Phytoestrogen Suppresses Efflux of the Diagnostic Marker ... · device camera (Axio-Cam CCD camera, Zeiss). The filter combi-nations were a 450-nm excitation filter, 510-nm beam

Molecular and Cellular Pathobiology

Phytoestrogen Suppresses Efflux of theDiagnostic Marker Protoporphyrin IX inLung CarcinomaHirofumi Fujita1, Keisuke Nagakawa1, Hirotsugu Kobuchi2, Tetsuya Ogino3,Yoichi Kondo1, Keiji Inoue4, Taro Shuin4, Toshihiko Utsumi5, Kozo Utsumi1,†,Junzo Sasaki1, and Hideyo Ohuchi1

Abstract

One promising method to visualize cancer cells is based on thedetection of the fluorescent photosensitizer protoporphyrin IX(PpIX) synthesized from 5-aminolevulinic acid (ALA), but thismethod cannot be used in cancers that exhibit poor PpIXaccumulation. PpIX appears to be pumped out of cancer cells bythe ABC transporter G2 (ABCG2), which is associated withmultidrug resistance. Genistein is a phytoestrogen that appearsto competitively inhibit ABCG2 activity. Therefore, we investigat-ed whether genistein can promote PpIX accumulation in humanlung carcinoma cells. Here we report that treatment of A549 lungcarcinoma cells with genistein or a specific ABCG2 inhibitorpromoted ALA-mediated accumulation of PpIX by approximately2-fold. ABCG2 depletion and overexpression studies furtherrevealed that genistein promoted PpIX accumulation via func-tional repression of ABCG2. After an extended period of genistein

treatment, a significant increase in PpIX accumulation wasobserved in A549 cells (3.7-fold) and in other cell lines. Systemicpreconditioning with genistein in a mouse xenograft model oflung carcinoma resulted in a 1.8-fold increase in accumulatedPpIX. Long-term genistein treatment stimulated the expressionof genes encoding enzymes involved in PpIX synthesis, such asporphobilinogen deaminase, uroporphyrinogen decarboxyl-ase, and protoporphyrinogen oxidase. Accordingly, the rate ofPpIX synthesis was also accelerated by genistein pretreatment.Thus, our results suggest that genistein treatment effectivelyenhances ALA-induced PpIX accumulation by preventingthe ABCG2-mediated efflux of PpIX from lung cancer cellsand may represent a promising strategy to improve ALA-baseddiagnostic approaches in a broader set of malignancies.Cancer Res; 76(7); 1837–46. �2016 AACR.

IntroductionProtoporphyrin IX (PpIX) functions as a fluorescent photosen-

sitizer, which is synthesized from5-aminolevulinic acid (ALA). AsPpIX preferentially accumulates in malignant tissues (1), theexogenous administration of ALA enables us to detect tumorsexhibiting enhanced PpIX fluorescence. This technology, referredto as photodynamic diagnosis, has been widely used clinically,especially during surgery for bladder cancer (2), prostate cancer

(3), and brain tumors (4), to identify precise tumor margins andprevent overlooking small lesions that are otherwise invisible.However, ALA-based photodynamic diagnosis remains unsatis-factory in diagnosing some tumors that accumulate insufficientamounts of PpIX (5–9).

Successful ALA-induced PpIX accumulation may rely on theactivity of enzymes that synthesize and metabolize PpIX and onthe proteins that transport PpIX (10, 11). Exogenously added ALAis taken up by target cells and metabolized to coproporphyrino-gen III in the cytosol by several enzymes, which include porpho-bilinogen deaminase (PBGD), uroporphyrinogen III synthase(UROS), which is the rate-limiting enzyme of porphyrin metab-olism (12), and uroporphyrinogen decarboxylase (UROD).Coproporphyrinogen III is then translocated into mitochondriathrough ATP-binding cassette (ABC) transporter B6 and metab-olized to PpIX by coproporphyrinogen oxidase (CPOX) andprotoporphyrinogen oxidase (PPOX; refs. 5, 7). PpIX is metab-olized further to heme by ferrochelatase. Furthermore, accumu-lating evidence indicates that the elimination of PpIX from cells iscarried out by ABC transporter G2 (ABCG2), which is amultidrugresistance-associated protein (11). Thus, heme synthesis enzymesand ABCG2 play important roles in regulating the cellular accu-mulationof PpIX in cancer.Our current research goal is to developnew combination regimens with compounds that enhance theaccumulation of PpIX to improve ALA-induced PpIX accumula-tion. A recent study reported that the systemic administrationof vitamin D3 for preconditioning significantly increased the

1Department of Cytology and Histology, Okayama University Gradu-ate School of Medicine, Dentistry and Pharmaceutical Sciences,Okayama, Japan. 2Department of Cell Chemistry,Okayama UniversityGraduate School of Medicine, Dentistry and Pharmaceutical Sciences,Okayama, Japan. 3Department of Nursing Science, Faculty of Healthand Welfare Science, Okayama Prefectural University, Soja, Japan.4Department of Urology, Kochi University Medical School, Nankoku,Kochi, Japan. 5Department of Biological Chemistry, Faculty of Agri-culture, Yamaguchi University, Yamaguchi, Japan.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

H. Fujita and K. Nagakawa contributed equally to this article.

†Deceased.

Corresponding Author: Hirofumi Fujita, Okayama University Graduate School,2-5-1 shilatacho, Kitaku, Okayama 700-8558, Japan. Phone: 818-6235-7081; Fax:818-6235-7079; E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-15-1484

�2016 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 1837

on April 7, 2020. © 2016 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst February 2, 2016; DOI: 10.1158/0008-5472.CAN-15-1484

http://cancerres.aacrjournals.org/

accumulation of PpIX in squamous tumor cell lines both in vitroand in vivo (13). The underlying mechanism involves increases inthe expressionofCPOXanddecreases in that of ferrochelatase.Wepreviously reported that the iron chelator deferoxamine promot-ed the accumulation of PpIX inurothelial carcinoma in vitro and invivo as well as in prostate cancer, oral squamous cell carcinoma,and histiocytic lymphoma in vitro (14–17). Furthermore, theinhibition of ABCG2 by specific inhibitors or knockdown usingRNAi facilitated the ALA-mediated accumulation of PpIX (8, 18,19). Therefore, the use of compounds that stimulate the synthesisof PpIX or block the efflux of PpIXmay become a good strategy toimprove ALA-induced PpIX accumulation.

