Respiratory virus infections among children in South China

Journal of Medical Virology 86:1249–1255 (2014)

Respiratory Virus Infections Among Children inSouth China

Xiao-Ying Cai,1 Qiong Wang,2 Guang-Yu Lin,1* Zhi-Wei Cai,3 Chuang-Xing Lin,1 Pai-Zhen Chen,1

Xiao-Hua Zhou,1 Jin-Chun Xie,1 and Xue-Dong Lu2

1Department of Pediatrics, The Second Affiliated Hospital of Shantou University Medical College, Shantou,Guangdong, China2Department of Clinical Laboratory Medicine, The Futian Hospital Affiliated to Guangdong Medical College,Shenzhen, Guangdong, China3Department of Transforming Medical Center, The Second Affiliated Hospital of Shantou University Medical College,Shantou, China

Acute respiratory tract infection is an importantcause of morbidity and mortality with a world-wide disease burden. This study aimed todetermine the prevalence and clinical charac-teristics of children with viral-induced acuterespiratory tract infection, in Southern China.Nasopharyngeal aspirate samples from 1,980pediatric patients with suspected acute respira-tory tract infection, and 82 samples fromhealthy subject controls were collected forroutine examination at the Second AffiliatedHospital of Shantou University Medical Col-lege, from October 2007 to August 2011. Speci-mens were tested by multiplex polymerasechain reaction (mPCR). At least one or moreviruses were detected from 1,087 samples(54.9%). These included laboratory confirma-tions for 446 respiratory syncytial virus (RSV),386 influenza virus A (FluA), 315 human rhino-virus (HRV), 135 human bocavirus (HBoV), 119Parainfluenza virus 3 (PIV3), 82 Parainfluenzavirus 1 (PIV1), 66 adenovirus (ADV), 53 WUpolyomavirus (WUPyV), 52 human metapneu-movirus (hMPV), and 29 influenza virus B(FluB) samples. Samples from healthy subjectswere negative for any virus. Of the patientswith positive specimens, 107 (9.8%) were ad-mitted to pediatric intensive care unit (PICU).Co-infection with at least two of the viralpathogens under study was observed in 325 ofthe 1,980 patients (16.4% of the total numberof cases). These findings may help in thediagnosis of viral infections of the respiratorytract in children, and help to consider currentand potential therapeutic approaches for thetreatment of acute respiratory tract infection,and further respiratory complications. J. Med.Virol. 86:1249–1255, 2014.# 2014 Wiley Periodicals, Inc.

KEY WORDS: respiratory virus; children;South China

INTRODUCTION

Acute respiratory tract infection is an importantcause of morbidity and mortality with a worldwidedisease burden estimated at an exceedance of fourmillion deaths per year [Seto et al., 2013]. Acuterespiratory tract infection causes approximately 20%of deaths in pre-school children worldwide, with 90%of these deaths attributed to pneumonia. Commonviral respiratory infections include respiratory syncy-tial virus (RSV), influenza types A and B (FluA andB), parainfluenza types 1 and 3 (PIV1 and 3), humanrhinovirus (HRV), human metapneumovirus (hMPV),adenoviruses (ADV), WU polyomavirus (WUPyV),and human bocavirus (HBoV) [Bastien et al., 2007;Huiuijskens et al., 2012; Bierbaum et al., 2013; Kimet al., 2013]. These viruses cause acute respiratorytract disease in children, are often seasonal, andabout 4–33% present with co-infection of at least oneadditional viral pathogen [Brunstein et al., 2008;Kaplan et al., 2008; Regamey et al., 2008; Sunget al., 2009]. Respiratory viruses can cause moreserious clinical complications such as croup, bronchi-olitis, and pneumonia, which often require

Conflicts of Interest: None.�Correspondence to: Guang-Yu Lin, MD, Department of

Pediatrics, The Second Affiliated Hospital of Shantou UniversityMedical College, Shantou, Guangdong 515041, China.E-mail: [email protected]

Accepted 21 February 2014

DOI 10.1002/jmv.23931Published online 12 March 2014 in Wiley Online Library(wileyonlinelibrary.com).

�C 2014 WILEY PERIODICALS, INC.

hospitalization [Garcıa-Garcıa et al., 2012; Turneret al., 2013]. The aim of this study was to investigatethe prevalence and clinical characteristics of childrenwith viral acute respiratory tract infection in South-ern China.

