Supplemental Information Coordinate Transcriptional and

Molecular Cell, Volume 50

Supplemental Information

Coordinate Transcriptional and Translational Repression of p53 by TGF-1 Impairs the Stress Response

Fernando J. López-Díaz, Philippe Gascard, Sri Kripa Balakrishnan, Jianxin Zhao, Sonia V. del Rincon, Charles Spruck, Thea D. Tlsty, and Beverly M. Emerson

Supplemental Information Inventory Figure S1. The p53-mediated DNA damage response in p63/p73 expressing MCF10A cells reciprocally interferes with Smad signaling, related to Figures 1 and 3. Figure S2, Representative IHC and western blot studies in Human Mammary Normal and Tumor Tissues, reveals that TGFβ signaling is active in normal and tumor breast tissues and that mutant or p53 protein levels do not fully reflect a cooperation between the two pathways in breast tissue, related to Figure 2 and table S1. Figure S3. Representative IHC results for PUMA, P53 and P-Smad2 showing contrasting levels of apoptotic protein PUMA, p53 as compared to P-Smad 2 in on select breast tumor samples, related to Figure 3. Figure S4, Analyses of Post-transcriptional, Post-translational, and translational regulation of p53 by physiological doses of TGFβ1, related to Figure 4. Figure S5. RPL26and EF1a distribution across the polysomal fractionation, RIP controls, and RPL26 nuclear/cytoplasm localization controls, related to Figure 4. Figure S6. ChIP studies for Smad and RNAP II association with the endogenous p53 gene promoter, related to Figures 5 and 6. Figure S7. E2F-4 knock-down studies on basal and TGFβ1-repressed p53 mRNA levels related to Figure 7. Table S1. Immunohistochemistry scores of human breast tissue sections, related to Figures 1, 2, S2, S3. Table S2. p53 mRNA in Human Breast Carcinomas, related to Figure 4. SUPPLEMENTAL EXPERIMENTAL PROCEDURES, including detailed procedures for methods described in the manuscript, additional methods and tables of antibodies, sequences and oligonucleotides. SUPPLEMENTAL REFERENCES

Lopez-Diaz et al., page 2

Figure S1. The p53-mediated DNA damage response in p63/p73-expressing MCF10A cells reciprocally

interferes with Smad signaling. Related to Figures 1 and 3.

(A) Apoptotic index assays were performed on lentiviral-transduced, GFP-positive, MCF10A cells

expressing shRNAs directed to p53 or to the Glucose Transporter 4 (GT4) used as control. Annexin V

binding was determined after 8 hr DoxR treatment by incubation with Alexa-350 conjugated Annexin-V

and propidium iodide followed by FACS analysis. Percentages of Annexin-V positive cells (PI- or PI+)

indicate early or late apoptosis, respectively. Data presented is representative of three biological

replicates.


(B) Expression of p53 family members p63 and p73 is unaffected by p53 depletion compared to control

cells, as determined by Western blot using p63 alpha- and p73 alpha/beta-specific antibodies.

(C-D) Western blot analysis of Smad protein levels in MCF10A cells stimulated with TGF-β1 in

unstressed or DoxR-treated cells as described in Figure 1C.


Figure S2. TGF-β signaling is active in normal and tumor human breast tissues, as previously

demonstrated (Gomis et al., 2006; Kang et al., 2005; Xie et al., 2002), and wild type or mutant p53

protein levels do not fully reflect cooperation between TGF-β and p53 pathways. Related to Figure 2 and

table S1.

(A) Representative IHC staining with an antibody specific for phosphorylated (P)-Smad 2 of normal

breast sections from healthy women. An antibody against the nuclear protein Ki67 is shown as non-

related antibody control. Black arrowheads indicate strong antibody recognition. Open arrowheads

indicate negative/weak staining. The blue counter-staining is seen only in negative nuclei. Nuclear

outlines are indicated with dotted lines. Magnification: 100X, insets 500 DX.

(B) TGF-β signaling and the p53 levels in human breast tumors. IHC staining with antibodies specific for

p53 (left) and P-Smad 2 (right) (complete list of results in Supplementary Table 1). Black arrowheads


indicate strong nuclear staining and open arrowheads indicate negative/weak staining. Nuclear outlines

are indicated with dotted lines. Magnification: 200X, insets 1000 DX.

