ARTICLE IN PRESS

0723-2020/$ - se

doi:10.1016/j.sy

�CorrespondE-mail addr

1All authorit

Systematic and Applied Microbiology 30 (2007) 343–354

www.elsevier.de/syapm

Relationships of plant pathogenic enterobacteria based on partial atpD,

carA, and recA as individual and concatenated nucleotide and peptide

sequences

J.M. Young�, D.-C. Park

Landcare Research, Private Bag 92170, Auckland, New Zealand

Abstract

Relationships of the genera in the Enterobacteriaceae containing plant pathogenic species: Brenneria, Dickeya,Enterobacter, Erwinia, Pantoea, Pectobacterium, and Samsonia, were investigated by comparison of their nucleotideand peptide sequences of atpD, carA, recA, and the concatenated sequences. Erwinia spp. and Pantoea spp., withPectobacterium cypripedii, formed a group distinct from other pathogenic taxa. Pectobacterium, Brenneria, Dickeya,and Samsonia formed a contiguous clade. Samsonia was usually concurrent with Pectobacterium. Most Brenneria werealso close to Pectobacterium, suggesting that these three taxa might be better represented as a single genus. Brenneria

quercina was not closely associated with other members of this genus and may represent a separate genus. Thesequences representing Dickeya were distinct, further supporting the generic status of the taxon. Plant pathogenicEnterobacter spp. display such sequence variability that few definite conclusions as to their specific placement could bemade. These data highlight the difficulty of drawing reliable and robust taxonomic conclusions based on comparativeanalysis of sequence data without some independent criterion to calibrate a scale for diversity.r 2007 Elsevier GmbH. All rights reserved.

Keywords: Brenneria; Dickeya; Enterobacter; Erwinia; Pantoea; Pectobacterium; Samsonia; Multilocus sequence typing (MLST);

Taxonomy

Introduction

The genus Erwinia1 originally comprised all plantpathogenic bacteria that were Gram-negative, peritri-chous-flagellate, facultatively anaerobic rods. From itsinception, the heterogeneity of the genus was generallyacknowledged [31] with several revisions suggested[2,32,39] prior to the publication of the Approved Listsof Bacterial Names [26]. However, there was noconsensus as to whether the genus should be retainedintact or if it should be divided into two or more genera

e front matter r 2007 Elsevier GmbH. All rights reserved.

apm.2007.03.002

ing author.

ess: youngj@LandcareResearch.co.nz (J.M. Young).

y references for names can be found in [7].

[6,16,37]. When the Approved Lists were published, allplant pathogens were included in Erwinia, although,following the proposals of Brenner et al. [2], Er.

carnegiana, Er. carotovora, Er. chrysanthemi, Er. cypri-

pedii, and Er. rhapontici were also listed as homotypic(objective) synonyms in Pectobacterium. Non-patho-genic Er. herbicola was also included in the lists asEnterobacter agglomerans.

Subsequent revisions entailed the transfer of selectedspecies to Enterobacter as En. cancerogenus [5],En. cloacae subsp. dissolvens (as En. dissolvens) [3],and En. nimipressuralis [3], and to Pantoea as Pa.

ananas [19], and Pa. stewartii [19]. En. agglomerans

(syn. Er. herbicola) was reclassified as Pa. agglo-

merans [10].

ARTICLE IN PRESSJ.M. Young, D.-C. Park / Systematic and Applied Microbiology 30 (2007) 343–354344

Further revisions [12,23,33] have been made, resultingin seven genera being now differentiated from theoriginal Erwinia: Brenneria, Dickeya, Enterobacter,Erwinia (sensu Hauben et al. [12]), Pantoea, Pectobac-

terium, and Samsonia. Brenneria now comprises Br. alni,Br. nigrifluens, Br. quercina, Br. rubrifaciens and Br.

salicis [12]. Species included in Pectobacterium are Pe.

atrosepticum [8], Pe. betavasculorum [8], Pe. cacticida

[12], Pe. carotovorum subsp. carotovorum [12], Pe.

carotovorum subsp. odoriferum [12], Pe. cypripedii [12]and Pe. wasabiae [8]. Pectobacterium spp. correspondclosely to those originally included in the ApprovedLists, being mainly of species exhibiting pectolyticactivity (except Pe. cypripedii), but not including Er.

carnegiana. Recently a genus, Dickeya, was proposed,with Di. paradisiaca being transferred from Brenneria,Di. chrysanthemi being transferred from Pectobacterium,and four novel species, Di. dadantii, Di. dianthicola, Di.

Dieffenbachiae, and Di. zeae being delineated frompathogenic populations previously recognized in Pecto-

bacterium chrysanthemi [12].The proposals of Hauben et al. [12] were based solely

on clades generated by 16S rDNA sequence analysesusing the neighbour-joining (N-J) algorithm. Using asimilar set of sequences and the same method, Sproer etal. [28] reported Brenneria and Pectobacterium as asingle clade, indicating the fragility of analyses using thiscriterion. Sutra et al. [33] justified the proposal ofSamsonia as a novel genus because different phyloge-netic models consistently placed this taxon in differentrelationships with other members of the Enterobacter-

iaceae. Except for Enterobacter, none of the generaproposed in the revisions of Erwinia have phenotypiccircumscriptions to support them [10,12,19,23,33]; theirdiscrimination is based on signature sequences in 16SrDNA [12].

These considerations led to the re-evaluation of therelationships of the plant pathogens in the Enterobac-

teriaceae described here, using partial sequences of thecatalytic subunit of the ATP synthase (atpD), the smallsubunit of carbamoyl phosphate synthase (carA),recombinase A (recA), and 16S rDNA, using variousmethods of analysis.