MATERIALS AND METHODS

Nasopharyngeal Aspirate Specimen Collection

From October 2007 to August 2011, nasopharyn-geal aspirate specimens were collected from 1,980pediatric patients (1,188 boys and 792 girls, agerange 30 days to 12 years) with suspected acuterespiratory tract infection. In addition 82 nasopha-ryngeal aspirate specimens were collected fromhealthy children for routine examination followingoutpatient service (49 boys and 33 girls, age range 3months to 8 years). Written informed consent wasobtained from the parents of each child, and theEthical Committee of the Second Affiliated Hospitalof Shantou University Medical College approved theexperimental protocols.The inclusion criterion was any acute respiratory

tract infection, regardless of the reason for hospitaladmission. These samples were collected from avariety of geographical locations in China includingShantou, Chaozhou, Puning, Shanwei, and Jieyang.The nasopharyngeal aspirate samples were obtainedwithin 24hr of admission where possible, and imme-diately added to 3.0ml of viral transport medium[Dulbecco’s Modified Eagle Medium (DMEM) with100U/ml penicillin (Zhongnuo Pharmaceutical, Shi-jiazhuang, China); 100mg/ml streptomycin (NorthChina Pharmaceutical, Shijiazhuang, China);2,000U/ml amphotericin B (Sanland-chem Interna-tional, Xiamen, China)] and viral transport mediumwas stored at �80˚C until further processing. Thefinal diagnosis was obtained from the dischargeletter, and was made on the basis of both chestradiograph and clinical findings.

Viral Detection

Primers used for multiplex PCR amplification ofrespiratory viruses were selected based on the se-quences available in GenBank. The primers wereselected using Primer Express software (Primer 5.0

and Oligo 6.0) and synthesized by Invitrogen LifeTechnologies (Table I). All of the primer pairs wereinclude in each PCR. The multiplex PCR used hasbeen described previously [Templeton et al., 2004;Fan et al., 2007]. Nucleic acid preparation wasperformed using AxyPrep Body Fluid Viral DNA/RNA Miniprep Kit (Axygen, Shantou, Guangdong,China) according to the manufacturer’s instructions.Briefly, individual NPA samples (200ml) were mixedwith an equal volume of viral lysis buffer andincubated for 5min at room temperature. After add-ing 75ml protein precipitation buffer, the mixturewas centrifuged at 12,000g for 5min. The super-natants were collected and mixed with 300ml isopro-panolþ 1% acetic acid. The mixture was loaded on toa Miniprep column and centrifuged at 6,000g for1min, followed by sequential washings with 500mlwashing buffer and 800ml of desalting buffer. Nucleicacids were eluted with 60ml TE buffer, quantified,and stored at �80˚C.Multiplex PCR involves reverse transcription of

genomes from RNA viruses (FluA and B, PIV1 and 3,RSV, HRV, hMPV), followed by PCR amplification ofthe corresponding cDNA, and direct PCR amplifica-tion of genomes from DNA viruses (ADV, WUPyV,and HBoV). The respiratory viruses were confirmedby resolving PCR products on 1% agarose gels toconfirm amplification of the predicted DNA. Sequenc-ing was performed using a Beckman CEQ-8000instrument and the identity of the PCR productsequences was confirmed using both BLAST andNCBI databases. Each PCR product was identified bysize of the band following agarose gel electrophoresisand confirmed by DNA sequencing.

Statistical Analysis

Data were analyzed using statistical software(SPSS, version 13.0). For statistical analyses, the chi-squared test was applied. A P-value of less than 0.05was considered significant.

RESULTS

Absolute and Relative Virus Frequency

From October 2007 to August 2011, nasopharyn-geal aspirate specimens from 1,980 patients were

TABLE I. Primers Used Multiplex PCR Detection

Virus Forward primer sequence (50–30) Reverse primer sequence (50–30) Product size (bp)

FluA AAGGGCTTTCACCGAAGAGG CCCATTCTCATTACTGCTTC 171FluB GGGATATACGTAATGTGTTGT GCACTGCCTGCTGTACACTT 489PIV1 CAGACGGCATATCTCCTCTGG GGTATGAGAAATTACCGGGT 307PIV3 CTGGGCTTCATCAGTAGAGA GATCTGTTGGTCACCACAAGA 585RSV TTTCCACAATATYTAAGTGTCAA TCATCWCCATACTTTTCTGTTA 155HRV CGGTAATTTTGTACGCCAGTTT GAAACACGGACACCCAAAGTAG 501ADV ATGTATTCCTTTTTCCGAAACTTCCA GCCACATGGTGCGATCGCA 248HBoV GCAAACCCATCACTCTCAATGC GCTCTCTCCTCCCAGTGACAT 404hMPV AACCGTGTACTAAGTGATGCACTC CATTGTTTGACCG(A)GCC(A)CCA(G)TAA 191WUPyV TGTTACAAATAGCTGCAGGTC GCATAATGGGGAGTACC 217

J. Med. Virol. DOI 10.1002/jmv

1250 Cai et al.

collected; 150 of these patients admitted to pediatricintensive care units (PICU). Of the children diag-nosed, 1,087 (54.9%) were positive for at least onevirus, while none of the 82 healthy controls werepositive. The positive specimens included the follow-ing viruses: RSV (446); FluA (386); HRV (315);hHBoV (135); PIV3 (119); PIV1 (82); ADV (66);WUPyV (53); hMPV (52); and FluB (29) (Fig. 1,Table II). Of the 1,087 patients with positive speci-mens, 107 (9.8%) were admitted to a pediatric inten-sive care unit with RSV (54) being the mostprevalent (Tables II and III).