Estrogens are known to induce porphyria cutanea tarda, whichis characterized clinically by cutaneous photosensitivity and theexcessive excretion of porphyrins (20). This effect of estrogen issupported by the findings of another study using cancer-bearingfemale rats in which estrogen depletion by ovariectomy caused asignificant reduction in ALA-induced PpIX levels and PBGDactivity in tumors (21). On the other hand, a phytoestrogengenistein known as a tyrosine kinase inhibitor was found toexhibit estrogen-like activity by interacting with estrogen recep-tors (ER) in mammals (22–24). Furthermore, a previous studyreported that genistein reversed ABCG2-mediated multidrugresistance and genistein was likely to competitively inhibit theefflux of anticancer agents such as SN-38 and mitoxantrone byABCG2 (25).

These findings prompted us to hypothesize that genisteinpromotes the accumulation of PpIX by increasing the synthesisof PpIX and/or reducing the efflux of PpIX. However, the effects ofgenistein on the accumulation of PpIX have not yet beenelucidated.

Therefore, we herein determined whether genistein increasedthe accumulation of PpIX in vitro and in a xenograft model usingthe human lung carcinoma A549 cell line, which expresses highlevels of the endogenous ABCG2 protein.

Materials and MethodsChemicals

ALA was purchased from COSMO OIL. The iron chelatordeferoxamine, genistein, Ko143, FBS, and G418 were obtainedfrom Sigma-Aldrich. RPMI1640 medium was obtained fromWako. (Z)-1-[N-(2-Aminoethyl)-N-(2-ammonioethyl)-amino]-diazen-1-ium-1,2- diolate (NOC18) was obtained fromDojindo.The antibody to ABCG2 was obtained from Cell Signaling Tech-nology. The monoclonal anti-actin antibody (clone C4) wasfrom Millipore. The anti-ferrochelatase antibody was a gift fromDr. S. Taketani (Kyoto Institute of Technology, Kyoto, Japan).MitoTracker Green was obtained from Invitrogen. The BCA Pro-tein Assay Kit was from Thermo Scientific. All other chemicalswere of analytic grade and obtained from Nacalai Tesque. Defer-oxamine was dissolved in saline as a stock solution. Genistein,Ko143, and MitoTracker Green were dissolved in DMSO andstored in aliquots at�20�Cuntil use. ALAwas diluted in ultrapurewater to make a stock solution of 0.5 mol/L.

Cell lines and culture conditionsThe following cell lines were purchased from the Japanese

Collection of Research Bioresources: A549, HEK293T, T98G,T24, MDA-MB-231, MeWo, DLD-1, and H1299. U937 andHL-60 cell lines were obtained from the RIKEN Cell Bank. These

cell lines were authenticated using short tandem repeat analysiswith the GenePrint 10 System (Promega) and Cell Line Authen-tication Database of JCRB and ATCC in 2015. ST-HEK cells wereprepared by the stable transfection of ABCG2 and cells expressinghigh levels of the functional ABCG2 protein (18). These cells weremaintained in complete medium: RPMI1640 supplemented with10% heat-inactivated FBS, 100 U/mL penicillin, and 100 mg/mLstreptomycin in a humidified atmosphere with 5% CO2/air at37�C. Typically, 1 � 105 cells were seeded in 1.5 mL of completemedium on 3.5-cm dishes and cultured for 24 hours beforeeach experiment. Unless otherwise indicated, chemicals wereadded at the following final concentrations: 0.5 mmol/L of ALA,5 to 50 mmol/L of genistein, 1 mmol/L of Ko143, and 300 mmol/Lof Noc18.

Flow cytometry of cellular PpIXAfter being incubated, cells were rinsed three times with PBS

andharvested by trypsinization. After centrifugation at 800� g for5 minutes, the cells were resuspended in 0.4 mL of PBS. CellularPpIX contents were measured using the flow cytometer FACScan(BD Biosciences) and quantified with CellQuest software (BDBiosciences). A total of 10,000 cells were analyzed in each sample(excitation 488 nm, emission 650 nm).

Fluorescence microscopyAfter being treated with ALA, cells were stained with 1 mmol/L

MitoTracker Green for 20 minutes at 37�C and then observed byfluorescence microscopy (Axiovert 200, Carl Zeiss Inc.). Mito-Tracker Green is a fluorescent dye compound that is used for thedetection of mitochondria. Fluorescence images were taken usinga highly light-sensitive thermoelectrically cooled charge-coupleddevice camera (Axio-Cam CCD camera, Zeiss). The filter combi-nations were a 450-nm excitation filter, 510-nm beam splitter,and 515 to 565-nm emission filter for MitoTracker green; a400-nm excitation filter, 580-nm beam splitter, and 590-nmlong-pass emission filter for PpIX.

Western blot analysisCells were solubilized in ice-cold lysis buffer (20 mmol/L

Tris-HCl, pH 7.4, 0.15 mol/L NaCl, 1% NP-40, 0.1% SDS, 0.1%sodium deoxycholate, 5 mmol/L ethylenediaminetetraaceticacid (EDTA), 5 mmol/L ethylene glycol tetraacetic acid (EGTA),1 mmol/L phenylmethylsulfonylfluoride, and 1 mg/mL each ofleupeptin and pepstatin A). After centrifugation of the homogenateat 15,000� g for 15minutes to remove cell nuclei, the supernatantwas collected and the protein content was determined using a BCAProtein Assay Kit. Samples were prepared by mixing with 2� SDSsample buffer and boiling for 5 minutes, and were then stored at�80�C until use. Protein content was determined using a BCAprotein assay kit. The samples were subjected to SDS-PAGE andproteins in the gel were transferred electrophoretically ontoan Immobilonmembrane (Millipore). Themembranewasblockedby 5% skimmilk in Tris–buffered saline tween 20 (TBST; 0.15mol/L NaCl, 0.05% Tween 20, 10 mmol/L Tris-HCl, pH 7.4) and thenincubated overnight with primary antibodies (1:1,000 for themouseanti-humanactin antibody, 1:300 for the rabbit anti-humanABCG2 antibody, and 1:1,000 for the rabbit anti-bovine ferroche-latase antibody) diluted in TBST containing 5% skim milk at 4�C.After washing three times with TBST, themembranewas incubatedfor 1.5 hours with the horseradish peroxidase -conjugated

Fujita et al.