Materials and methods

Strains used

Strains were obtained from the International Collec-tion of Micro-organisms from Plants (ICMP),Landcare Research, Auckland (Table 1). Further infor-mation on these strains is given at the ICMP website:http:/www. landcareresearch. co. nz/research/biodiversity/fungiprog/icmp.asp.

DNA extraction

Strains were cultured on nutrient agar incubated at27 1C for 2–3 days. Genomic DNA was directlyextracted from colonies grown on nutrient agar usingPhenol and CTAB [1].

Amplification and sequencing

Degenerate primers for PCR amplification of partialsequences of atpD, carA, and recA in the enterobacteriawere manually designed from a multiple sequencealignment of 15 enterobacteria from the GenBankdatabase (Table 2). PCR amplification was performedwith an Applied Biosystems 9700 thermal cycler. Aninitial denaturing step (95 1C/4min) and a final exten-sion step (72 1C/7min) was used for all PCR reactions.PCR conditions for recA were: 20 cycles (94 1C/30 s;55 1C reducing to 45 1C (0.5 1C for each cycle)/30 s;72 1C/40 s), followed by 17 cycles (94 1C/30 s; 45 1C/30 s;72 1C/40 s). PCR condition for atpD were: 30 cycles(94 1C/45 s; 45 1C/1min; 72 1C/30 s). PCR conditions forcarA were: 35 cycles (94 1C/30 s; 60 1C/30 s; 72 1C/40 s.PCR products were column-purified with a Roche HighPure PCR Product Purification Kit. When multiplebands occurred on gels, the correct sized fragment wasextracted using the PCR purification kit. Purifiedproducts were cycle sequenced with the appropriateprimers using BigDye Terminator Ready Reaction Mixv3.1 (ABI) and sequences obtained in both directionsusing an ABI 3100 Avant Genetic Analyzer. In the caseof the atpD and carA genes, internal pairs of primers weredesigned as sequence data became available (Table 2).Sequences were assembled and edited with Sequencher4.5 (Gene Codes Corp.).

GenBank sequences from the type strains of repre-sentative species were also included for comparison. Theoutgroup for each alignment of 16S rDNA, atpD, car A,and recA was the appropriate sequence from Bordetella

pertussis strain Tohama I, obtained from the completegenome (GenBank accession BX470248).

Sequence analysis

Nucleotide sequences were aligned with ClustalX 1.83and both ends of each alignment were trimmed to thefollowing final sizes: atpD, 1267 positions; carA, 998positions; recA, 697 positions; 16S rDNA, 1393 posi-tions. The concatenated DNA sequence was 2692positions. For 16S rDNA sequences, maximum like-lihood (ML) was compared with N-J. Peptide sequencesfor atpD, carA, and recA were determined from alignedsequences using GeneDoc, aligned using ClustalX andmanually edited again using GeneDoc to ensure thatalignment gaps in peptide coding genes did not cause

ARTICLE IN PRESS

Table 1. Names of species used in this study with ICMP strain accession numbers and GenBank accession numbers for sequences

Current name ICMP # Partial sequences (Genbank reference #)

atpD carA recA 16S rDNA

Br. alni 12481T DQ859793 DQ859827 DQ859871 AJ223468

Br. nigrifluens 1578T DQ859794 DQ859828 DQ859872 Z96095

Br. quercina 1845T DQ859803 DQ859852 DQ859875 AJ223469

Br. rubrifaciens 1915T DQ859792 DQ859826 DQ859870 Z96098

Br. salicis 1587T DQ859795 DQ859825 DQ859869 Z96097

Di. chrysanthemi 5703T DQ859789 DQ859815 DQ859873 Z96093

Di. paradisiaca 2349* DQ859791 DQ859816 DQ859874 Z96096

En. aerogenes 15660T DQ859778 DQ859844 — EAE251468

En. cancerogenus 5706T DQ859790 DQ859843 DQ859855 Z96077

En. cloacae subsp. dissolvens 1570T DQ859777 DQ859842 DQ859854 Z96079

Er. amylovora 1540T DQ859810 DQ859835 DQ859884 Z96088

Er. mallotivora 5705T DQ859814 DQ859841 DQ859877 Z96084

Er. persicinus 12532T DQ859809 DQ859838 DQ859883 Z96086

Er. psidii 8426T DQ859813 DQ859840 DQ859878 Z96085

Er. pyrifoliae 14143T DQ859811 DQ859836 DQ859885 EF122435

Er. rhapontici 1582T DQ859808 DQ859837 DQ859882 Z96087

Er. tracheiphila 5845T DQ859812 DQ859839 DQ859879 Y13250

Pa. agglomerans 272T DQ859807 DQ859833 DQ859881 Z96082

Pa. ananatis 1850T DQ859805 DQ859832 DQ859880 Z96081

Pa. stewartii 257T DQ859804 DQ859831 — Z96080

Pe. atrosepticum 1526T DQ859796 DQ859818 DQ859862 Z96090

Pe. betavasculorum 4226T DQ859797 DQ859822 DQ859866 Z96091

Pe. cacticida 11136T DQ859802 DQ859823 DQ859867 AJ223409

Pe. carotovorum subsp. carotovorum 5702T DQ859799 DQ859820 DQ859864 Z96089

Pe. carotovorum subsp. odoriferum 11533T DQ859800 DQ859820 DQ859865 AJ223407

Pe. cypripedii 1591T DQ859806 DQ859834 DQ859876 EF122434

Pe. wasabiae 9121T DQ859798 DQ859819 DQ859863 AJ223408

Sa. erythrinae 13937T DQ859801 DQ859824 DQ859868 AF273037

Ci. freundii 7610T DQ859776 DQ859849 DQ859856 M59291

Es. coli 15663T DQ859781 DQ859848 DQ859857 NC000913

Kl. pneumoniae 15667T DQ859783 DQ859845 DQ859859 X87276

Salmonella sp. 15669 DQ859782 DQ859850 DQ859861 X80681

Se. marsescens 7617T DQ859788 DQ859851 DQ859889 M59160

Sh. disintericae 15674 DQ859780 DQ859847 DQ859858 X80680

Sh. flexneri 7618 DQ859779 DQ859846 — X80679

Ew. americana 15665T DQ859784 DQ859829 DQ859886 X88848

Ha. alvei 15666 DQ859785 DQ859853 DQ859890 M59155

Ra. aquatilis 15668 DQ859786 DQ859830 DQ859887 X79939

Ye. enterocolitica 15678T DQ859787 DQ859817 DQ859888 Z49829

Ph. luminescens — — — — X82248

Pr. vulgaris — — — — J01874

Xe. japonicus — — — — D78008

Xe. poinarii — — — — X82253

Bordetella pertussis Tohama I BX470248 (Chromosome)

