Nuove acquisizioni per la gestione delle risorse genetiche ...· flanking sequenze Microsatellite

  • View
    213

  • Download
    0

Embed Size (px)

Text of Nuove acquisizioni per la gestione delle risorse genetiche ...· flanking sequenze Microsatellite

Nuove acquisizioni per la gestione delle risorse genetiche animali

Dipartimento di Scienze Zootecniche, Universita di Sassari

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Punti essenziali

Mappa del geno ma

Individuazione se gmenti cromosomici o geni convolti nell espressione di caratteri di interesse zootecnico

Selezione assistita da marcatori

Dipartimento di Scienze Zootecniche, Universita di Sassari

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Zhao et al. 1999. Animal genetics, 30:251-257.

Dipartimento di Scienze Zootecniche, Universita di Sassari

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Strumenti utilizzati per la ricerca di QTLs:i Microsatelliti

Al 1 ACCCATGCAGATCCACTGAAATGTACTAATGTGTGTGTGTGTGTGTGTGTGTGTGTGCCAGCATAAACGATCCATAA

Al 2 ACCCATGCAGATCCACTGAAATGTACTAATGTGTGTGTGTGTGTGTGTGCCAGCATAAACGATCCATAAGTAATGAT

Microsatellite (14 repeats)flanking sequenze flanking sequenze

Microsatellite (10 repeats)75 bp

67 bp

Marcatori Codominanti frequenti nei genomi degli eucarioti Dotati di elevato grado di polimorfismo Possono essere amplificati mediante PCRSono necessarie piccole quntit di DNA (da pelo, sangue, seme, saliva)Lanalisi pu essere automatizzata e i dati possono essere memorizzati ed elaborati al computer.

Dipartimento di Scienze Zootecniche, Universita di Sassari

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Ricerca di QTL e geni 1990-2000Mappe sparse

150-200 marcatori (uno ogni 20-15 cM per il genoma bovino)

Tradizionalmente usate per la ricerca di QTLs con whole genome scan

In un intervallo di 20 cM possono e ssere compresi sino a 50-60 geni

Dipartimento di Scienze Zootecniche, Universita di Sassari

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Ricerca di QTLs sul cromosoma 6 bovinoOlsen et al., J. Dairy Sci., 2002

Dipartimento di Scienze Zootecniche, Universita di Sassari

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Carattere Geni QTLAcidi grassi 28 11caseine 38CCS 49 142Grasso kg 141 169Grasso % 158 172Latte 142 271Proteina kg 143 171Proteina % 98 354

Localizzazione diversi geni e QTLs

Dipartimento di Scienze Zootecniche, Universita di Sassari

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

MessineseMessinese

Argentata dellEtna

Aspromonte

Rossa Mediterranea

GirgentanaGirgentana

MalteseMaltese

90.890.8

95.595.559.759.7

A. Crescione, tesi di dottoratoA. Crescione, tesi di dottoratoUso di microsatelliti per lo studio delle distanze genetiche f ra razze

Dipartimento di Scienze Zootecniche, Universita di Sassari

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Geni che influenzano caratteri di interesse economico: il gene SCD

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Geni con effetto su caratteri di interesse economico:il gene SCD

Latte (kg/d)

Proteina (kg/d)

SCD Media MediaAA 33.86 A 1.110 A

AV 34.52 A 1.126 A

VV 36.13 B 1.1180 B

Macciotta et al., J. Dairy Sci., 2008

Dipartimento di Scienze Zootecniche, Universita di Sassari

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Selezione assistita da marcatori molecolari: razionale

Integrazione delle informazioni della genetica molecolare negli schemi di selezione per aumentarne lefficacia

Selezione precoce dei riproduttori

Selezione di caratteri di difficile e costosa misurazione

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Potenziale impatto sul progresso geneti co

Aumento dellaccuratezza della stima del valore genetico

Riduzione dellintervallo di genera zione

Ti

G g

=

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Potenzialit della MAS (Meuwissen e Goddard, 1996)

Disponibilit records

Generazione Selezione individuale

Selezione familiare

1 108 138

2 106 131

3 104 125

4 102 116

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Marcatori ravvicinati sul cromosoma (

Single Nucleotid e Polymorphisms (SNPS)

Dipartimento di Scienze Zootecniche, Universita di Sassari

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Analisi contemporanea di decine di migliaia di SNPs con i DNA chip

Dipartimento di Scienze Zootecniche, Universita di Sassari

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

SNP1 SNP2 SNP3 SNP4 SNP5

I1 I3I2 I4 I5

Suddivisione del genoma in intervalli discreti di frazione di cM delimitati da marcatori

.SNP201

I200

Uso delle mappe dense per il mi glioramento geneti co la Genome-wide Selection

(Meuwissen, Hayes and Goddard, 2001)

Dipartimento di Scienze Zootecniche, Universita di Sassari

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Stima puntuale degli effetti

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Intervalli/aplotipi possibili

1 1

1 2

2 1

2 2

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Stima degli effetti degli aplotipi

Aplotipo Int. 1 Int. 2 Int. 3 Int. 41 1 +0.01 +1.03 +6.35 +0.891 2 +0.06 +0.74 +2.19 +0.672 1 -0.07 -0.36 +0.05 -0.582 2 +0.00 -1.41 -8.59 -0.98

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

GEBV dellanimale A

Aplotipo Int. 1 Int. 2 Int. 3 Int. 41 1 +0.01 +1.03 +6.35 +0.891 2 +0.06 +0.74 +2.19 +0.672 1 -0.07 -0.36 +0.05 -0.582 2 +0.00 -1.41 -8.59 -0.98

Animale A 1 1 1 2 2 2 2 1

0.01 + 0.74 - 8.59 - 0.58

GEBV = -8.42

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

GEBV dellanimale B

Aplotipo Int. 1 Int. 2 Int. 3 Int. 41 1 +0.01 +1.03 +6.35 +0.891 2 +0.06 +0.74 +2.19 +0.672 1 -0.07 -0.36 +0.05 -0.582 2 +0.00 -1.41 -8.59 -0.98

Animal B 1 2 2 1 1 1 1 2

0.06 - 0.36 + 6.35 + 0.67

GEBV = +6.72

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Possibile valutazione genetica per cromosomaNet Merit by Chromosome for O Man

Top bull for Net Merit

-40

-20

0

20

40

60

80

X 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30

Chromosome

NM

$

NM$

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22

Altre applicazioni delle mappe dense: la ri costruzione della parentela con un panel di circa 9000SNPs

Hayes e Goddard, 2008

Dipartimento di Scienze Zootecniche, Universita di Sassari

http://www.pdfcomplete.com/cms/hppl/tabid/108/Default.aspx?r=q8b3uige22