Chapter 9

Mapping and characterizing whole genomes

• Structural Genomics• Functional genomics

How many genes has a human?

27,000

5,500

Interpretation of genomicinformation:

high throughputtechnologies are used to getideas about gene (orgenomic) function.

Structural and functional genomics:a hierarchical representation

Structural Genomics.The analysis of the physical structure of genomes.

Mapping Genomes

Cytogenetic and Genetic maps were very helpful forsequencing genomes.

Cytogenetic maps are established by correlating chromosomallandmarks with phenotyps. The correlation with the location ofcloned DNA can result in high resolution maps.

Chromosome painting by in situ hybridisation using different-labelled probes.

A B

a b

A B a b

a bX

A B

A = rote Blüte, B = hohe Pflanze

F1:

Genetische Karten

A B

a b

a b

a bX

Genetische Karten 1: die Phänotypen der Allele der GeneA und B werden betrachtet

A B

a ba b

a b

parental:

Die Gene A und Bsind mit 10 cMgekoppelt,Analyse durch Auswertung derPhänotypen

rekombinant:A b

a ba B

a b

90

10

A B

a b

a b

a bX

Genetische Karten 2: der Phänotyp der Allele von A undder DNA-Polymorphismus in Position B werden betrachtet

A B

a ba b

a b

parental:

rekombinant:

A b

a B

90

10

Phänotyp DNA in B

A/a

a/a

A/a

a/a

B/b b/b

b/b B/b

A B

a b

a b

a bX

Genetische Karten 3: die DNA-Polymorphismen in denPositionen A und B werden betrachtet

A B

a ba b

a b

parental:

rekombinant:

A b

a B

90

10

DNA in A DNA in B

B/b b/bA/a a/a

b/b B/bA/a a/a

High resolution genetic maps: making use of meiotic recombination

a) Restriction fragment lenght polymorphism maps (RFLP maps)

neutral DNA sequence variation is used

A probe P detects a DNA polymorphism when the genomic DNA is cut by acertain restriction enzyme (RE). The pedigree of the dominant diseasephenotype D shows linkage of the D locus to the RFLP locus; only child 8is a recombinant.

preparation of the probe

Obtaining a DNA fingerprint by using VNTR (variable numbertandem repeats) probe. VNTRs are also called minisatellite DNA.VNTRs consist of a variable number of a repeating unit which isabout 15 to 100 bp in length.

In this example, a Southern blot is used for detection. Now replaced by PCR

DNA fingerprints

are used in forensic medicine. Minute DNAamounts isolated for example from bloodare used by amplifying specific VNTRsequences with PCR.

VNTRs can be used for genetic mapping. The molecular markers can bemapped to one another or to a locus with a known phenotype.

Microsatellite Markers

Microsatellites is a class of repetitive DNA that is based on di- andtrinucleotide repeats that are highly variable between individuals. Thesesimple-sequence length polymorphisms (SSLPs) are also used for geneticmapping.(VNTRs are also classified as SSLPs).

(CA)n(GT)n

Primer 1

Primer 2

5'5'

Microsatellites as molecular markers for mapping.

Microsatellites as molecular markers for mapping.

High resolution genetic maps

b) Simple sequence length polymorphisms (SSLPs)

RFLP markers have first been used in molecular mapping projects. Theyare now replaced by markers based on the variation of short tandem

repeats.

• Tandemly repeated• Variable numbers of repeats, give different size restriction fragments

detected on Southern blots• Simple sequence length polymorphisms (SSLPs)

– e.g., TGACGTATGACGTATGACGTATGACGTA– mutations give rise to large number of alleles– higher proportion of heterozygotes– two types in genomics

• minisatellite (VNTRs)• microsatellite

• Minisatellites– based on variation of number of tandem repeats

(VNTRs) which segregate as alleles– in humans, repeat unit is 15-100 nucleotides, for total

of 1-5 kb– if number of repeats is variable, Southern blot will

show numerous bands– basis of DNA fingerprinting and can be used in

mapping• Microsatellites

– sequences dispersed throughout the genome– variable numbers of di- or trinucleotide repeats– detected by PCR

There are several more molecular mapping techniques existing

Physical Mapping of Genomes

Long chromosomal fragments (~ 150 kb) can be cloned into BAC vectorsand a genomic librqary can be established.

Individual BAC clones are alligned in order to cover wholechromosomes. These BAC contigs are one possible starting materialfor genome sequencing projects.

(An example from the yeast genome is presented in the next figure.)

heterochromatin

centromer

chromosome

Genome projects

After alignement of the BAC clones, each BAC is sequenced by shotgunsequencing: DNA fragments of 1 - 2 kb are generated, sequenced from bothends, and aligned by sequence comparisons.

An alternative is to omitt the BAC clones and to start shotgun sequencingdirectly with the genomic DNA.

A bacterial genome

Arabidopsis thaliana genome sequence

The Arabidopsis genome initiative, Nature408, 796-815 (2000)

Lin et al, Nature 402, 761-768 (1999)

Proportion of predicted genes in functional categoriesAbout 25,000 genes have been predicted

The Arabidopsis genome initiative, Nature 408, 796-815 (2000)

Segmentally duplicated regions in the Arabidopsis genome.The Arabidopsis genome initiative, Nature 408, 796-815 (2000)

Functional genomics

• Study of expression and interaction of gene products• Requires new vocabulary and techniques

– transcriptome: all DNA transcripts• may be monitored by use of DNA chips

– proteome: all encoded proteins• complicated by alternative splicing

– interactome: all interactions between all categories ofmolecules

• detected by two-hybrid system and relatedprocedures

– phenome: phenotype of each gene knockout

Functional genomics

• The study of transcriptional regulation by using DNA chips• The study of proteins by using 2D gels and mass spectroscopy• The study of metabolites by using chromatographic separation and mass

spectroscopy

The analysis of cells, tissues, and organisms can occur on differentlevels of gene expression

DNA

RNA

Protein

Metabolite

Genome

Transcriptome

Proteome

Metabolome

Transcriptome analysisba using microarrays (DNA chips)

Display of gene expression patterns detected bymicroarrays.

Each row is a different gene and each column adifferent time point. Red means active; greeninactive.

Caterpillar and butterfly of the same species

Lottspeich, Angewandte Chemie, 1999

Proteome

Arabidopsis proteins separated on a 2D PAGE; provided by Angelika GörgFirst Dimension: 3-10 IPG

isoelectric focusingSDS PAGE

++

samplegrating

UV or IR laser

TOF detector

MALDI-TOF analysis of proteins

Lipophilic phase of Arabidopsis leaves analysed by GC/MS; ~ 160 metabolitescan be distiguished.

Metabolite profiling by GC/MS. Base peak intensity GC/MS chromatogram of the polarfraction of a leaf extract from the Arabidopsis dgd1 mutant (A). Target metabolites areidentified by exact retention times and their corresponding mass spectra (B) as shownfor the co-eluting peaks of malate, -aminobutyric acid (GABA), and an unidentifiedcompound. m/z, Ratio of mass to charge.

Scheme showing how the integration of results from differenttechnological levels of functional genomics leads to construction of a

virtual plant

Functional Genomics