Viral Co-Infections

Co-infection with at least two of the viral patho-gens under study, was observed in 325 of the 1,980patients (16.4% of the total number of cases); twopathogens were detected in 234 samples (11.8%),three pathogens in 68 samples (3.4%), four pathogensin 17 samples (0.9%), and six samples (0.3%) con-tained five viral pathogens. The most common patho-gens in co-infected samples were PIV1 (68.5%), PIV3(60%), FluB (58.6%), WUPyV (54.9%), FluA (52.1%),and HBoV (50.4%) (Table IV).

Correlation of Specific Viruses With AgeDistribution

The age distribution of the patients from whom theviruses were detected was identical to the agedistribution of the population sampled. Although RSVinfection was detected in 26.5% of children, thefrequency of RSV-positive samples decreased withincreasing age. Among children in the first 6 monthsof life, RSV was the most common virus detected,

infecting 30.5% (160/524) children (Table V). Only19.6% of children older than 6 months of age wereRSV positive (x2¼ 26.2, P< 0.05). While the percent-age of FluA infected children rose from 18.6% to22.9% after reaching the age of 3, the differenceswere not statistically significant. Similarly, no sta-tistically significantly age group differences wereobserved in ADV, PIV1, PIV3, HBoV, hMPV, FluB, orWUPyV-infected individuals.

Seasonal Distribution of Viruses

The virus detection rate was not distributed equal-ly during different seasons (Fig. 2). RSV was detectedmostly during the spring and winter, while ADV wasprimarily detected in the summer. HRV was detectedin all seasons but detected mostly during the end ofthe winter and the beginning of spring. HBoV andWUPyV were detected primarily during the springand summer, while PIV3, FluA, PIV1, FluB, andhMPV were primarily detected in the spring.

Clinical Characteristics of Patients With ViralInfection

The clinical symptoms and diagnosis of the patientswith viral infection are shown in Tables VI and VII.Bronchopneumonia was the most common diagnosis

Fig. 1. Identification of viral isolates by PCR analysis. M,molecular marker; lane 1, FluA, FluB, PIV1, PIV3 positive; lane2, FluA positive; lane 3, FluB positive; lane 4, PIV1 positive;lane 5, PIV3 positive; lane 6, no template control; lane 7, RSV,HRV positive; lane 8, RSV positive; lane 9, HRV positive; lane10, no template control; lane 11, hMPV positive; lane 12, notemplate control; lane 13, ADV, HBoV positive; lane 14, ADVpositive; lane 15, HBoV positive; lane 16, no template control.The samples tested are from patients.

TABLE II. Viruses Detected by Multiplex PCR From 1,980NPA Specimens: October 2007 to August 2011

VirusPositivecases

Positiveconstituentratio (%)

PICUcases

PICUconstituent

ratio

RSV 446 41.03 54 12.11FluA 386 35.51 8 2.07HRV 315 28.98 50 15.87HBoV 135 12.42 5 3.70PIV3 119 10.95 4 3.36PIV1 82 7.54 2 2.44ADV 66 6.07 10 15.15WUPyV 53 4.88 2 3.77hMPV 52 4.78 2 3.85FluB 29 2.67 3 10.34

TABLE III. General Ward Versus PICU Admissions

The general ward PICU x2 P-value

No. of samples 1,830 150Positive samples (%)Total 980 107RSV 392 (21.4%) 54 (36%) 16.88 <0.01FluA 378 (20.65%) 8 (5.33%) 20.74 <0.01HRV 265 (14.48%) 50 (33%) 36.83 <0.01HBoV 130 (7.10%) 5 (3.33%) 3.1 >0.05PIV3 115 (6.28%) 4 (2.67%) 3.21 >0.05PIV1 80 (4.37%) 2 (1.33%) 3.22 >0.05ADV 56 (3.06%) 10 (6.67%) 5.43 <0.05WUPyV 51 (2.79%) 2 (1.33%) 0.64 >0.05hMPV 50 (2.73%) 2 (1.33%) 0.58 >0.05FluB 26 (1.42%) 3 (2%) 0.046 >0.05

The boldness is to emphasize these results are meaningful.