Code for generic names: Brenneria (Br.), Citrobacter (Ci.), Dickeya (Di.), Enterobacter (En.), Erwinia (Er.), Escherichia (Es.), Ewingella (Ew.), Hafnia

(Ha.), Klebsiella (Kl.), Pantoea (Pa.), Pectobacterium (Pe.), Photorhabdus (Ph.), Proteus (Pr.), Rahnella (Ra.), Samsonia (Sa.), Serratia (Se.), Shigella

(Sh.), Xenorhabdus (Xe.), Yersinia (Ye.)T Type strain.

* This strain is the pathotype strain of Er. chrysanthemi pv. paradisiaca.

— Not determined.

GenBank sequences in plain text were derived in this study. Those in italic were obtained from GenBank.

J.M. Young, D.-C. Park / Systematic and Applied Microbiology 30 (2007) 343–354 345

ARTICLE IN PRESS

Table 2. Primers for amplifying for atpD, carA, and recA

atpD Forward PfatpD GACGTCGAATTCCCTCARGA

PfatpD2 GACGTCGAGTTCCCKCARGA

Internal forward PfatpD2_seq GTAGGTAAAACCGTAAACATG

Reverse PratpD TSGCTTTTTCCACAGCTTCT

PratpD2 TTGGCTTTTTCCACKACTTC

Internal reverse PratpD2_seq GGTCAGTCAAGTCATCCGCA

carA Forward PfcarA AGCGCTATTGGTTCTSGAAG

Internal forward PfcarA2_seq GTGGCGATTGCBGAYATCGA

Reverse PrcarA CCTGGAAGCTGAACGCYGSTT

PrcarA2 ATGGCTGTTACTACAGTTA

recA Forward ErecAF GARKCBTCNGGTAAAACVAC

Reverse ErecAR TTCGCYTTRCCCTGRCCRATC

ErecAR2 RTTGATRCCTTCGCCGTASA

J.M. Young, D.-C. Park / Systematic and Applied Microbiology 30 (2007) 343–354346

errors in the amino acid sequence. Calculated peptidesequence lengths for atpD, carA, and recA were 422,332, and 232 amino acids, respectively, with a con-catenated peptide length of 986 amino acids.

All aligned sequences, including combined sequenceswere analysed using the likelihood optimality criterion.The appropriate ML parameter (GTR+G+I model)was selected using ‘MODELTEST’ version 3.06. Themodel parameters (base frequencies, proportion ofinvariable sites, gamma distribution shape parameter,and substitution rate matrix) were then specified inPAUP* 4.0b10 [34] to build trees using Tree-Bisection-Reconnection heuristics. Peptides were analysed inMrBayes 3.1.2 [22] for 1 million generations.

Concatenated peptide and nucleotide sequences werealso analysed using unweighted pair group method witharithmetic mean (unweighted pairs by group meananalysis – UPGMA) [20], conducted on using PAUP*.The tree was generated using the ‘phylogram’ optionin Treeview [21]. Concatenated sequences were alsotreated using Gblocks 9.1b (http://molevol.ibmb.csic.es/Gblocks/Gblocks.html) [4], which eliminates poorlyaligned positions and divergent regions of an alignmentof DNA or protein sequences; positions which may notbe homologous or may have been saturated by multiplesubstitutions.

Results

Sequences were obtained for all nucleotides except forrecA of En. aerogenes and Pa. stewartii.

16S rDNA sequence analyses

The comparative analysis of 16S rDNA sequencesusing N-J produced a tree (Fig. 1) with Brenneria,Pectobacterium, and Erwinia–Pantoea represented asdistinct groups, separated by non-pathogenic entero-

bacterial genera. In the tree produced here, however, Di.

(Brenneria) paradisiaca and Di. (Pectobacterium) chry-

santhemi and Samsonia erythrinae grouped in one clade,with Br. quercina and Pe. cypripedii as outliers to thisgroup. By contrast, although based on the samealignment of sequences, the tree produced usingoptimum likelihood (Fig. 2) showed little congruencewith the N-J tree. Erwinia sequences were not wellresolved and Pectobacterium, Brenneria, Dickeya, andSamsonia sequences produced a heterogeneous series.

Individual peptides and genes

Trees for individual genes and peptides are recordedas Supplementary Material (Appendix A). These in-dicated an overall structure for genera and species infour groups, although there were several notableexceptions.

Group 1

Citrobacter, Enterobacter, Escherichia, Klebsiella,Salmonella, and Shigella. This group of genera wassupported by all gene and peptide trees, except for atpD

peptide and nucleotide sequences which grouped En.

cancerogenus with Dickeya.

Group 2

Ewingella, Hafnia, Rahnella, Serratia, and Yersinia.This group of genera was supported by all gene andpeptide trees except for Ye. enterocolitica, which wasdisplaced in the carA tree.