Cancer Res; 76(7) April 1, 2016 Cancer Research1838




secondary antibody diluted at 1:5,000 in TBST containing 5% skimmilk at room temperature. Immunoreactive bands ware visualizedwith Immunostar LD and exposed to Polaroid films.

qRT-PCRTotal RNAwas isolated fromA549 cells treated with or without

50 mmol/L genistein for 28 hours using RNeasyMini Kit (Qiagen)following the manufacturer's instructions. The RNA was treatedwith a TURBO DNA-free kit (ThermoFisher Scientific) to removegenomicDNA. cDNAwasprepared from0.5mgof total RNAusingRevertra Ace qPCR RT master Mix (TOYOBO). One-twentieth ofeach of the obtained cDNA specimens was used for each PCR.qRT-PCR was performed in LightCycler 8-Tube Strips usingthe LightCycler Nano Instrument and FastStart Essential DNAGreen Master (Roche). The primers used to amplify heme syn-thesis genes and an internal standard b-actin were: humanALAD forward primer CCTCGGTTCCAACCAACTGAT, ALADreverse primer: GATAGGVTGTATGTCATCAGGAACA; humanPBGD forward primer CAAGGACCAGGACATCTTGGAT, PBGDreverse primer: CCAGACTCCTCCAGTCAGGTACA; humanUROS forward primer TCAGCACTGCCTCTTCTATTTCC, UROS

reverse primer: CTGGGTGTGCAACTGTCTGATAC; humanUROD forward primer CGGGAGTGTGTGGGAA, UROD reverseprimer: AAGCAGACGTGAGTGTTTATGCA; human CPOX for-ward primer GGCGGAGATGTTGCCTAAGAC, CPOX reverseprimer: AATGCTCACCCCAGCCTTTT; human b-actin forwardprimer TGGCACCCAGCACAATGAA, b-actin reverse primer:CTAAGTCATAGTCCGCCTAGAAGCA; The PCR protocol was95�C for 10 minutes followed by 40 cycles of denaturation at95�C for 15 seconds and annealing/extension at 60�C for1 minute.

Generation of an in vivo tumor xenograft modelAll animal procedures were approved by the Okayama Uni-

versity Institutional Animal Care and Use Committee (approvalnumber: OKU-2012634 andOKU-2015443).Male athymic nudemice (BALB/c nu/nu) were obtained from Charles River Japan,Inc. and they received intradermal injections of 2� 106 A549 cellsin each flank. After 2 weeks, visible nodules approximately 5 mmin diameter had formed. Mice (n ¼ 5 per group) received vehicle(50% ethanol in PBS) or genistein [10 mg/kg/day, intraperitone-ally (i.p.) daily for 3 days] as a preconditioning treatment. Zero, 1,

Figure 1.Effects of genistein on ALA-mediated accumulation of PpIX in ABCG2-expressing cells. A, protein expression of ABCG2 and ferrochelatase (FECH) in U937 andA549cells. Cell lysates were analyzed byWestern blotting using antibodies against ABCG2, ferrochelatase, and actin. B, the ALA-mediated accumulation of PpIX in U937and A549 cells. Cells were treated with the indicated concentration of ALA for 3 hours. PpIX fluorescence was measured by a flow cytometer and expressedas a percentage of the control (0 mmol/L ALA). C, genistein (left graph) and Ko143 (an ABCG2 inhibitor, right graph) treatments stimulated ALA-mediatedaccumulation of PpIX in A549 cells in a dose-dependent manner. D, genistein and Ko143 stimulated ALA-mediated accumulation of PpIX in A549 cells in a time-dependent manner. Data in C are percent increases relative to the PpIX fluorescence intensity induced by 0.5 mmol/L ALA only. E and F, effects of genistein,Ko143, and Noc18 (ferrochelatase inhibitor) on the ALA-induced accumulation of PpIX in U937 (E) and A549 (F) cells. Cells were incubated with 0.5 mmol/L ALA for3 hours in the presence or absence of 1 mmol/L Ko143, 25 mmol/L genistein, or 300 mmol/L Noc18 and intracellular PpIX fluorescence was measured. Themean � SD for three independent experiments. Asterisks, a significant difference from ALA only.

Genistein Promotes PpIX Accumulation

www.aacrjournals.org Cancer Res; 76(7) April 1, 2016 1839




4, 12, and 24 hours after the administration of ALA [75 mg/kg,intramuscularly (i.m.)] to both groups, the mice were euthanizedand the tumors and neighboring normal-appearing tissues wereharvested, embedded in optimal cutting temperature com-pound (Sakura Finetek), and frozen in liquid nitrogen. Sec-tions were cut (15-mm thickness) and five consecutive sectionswere mounted on separate Superfrost Plus glass slides(Thermo Fisher Scientific). PpIX was detected without fixationwith a 400-nm excitation filter, a 565-nm beam splitter, and a605/70 nm bandpass emission filter on a fluorescence micro-scope (BZ-X700, KEYENCE). Sections containing tumor tissueand neighboring normal-appearing tissue were identified andanalyzed with BZ-X Analyzer software (KEYENCE). Detectionof E-cadherin was used to distinguish the tumor tissues andnontumor tissues, as described below. PpIX fluorescence wasmeasured as reported previously (13) with the followingmodifications. The PpIX signal intensity per unit area wasmeasured separately in the tumor and nontumor tissues bycalculating the mean intensity of the red fluorescence in eachpixel of each digital image. The ratios of tumor PpIX signalper unit area and nontumor PpIX signal per unit area werecompared.

E-cadherin IHCFrozen sections adjacent to the sections used for PpIX detection

were fixed in 4%paraformaldehyde for 10minutes and thenwereincubated with blocking solution (5% goat serum and 0.25%Triton X-100 in PBS) for 30 minutes at room temperature.The sections were incubated with the anti-E-cadherin antibodydiluted 1:200 in IMMUNO SHOT (Cosmobio) for 16 hours at4�C. After washing, Alexa488-labeled secondary antibodies were

diluted 1:750 for 1.5 hours at room temperature. Cell nuclei werestained with 40-6-diamidino-2-phenylindole (DAPI). The slideswere mounted with the antifade mountant, SlowFade Gold(Life Technologies). The sections were analyzed by confocalmicroscopy (ZEISS Confocal Laser Scanning Microscope ModelLSM780) or BZ-X700.