Respiratory Virus Infections 1251

for RSV, FluA, HRV, PIV3, PIV1, ADV, and WUPyVinfection. HBoV and hMPV infection was more com-monly associated with capillary bronchitis than bron-chopneumonia. Fever, panting, and cough comprisedthe majority of clinical symptoms. Interestingly, twopatients, one infected with WUPyV and one infectedwith HBoV, were diagnosed with severe encephalitis.In addition, two other patients, one infected withhMPV and one infected with HBoV, were diagnosedwith respiratory failure.

DISCUSSION

Acute respiratory tract infections are a persistentand significant public health problem. Worldwide,they cause a greater burden of disease than humanimmunodeficiency virus infection, malaria, cancer, orheart attacks. It has been postulated that they causemore illness and death than any other infection, andthere has been little change in mortality due to acuterespiratory tract infection for more than five decades[Mizgerd, 2006; Hasan et al., 2014]. Furthermore,respiratory infections are the most lethal of diseasesin developing countries [Perdue et al., 2011].This study describes the simultaneous detection of

multiple respiratory pathogens with different clinicalmanifestations of acute respiratory tract infection inhospitalized children. An epidemiological investiga-tion of ten viruses was conducted over 46 months. Atleast one viral pathogen was detected in 54.9%(1,087/1,980) of the nasopharyngeal aspirate speci-mens, a rate comparable to other studies (35–78%)

[Bharaj et al., 2009; Sung et al., 2009; Bukhari andElhazmi, 2013; Drieghe et al., 2014; Hasan et al.,2014]. This large number of specimens provided thestudy with an adequate database with which to makemeaningful conclusions regarding the relative fre-quencies and seasonal distributions of the virusesdetected and the statistical power to infer clinicalcorrelations. Two or more pathogens were detected in16.4% of the children, with some pathogens, such asHRV, WUPyV, and HBoV, being frequently identifiedas co-infections while others, including RSV andhMPV were more commonly detected as single in-fections. Co-infection was not associated with in-creased disease severity, an observation corroboratedby other analyses [Canducci et al., 2008].Patients with respiratory viral infection usually

develop clinical symptoms, including fever, cough,panting, and shortness of breath. Such infections canlead to the development of bronchial pneumonia,bronchiolitis, and upper respiratory tract infection[Sung et al., 2009; Broor et al., 2013]. The studyfound fever and cough to be the most common clinicalsymptoms. Bronchopneumonia was the most commondiagnosis for RSV, FluA, HRV, PIV3, PIV1, ADV, andWUPyV infection while capillary bronchitis was themost common diagnosis for HBoV and hMPVinfection.The most common pathogen detected in the study

was RSV. RSV is the most common cause of child-hood pneumonia worldwide [Zhang et al., 2010]. Inthe study, 36% of RSV-positive children were admit-ted to the pediatric intensive care unit, while 21.4%

TABLE V. Age Group Correlation and Viral Infection

Age Samples

Positivesamples

(%)

Patients infected with each virus

TotalRSV HRV FluA ADV PIV3 PIV1 HBoV hMPV FluB WUPyV

<6 months 524 85.11 160 77 91 16 26 17 27 12 7 13 4466 months–1 year 466 82.83 103 75 80 17 31 21 32 10 6 11 3861–3 years 616 88.31 134 108 128 17 43 26 50 15 5 18 5443–6 years 262 84.35 34 37 64 8 16 12 17 15 8 10 221>6 years 112 76.78 15 18 23 8 3 6 9 0 3 1 86Total 1,980 85 446 315 386 66 119 82 135 52 29 53 1,683

TABLE IV. Pathogen Frequency in Co-Infected Samples

VirusPositivesamples

Co-infectedsamples Frequency (%)

RSV 446 218 48.95FluA 386 201 52.12HRV 315 154 49.08HBoV 135 68 50.37PIV3 119 71 60PIV1 82 57 68.51ADV 31 66 48.21WUPyV 53 29 54.90hMPV 52 19 36.54FluB 29 17 58.62

Fig. 2. Seasonal distributions of individual viruses. Respira-tory viruses were isolated over four seasons with their preva-lence expressed as a percentage of the total.