Group 3

Erwinia, Pantoea and Pe. cypripedii. Erwinia, andPantoea sequences usually formed a single group, eachgenus being represented separately. Erwinia spp. andGroup 2 sequences were not resolved by recA DNA.With the exception of recA DNA, Pe. cypripedii wasalways associated with Group 3. For carA and recA

ARTICLE IN PRESS

Fig. 1. Relationships of the plant pathogenic Enterobacteria based on a comparative analysis of 16S rDNA partial sequences using

the neighbour-joining algorithm. Generic groups are indicated by labelled arrows. Aberrant strains are marked by unlabelled

arrows.

J.M. Young, D.-C. Park / Systematic and Applied Microbiology 30 (2007) 343–354 347

there seemed to be relatively little correspondencebetween the DNA and peptide trees. This is mostnoticeable in the placement of Ewingella, Rahnella,Hafnia, and Yersinia, embedded with Erwinia andPantoea in the recA DNA tree, and as outliers in therecA peptide tree.

Group 4

Brenneria, Dickeya, Pectobacterium, and Samsonia.Group 4 is so heterogeneous that it is hard to provide acoherent synthesis of the data from the individualpeptides and genes. Brenneria sequences were relativelyheterogeneous, usually associated with Pectobacterium.

Br. quercina was commonly expressed as an outlier,usually removed from the cluster by carA and recA. The

two sequences representing Dickeya are always asso-ciated, sometimes as outliers to the group. AtpD

sequences grouped En. cancerogenus with Dickeya. Withthe exception of the atpD peptide sequence, which didnot resolve the group, Samsonia was associated closelywith Pectobacterium sequences.

Perplexing placements

The 16S rDNA sequence of Pe. cypripedii 1591T wasidentical to that recorded by Hauben et al. [12],confirming the authenticity of the strain, but thesequence was not associated with other Pectobacterium

sequences in this study, being an outlier with Br.

ARTICLE IN PRESS

Fig. 2. Relationships of the plant pathogenic Enterobacteria based on a comparative analysis of 16S rDNA partial sequences using

the likelihood algorithm. Generic groups are indicated by labelled arrows. Aberrant strains are marked by unlabelled arrows.

J.M. Young, D.-C. Park / Systematic and Applied Microbiology 30 (2007) 343–354348

quercina. Pe. cypripedii atpD, carA and recA sequenceswere most similar to their respective Pantoea sequences.Br. quercina sequences were not associated with otherBrenneria sequences. The atpD sequence of En. cancer-

ogenus was located with Dickeya.

Concatenated sequences

Although indicating a common structure, the data ofindividual peptides and genes gave the variable resultsdescribed above. Concatenation of peptides and genes toobtain an overall consensus result offered a possibleresolution of the variable data.

Analyses of concatenated genes and peptides based onlikelihood (Fig. 3) and UPGMA (Fig. 4) confirmed fourgroups that generally corresponded to those indicatedby individual genes and peptides.

1.

Citrobacter, Enterobacter, Escherichia, Klebsiella,Salmonella, and Shigella Enterobacter

The placement of En. cancerogenus differed betweenthe peptide and DNA trees. The phenotypic treeprovided by the peptide analysis places the sequence

with other Enterobacter sequences. The nucleotideanalysis placed the sequence with Dickeya and Br.

quercina. This anomaly depends on the contributionof the atpD sequences.

2.

Ewingella, Hafnia, Rahnella, Serratia, and Yersinia

3.

Erwinia, Pantoea, and Pe. cypripedii

4.

Brenneria, Dickeya, Pectobacterium, and Samsonia

Similarity matrices of the concatenated sequenceswere not informative. Analyses of data treated usingGblocks did not significantly affect the results.

Discussion

16S rDNA analyses

The comparative analysis of 16S rDNA sequencesusing N-J produced a tree (Fig. 1) not dissimilar to that ofHauben et al. [12]. By contrast, although based on thesame alignment of sequences, the tree produced usingoptimum likelihood (Fig. 2) showed little congruence withthe N-J tree. Erwinia sequences were not well resolved and

ARTICLE IN PRESS

Fig. 3. Relationships of the plant pathogenic Enterobacteria based on a comparative analysis of concatenated alignments of atpD,

carA, and recA sequences using the likelihood algorithm for the peptide and DNA. Generic groups are indicated by labelled arrows.

Aberrant strains are marked by unlabelled arrows.

J.M. Young, D.-C. Park / Systematic and Applied Microbiology 30 (2007) 343–354 349

Pectobacterium, Brenneria, Dickeya, and Samsonia se-quences produced a heterogeneous series. Considered inisolation, the relationships expressed in this tree would notlead to the same nomenclature as that based on the N-Jtree. In a similar study, Sproer et al. [28] concluded thatBrenneria and Pectobacterium were in the same radiationand therefore did not support the classification of Haubenet al. [12]. These results are a further indication of theextent to which choice of algorithm can influence results,leading to diverse taxonomic interpretations. In bothtrees, the sequences representing Enterobacter were notcongruent, with En. cancerogenus and En. aerogenes

separate from En. dissolvens.Examination of the genomes from GenBank of

Escherichia coli (NC004431) and Pe. carotovorum

(NC004547) showed that atpD, carA, and recA werepresent as single copies and it is assumed that this is thecase for these genes in the other enterobacteriaconsidered here. By contrast, 16S rDNA is usually

present in at least three copies, as is the case for E. coli

and Pe. carotovorum, and for other genera. Theconsensus of gene data shows that Br. quercina andPe. cypripedii are misplaced compared with theiridentifications based on 16S rDNA (see below).Although this could be because aberrant copies of 16SrDNA were obtained from GenBank, this seemsunlikely because the result for Pe. cypripedii wasconfirmed using a sequence prepared here.

Individual peptides and genes

Natural selection involves an interaction between thephenotype and the environment. At the molecular level,natural selection is on peptide efficiency, the nucleotidesequence being the vehicle for inherited transfer of thefunctional structure. In evolutionary terms, therefore,peptide sequences determine nucleotide sequences.