Statistical analysisStatistical analyses were performed using the Student t test. The

mean of three distributions was considered significantly differentif P < 0.05.

ResultsEffects of genistein on ALA-mediated accumulation of PpIX inA549 cells

To determine whether genistein promoted the ALA-mediatedaccumulation of PpIX by inhibiting ABCG2, we examined therelationship between the abundance of ABCG2 and effects ofgenistein on the accumulation of PpIX. A Western blot analysisconfirmed that A549 cells had a high content of ABCG2, whereashuman histiocytic lymphoma U937 cells had a low content ofABCG2(Fig. 1A; ref. 18). TheALA-mediated accumulationofPpIXwas significantly lower in A549 cells than in U937 cells (Fig. 1B).Genistein increased the ALA-mediated accumulation of PpIX inA549 cells in dose- and time-dependent manners, which wassimilar to the effects of the specific ABCG2 inhibitor Ko143(Fig. 1C and D). In contrast, neither Ko143 nor genistein pro-moted the ALA-mediated accumulation of PpIX in U937 cells(Fig. 1E). When heme synthesis was inhibited by the FEHCinhibitor Noc18 (NO donor), cellular PpIX levels increased

Figure 2.Effects of genistein and Ko143 on the amountand distribution of PpIX in ALA-treated A549cells in vitro. Cells were incubated with0.5 mmol/L ALA for 3 hours in the presence orabsence of 1 mmol/L Ko143 or 25 mmol/Lgenistein and then stained with MitoTrackerGreen, a mitochondrial-selective probe. Imageswere taken using fluorescent microscopy.Magnification, �200.

Fujita et al.





significantly in U937 cells and A549 cells (Fig. 1E and F). Fluo-rescence microscopy revealed that accumulated PpIX mainlylocalized in mitochondria (Fig. 2). These results indicated thatthe ALA-mediated accumulation of PpIX was facilitated by genis-tein in A549 cells in vitro.

Genistein stimulated PpIX accumulation by the functionalrepression of ABCG2

As genistein stimulated the ALA-mediated accumulation ofPpIX in a similar manner to that of the ABCG2 inhibitor, weexpected genistein to suppress the efflux of PpIX through ABCG2.Thus, we examined the effects of genistein on the accumulation ofPpIX in ABCG2-knockdown cells. Figure 3A shows that the siRNAdesigned to silence the ABCG2 gene obliterated the proteinexpression of ABCG2 in A549 cells. After the accumulationof PpIX was induced with ALA, washing the control cells withALA-free medium significantly decreased the accumulated levelsof PpIX in 3 hours. On the other hand, large amounts of PpIX stillremained in ABCG2-knockdown cells after washing (Fig. 3B).When control cells were washed in the presence of Ko143 orgenistein, larger amounts of PpIX were retained in the cells. Theaccumulation of PpIX in ALA-treated ABCG2-knockdown cellswas greater withNoc18, which inhibits ferrochelatase through the

generation of NO, but not with Ko143 or genistein than that incontrol cells. These results suggested that the efflux of PpIX byABCG2 and heme synthesis were major factors regulating theintracellular accumulation of PpIX in A549 cells and also thatgenistein suppressed the efflux of intracellular PpIX by ABCG2.

We then investigated the effects of genistein on the ALA-medi-ated accumulation of PpIX in ABCG2-overexpressing HEK cells(ST-HEK cells, Fig. 3C). The ALA treatment failed to increase theaccumulation of PpIX in ST-HEK cells, which was in contrast tothat in parental HEK cells. However, these two cells showed thehigher or similar accumulation of PpIX when cells were treatedwith Ko143 or genistein, respectively (Fig. 3D). These resultssuggested that genistein suppressed the PpIX efflux function ofABCG2 in HEK cells.

A longer genistein treatment markedly stimulatedALA-mediated accumulation of PpIX

We also examined the effects of a longer genistein treatment forup to 48 hours on the ALA-mediated accumulation of PpIX inA549 cells. The accumulationof PpIXwasmarkedly higher byALAþ genistein than by ALA alone or ALA þ Ko143 (Fig. 4A). TheABCG2-inhibitory activity of Ko143 was not affected by theincubation in culture medium for 48 hours (data not shown).

Figure 3.Genistein (Geni) stimulated PpIX accumulation by functionally repressing ABCG2. A and B, ABCG2 protein expression in A549 cells was knocked down by RNAi, andthe effects of genistein on PpIX excretion/consumption were determined by removing the substrate. Cells were transfected with ABCG2-specific siRNA for5 days, treated with ALA for 1.5 hours, rinsed with ALA-free medium, and then incubated in the medium for 3 hours in the presence of 1 mmol/L Ko143, 25 mmol/Lgenistein, or 300 mmol/L Noc18. A, Western blot for the ABCG2 protein from ABCG2-knockdown A549 cells. B, PpIX levels were measured by flow cytometry.Asterisks, a significant difference from the corresponding "control cells." #, a significant difference from the corresponding "Wash" samples. C, ABCG2protein expression in parental HEK cells and ST-HEK cells, in which an ABCG2 expression vector was stably transfected. D, effects of genistein on the accumulationof PpIX in HEK cells and ST-HEK cells. HEK cells and ST-HEK cells were incubated with 0.5 mmol/L ALA for 3 hours in the presence of 1 mmol/L Ko143 or25 mmol/L genistein. The mean � SD for three independent experiments. Asterisks, a significant difference from the corresponding "ALA" samples.






Fluorescence microscopy revealed that the ALA þ genistein treat-ment for 48 hours increased PpIX fluorescence in A549 cells andthat PpIX was localized in the cytosol and mitochondria, whichwas similar to that with ALA alone (Fig. 4B). Furthermore, thepretreatment with genistein significantly increased the ALA-medi-ated accumulationof PpIX in amanner that dependedon the doseof genistein and time of the pretreatment (Fig. 5A and 5B). Inaddition, genistein enhanced ALA-mediated PpIX accumulationin another lung carcinoma cell line, H1299, and also in varioustumor cell lines that express ABCG2, including glioblastomaT98G cells, breast cancer MDA-MB-231 cells, melanoma MeWocells, and colorectal adenocarcinoma DLD-1 cells (Supplemen-tary Fig. S1A and S1B). Importantly, genistein pretreatment alsoenhanced the cell death induced by ALA-mediated photodynamictreatment in A549 cells (Supplementary Fig. S1C). As estrogenand estrogenic compounds often stimulate the proliferation of

cancer cells (26–28), the effect of genistein on the cell growth ofA549 cells was examined. As shown in Fig. 5C, 25 and 50 mmol/Lgenistein inhibited the cell growth of A549 cells for 48 hours.