(C) Western blot analysis of 9 freshly frozen breast tumor lysates with the indicated antibodies.

Relative levels of expression (1-10) for each sample are indicated at the bottom. p53 mutation status (red

text) or 72R polymorphism are indicated. Asterisks below the corresponding specimen indicate

contrasting levels of p53 vs phosphorylated Smad 2.


Figure S3. Representative IHC results for PUMA, p53 and P-Smad2 showing contrasting levels of

apoptotic protein PUMA, p53 as compared to P-Smad 2 in on select breast tumor samples. Related to

Figure 3.


Representative images of PUMA IHC studies on class IIa (high P-Smad2/low p53) or IIb (low P-

Smad2/high p53) human breast invasive carcinomas. Black and open arrowheads indicate strong or

negative/weak antibody staining, respectively. The strong staining of PUMA is specifically seen in the

cytoplasm of positive cells. Nuclear outlines are indicated with dotted lines. Diagram of the inferred

cellular cytoplasm is indicated with a dotted line. (Full list of results in Table S1).



Figure S4. Analyses of post-transcriptional, post-translational, and translational regulation of p53 by

physiological doses of TGF-β1. Related to Figure 4.

(A-E) Physiologically relevant concentrations of TGF-β1 (Ivanovic et al., 2006; Ivanovic et al., 2003;

O'Brien et al., 2008) repress endogenous but not exogenously expressed p53 proteins as well as HDM2.

(A-B) Dose response Western blot analysis of phosphorylation of Smad 2 and repression of p53 levels

by 2-fold increasing concentrations of TGF-β1, as indicated both in ng/ml or pMolar (bottom) covering

physio-pathological concentrations of TGF-β1 including the most common concentrations used in

epithelial cells in vitro. Extracts were prepared after 1 hour (A) and 24 hours (B) of TGF-β1 addition.

(C) MCF10A cells were infected with a lentivirus expressing p53 cDNA driven by the EF1A promoter.

After 48 hours, TGF-β1 (5 ng/ml) was added to cells for 16 hours. p53 and β-actin were analyzed by

Western blot and compared to a mock infection.

(D) Western analysis of exogenously expressed HA-tagged p53 (pLV-EF1a-p53-HA) upon TGF-β

treatment over a time course.

(E) Western blot analysis of HDM2 protein levels in MCF10A cells (top) or vHMEC (donor 48RS) primary

cultures (bottom). Cellular levels of HDM2 protein were evaluated at the indicated times after DoxR

treatment in the presence or absence of TGF-β1.

(F) p53 mRNA stability analysis. Cells were treated with Actinomycin-D (1.25 µg/ml) after incubation with

or without TGF-β1 for 16 hours and the p53 mRNA half-life (t1/2) was determined by measuring its levels

as described. Values represent the % of p53 mRNA relative to the initial amount at the beginning of the

Actinomycin D treatment.

(G) p53 pre-mRNA cellular levels in vHMECs from donors RM33 and RM35 were analyzed by RT-qPCR

as described above using the intron-specific primer pairs as indicated.

(H-K) p53 Translational Regulation Analyses

(H) Duration of p53 mRNA repression by TGF-β1. Cells were treated twice with TGF-β1, first at t=0h and

again at t=24h. GAPDH-normalized p53 mRNA levels are expressed as the percentage compared to

cells treated with a control buffer as measured by RT-PCR analysis.


(I) Cycloheximide abrogates p53-protein induction upon DNA damage, as reported by Kastan and

colleagues. Continuous translation of p53 is required to support the accumulation of short-lived p53

protein. Western blot analysis of cellular p53 levels in MCF10A (B) or MCF7 (C) cells upon DoxR

addition alone (left) or together with Cycloheximide (10 µg/ml, right), as indicated in in the diagram.

