivarelli, E., Kelly, R., Papkoff, J., Duprez, D., Buckingham,M., Cossu, G., 1998. Differential activation of Myf5 and MyoD by different Wntsin explants of mouse paraxial mesoderm and the later activation of myogenesisin the absence of Myf5. Development 125, 4155–4162.

Thatcher, E.J., Paydar, I., Anderson, K.K., Patton, J.G., 2008. Regulation of zebrafishfin regeneration by microRNAs. Proc. Natl. Acad. Sci. USA 105, 18384–18389.

von Maltzahn, J., Chang, N.C., Bentzinger, C.F., Rudnicki, M.A., 2012. Wnt signaling inmyogenesis. Trends Cell Biol. 22, 602–609.

Vonica, A., Weng, W., Gumbiner, B.M., Venuti, J.M., 2000. TCF is the nuclear effectorof the beta-catenin signal that patterns the sea urchin animal–vegetal axis. Dev.Biol. 217, 230–243.

Wahl, M.E., Hahn, J., Gora, K., Davidson, E.H., Oliveri, P., 2009. The cis-regulatorysystem of the tbrain gene: alternative use of multiple modules to promoteskeletogenic expression in the sea urchin embryo. Dev. Biol. 335, 428–441.

Wang, D., Zhang, H., Li, M., Frid, M.G., Flockton, A.R., McKeon, B.A., Yeager, M.E., Fini,M.A., Morrell, N.W., Pullamsetti, S.S., Velegala, S., Seeger, W., McKinsey, T.A.,Sucharov, C.C., Stenmark, K.R., 2014. MicroRNA-124 controls the proliferative,migratory, and inflammatory phenotype of pulmonary vascular fibroblasts.Circ. Res. 114, 67–78.

Wang, T., Xu, Z., 2010. miR-27 promotes osteoblast differentiation by modulatingWnt signaling. Biochem. Biophys. Res. Commun. 402, 186–189.

Wessel, G.M., McClay, D.R., 1985. Sequential expression of germ-layer specificmolecules in the sea urchin embryo. Dev. Biol. 111, 451–463.

Wessel, G.M., Zhang, W., Klein, W.H., 1990. Myosin heavy chain accumulates indissimilar cell types of the macromere lineage in the sea urchin embryo. Dev.Biol. 140, 447–454.

Wheeler, B.M., Heimberg, A.M., Moy, V.N., Sperling, E.A., Holstein, T.W., Heber, S.,Peterson, K.J., 2009. The deep evolution of metazoan microRNAs. Evol. Dev. 11,50–68.

Whittaker, J.R., 1990. Determination of alkaline phosphatase expression in endo-dermal cell lineages of an ascidian embryo. Biol. Bull. 178, 222–230.

Wikramanayake, A.H., Huang, L., Klein, W.H., 1998. beta-Catenin is essential forpatterning the maternally specified animal–vegetal axis in the sea urchinembryo. Proc. Natl. Acad. Sci. USA 95, 9343–9348.

Wikramanayake, A.H., Peterson, R., Chen, J., Huang, L., Bince, J.M., McClay, D.R.,Klein, W.H., 2004. Nuclear beta-catenin-dependent Wnt8 signaling in vegetalcells of the early sea urchin embryo regulates gastrulation and differentiation ofendoderm and mesodermal cell lineages. Genesis 39, 194–205.

Xia, H., Ng, S.S., Jiang, S., Cheung, W.K., Sze, J., Bian, X.W., Kung, H.F., Lin, M.C., 2010.miR-200a-mediated downregulation of ZEB2 and CTNNB1 differentially inhi-bits nasopharyngeal carcinoma cell growth, migration and invasion. Biochem.Biophys. Res. Commun. 391, 535–541.

Yaguchi, S., Yaguchi, J., Angerer, R.C., Angerer, L.M., 2008. A Wnt-FoxQ2-nodalpathway links primary and secondary axis specification in sea urchin embryos.Dev. Cell 14, 97–107.

Zeng, G., Germinaro, M., Micsenyi, A., Monga, N.K., Bell, A., Sood, A., Malhotra, V.,Sood, N., Midda, V., Monga, D.K., Kokkinakis, D.M., Monga, S.P., 2006. AberrantWnt/beta-catenin signaling in pancreatic adenocarcinoma. Neoplasia 8,279–289.

Zhao, J.-X., Yue, W.-F., Zhu, M.-J., Du, M., 2011. AMP-activated protein kinaseregulates beta-catenin transcription via histone deacetylase. J. Biol. Chem. 5,286.
































































































































Documents

microRNAs regulate β-catenin of the Wnt signaling pathway ...€¦ · microRNAs regulate β-catenin of the Wnt signaling pathway in early sea urchin development Nadezda Stepichevaa,