Systemic preconditioning with genistein enhanced theaccumulation of PpIX in a tumor model established in vivo

To determine whether genistein can enhance the accumulationof PpIX in tumor cells in vivo, nude mice were implanted withA549 adenocarcinoma cells. After 2weeks, the tumorswere visibleand the animals received systemic preconditioningwith vehicle orgenistein over a 3-day period. On the third day, ALA was injectedintramuscularly and both tumor-bearing and nontumor tissueswere harvested 0, 1, 4, 12, and 24 hours later and were analyzedfor PpIX fluorescence. In the vehicle control, ALA was found toinduce a transient accumulation of PpIX in the xenografted tumorcells (Supplementary Fig. S2A), which was confirmed with the

Figure 4.A longer genistein treatmentmarkedly stimulated ALA-mediatedaccumulation of PpIX. A, cells weretreated with 0.5 mmol/L ALA for 48hours in the presence of 1 mmol/LKo143 or 50 mmol/L genistein andPpIX fluorescence was analyzed byflow cytometry. B, the amount anddistribution of PpIX at 48 hours wereanalyzed by fluorescence microscopy.Magnification, �200. MitoTrackerGreen is a mitochondrial-sensitiveprobe.

Figure 5.Thegenistein pretreatment stimulatedALA-mediated accumulationof PpIX. A, A549 cellswere treatedwith the indicated concentration of genistein for 48hours andthen with 0.5 mmol/L ALA þ genistein for 3 hours. PpIX fluorescence was analyzed by flow cytometry. B, preincubation time-dependent accumulation ofALA-mediated PpIX by genistein. C, effects of genistein on A549 cell growth at 48 hours. Cell growth was analyzed with a hemocytometer and the Trypanblue exclusion test. Asterisks, genistein significantly increased the accumulation of PpIX. Data are the mean � SD derived from three independent experiments.

Fujita et al.





detection of E-cadherin immunoreactivity in the tumor tissues.PpIX accumulation peaked 4 hours after the administration ofALA (Supplementary Fig. S2A), although, the fluorescence inten-sity ratio for PpIX between the tumor and nontumor tissues wasrelatively low at the same time point (1.49 � 0.31). The greatestcontrast in PpIX fluorescence was observed 1 hour after ALAadministration, and at the same time point the genistein pretreat-ment significantly increased PpIX accumulation in the xeno-grafted tumor (Fig. 6A–C). Moreover, this increase in PpIX accu-mulation did not affect the tumor:nontumor PpIX fluorescenceratio (Fig. 6C). Treatment with genistein also increased the accu-mulation of PpIX in the normal epidermis and hair follicles(Supplementary Fig. S2B and S2C), suggesting that genisteinpromotes PpIX accumulation in proliferating tissues such as skin.

We also attempted to elucidate the mechanism by which thelong-term treatment with genistein increased the accumulation ofPpIX in vitro.We examined whether genistein affected the expres-sion of ABCG2 in A549 cells. Figure 6D showed that genistein did

not suppress, but rather increased the protein expression ofABCG2. We investigated the effects of genistein on the geneexpression of heme synthesis enzymes. The gene expression ofALAD,PBGD,UROS,UROD,CPOX, andPPOXwas stimulated bythe genistein treatment (Fig. 6E). Accordingly, the rate of PpIXsynthesis was also accelerated by the genistein pretreatment for48 hours when the efflux of PpIX by ABCG2 and its consumptionby ferrochelatase were inhibited by Ko143 and Noc18 (Fig. 6F).These results suggested that the long-term treatment with genis-tein increased the accumulation of PpIX by upregulating geneexpression involved in the synthesis of PpIX.

DiscussionThe enhanced accumulation of PpIX in tumor cells represents

a critical issue for successful ALA-mediated photodynamicdiagnosis. In the current study, we showed that genisteinstimulated the accumulation of PpIX in A549 human lung

Figure 6.Preconditioningwith genistein stimulated the accumulation of PpIX in a xenograft tumormodel and promoted the gene expression of hememetabolism enzymes inA549 cells. A, histologic detection of PpIX levels in A549 tumor cells established in nude mice as a xenograft model (see Materials and Methods). These micereceived genistein (10 mg/kg, daily, i.p.) for 3 days and ALA (75 mg/kg, i.m.) for 1 hour to stimulate the synthesis of PpIX before the tumors were analyzed.Wide-field and confocal fluorescence photomicrographs of frozen sections showed PpIX fluorescence and E-cadherin immunoreactivity, respectively. Asterisk,calcified tissue. Scale bar, 300 mm. B, digital quantification of PpIX fluorescence in A549 tumors subjected to genistein as shown in A. PpIX signal per unit areain the E-cadherin positive region was calculated and expressed as a percentage of vehicle PpIX fluorescence. Data are the mean � SD calculated from fivesamples. Asterisks, a significant difference from the vehicle control. C, the ratio of PpIX fluorescence in the tumor to that in adjacent nontumor tissue is shown. D,Western blot analysis of protein levels. A549 cells were treated with 50 mmol/L genistein for the indicated times in vitro. Proteins were analyzed by Westernblotting. E, changes in the mRNA expression of heme metabolism enzymes in A549 cells treated with genistein in vitro. These mRNAs were analyzed byquantitative real-time PCR. Asterisks, a significant difference from the 0-h control of each gene of interest. FECH, ALAD, PBGD, UROS, UROD, CPOX, andPPOX are ferrochelatase (FECH), ALA dehydrogenase, PBGD, UROS, UROD, CPOX, and PPOX, respectively. F, the rate of PpIX synthesis in genistein-treatedA549 cells. A549 cells were treated with or without 50 mmol/L genistein for 48 hours and then treated with 0.5 mmol/L ALA for 1 and 2 hours in the presenceof Noc18 and Ko143.






adenocarcinoma cell line both in vitro and in vivo by preventingABCG2-mediated PpIX efflux and upregulating the gene expres-sion of heme synthesis enzymes (Fig. 7). Furthermore, theenhancement of PpIX accumulation by genistein was not lim-ited to the A549, lung adenocarcinoma cell line, and similaraccumulation patterns were observed in other tumor cell lines.Thus, genistein appears to effectively improved ALA-inducedPpIX accumulation in ABCG2 expressing tumors in vitro and invivo and these findings suggest that the phytoestrogen, genis-tein, may represent a potentiating agent for ALA-mediatedphotodynamic diagnosis in humans.