(J) Polysomal profiling by sucrose gradient fractionation of MCF10A cytoplasmic extracts in the absence

or presence of EDTA, which dissociates polysomes into the 60S and 40S ribosomal subunits. A 254 nm

(top) of crude fractions (n=36) and in chip electrophoresis (bottom) of purified RNAs from key fractions in

a Bioanalyzer (Agilent) were used to define the distribution of the different ribosomal subunits across the

gradient indicated in the cartoon on top. (1, lightest fraction and 36, heaviest fraction)

(K) Bioanalyzer analysis of purified RNAs from the fractions collected after sucrose gradient fractionation

of cytoplasmic extracts from MCF10A cells treated as indicated in Figure 1C (fraction n=12. 1, lightest

fraction;12, heaviest fraction). The distribution of tRNAs, 18S and 28S ribosomal RNAs confirmed the

distribution of free ribosomes, ribosomal subunits 40S, 60S, monosomes (80S) and polysomes in the

gradients.

(L) RT-qPCR analysis of polysome distribution of control mRNAs. Data represents the % of mRNA of

each fraction relative to the total amount of mRNA detected. RPL26 distribution across the gradient was

detected by Western blot and used to track the distribution of 60S ribosomal subunits and polysomes.

Data presented (panels F,G,H,L) correspond to the mean values ± S.E.M. from triplicated experiments.



Figure S5. RPL26 and eEF1A distribution across the polysomal fractionation, RIP controls, and RPL26

nuclear/cytoplasm localization controls. Related to Figure 4.

(A) Analysis of proteins after sucrose gradient fractionation. MCF10A cells were treated as indicated in

Figure 1C. Cytoplasmic extracts were prepared 2h after DNA damage induction and fractionated by

sucrose gradient centrifugation. The distribution of RPL26 and eukaryote Elongation Factor 1 a (EF1a)

was analyzed by Western blot on 2% of the inputs and each of the fractions to validate the consistency

of each fractionation. TGF-β1 per se does not affect RPL26 nor EF1a distribution but protects

displacement of RPL26 from heavy polysomes to lighter polyribosomes/monosome-enriched fractions

that is induced by DoxR.

(B) RIP analysis of snRNP70 association with p53 mRNA in MCF10A cells treated and harvested as in

1C. snRNP70 only associates with U1 snRNA species. IgG-precipitated RNA was quantified by RT-

qPCR with specific primers, as indicated, and arbitrarily set as 1.

(C) RIP assays for RPL26 association with p53 were confirmed by amplification of p53 mRNA using 3

different primers, each recognizing the 5’UTR, a location in exon 4, or the 3’UTR of p53 mRNA. Since

RPL26 specifically binds to the 5’UTR, this result serves as a quality control for the integrity of our mRNA

preparation that was subjected to RIP analyses. If the mRNA is intact, a PCR with any primer should

provide identical results.

(D) Antibody specificity control for RPL26 association with mRNA. RIPs with a ChIP-efficient anti-Smad 2

antibody (ab71109) does not pull down p53 mRNA.

(E) RPL26 and EF1A cellular levels upon different treatments and efficiency of the RIPs were analyzed

by Western blot using 2% of the WCE input material and 10% of each RIP sample after elution. Different

antibodies (also raised on a different species) were used to further confirm specificity of the RIP

reactions.

(F) Total and relative nuclear vs. cytoplasmic levels of RPL26 and Smad2 upon TGF-β1 treatment were

analyzed by Western blot before and after a 6 hour induction of DNA damage. Nuclear (10 µg ) or

cytoplasmic (20 µg) extracts were analyzed by Western blot for RPL26 using the indicated antibodies.


While RPL26 localization remains invariable across all treatments, Smad 2 relative localization switches

from cytoplasmic to nuclear -enriched upon TGF-β1 treatment and is unaffected by DoxR. Irreversible

DoxR- induced damage, as assessed by the start of cleavage of PARP1 within the nuclei is prevented by

TGF-β1. RIP results (panels B-D) are presented as the mean values ± S.E.M. from 3 experiments.


Figure S6. ChIP studies for Smad and RNAP II association with the p53 gene promoter. Related to


Figures 5 and 6.

(A-E) ChIP kinetic analysis of phosphorylated-Smad 2 and Smad 3 binding to the SR2 in the p53

promoter and the PAI-1 -788 SBE was performed as described.

(B) Diagram of the Smad binding region centered at -788 of the PAI-1 gene. The blue boxes represent

individual perfect SBEs. Numbers show the center of the amplicons used in the ChIP assays. (C) ChIP

kinetic analysis of phosphorylated-Smad 2 and Smad 3 binding to the PAI-1 promoter was performed as

described.

