miRNA Profiling to Distinguish Bodily FluidsRachel Markert

(http://3.bp.blogspot.com/_hVwPMMFDypI/TDNojHnNzlI/AAAAAAAAAJI/AGLt4p6EyRc/s1600/Forensics+front.jpg)

(http://4.bp.blogspot.com/-XQlCMNOapwI/TjZo_XTWemI/AAAAAAAABVI/yPhPQyjOqDY/s1600/blood.jpg)

Purpose of Experiment

• Use miRNA in forensic applications by recovering miRNA from samples obtained for forensics and identifying the bodily fluid it came from.

• Prove that miRNA assaying can be cheaper, easier, and overall capable in forensic labs.

(http://www.kenoshapolice.com/UserFiles/image/crime%20scene.jpg)

Forensic Background• Forensic investigations often involve body fluids, such as blood and

saliva• These fluids contain mRNAs and more stable miRNAs• Fluids can connect suspects to crime scenes or victims and miRNAs

is easier and faster than other methods

(http://www.leelofland.com/wordpress/wp-content/uploads/2011/07/New-Picture-67.jpg)

Micro-RNA Background• Small noncoding RNA• Used in cellular processes, posttranslational• miRNA regulation used for controlling gene expression. • Binds to mRNA

(http://cnx.org/content/m36053/latest/mirna.png)

Experiment: Step 1• Fluids were obtained through buccal swabs for saliva and vacutainer tubes for blood.• The microarray method used fluids from 4 females and 1 male• Verification by PCR used samples from 3 females and 2 males• Aged blood was made from one sample over one year

(http://anotherstudentdoctor.files.wordpress.com/2010/09/vacutainer.jpg)

(http://www.dnares.in/images/header/buccal-swab-collection.jpg)

Experiment: Step 2• Extraction of RNA from all samples• Enriched for miRNAs with kits• Buffer used to remove erythrocytes from blood• RNA concentration was found using RNA integrity number

(RIN) from fluorometer and bioanalyzer

Experiment: Step 3• Microarrays were used • Probes were created as

reverse complements of miRNAs from known human sequences• Positive results for blood

and saliva were selected for from respective arrays

http://www.biolab.cn/uploads/1/Image/20090606110818709.gif

Experiment: Step 4• RT-PCR was done on each selected sample for both blood and

saliva• From before, miRNA was extracted again• cDNA was created by reverse transcriptase after

polyadenylation by poly (A) polymerase• Oligo-dT primers were used to tag the 5’ end for quantitative

PCR

Courts et al. (2011)

TABLE 1 — B o d y -flu id identification assay p an els .

B o d y -F lu id ⁄ Task Assay Name Sequence R efe re n ce s

Blood miR-126 UCGUACCGUGAGUAAUAAUGCG (4,13) miR-150 UCUCCCAACCCUUGUACCAGUG (4,13) miR-451 AAACCGUUACCAUUACUGAGUU (4,14,15)

Saliva miR-200c UAAUACUGCCGGGUAAUGAUGGA (4,16–18) miR-203 GUGAAAUGUUUAGGACCACUAG (4,19,20) miR-205 UCCUUCAUUCCACCGGAGUCUG (4,18,19,21)

Normalization RNU6b CTGCGCAAGGATGACACGCAAATTCGTG AAGCGTTCCATATTTTT

(22,23

Experiment: Step 5• Mathematical equations were carried out for hierarchical

clustering

Var(t) is sample variance Var (t,i) is variance in group i, calculated already

Normalization for qPCR

g

i

it

ttS

1

),var(

)var()(

)6()( bRNUCtmiRNACtCt

)()( 21 fluidbodyfluidbody miRNACtmiRNACtC

Courts et al. (2011)

Courts et al. (2011)

Courts et al. (2011)

FIG. 5—Expression of candidate miRNAs in different kinds of tissue.Upper panel: Normalized median expression of the three blood-miRNAs(miR-126, miR-150, miR-451) in blood, saliva, liver, muscle and brainLower panel: Normalized median expression of the three saliva-miRNAs(miR-200c, miR-203, miR-205) in blood, saliva, liver, muscle and brain.

FIG. 4—qPCR validation of candidate miRNAs for blood and saliva.Upper panel: relative expression of blood candidate miRNAs in blood comparedto saliva, for which expression has been arbitrarily set to 0; Centralpanel: relative expression of blood candidate miRNAs in aged blood comparedto saliva for which expression has been arbitrarily set to 0; Lowerpanel: relative expression of saliva candidate miRNAs in saliva comparedto blood for which expression has been arbitrarily set to 0.

Results• As seen previously, 3 candidates from both blood and saliva

contained specific miRNAs • Aged blood also resulted in miRNA assay, proving that miRNA

could withstand some degradation• A mixed sample of blood and saliva resulted in distinguishing

between the two types of samples

Future Applications• Hopefully, widespread use in forensic labs• Standardization of the procedure for validation and optimal

processes for distinction• More research into other body fluids, such as semen, vaginal

secretions, and menstrual blood• Use especially in rape cases

http://www.fresnosheriff.org/images/Forensic-Lab-Technologist.jpg

References• Courts, C; Madea, B. “Specific micro-RNA signatures for the

detection of saliva and blood in forensic body-fluid identification.” J Forensic Sci. v.56 no. 6 p. 1464-1470. 2011.

• Landgraf , P; Rusu , M; Sheridan , R; et al. “A mammalian microRNA expression atlas based on small RNA library sequencing.” Cell. v. 129 no. 7 p. 1401–14. 2007.