ARTICLE IN PRESS

Fig. 4. Relationships of the plant pathogenic Enterobacteria based on a comparative analysis of concatenated alignments of atpD,

carA, and recA sequences using the UPGMA algorithm for the peptide and DNA. The tree is produced as a phylogram. Generic

groups are indicated by labelled arrows. Aberrant strains are marked by unlabelled arrows.

J.M. Young, D.-C. Park / Systematic and Applied Microbiology 30 (2007) 343–354350

Aligned genes and peptides sequences showed con-siderable identity over extended ranges of the sequences.This suggests that sequences were homologous and thatparalogy had not occurred in these genes in theenterobacteria.

Second and especially third base redundancy incodons in aligned sequences was clearly observed byinspection. The higher levels of diversity in nucleotide-based trees compared with peptide-based trees areprobably due to this redundancy.

Enterobacter

En. cloacae is the type species of the genus. Acceptingthe close relationship of En. dissolvens to En. cloacae

[13], the type species of the genus, the placement of En.

dissolvens in this study specifies the placement of thegenus in the group. Comparative 16S rDNA sequenceanalyses separated En. aerogenes and En. cancerogenus,

from En. [cloacae subsp.] dissolvens. CarA and recA

sequences showed En. cancerogenus associated withEn. [cloacae subsp.] dissolvens but separate from En.

aerogenes. The atpD sequence comparison placed En.

aerogenes and En. [cloacae subsp.] dissolvens separatelyin Group 1, with En. cancerogenous associated withDi. chrysanthemi.

Erwinia, Pantoea, and Pe. cypripediiWhen it was first proposed [10], no distinct generic

circumscription was provided to justify the separation ofPantoea from Erwinia. When the position of Pantoea

was examined using comparative 16S rDNA sequenceanalysis [12,15,28], it formed a clade contiguous withErwinia spp., and was not otherwise supported by aunique circumscription [42]. A recent review does notprovide further justification for the discrimination ofPantoea from Erwinia [11]. The results of this study

ARTICLE IN PRESSJ.M. Young, D.-C. Park / Systematic and Applied Microbiology 30 (2007) 343–354 351

confirm Pantoea spp. as sharing the same clusterwithout giving strong support for recognition as a genusdistinct from Erwinia. These data indicate that Pe.

cypripedii is closely associated with Pantoea and isprobably a member of the taxon.

Brenneria, Dickeya, Pectobacterium, and SamsoniaA consideration of the internal structure of the gene

and peptide trees indicates that all Pectobacterium

(except Pe. cypripedii), most Brenneria (except Br.

quercina) and Samsonia form a single group, withDickeya and Br. quercina as outliers. A genus Pecto-

bacterium that includes Samsonia is identified as aseparate group. Probably Dickeya will be supported as asister genus by further analyses. Br. quercina appears tobe unrelated to other members of this genus, and ifPectobacterium and Brenneria were amalgamated, thespecies would be represented in a separate taxon.

Sutra et al. [33] justified the proposal of Samsonia as anovel genus because three different phylogenetic modelsplaced this taxon in close relationships with Brenneria,Pectobacterium, and Yersinia, respectively. However,instability under different modelling systems does notsupport any of these interpretations of classification andis not the basis for the discrimination of a genus as Sutraet al. [33] themselves noted. Rather, it indicates a closerelationship between Brenneria, Pectobacterium, andYersinia and the need for more data. Samsonia wasconsistently placed with Pectobacterium and is probablybest classified with that genus.

Sequence analysis and classification

The results reported here highlight a problem implicitin all taxonomic interpretations; what level of differenceestablished between strains justifies their differentiationinto separate taxa? For species, DNA–DNA reassocia-tion similarity values of less that 70% and differences inDNA duplex melting temperature of greater than 5 1Care considered to justify separate species. Althougharbitrary and subject to large experimental error [27]and increasingly questioned as a practical method[36,42], it does, in principle, bring stability to inter-pretations of data for classification. An attempt toreconcile DNA–DNA reassociation data with 16SrDNA sequence data was made by Stackebrandt andGoebel [29]. In a study of species for which bothreassociation data and 16S rDNA sequence data wereavailable, they demonstrated that strains that had 16SrDNA similarity values lower than 97% were invariablyfrom different species based on reassociation data.However, this co-relationship is of limited utilitybecause many species based on reassociation have 16SrDNA similarities greater than 99%. Furthermore, 16SrDNA similarities within and between genera do offer

reliable discrimination of these taxa. For instance, thesimilarity matrix of 16S rDNA for the enterobacteriaprovided by Hauben et al. [12] gave similarity valuesrepresenting species within the genera Erwinia, Brenneria,Pantoea, and Pectobacterium as low (95%) as did thosebetween genera. Thus, if Pantoea is considered to be agenus distinct from Erwinia then an equivalent case canbe made that every species be considered as a mono-specific genus [42]. Moreover, interspersed between theplant pathogenic genera proposed by Hauben et al. [12]are sequences representing other genera of the Enter-

obacteriaceae, including several containing human patho-gen species in Enterobacter, Escherichia, Klebsiella,Salmonella, Shigella, and Yersinia. It is axiomatic thatthese genera must also have equivalent sequence similar-ity values and therefore there is little basis for anygeneric differentiation on these sequence data alone[42]. Clearly, if genera are to be based on the compa-rison of sequence data alone [17], there is a need forsome calibration of the method. Because, as the resultshere show, accurate calibration would require agreementas to genes used, as well as the method of analysis, aconsensus about the method may be difficult to achieve.The validity of genera as stable taxa will thereforecontinue to be, and may become increasingly, prob-lematic.