(D-E). TGF-β1 represses association of RNAPII with the p53 gene in mutant p53-expressing cell lines.

(D) HaCaT immortalized human keratinocytes were treated with TGF-β1 for 2 hours, after which ChIP

reactions were performed with anti-RNA Polymerase II (RNAPII) antibody or control IgG. Interaction at

different locations in the p53 gene was analyzed by qPCR and shown as immunoprecipitated DNA

relative to input DNA.

(E) MDA-MB-231 cells were treated with TGF-β1 and ChIP experiments were performed as in (A) using

antibodies against total (RNAPII) or the elongating form (S2P-RNAPII). IgG ChIPs were included as

controls. The association of RNAPII or S2P-RNAPII with the proximal promoter region (at +200) or the

last exon (+19910) of the p53 gene was analyzed as in (A). *: p<0.05.

(F) Promoter deletion analysis. Gene reporter assays were performed as described with p53 promoter-

driven reporters containing the indicated deletions. Normalized relative light units are shown as the

percentage of activity relative to the wild type short (-80/258) p53 promoter-luciferase reporter.

Data (panels A-F) is presented as the mean values ± S.E.M. from 4 experiments.


Figure S7. E2F-4 knock-down studies on basal and TGF-β1-repressed p53 mRNA levels. Related to

Figure 7.


(A) E2F-4 knock-down efficiency of 5 different shRNAs in cells analyzed by RT-qPCR (left) or Western

blot (right).

(B) p53 mRNA level analysis upon efficient knock down of E2F-4 as determined in (A).

(C) p53 mRNA in E2F-4 silenced cells upon TGF-β1 treatment was analyzed by RT-qPCR.

(D) Promoter-specific requirement of Smad 4/E2F-4 for chromatin interaction of P-Smad 2 with the SBE

at -788 on the PAI-1 gene in either Smad 4 or E2F-4 depleted cells was determined by ChIP after

treatment with TGF-β1 as described.

Data (panels A-D) is presented as the mean values ± S.E.M.


Table S1. Immunohistochemistry scores of human breast tissue sections. Related to

Figures 1, 2, S2, S3.

tissue # Diagnosis Ki67 P-

Smad2 p53 Puma Class

p53:PUMA expression

match

TT51 normal breast (RM) neg high low low IIa Yes

TT52 normal breast (RM) neg strong low mod IIa Yes

TT54 normal breast (RM) neg high low mod IIa Yes

TT56 normal breast (RM) neg high low neg IIa Yes

D-44300 invasive ca+DCIS high high neg low IIa Yes

D-44301 invasive ca +DCIS high high low low IIa

Yes

TT166b invasive ca neg high low mod IIa Yes TT193 invasive ca neg high low low IIa Yes

D-44292

invasive ca+minor DCIS high low high high IIb

Yes

D-44297 invasive ca+ focal DCIS mod low high mod IIb

Yes

D-44347 invasive ca+ DCIS mod/neg low high mod IIb

Yes

TT170 invasive ca neg high low high IIa No TT194? invasive ca high mod neg mod IIa No TT168 invasive ca neg high mod mod Ia Yes TT202 invasive ca low mod high mod Ia Yes TT117 DCIS neg high mod/high high Ia Yes TT118 DCIS high high high mod Ia Yes D-44294 invasive ca neg/mod mod mod low Ib Yes D-44295 invasive ca mod low low mod Ib Yes

D-44348

minimal invasive with DCIS high low low mod Ib

Yes

TT217 invasive ca high high high low Ia No TT218 invasive ca high high mod/high high Ia Yes TT163 invasive ca high high high low Ia No

D-44320 invasive ca+ DCIS high low neg high Ib No

Staining scores: negative (0), low (1+), moderate (2+), high (3+), strong (4+).


Table S2. p53 mRNA in human breast carcinomas. Related to Figure 4.