1252 Cai et al.

were admitted to the general ward setting. Immunityto RSV infection is not permanent with repeatedinfections throughout life being common. Further-more, there is no effective vaccine and anti-viraltreatment is not clinically indicated nor effective[Zhang et al., 2010]. RSV is particularly prevalent ininfants below the age of 6 months [Reiche andSchweiger, 2009; Moore et al., 2013], an observationthat our study corroborated.Infections with FluA and HRV were also common

and there were no age-specific differences betweengroups. For FluA infection, a small percentage ofchildren required pediatric intensive care unit sup-port. However, the incidence of influenza pediatricintensive care unit admissions decreased significantlycompared with the general ward admissions. Con-versely, the incidence of HRV in pediatric intensivecare unit admissions increased significantly whencompared with the general ward admissions.Adenovirus infections are associated with different

clinical syndromes. The majority of adenovirus infec-tions result in tonsillopharyngitis and respiratoryillness, particularly in children [Lu et al., 2013].Furthermore, ADV are responsible for up to 10% oflower respiratory tract infections in children [Ardenet al., 2006; Moura et al., 2007; Albarbi et al., 2012;Qurei et al., 2012]. In this study, a lower rate of ADVinfection was found, as well as a difference between

pediatric intensive care unit admissions and generalward admissions, even though ADV infections arebeing increasingly recognized as a cause of severedisease [Lynch et al., 2011].This study identified increased detections with

emerging viruses including HBoV, WUPyV, andhMPV. WU polyomavirus (WUPyV) was identifiedfrom lower respiratory tract samples in 2007 [Gaynoret al., 2007]. The prevalence rate of WUPyV infectionvaries from 0.4% to 13.9% among patients andasymptomatic individuals [Rao et al., 2011; Okadaet al., 2013]. In this study, WUPyV infection rate was2.7%. Previous studies have found that individualswith WUPyV infection are commonly co-infected withother viruses [Gaynor et al., 2007; Neske et al., 2008;Debiaggi et al., 2012]. In the current study, 29 of 53patients with WUPyV infection were co-infected withat least one other virus.Human bocavirus (HBoV) was first described in

September 2005 [Allander et al., 2005]. The propor-tion of respiratory specimens from symptomatic hos-pitalized children that contain HBoV sequences hasranged from 1.5% to 19% [Allander et al., 2007;Deerojanawong et al., 2013; Levican et al., 2013]. Inthis study, the HBoV infection rate was 6.8%. Accord-ing to the literature, HBoV DNA-positive acuterespiratory tract infections occur in children across arange of months, with the peak season varying from

TABLE VII. Clinical Symptoms and X-Ray Results From Infected Patients

Virus Number Fever CoughShortnessof breath Panting Gastroenteritis

X-ray results

BPNchanged

Bronchitischanged No assay

RSV 446 312 (69.95) 446 (100) 145 (31.51) 215 (48.21) 10 (2.24) 205 (45.9) 180 (40.36) 61 (13.68)FluA 386 307 (79.53) 380 (98.44) 104 (26.94) 113 (29.27) 12 (3.11) 154 (39.89) 173 (44.82) 59 (15.28)HRV 315 288 (91.43) 267 (84.76) 123 (39.05) 196 (62.22) 17 (5.40) 149 (47.30) 84 (26.98) 82 (26.03)HBoV 135 114 (84.44) 103 (76.30) 96 (71.11) 101 (74.81) 9 (6.67) 44 (32.59) 63 (46.67) 28 (20.74)PIV3 119 97 (81.51) 109 (91.60) 46 (38.65) 25 (21.01) 8 (6.72) 59 (49.58) 36 (30.25) 24 (20.17)PIV1 82 77 (93.90) 75 (91.46) 5 (6.10) 8 (9.76) 10 (12.20) 40 (48.78) 26 (31.70) 16 (19.51)ADV 66 66 (100) 57 (86.36) 17 (25.76) 12 (18.18) 4 (6.06) 40 (60.60) 25 (37.88) 1 (1.51)WUPyV 53 30 (56.60) 52 (98.11) 27 (50.94) 28 (52.83) 5 (9.43) 28 (52.83) 18 (33.96) 7 (13.21)hMPV 52 31 (59.61) 40 (76.92) 23 (44.23) 25 (48.08) 6 (11.54) 19 (36.54) 25 (48.08) 8 (15.38)FluB 29 23 (79.31) 28 (96.55) 15 (51.72) 9 (31.03) 3 (10.34) 10 (34.48) 11 (37.93) 8 (27.59)