Various approaches have been attempted to promote theaccumulation of PpIX in tumors by regulating key factors in thesynthesis and metabolism of PpIX. The inhibition of hemesynthesis by deferoxamine has been shown to improve theALA-induced accumulation of PpIX in urothelial carcinoma,leukemia, and gastric cancer (15–17, 29–31). However, the ane-mic conditions commonly observed in patients with cancer maylimit the use of such an iron chelator to locally. A treatment withanABCG2 inhibitor alone or in combination with ferrochelataseinhibitors was shown to significantly increase the ALA-medi-ated accumulation of PpIX in human urothelial and oralsquamous cell carcinoma in vitro (8, 19). Vitamin D3 has alsobeen reported to promote the ALA-mediated accumulation ofPpIX by increasing the protein expression of the heme synthesisenzyme CPOX (13). In this context, our results demonstratedfor the first time that genistein promoted the accumulation ofPpIX by regulating multiple key factors in the accumulation ofPpIX such as ABCG2, ALAD, PBGD, UROS, UROD, and PPOXin A549. Furthermore, the combination of these approachessuch as the genistein treatment with vitamin D3 may improveALA-induced PpIX accumulation more efficiently, which is thenext subject to be explored.

Genistein has a structural similarity to 17b-estradiol, whichexplains its estrogenic activity (32). Genistein binds to ERa andERb, and its affinity to ERb is similar to that of 17b-estradiol (22).Although the stimulation of ERb by its selective agonist 2,3-bis(4-hydroxyphenyl) propionitrile was previously shown to pro-mote the activation of ERK1/2 and cell growth in 201T human

non–small cell lung cancer cells (33), genistein did not stimulatethe proliferation of A549 cells expressing ERb (Fig. 1 and 5C;refs. 34–36). Furthermore, estrogen depletion by ovariectomy inrats reduced ALA-induced PpIX levels in the tumors of theseanimals (21). These findings suggest that estrogen and the phy-toestrogen genistein may accelerate the accumulation of PpIX bystimulating ERb signaling.

Porphyria cutanea tarda is a metabolic disease of the hemesynthesis pathway and is characterized by vesicles, bullae, and thefragility of skin and sclerodermoid changes that occur predomi-nantly in sun-exposed areas (37,38). This disorder is biochemicallycharacterized by the accumulation of uroporphyrin and hepta-carboxyl porphyrin in the liver (39). Uroporphyrin and hepta-carboxyl porphyrin circulate in the plasma andmediate cutaneousphotosensitivity. It is widely accepted that estrogen is one of theenvironmental factors of porphyria cutanea tarda and the use ofestrogen also plays a role its clinical expression (37, 39). In thiscontext, it is important tonote thatgenisteinpretreatment increasedALA-induced PpIX accumulation in the mouse normal epidermisand hair follicles as well as in xenografted tumor in the currentstudy. Thus, estrogens may be good candidates of potentiatingagents for ALA-mediated photodynamic diagnosis in humans.

Genistein is known to enhance apoptosis induced by theanticancer drug trichostatin A in A549 cells, but not in normalhuman lung fibroblasts by increasing the expression of ERb-mediated TNF receptor-1 (40, 41). Therefore, genistein may bebeneficial not only for improving the quality of ALA-mediatedphotodynamic diagnosis, but also for better outcomes of subse-quent chemotherapy in patients with lung cancer.

In the current study, ALA-induced PpIX accumulation increased3.7-fold in vitro and 1.8-fold in vivo following pretreatment withgenistein (Figs. 5B and 6B). This discrepancy between the in vitroand in vivo results may be multifactorial. One possible explana-tion is that genistein can be metabolized to 30-OH-genistein bycytochrome P450 1A2 (CYP1A2), a major enzyme in the phase Ihydroxylation process in mouse liver (42, 43). Another consid-eration is that passive targeting systems [e.g., tumor targetingnanoparticles (44)]may improve the effects of genistein in vivo byachieving a better distribution of genistein among cancer cells.

When ALA-induced PpIX is activated by visible light in tumorcells, cytotoxic singlet oxygens are generated and these can kill thetumor cells. In the current study, cell death due to ALA-basedphotodynamic treatment increased 1.8-fold and PpIX accumula-tion increased 3.7-fold following 50 mmol/L genistein pretreat-ment. The mild increase in cytotoxicity despite a marked PpIXincrease suggests that genistein partially acts as an antioxidant(45). In addition, genistein has been shown to upregulate theexpression of antioxidant genes via ERs and ERK1/2 activation(46). Thus, it is possible that some of the cytotoxic effects that aremediated by ALA-based photodynamic treatment in the presenceof genistein may be cancelled by genistein itself.

In the current study, the 48-hour genistein treatment wasassociated with an increase, rather than a decrease in ABCG2protein expression, despite the treatmentmarkedly promoting theALA-mediated accumulation of PpIX in A549 cells. Although thereason for this apparent discrepancy currently remains unknown,it may reflect themultifaceted functions of genistein. Namely, thesynthesis of PpIX by genistein-induced heme synthesis enzymesmay override the efflux of PpIX by genistein-induced ABCG2 inA549 cells and/or genistein may suppress preexisting and genis-tein-induced ABCG2 protein levels.

Figure 7.Schematic representation of potential mechanisms by which phytoestrogengenistein stimulates ALA-mediated accumulation of PpIX in malignant cells.FECH, ALAD, PBGD, UROS, UROD, CPOX, PPOX, and PEPT are ferrochelatase(FECH), ALA dehydrogenase, PBGD, UROS, UROD, CPOX, PPOX, andoligopeptide transporter, respectively.

Fujita et al.





Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: H. Fujita, T. Ogino, T. ShuinDevelopment of methodology: K. NagakawaAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): H. Fujita, K. Nagakawa, H. Kobuchi, T. Shuin,T. Utsumi, K. UtsumiAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis):H. Fujita, K.Nagakawa, T.Ogino, T. Shuin,H.OhuchiWriting, review, and/or revision of the manuscript: H. Fujita, K. Nagakawa,T. Ogino, Y. Kondo, T. Shuin, K. Utsumi, J. Sasaki, H. Ohuchi

Administrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): H. Fujita, H. Kobuchi, Y. Kondo, T. Shuin,T. Utsumi, K. Utsumi, H. OhuchiStudy supervision: H. Fujita, K. Inoue, T. Shuin, J. Sasaki, H. OhuchiOther (senior Author and I made an equal contribution): K. Nagakawa

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received June 3, 2015; revised October 22, 2015; accepted November 18,2015; published OnlineFirst February 2, 2016.

References1. Peng Q, Warloe T, Berg K, Moan J, Kongshaug M, Giercksky KE, et al. 5-

Aminolevulinic acid-based photodynamic therapy. Clinical research andfuture challenges. Cancer 1997;79:2282–308.

2. Inoue K, Fukuhara H, Shimamoto T, Kamada M, Iiyama T, Miyamura M,et al. Comparison between intravesical and oral administration of 5-aminolevulinic acid in the clinical benefit of photodynamic diagnosis fornonmuscle invasive bladder cancer. Cancer 2012;118:1062–74.

3. Fukuhara H, Inoue K, Satake H, Tamura K, Karashima T, Yamasaki I, et al.Photodynamic diagnosis of positive margin during radical prostatectomy:preliminary experience with 5-aminolevulinic acid. Int J Urol 2011;18:585–91.

4. Friesen SA, Hjortland GO, Madsen SJ, Hirschberg H, Engebraten O,Nesland JM, et al. 5-Aminolevulinic acid-based photodynamic detec-tion and therapy of brain tumors (review). Int J Oncol 2002;21:577–82.

5. MessmannH,Mlkvy P, Buonaccorsi G,Davies CL,MacRobert AJ, Bown SG.Enhancement of photodynamic therapy with 5-aminolaevulinic acid-induced porphyrin photosensitisation in normal rat colon by thresholdand light fractionation studies. Br J Cancer 1995;72:589–94.

6. Teng L,NakadaM,Zhao SG, EndoY, FuruyamaN,NambuE, et al. Silencingof ferrochelatase enhances 5-aminolevulinic acid-based fluorescence andphotodynamic therapy efficacy. Br J Cancer 2011;104:798–807.

7. Togsverd-Bo K, Lerche CM, Philipsen PA, Poulsen T, Wulf HC, HaedersdalM. Porphyrin biodistribution inUV-exposedmurine skin aftermethyl- andhexyl-aminolevulinate incubation. Exp Dermatol 2012;21:260–4.

8. Yamamoto M, Fujita H, Katase N, Inoue K, Nagatsuka H, Utsumi K, et al.Improvement of the efficacy of 5-aminolevulinic acid-mediated photody-namic treatment in human oral squamous cell carcinomaHSC-4. ActaMedOkayama 2013;67:153–64.

9. Zhao SG, Chen XF, Wang LG, Yang G, Han DY, Teng L, et al. Increasedexpression of ABCB6 enhances protoporphyrin IX accumulation andphotodynamic effect in humanglioma. AnnSurgOncol 2013;20:4379–88.

10. Ishizuka M, Abe F, Sano Y, Takahashi K, Inoue K, Nakajima M, et al. Noveldevelopment of 5-aminolevurinic acid (ALA) in cancer diagnoses andtherapy. Int Immunopharmacol 2011;11:358–65.

11. KuoMT. Redox regulation ofmultidrug resistance in cancer chemotherapy:molecular mechanisms and therapeutic opportunities. Antioxid RedoxSignal 2009;11:99–133.

12. Doss M, Sixel-Dietrich F, Verspohl F. "Glucose effect" and rate limitingfunction of uroporphyrinogen synthase on porphyrin metabolism inhepatocyte culture: relationship with human acute hepatic porphyrias.J Clin Chem Clin Biochem 1985;23:505–13.

13. Anand S, Wilson C, Hasan T, Maytin EV. Vitamin D3 enhances theapoptotic response of epithelial tumors to aminolevulinate-based photo-dynamic therapy. Cancer Res 2011;71:6040–50.

14. Amo T, Kawanishi N, Uchida M, Fujita H, Oyanagi E, Utsumi T, et al.Mechanism of cell death by 5-aminolevulinic acid-based photodynamicaction and its enhancement by ferrochelatase inhibitors in human histio-cytic lymphoma cell line U937. Cell Biochem Funct 2009;27:503–15.

15. Fukuhara H, Inoue K, Kurabayashi A, Furihata M, Fujita H, Utsumi K, et al.The inhibition of ferrochelatase enhances 5-aminolevulinic acid-basedphotodynamic action for prostate cancer. Photodiagnosis Photodyn Ther2013;10:399–409.

16. Inoue K, Fukuhara H, Kurabayashi A, Furihata M, Tsuda M, Nagakawa K,et al. Photodynamic therapy involves an antiangiogenic mechanism and isenhanced by ferrochelatase inhibitor in urothelial carcinoma. Cancer Sci2013;104:765–72.

17. Inoue K, Karashima T, Kamada M, Shuin T, Kurabayashi A, Furihata M,et al. Regulation of 5-aminolevulinic acid-mediated protoporphyrin IXaccumulation in human urothelial carcinomas. Pathobiology 2009;76:303–14.

18. Kobuchi H, Moriya K, Ogino T, Fujita H, Inoue K, Shuin T, et al. Mito-chondrial localization of ABC transporter ABCG2 and its function in 5-aminolevulinic acid-mediated protoporphyrin IX accumulation. PloSOne2012;7:e50082.

19. Ogino T, Kobuchi H,MunetomoK, FujitaH, YamamotoM,Utsumi T, et al.Serum-dependent export of protoporphyrin IX by ATP-binding cassettetransporter G2 in T24 cells. Mol Cell Biochem 2011;358:297–307.

20. Vail JTJr. Porphyria cutanea tarda and estrogens. JAMA 1967;201:671–4.

21. Gibson SL, Anderson LT, Havens JJ, Hilf R. Effect of estrogenic perturba-tions on delta-aminolevulinic acid-induced porphobilinogen deaminaseand protoporphyrin IX levels in rat Harderian glands, liver, and R3230ACtumors. Biochem Pharmacol 1999;58:1821–9.