# Sample ID

p53 sequence (wt 72R variant is indicated) p53/(actin)

p53/b-actin rel. to

average within

sample Expression fold (+ / -)

NB1 2DF7 wt 0.94221698 0.75377358 -1.326658 NB2 2DF8 wt 1.01533019 0.81226415 -1.231127 NB3 2DFB wt 1.25589623 1.00471698 1.004717 NB4 2DFC wt-72R 1.41391509 1.13113208 1.1311321 NB5 2DFD wt 1.62264151 1.29811321 1.2981132 BT1 3424 wt 0.31095482 0.158446783 -6.311267 BT2 655 wt-72R 0.50389417 0.256758873 -3.894705 BT3 667 mut 276 Ala->Gly 0.61271691 0.312209416 -3.202978 BT4 291 wt-72R 0.62785489 0.319922960 -3.125753 BT5 2181 wt 0.64996764 0.331190494 -3.019410 BT6 884 wt 0.71755053 0.365627303 -2.735026 BT7 1991 wt 0.77357038 0.394172175 -2.536962 BT8 270 wt-72R 1 0.509549207 -1.962519 BT9 1125 mut 234 tyr->cys 1.23320656 0.628379423 -1.591395 BT10 2409 wt 1.30929356 0.667149496 -1.498914 BT11 2771 mut 332 Ile>Asn 1.70813748 0.870380098 -1.148923 BT12 1071 wt 1.85211907 0.943745803 -1.059607 BT13 3573 wt 1.8946293 0.965406855 -1.035833 BT14 3819 wt 1.99784869 1.018002216 1.018002 BT15 1517 wt 2.96692828 1.511795950 1.511796 BT16 974 wt 2.98148912 1.519215415 1.519215 BT17 1237 wt 3.10941152 1.584398175 1.584398 BT18 2500 mut 304 Thr>Ala 3.15983279 1.610090291 1.610090 BT19 1579 wt 3.28139843 1.672033966 1.672034 BT20 1779 wt 4.55487561 2.320933255 2.320933 BT21 3749 mut 175 Arg>His 5.96721446 3.040589394 3.040589 p=0.002625 F-‐Test Two-‐Sample for Variances Normal B Breast Tumor Mean 1.25 1.962518771 Variance 0.078891 2.220304077 Observations 5 21 df 4 20 F 0.035532 P(F<=f) Var tumor </= Var normal

0.002625

F Critical 0.172338


EXTENDED EXPERIMENTAL PROCEDURES

Cell Culture

MCF10A cells (ATCC) were cultured in DMEM/F12 media supplemented with 5% horse serum (Sigma), 0.1

µg/ml Cholera Toxin, 20 ng/ml EGF, 0.5 µg/ml Hydrocortisone, 10 µg/ml Insulin and antibiotics. Reduction

Mammoplasty (RM)-derived Human Mammary epithelial cells (HMEC) and matching post-selection variant

HMECs (vHMECs) (Romanov et al., 2001) from donors: RM33, RM35, RM45, were propagated in MEGM

(Lonza) as described (Hammond et al., 1984). p53 mutated MDA-MB-231 and MDA-MB-435 cells (ATCC) and

wild type p53 expressing U2OS and U87MG cells were grown in DMEM plus 10% fetal bovine serum. A549 (p53

wt) cells were grown in F-12K (Invitrogen) media with 10% FBS. CDK4-Tert-transformed Human Bronchial

Epithelial Cells (HBEC-KT, p53 wt) (Ramirez et al., 2004) were grown in Keratinocyte serum free media (Life

technologies), as described. Cells were routinely passaged, minimizing as much as possible any stress condition

that could activate p53 signaling, such as Room Temperature, low CO2 exposure in the hoods no longer than 2-

3 minutes. TGF-β1 (Peprotech or in-house purified) was diluted in vehicle buffer (10 mM citrate, pH 3.5, 1 mg/ml

Bovine Serum Albumin) and Doxorubicin (Sigma-Aldrich) was diluted in water and added to cells at the indicated

concentrations. 5-fluorouracil (Sigma) was diluted in DMSO/Ethanol (working concentration 375 µM) and

Paclitaxel (Sigma) was diluted in ethanol.