The ready ability, using PCR, to amplify conserved16S rDNA or 23S rDNA universally found in bacteria,and the ability to sequence this DNA, saw an explosionof systematic studies based on these sequences. Thecomparative analysis of rDNA sequences has beenthought to provide a key to the systematization ofrelationships at the generic and higher taxonomic levels[30,40]. However, although rDNA is ubiquitous, this isnot of itself the basis for asserting that such analysesgive accurate phylogenies [27,41–43]. In a study ofbacterial species for which whole chromosomes havebeen sequenced, Zeigler [44] compared 32 individualgene sequences as representatives of the overall chromo-some. Of those tested, genes such as recN, lig, DnaX,glyA, cysS gave best results, with atpD (23rd), recA

(29th), and 16S rRNA (32nd) being relatively unrepre-sentative of the chromosome. AtpD, carA, and recA

have been used because primers could only be developedfrom the limited data available in the past [9,38]. Infuture, it should be possible to choose genes that bestrepresent taxa under consideration. However, consid-ered alone, such analyses do not necessarily allowdifferentiation of individual taxa. As noted earlier[42,43], without some concept of scale or independentsupport, differentiation of sequences in a tree intoseparate taxa is arbitrary.

Systematic analysis based on more than one gene hasbeen restricted in the past by the technical difficulties ofdeveloping primers and of producing large numbers ofsequences. These have now been overcome. The concept

ARTICLE IN PRESSJ.M. Young, D.-C. Park / Systematic and Applied Microbiology 30 (2007) 343–354352

of multilocus sequence typing (MLST) [18], involvingsystematic selection of a number of house-keeping genesto represent the chromosome, has so far been usedmainly in the study of mammalian bacterial pathogens.Recently, it has been applied to plant pathogens in twostudies of Pseudomonas syringae [14,24], and in one ofXylella fastidiosa [25]. The availability of completechromosome sequences means that it is now practicableto apply to increasing numbers of taxa and is likely to bea method of choice in future systematics sequencestudies. Whether comparative analyses of total chromo-somes will have utility will depend on improvedcomputational methods. The variation between indivi-dual strains indicated by Tettelin et al. [35] hints at acomplexity that may require methods with a consider-able heuristic component.

Taxa can be related on the basis of the similarities anddifferences in the functional genes and their derivedpeptides, and by implication on phenotypic differences.Future classification may be based on structuraldifferences at the chromosomal level, or on the overallderived phenotype.

The primary conclusions of this study are that plantpathogenic enterobacteria are contained in two maingroups:

1.

Erwinia-Pantoea with Pe. cypripedii. Erwinia, andPantoea are closely related. As yet, there are nocircumscriptions that justify their differentiation asseparate genera. Further studies are needed, but itseems likely that Pe. cypripedii should be consideredto be a member of Pantoea.

2.

Pectobacterium (with Brenneria and Samsonia). Thesequences of Pectobacterium and Brenneria alwayssegregated independently but are closely associated.There is no compelling evidence to consider them asseparate genera. The sequence representing S. erythri-

nae was usually an outlier to Pectobacterium, but in theabsence of other evidence, this species should probablybe considered to be a member of Pectobacterium. Thesequences representing Dickeya were always closelyassociated and stood as outliers to Pectobacterium,Brenneria, and Samsonia, suggesting that furthersequence analysis might support this genus.

Sequence data reported here confirm the observationof Hauben et al. [12] that individual plant pathogenicEnterobacter spp. are distributed among non-pathogenicenterobacteria, indicating a need for further investiga-tion of the relationships of these species.

Results are dependent on genes chosen and thealgorithm used in sequence analysis. There is a needfor criteria to decide when sequence differences justifytaxonomic decisions, especially at the generic level,where there is an absence of independent supportingphenotypic data for differentiation.

No specific nomenclatural proposals have beenproposed from the data presented here because,although they indicate that some previous revisions ofthe genus Erwinia may not have been adequatelysupported, they are insufficient to justify an accuratealternative classification. The refinement of classificationin future may result from several possible strategies.Those based on DNA and peptide sequence data willdepend on the development of methods to process verylarge sequence databases. MLST, with careful selectionof representative sequences, appears to offer the bestprospect for improvement. However, until a bettergenus concept is developed and unless there is a betterunderstanding of the relationship of variation betweengenes and chromosomal structure, it seems likely thatrevisions will remain idiosyncratic.

Acknowledgment

The New Zealand Foundation is thanked for Re-search Science and Technology for financial support.R.E. Beever and R.L. Howitt, Landcare Research, arethanked for critically reading the manuscript.

Appendix A. Supplementary materials

Supplementary data associated with this article can befound in the online version at doi:10.1016/j.syapm.2007.03.002

References

[1] F.M. Ausubel, B. Brent, R.E. Kingston, D.D. Moore,

J.G. Seidman, J.A. Smith, K. Struhl, Current Protocols in

Molecular Biology, Wiley, New York, 1987.

[2] D.J. Brenner, G.R. Fanning, A.G. Steigerwalt, Deoxy-

ribonucleic acid relatedness among Erwinia and other

Enterobacteriaceae: the gall, wilt, and dry-necrosis organ-

isms (genus Erwinia Winslow et al., sensu stricto), Int. J.

Syst. Bacteriol. 24 (1974) 197–204.

[3] J. Castresana, Selection of conserved blocks from multi-

ple alignments for their use in phylogenetic analysis, Mol.

Biol. Evol. 17 (2000) 540–552.

[4] D.J. Brenner, A.C. McWhorter, A. Kai, A.G. Steigerwalt,

J.J. Farmer, Enterobacter asburiae sp. nov., a new species

found in clinical specimens, and reassignment of Erwinia

dissolvens and Erwinia nimipressuralis to the genus

Enterobacter as Enterobacter dissolvens comb. nov. and

Enterobacter nimipressuralis comb. nov., J. Clin. Micro-

biol. 23 (1986) 1114–1120.