22. Kuiper GG, Lemmen JG, Carlsson B, Corton JC, Safe SH, van der Saag PT,et al. Interaction of estrogenic chemicals and phytoestrogens with estrogenreceptor beta. Endocrinology 1998;139:4252–63.

23. Ming LG, Chen KM, Xian CJ. Functions and action mechanisms offlavonoids genistein and icariin in regulating bone remodeling. J CellPhysiol 2013;228:513–21.

24. Prossnitz ER, BartonM. The G-protein-coupled estrogen receptor GPER inhealth and disease. Nat Rev Endocrinol 2011;7:715–26.

25. Imai Y, Tsukahara S, Asada S, Sugimoto Y. Phytoestrogens/flavonoidsreverse breast cancer resistance protein/ABCG2-mediated multidrug resis-tance. Cancer Res 2004;64:4346–52.

26. Beral V. Breast cancer and hormone-replacement therapy in the MillionWomen Study. Lancet 2003;362:419–27.

27. Beral V, Bull D, Green J, Reeves G. Ovarian cancer and hormone replace-ment therapy in the Million Women Study. Lancet 2007;369:1703–10.

28. Lucki NC, SewerMB. Genistein stimulatesMCF-7 breast cancer cell growthby inducing acid ceramidase (ASAH1) gene expression. J Biol Chem2011;286:19399–409.

29. Berg K, Anholt H, Bech O, Moan J. The influence of iron chelators on theaccumulationof protoporphyrin IX in 5-aminolaevulinic acid-treated cells.Br J Cancer 1996;74:688–97.

30. Lin F, Geiger PG, Korytowski W, Girotti AW. Protoporphyrin IX-sensitizedphotoinactivation of 5-aminolevulinate-treated leukemia cells: effects ofexogenous iron. Photochem Photobiol 1999;69:375–81.

31. Tan WC, Krasner N, O'Toole P, Lombard M. Enhancement of photody-namic therapy in gastric cancer cells by removal of iron. Gut 1997;41:14–8.

32. Mahmoud AM, YangW, BoslandMC. Soy isoflavones and prostate cancer:a review of molecular mechanisms. J Steroid Biochem Mol Biol2014;140:116–32.

33. Hershberger PA, Stabile LP, Kanterewicz B, RothsteinME, Gubish CT, LandS, et al. Estrogen receptor beta (ERbeta) subtype-specific ligands increasetranscription, p44/p42 mitogen activated protein kinase (MAPK)






activation and growth in human non-small cell lung cancer cells. J SteroidBiochem Mol Biol 2009;116:102–9.

34. Verma MK, Miki Y, Abe K, Niikawa H, Sasano H. Cytoplasmic estrogenreceptor beta as a potential marker in human non-small cell lung carci-noma. Expert Opin Ther Targets 2012;16:S91–102.

35. Shen L, Li Z, Shen S, Niu X, Yu Y, Li Z, et al. The synergistic effect of EGFRtyrosine kinase inhibitor gefitinib in combination with aromatase inhib-itor anastrozole in non-small cell lung cancer cell lines. Lung Cancer2012;78:193–200.

36. Tang H, Liao Y, Chen G, Xu L, Zhang C, Ju S, et al. Estrogen upregulates theIGF-1 signaling pathway in lung cancer through estrogen receptor-beta.Med Oncol 2012;29:2640–8.

37. Elder GH. Porphyria cutanea tarda. SemLiver Dis 1998;18:67–75.38. Urbanek RW, Cohen DJ. Porphyria cutanea tarda: pregnancy versus

estrogen effect. J Am Acad Dermatol 1994;31:390–2.39. Phillips JD, Jackson LK, BuntingM, FranklinMR, Thomas KR, Levy JE, et al.

Amousemodel of familial porphyria cutanea tarda. ProcNatl Acad SciUSA2001;98:259–64.

40. Shiau RJ, Chen KY, Wen YD, Chuang CH, Yeh SL. Genistein and beta-carotene enhance the growth-inhibitory effect of trichostatin A in A549cells. Eur J Nutr 2010;49:19–25.

41. Wu TC, Yang YC, Huang PR, Wen YD, Yeh SL. Genistein enhancesthe effect of trichostatin A on inhibition of A549 cell growth byincreasing expression of TNF receptor-1. Toxicol Appl Pharmacol2012;262:247–54.

42. Hu M, Krausz K, Chen J, Ge X, Li J, Gelboin HL, et al.et al. Identification ofCYP1A2 as the main isoform for the phase I hydroxylated metabolism ofgenistein and a prodrug converting enzyme of methylated isoflavones.Drug Metab Dispos 2003;31:924–31.

43. Kulling SE, Honig DM, Metzler M. Oxidative metabolism of the soyisoflavones daidzein and genistein in humans in vitro and in vivo. J Agr FoodChem 2001;49:3024–33.

44. Cho K, Wang X, Nie S, Chen ZG, Shin DM. Therapeutic nano-particles for drug delivery in cancer. Clin Cancer Res 2008;14:1310–6.

45. WeiH,Wei L, Frenkel K, Bowen R, Barnes S. Inhibition of tumor promoter-induced hydrogen peroxide formation in vitro and in vivo by genistein. NutrCancer 1993;20:1–12.

46. Borr�as C, Gambini J, G�omez-Cabrera MC, Sastre J, Pallard�o FV, Mann GE,et al.et al. Genistein, a soy isoflavone, up-regulates expression of antiox-idant genes: involvement of estrogen receptors, ERK1/2, and NFkappaB.FASEB J 2006;20:2136–8.


Fujita et al.




2016;76:1837-1846. Published OnlineFirst February 2, 2016.Cancer Res Hirofumi Fujita, Keisuke Nagakawa, Hirotsugu Kobuchi, et al. Protoporphyrin IX in Lung CarcinomaPhytoestrogen Suppresses Efflux of the Diagnostic Marker

Updated version

10.1158/0008-5472.CAN-15-1484doi:

Access the most recent version of this article at:

Cited articles

http://cancerres.aacrjournals.org/content/76/7/1837.full#ref-list-1

This article cites 46 articles, 7 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/76/7/1837To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-15-1484

http://cancerres.aacrjournals.org/content/76/7/1837.full#ref-list-1

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/76/7/1837


Documents

Phytoestrogen Suppresses Efflux of the Diagnostic Marker ... · device camera (Axio-Cam CCD camera, Zeiss). The filter combi-nations were a 450-nm excitation filter, 510-nm beam