Human Tissues

Tissue blocks were obtained from the University of California, San Francisco Cancer Center or from the

Cooperative Human Tissue Network Western Division (Nashville, Tennessee) under an institutionally approved

human subject use protocol (CHR#H8759-35171-01). Breast cancer tissues for mRNA quantification and

Western blotting analysis were kindly provided by Dr. Martin Widschwendter, (University College London,

London, UK). Tissues were obtained from the Department of Obstetrics and Gynecology of the Innsbruck

Medical University, Austria between 1989 and 2001. All specimens were obtained immediately after resection of

the breast- or lumpectomy, brought to the pathologist, and a part of the tissue was pulverized under cooling with


liquid nitrogen and stored at -70°C. All samples were collected during surgery in compliance with an approved

protocol by the Institutional Review Boards.

Generation of Lentiviruses and shRNA Expressing Cell Lines

Plasmids expressing GFP and shRNAs for p53 (pGFP-shp53) (Tiscornia et al., 2003) or Glucose transporter-4

(pGFP-shGT4) (Liao et al., 2006), used as a specificity control, were kindly provided by Drs. Inder Verma and

Gustavo Tiscornia. Plasmids expressing the puromycin resistance cassette and shRNAs for Smad 4, E2F-4 or

scrambled sequences were purchased from Sigma (Table S6). Third-generation lentiviruses expressing shRNAs

were produced by calcium phosphate transfection of the shRNA-coding vector and the packaging plasmids

(pMDL, pVSV-G, pREV) into 293T cells as described (Dull et al., 1998). After 16 hrs, the media was replaced

and supernatants were collected 24 hours later, filtered through 0.45 µm cellulose acetate filters, and aliquots

stored at -80oC. 100,000 cells were transduced with 100-500 µl of lentiviruses in 6-well dishes and selected with

puromycin (2.5 µg/ml) after 72 h.p.i. or by GFP expression by FACS after 5 days. Puromycin-was retired from

the media 16-24 hr before TGF-β1 treatment. E2F-4-depleted cells were analyzed after 2 days in the selection

media. Upon additional passaging, most of the shRNA-expressing cells stopped growing or recovered E2F-4

expression.

Quantitative RT-PCR

Total RNA was prepared using the Qiagen RNAeasy kit. cDNA was synthesized from 0.5 µg RNA from cultured

cells or breast tumors (Table S1) with the Superscript III cDNA kit (Invitrogen) using oligodT(20) primers. cDNAs

(10 ng) were amplified by real time PCR with the SYBR green master mix (Applied Biosystems) in triplicate

reactions using a MX3005P qPCR station (Stratagene). Primer sequences are listed in Table S4. Standard

curves were generated from pooled cDNAs and gene-specific mRNA variations among samples were quantified

by the ΔΔCt method using GAPDH or β-actin mRNA as internal references which gave similar results in the cell

lines. In breast tissues while β-actin, TBP, 18S RNA or HPRT1 housekeeping genes reflected little mRNA


variability, GAPDH showed a significant variation among all samples and thus we chose β-actin as normalization

gene.

Immunohistochemistry (IHC)

All paraffin-embedded human breast cancer tissue sections were processed, stained and analyzed

simultaneously as previously described (Crawford et al., 2004) using the antibodies indicated in Table S3.

Specific nuclear vs cytoplasmic staining by different antibodies and the unique pattern of staining with each

antibody across sections is a built-in internal control for antibody specificity. Four-micron sections cut from

formalin-fixed, paraffin-embedded tissue blocks were deparaffinized with xylene and rehydrated twice for 2 min

in 100% ethanol, once for 2 min in 95% and 80% ethanol, then rinsed in distilled water. Following endogenous

peroxidase blocking (3% H202) for 10 min at room temperature, slides were microwaved for 10 min in citrate

buffer (10mM citric Acid, 0.05% Tween 20, pH 6.0) for antigen retrieval of Ki67, p53 and P-Smad2 or heated in a

pressure cooker for 3 min in EDTA, pH 8.0, for antigen retrieval of PUMA. Sections were then incubated for 1 hr

with either a mouse monoclonal anti-Ki67 (clone MIB-1, Dako #M7240) diluted 1:150, mouse monoclonal anti-

p53 (clone DO-1, ThermoScientific #MS-187-P) diluted 1:200, rabbit polyclonal anti-P-Smad2 or anti-PUMA (Cell

Signaling Technology #3101 and #4976) diluted 1:1,000 and 1:200, respectively. Staining was visualized after

incubation with primary antibody enhancer and HRP polymer according to the manufacturer’s instructions

(ThermoScientific #TL-060-HL). Slides were then counterstained in Mayer’s hematoxylin and scored using a

condensed Allred score. Scores lower than 2 and greater than 2 were referred to as “low” and “high”,

respectively.