[5] R.S. Dickey, C.H. Zumoff, Emended description of

Enterobacter cancerogenus comb. nov. (formerly Erwinia

cancerogena), Int. J. Syst. Bacteriol. 38 (1988) 371–374.

ARTICLE IN PRESSJ.M. Young, D.-C. Park / Systematic and Applied Microbiology 30 (2007) 343–354 353

[6] D.W. Dye, A numerical taxonomic study of the genus

Erwinia, NZ J. Agric. Res. 24 (1981) 223–229.

[7] J.P. Euzeby, List of bacterial names with standing in

nomenclature: a folder available on the Internet (updated:

March 2006; revised URL: http://www.bacterio.cict.fr/).

Int. J. Syst. Evol. Microbiol. 47 (1997–2006) 590–592.

[8] L. Gardan, C. Gouy, R. Christen, R. Samson, Elevation

of three subspecies of Pectobacterium carotovorum to

species level: Pectobacterium atrosepticum sp. nov.,

Pectobacterium betavasculorum sp. nov. and Pectobacter-

ium wasabiae sp. nov, Int. J. Syst. Evol. Microbiol. 53

(2003) 381–391.

[9] M.W. Gaunt, S.L. Turner, L. Rigottier-Gois, S.A. Lloyd-

Macgilp, J.P.W. Young, Phylogenies of atpD and recA

support the small subunit rRNA-based classification of

rhizobia, Int J. Syst. Evol. Microbiol. 51 (2001)

2037–2048.

[10] F. Gavini, J. Mergaert, A. Beji, C. Mielcarek, D. Izard, K.

Kersters, J. De Ley. Transfer of Enterobacter agglomerans

(Beijerinck 1888) Ewing & Fife 1972 to Pantoea gen. nov.

as Pantoea agglomerans comb. nov. and description of

Pantoea dispersa sp. nov., Int. J. Syst. Bact. 39 (1989)

337–345.

[11] P.A.D. Grimont, F. Grimont, Genus XXIII. Pantoea

Gavini, Mergaert, Beji, Mielcarek, Izard, Kersters, and

De Ley 1989 343VP emend. Mergaert, Verconck and

Kersters 1993, 171, in: D.J. Brenner, N.R. Krieg, J.T.

Staley, G.M. Garrity (Eds.), Bergey’s Manual of Sys-

tematic Bacteriology, The Proteobacteria, vol. 2C, second

ed., Springer, New York, USA, 2005, pp. 340–345.

[12] L. Hauben, E.R.B. Moore, L. Vauterin, M. Steenackers,

J. Mergaert, L. Verdonck, J. Swings, Phylogenetic

position of phytopathogens within the Enterobacteria-

ceae, Syst. Appl. Microbiol. 21 (1998) 384–397.

[13] H. Hoffmann, S. Stindl, W. Ludwig, A. Stumpf, A.

Mehlen, J. Heesemann, D. Monget, K.-H. Schleifer, A.

Roggenkamp, Reassignment of Enterobacter dissolvens to

Enterobacter cloacae as E. cloacae subspecies dissolvens

comb. nov. and emended description of Enterobacter

asburiae and Enterobacter kobei, Syst. Appl. Microbiol.

28 (2005) 196–205.

[14] M.S.H. Hwang, R.L. Morgan, S.F. Sarkar, P.W. Wang,

D.S. Guttman, Phylogenetic characterization of virulence

and resistance phenotypes of Pseudomonas syringae,

Appl. Environ. Microbiol. 71 (2005) 5182–5191.

[15] S.-W. Kwon, J.-Y. Park, J.-S. Kim, J.-W. Kang, Y.-H.

Cho, C.-K. Lim, M.A. Parker, G.-B. Lee, Phylogenetic

analysis of the genera Bradyrhizobium, Mesorhizobium,

Rhizobium and Sinorhizobium on the basis of 16S rRNA

gene and internally transcribed spacer region sequences,

Int. J. Syst. Evol. Microbiol. 55 (2005) 263–270.

[16] R.A. Lelliott, R.S. Dickey, Genus XII. Erwinia Winslow,

Broadhurst, Buchanan, Krumwiede, Rogers & Smith

1920, 209AL, in: N.R. Krieg, J.G. Holt (Eds.), Bergey’s

Manual of Systematic Bacteriology, seventh ed., The

Williams & Wilkins Co., Baltimore, 1984, pp. 235–242.

[17] K. Lindstrom, M.E. Martınez-Romero, International

Committee on Systematics of Prokaryotes; Subcommittee

on the taxonomy of Agrobacterium and Rhizobium.

Minutes of the Meeting, 26 July 2004, Toulouse, France,

Int. J. Syst. Evol. Microbiol. 55 (2005) 1383.

[18] M.C.J. Maiden, J.A. Bygraves, E. Feil, G. Morelli, J.E.

Russell, R. Urwin, Q. Zhang, J. Zhou, K. Zurth, D.A.

Caugant, I.M. Feavers, M. Achtman, B.G. Spratt,

Multilocus sequence typing: a portable approach to the

identification of clones within populations of pathogenic

microorganisms, Proc. Natl. Acad. Sci. USA 95 (1998)

3140–3145.

[19] J. Mergaert, L. Verdonck, K. Kersters, Transfer of

Erwinia ananas (synonym, Erwinia uredovora) and Erwinia

stewartii to the genus Pantoea emend. as Pantoea ananas

(Serrano 1928) comb. nov. and Pantoea stewartii (Smith

1898) comb. nov., respectively, and description of Pantoea

stewartii subsp. indologenes subsp. nov., Int. J. Syst.

Bacteriol. 43 (1993) 162–173.

[20] C.D. Michener, R.R. Sokal, A quantitative approach to a

problem in classification, Evolution 11 (1957) 130–162.

[21] R.D.M. Page, TREEVIEW: an application to display

phylogenetic trees on personal computers, Comput. Appl.