TABLE VI. Clinical Diagnosis of Patients With Virus

Virus Number BPN Bronchiolitis URTI Capillary bronchitis Laryngitis

RSV 446 205 (45.9) 40 (8.96) 27 (6.05) 130 (29.14) 44 (9.86)FluA 386 154 (39.89) 77 (30.05) 38 (9.84) 96 (24.87) 21 (5.4)HRV 315 158 (50.16) 35 (11.11) 47 (14.92) 40 (12.70) 35 (11.11)HBOV 135 40 (29.62) 23 (17.03) 16 (11.85) 48 (35.56) 8 (5.92)PIV3 119 61 (51.26) 22 (18.49) 24 (20.17) 12 (10.08) 0PIV1 82 40 (48.78) 25 (30.48) 15 (18.29) 1 (1.22) 1 (1.22)ADV 66 36 (54.54) 13 (19.69) 3 (4.54) 12 (18.18) 2 (3.03)WUPyV 53 25 (47.17) 10 (18.87) 5 (9.43) 8 (15.1) 5 (9.43)hMPV 52 18 (34.61) 8 (15.38) 5 (9.61) 19 (36.54) 2 (3.85)FluB 29 8 (27.59) 10 (34.48) 9 (31.03) 1 (3.45) 1 (3.45)Total 1,683 753 (44.74) 273 (16.22) 189 (11.22) 349 (20.74) 119 (7.07)

BPN, bronchopneumonia; URTI, upper respiratory tract infection.



year to year [Ahn et al., 2014]. Most researchersreporting from regions with temperate climates haveobserved a higher occurrence of HBoV detectionsduring the winter and spring months [Smuts andHardie, 2006; Tran et al., 2013]. This study found arelatively high occurrence of HBoV in the late springand early summer in this study, consistent withprevious findings [Choi et al., 2006]. This studydetected one or more additional viruses in 50.4% (68/135) of HBoV-positive samples. Such high percen-tages have been reported by most studies that haveinvestigated co-infections [Fry et al., 2007]. Previousstudies have found that most children with HBoV,WUPyV, or hMPV infection had mild or moderatedisease but in our studies, four patients who werepositive for these emerging viruses, developed pro-gressive diseases such as severe encephalitis orrespiratory failure. It is important to examine furtherthe propensity of HBoV, WUPyV, or hMPV to causesevere disease and the pathogenic mechanisms un-derlying this phenomenon.

CONCLUSIONS

Viral infections of the respiratory tract and thesubsequent complications from these infections leadto a significant burden on healthcare systemsthroughout the world. Current treatments are lessthan ideal making clinical research and public healthsurveillance critical. These regionally specific findingswill provide data to pediatricians and general practi-tioners to aid in the selection of appropriate therapiesand to prevent the abuse of antibiotics. This studyhighlighted the incidence of respiratory pathogens inchildren in South China. These findings may help inthe diagnosis of viral infections of the respiratorytract, in children. However, further studies with alarge number of patients will increase our under-standing of the pathogenesis of respiratory tract viralinfections.

REFERENCES

Ahn JG, Choi SY, Kim DS, Kim KH. 2014. Human bocavirusisolated from children with acute respiratory tract infections inKorea, 2010–2011. J Med Virol, Jan 4 [Epub ahead of print].

Alharbi S, Van Caeseele P, Consunji-Araneta R, Zoubeidi T, FanellaS, Souid AK, Alsuwaidi AR. 2012. Epidemiology of severepediatric adenovirus lower respiratory tract infections in Man-itoba, Canada, 1991–2005. BMC Infect Dis 13:12–55.

Allander T, Jartti T, Gupta S, Niesters HG, Lehtinen P, OsterbackR, Vuorinen T, Waris M, Bjerkner A, Tiveljung-Lindell A, vanden Hoogen BG, Hyypia T, Ruuskanen O. 2007. Humanbocavirus and acute wheezing in children. Clin Infect Dis44:904–910.

Allander T, Tammi MT, Eriksson M, Bjerkner A, Tiveljung-LindellA, Andersson B. 2005. Cloning of a human parvovirus bymolecular screening of respiratory tract samples. Proc Natl AcadSci USA 102:12891–12896.

Arden KE, McErlean P, Nissen MD, Sloots TP, Mackay IM. 2006.Frequent detection of human rhinoviruses, paramyxoviruses,coronaviruses, and bocavirus during acute respiratory tractinfec-tions. J Med Virol 78:1232–1240.

Bastien N, Chui N, Robinson JL, Lee BE, Dust K, Hart L, Li Y.2007. Detection of human bocavirus in Canadian children in a 1-year study. J Clin Microbiol 45:610–613.

Bharaj P, Sullender WM, Kabra SK, Mani K, Cherian J, Tyagi V,Chahar HS, Kaushik S, Broor S. 2009. Respiratory viralinfections detected by multiplex PCR among pediatric patientswith lower respiratory tract infections seen at an urban hospitalin Delhi from 2005 to 2007. Virol J 6:89–100.

Bierbaum S, Forster J, Berner R, Rucker G, Rohde G, Neumann-Haefelin D, Panning M, study CAPNETZ group. 2013. Detectionof respiratory viruses using a multiplex real-time PCR assay inGermany, 2009/10. Arch Virol, Oct 15 [Epub ahead of print].