Biosci. 12 (1996) 357–358.

[22] F. Ronquist, J.P. Huelsenbeck, MrBayes 3: Bayesian

phylogenetic inference under mixed models, Bioinfor-

matics 19 (2003) 1572–1574.

[23] R. Samson, J.B. Legendre, R. Christen, M. Fischer-Le

Saux, W. Achouak, L. Gardan, Transfer of Pectobacter-

ium chrysanthemi (Burkholder et al. 1953) Brenner et al.

1973 and Brenneria paradisiaca to the genus Dickeya gen.

nov. as Dickeya chrysanthemi comb. nov. and Dickeya

paradisiaca comb. nov. and delineation of four novel

species, Dickeya dadantii sp. nov., Dickeya dianthicola sp.

nov.Dickeya dieffenbachiae sp. nov. and Dickeya zeae sp.

nov., Int. J. Syst. Evol. Microbiol. 55 (2005) 1415–1427.

[24] S.F. Sarkar, D.S. Guttman, Evolution of the core genome

of Pseudomonas syringae, a highly clonal, endemic

plant pathogen, Appl. Environ. Microbiol. 70 (2004)

1999–2012.

[25] M. Scally, E.L. Schuenzel, R. Stouthamer, L. Nunney,

Multilocus sequence type system for the plant pathogen

Xylella fastidiosa and relative contributions of recombi-

nation and point mutation to clonal diversity, Appl.

Environ. Microbiol. 71 (2005) 8491–8499.

[26] V.B.D. Skerman, V. McGowan, P.H.A. Sneath (Eds.),

Approved lists of bacterial names. Int. J. Syst. Bacteriol.

30 (1980) 225–420.

[27] P.H.A. Sneath, Analysis and interpretation of sequence

data for bacterial systematics: the view of a numerical

taxonomist, Syst. Appl. Microbiol. 12 (1989) 15–31.

[28] C. Sproer, U. Mendrock, J. Swiderski, E. Lang, E.

Stackebrandt, The phylogenetic position of Serratia,

Buttiauxella and some other genera of the family

Enterobacteriaceae, Int. J. Syst. Bacteriol. 49 (1999)

1433–1438.

[29] E. Stackebrandt, G.M. Goebel, Taxonomic note: a place

for DNA-DNA-reassociation and 16S rRNA sequence

analysis in the present species definition in bacteriology,

Int. J. Syst. Bacteriol. 44 (1994) 846–849.

[30] E. Stackebrandt, C.R. Woese, The phylogeny of the

prokaryotes, Microbiol. Sci. 1 (1984) 117–122.

ARTICLE IN PRESSJ.M. Young, D.-C. Park / Systematic and Applied Microbiology 30 (2007) 343–354354

[31] M.P. Starr, A.K. Chatterjee, The genus Erwinia: entero-

bacteria pathogenic to plants and animals, Annu. Rev.

Microbiol. 26 (1972) 389–426.

[32] M.P. Starr, M. Mandel, DNA base composition and

taxonomy of phytopathogenic and other enterobacteria,

J. Gen. Microbiol. 56 (1969) 113–123.

[33] L. Sutra, R. Christen, C. Bollet, P. Simoneau, L. Gardan,

Samsonia erythrinae gen. nov., sp. nov., isolated from

bark necrotic lesions of Erythrina sp., and discrimination

of plant-pathogenic Enterobacteriaceae by phenotypic

features, Int. J. Syst. Evol. Microbiol. 51 (2001)

1291–1304.

[34] D.L. Swofford, PAUP*: Phylogenetic Analysis Using

Parsimony (*and Other Methods). Version 4, Sinauer

Associates, Sunderland, MA, 2001.

[35] H. Tettelin, V. Masignani, M.J. Cieslewicz, and 43 others,

Genomic analysis of multiple pathogenic isolates of

Streptococcus agalactiae: implications for the microbial

pan-genome, Proc. Natl. Acad. Sci. 102 (2005)

13950–13955.

[36] L. Vauterin, J. Swings, Are classifications and phyto-

pathological diversity compatible in Xanthomonas?,

J. Ind. Microbiol. Biotechnol. 19 (1997) 77–82.

[37] E.L. Waldee, Comparative studies of some peritrichous

phytopathogenic bacteria, Iowa State College, J. Sci. 19

(1945) 435–484.

[38] B.S. Weir, S.J. Turner, W.B. Silvester, J.M. Young,

Unexpectedly diverse Mesorhizobium strains and Rhizo-

bium leguminosarum nodulate native legume genera of

New Zealand, while introduced legume weeds are

nodulated by Bradyrhizobium species, Appl. Environ.

Microbiol. 70 (2004) 5980–5987.

[39] J.N. White, M.P. Starr, Glucose fermentation end

products of Erwinia spp. and other Enterobacteria, J.

Appl. Bacteriol. 34 (1971) 459–475.

[40] C.R. Woese, Bacterial evolution, Microbiol. Rev. 51

(1987) 221–271.

[41] J.M. Young, Recent systematics developments and

implications for plant pathogenic bacteria, in: F.G. Priest,

M. Goodfellow (Eds.), Applied Microbial Systematics,

Kluwer, Dordrecht, 2000, pp. 133–160.

[42] J.M. Young, Implications of alternative classifications

and horizontal gene transfer for bacterial taxonomy, Int.

J. Syst. Evol. Microbiol. 51 (2001) 945–953.

[43] J.M. Young, Y. Takikawa, L. Gardan, D.E. Stead,

Changing concepts in the taxonomy of plant pathogenic

bacteria, Annu. Rev. Phytopathol. 30 (1992) 67–105.

[44] D.R. Zeigler, Gene sequences useful for predicting

relatedness of whole genomes in bacteria, Int. J. Syst.

Evol. Microbiol. 53 (2003) 1893–1900.