Broor S, Dawood FS, Pandey BG, Saha S, Gupta V, Krishnan A,Rai S, Singh P, Erdman D, Lal RB. 2013. Rates of respiratoryvirus-associated hospitalization in children aged <5 years inrural northern India. J Infect, Nov 21 [Epub ahead of print].

Brunstein JD, Cline CL, McKinney S, Thomas E. 2008. Evidencefrom multiplex molecular assays for complex multi-pathogeninteractions in acute respiratory infections. J Clin Microbiol46:97–102.

Bukhari EE, Elhazmi MM. 2013. Viral agents causing acute lowerrespiratory tract infections in hospitalized children at a tertiarycare center in Saudi Arabia. Saudi Med J 34:1151–1155.

Canducci F, Debiaggi M, Sampaolo M, Marinozzi MC, Berre S,Terulla C, Garqantini G, Cambieri P, Romero E, Clementi M.2008. Two-year prospective study of single infections and co-infections by respiratory syncytial virus and viruses identifiedrecently in infants with acute respiratory disease. J Med Virol80:716–723.

Choi EH, Lee HJ, Kim SJ, Eun BW, Kim NH, Lee JH, Song EK,Kim SH, Park JY, Sung JY. 2006. The association of newlyidentified respiratory viruses with lower respiratory tract infec-tions in Korean children, 2000–2005. Clin Infect Dis 43:585–592.

Debiaggi M, Canducci F, Ceresola ER, Clementi M. 2012. The roleof infections and coinfections with newly identified and emergingrespiratory viruses in children. Virol J. 9:247–265.

Deerojanawong J, Satdhabudha A, Prapphal N, Sritippayawan S,Samransamruajkit R. 2013. Incidence of recurrent wheezing inunder 5-year-old human bovavirus infection during one yearfollow-up. J Med Assoc Thai 96:185–191.

Drieghe S, Ryckaert I, Beuselinck K, Lagrou K, Padalko E. 2014.Epidemiology of respiratory viruses in bronchoalveolar lavagesamples in a tertiary hospital. J Clin Virol [Epub ahead ofprint].

Fan W, Hamilton T, Webster-Sesay S, Nikolich MP, Lindler LE.2007. Multiplex real-time SYBR Green I PCR assay for detectionof tetracycline efflux genes of Gram-negative bacteria. Mol CellProbes 21:245–256.

Fry AM, Lu X, Chittaganpitch M, Peret T, Fischer J, Dowell SF,Anderson LJ, Erdman D, Olsen SJ. 2007. Human bocavirus: Anovel parvovirus epidemiologically associated with pneumoniarequiring hospitalization in Thailand. J Infect Dis 195:1038–1045.

Garcıa-Garcıa ML, Calvo C, Pozo F, Villadangos PA, Perez-Bre~na P,Casas I. 2012. Spectrum of respiratory viruses in children withcommunity-acquired pneumonia. Pediatr Infect Dis J 31:808–813.

Gaynor AM, Nissen MD, Whiley DM, Mackay IM, Lambert SB, WuG, Brennan DC, Storch GA, Sloots TP, Wang D. 2007. Identifica-tion of a novel polyomavirus from patients with acute respirato-ry tract infections. PLoS Pathog 3:e64.

Hasan R, Rhodes J, Thamthitiwat S, Olsen SJ, Prapasiri P, NaoratS, Chittaganpitch M, Henchaichon S, Dejsirilert S, SrisaengchaiP, Sawatwong P, Jorakate P, Kaewpwan A, Fry AM, Erdman D,Chuananon S, Amornintapichet T, Maloney SA, Baggett HC.2014. Incidence and etiology of acute lower respiratory tractinfections in hospitalized children younger than 5 years in ruralThailand. Pediatr Infect Dis J 33:e45–e52.

Huiuijskens EG, Biesmans RC, Buiting AG, Obihara CC, RossenJW. 2012. Diagnostic value of respiratory virus detection iinsymptomatic children using real-time PCR. Viral J 9:276–283.

Kaplan NM, Dove W, Abd-Eldayem SA, Abu-Zeid AF, Shamoon HE,Hart CA. 2008. Molecular epidemiology and disease severity ofrespiratory syncytial virus in relation to other potential patho-gens in children hospitalized with acute respiratory infection inJordan. J Med Virol 80:168–174.

Kim JK, Jeon JS, Kim JW, Rheem I. 2013. Epidemiology ofrespiratory viral infection using multiplex rt-PCR in Cheonan,Korea (2006–2010). J Microbiol Biotechnol 23:267–273.

Levican J, Navas E, Orizola J, Avendano LF, Gaggero A. 2013.Human bocavirus in children with acute gastroenteritis, Chile,1985–2010. Emerg Infect Dis 19:1877–1880.


1254 Cai et al.

Lu MP, Ma LY, Zheng Q, Dong LL, Chen ZM. 2013. Clinicalcharacteristics of adenovirus associated lower respiratory tractinfection in children. World J Pediatr 9:346–349.

Lynch JP, Fishbein M, Echavarria M. 2011. Adenovirus. SeminRespir Crit Care Med 32:494–511.

Mizgerd JP. 2006. Lung infection-a public health priority. PLoSMed 3:e76.

Moore ML, Stokes KL, Hartert TV. 2013. The impact of viralgenotype on pathogenesis and disease severity: Respiratorysyncytial virus and human rhinoviruses. Curr Opin Immunol25:761–768.

Moura PO, Roberto AF, Hein N, Baldacci E, Vieira SE, EjzenbergB, Perrini P, Stewien KE, Durigon EL, Mehneri DU, Harsi CM.2007. Molecular epidemiology of human adenovirus isolatedfrom children hospitalized with acute respiratory infection inSao Paulo, Brazil. J Med Virol 79:174–181.

Neske F, Blessing K, Ullrich F, Prottel A, Wolfqang Kreth, H,Weissbrich, B. 2008. WU polyomavirus infection in chidlren,Germany. Emerg Infect Dis 14:680–681.

Okada M, Hamada H, Sato-Maru H, Shirato Y, Honda T, Muto A,Hayashi K, Terai M. 2013. Wu polyomavirus detected inrespiratory tract specimens from young children in Japan.Pediatr Int 55:536–537.

Perdue ML, Bright RA. 2011. United States of America Departmentof Health Human Services support for advancing influenzavaccine manufacturing in the developing world. Vaccine. 29:a48–a50.

Qurei L, Seto D, Salah Z, Azzeh M. 2012. A molecular epidemiologysurvey of respiratory adenoviruses circulating in children resid-ing in Southern Palestine. PLoS ONE 7:e42732.

Rao S, Garcea RL, Robinson CC, Somoes EA. 2011. WU and KIpolyomavirus infections in pediatric hematology patients withacute respiratory tract illness. J Clin Virol 52:28–32.

Regamey N, Kaiser L, Roiha HL, Deffernez C, Kuehni CE, LatzinP, Aebi C, Frey U. 2008. Viral etiology of acute respiratoryinfections with cough in infancy: A community-based birthcohort study. Pediatr Infect Dis J 27:100–105.

Reiche J, Schweiger B. 2009. Genetic variability of group A humanrespiratory syncytial virus strains circulating in Germany from1998 to 2007. J Clin Microbiol 47:1800–1810.

Seto WH, Conly JM, Pessoa-Silva CL, Malik M, Eremin S. 2013.Infection prevention and control measures for acute respiratoryinfections in healthcare settings: An update. East MediterrHealth J 19: S39–S47.

Smuts H, Hardie D. 2006. Human bocavirus in hospitalizedchildren, South Africa. Emerg Infect Dis 12:1457–1458.

Sung RY, Chan PK, Tsen T, Li AM, Lam WY, Yeung AC, NelsonEA. 2009. Identification of viral and atypical bacterial pathogensin children hospitalized with acute respiratory infections inHong Kong by multiplex PCR assays. J Med Virol 81:153–159.

Templeton KE, Scheltinga SA, Beersma MF, Kroes AC, Claas EC.2004. Rapid and sensitive method using multiplex real-timePCR for diagnosis of infections by influenza A and influenza Bviruses, respiratory syncytial virus, and parainfluenza viruses 1,2, 3, and 4. J Clin Microbiol 42:1564–1569.

Tran DN, Nguyen TQ, Nguyen TA, Hayakawa S, Mizuguchi M,Ushijima H. 2013. Human bocavirus in children with acute respira-tory infections in Vietnam. J Med Virol [Epub ahead of print].

Turner P, Turner C, Watthanaworawit W, Carrara, V, Cicelia N,Deglise C, Phares C, Ortega L, Nosten F. 2013. Respiratoryvirus surveillance in hospitalised pneumonia patients on theThailand–Myanmar border. BMC Infect Dis 13:434–443.

Zhang RF, Jin Y, Xie ZP, Liu N, Yan KL, Gao HC, Song JR, YuanXH, Guo MW, Zhou QH, Hou YD, Duan Z. 2010. Humanrespiratory syncytial virus in children with acute respiratorytract infections in China. J Clin Microbiol 48:4193–4199.



Documents

Respiratory virus infections among children in South China