(*) detailed procedures from methods explained in the manuscript:

Metabolic Labeling and p53 immunoprecipitation

For metabolic labeling, MCF10A cells were treated for 24-30 hours with TGF-β1 and in the last hour the

regular media was replaced by Methionine- and cysteine –free media supplemented with 2.5 % dialyzed

FBS (Life Technologies) plus the proteasome inhibitor MG132 (20µM). Cells were labeled with 100 µCi /ml


of [35S]-Methionine (MP Biomedicals) for 5 min and whole cell extracts were prepared with RIPA buffer.

Immunoprecipitation (DO1 – EMD) was performed as described for ChIPs with minor modifications using

RIPA whole cell extracts diluted 1/10 with IP buffer (150 mM NaCl, 50 mM Tris). Extensive washing (7X)

was performed with RIPA buffer and bound proteins were eluted in Laemmli buffer, loaded on a SDS-

PAGE, and either analyzed by Western blot using a p53 FL393 antibody or by autoradiography.

Protein Immunoblot Analyses

Typically, 20 µg (HMEC, vHMEC, MCF10A, HBEC, NCI-H460, A549, MCF7), 5-10 µg (MDA-231, MDA-435) or

80 µg (breast tumors) of protein extracts were resolved by 10% SDS-PAGE and transferred onto Hybond-C

extra membranes (Amersham Biosciences). Blots were probed with primary antibodies (Table S3) typically

diluted 1:500-1000 or 1:20.000 (β-actin) and developed with peroxidase-conjugated secondary antibodies and

ECL detection reagents (Pierce). Densitometry quantification of selected blots was performed using ScionImage

software. Information on antibody sources is listed in Table S3.

Nuclear and Cytoplasmic Fractionation

Nuclear and cytoplasmic fractionation was performed as described by Chen and Kastan (Genes and

Development, 2010) using NE-PER nuclear and cytoplasmic extraction kit (Thermo Scientific). 20ug of

cytoplasmic and 10μg of nuclear extracts, totaling 3% of cytoplasmic and 5% of nuclear fractions, were loaded

on a 4-12% bis-tris gel for immunoblot analysis. RPL26 (Bethyl Laboratories), α−Tubulin (Sigma) and TBP

(Santa Cruz) antibodies were used for detection.

Ribosome Analyses

Polysome fractionation by sucrose gradient centrifugation was performed as described by Takagi et al. (2005)

with minor modifications. Briefly, 100 uM Cycloheximide was added before collection and cells were collected in

1 mL of fresh polysome lysis buffer (0.5 mM NP40, 100 mM NaCl,10 mM MgCl2, 2 mM DTT,50 mM Tris-HCl

ph=7.5, + 200U/ml RNaseOut, 200 µg/mL heparin, 100 µg/ml of Cycloheximide and protease inhibitors and 0.1


mM PMSF). When indicated, EDTA 25 mM was also included to dissociate polysomes. Cells were lysed 5

minutes on ice, centrifuged at 10,000 g for 15 minutes. Cytosolic supernatants were fractionated on a 15-40%

(W/V) sucrose cushion (10 ml+ 1 ml=11ml) (in 150 mM NaCl, 25 mM tris-HCl pH=7.5, 5 mM MgCl2) by

centrifugation at 38,000 rpm for 150 minutes in a SW41 rotor. Fractions were obtained by positive force with a

density gradient fractionator (ISCO) at 3 ml/minute and a FRAC-100 Biorad fraction collector. The absorbance at

254 nm was analyzed in real time with a DI-145 (DataQ) data acquisition instrument (DATAQ instruments) or

read from each of the 12/36 fractions. RNA was purified from each fraction and from 5% of input sample by

Trizol extraction followed by ethanol precipitation. Purified mRNAs were quantified in a nanodrop and analyzed

by in-chip electrophoresis on a Bioanalyzer 2100 (Agilent) before cDNA synthesis. cDNAs were quantified by

real time PCR as described.

RNA Immunoprecipitation (RIP)

Mononucleosomes were obtained using the ChIP-IT-enzymatic kit (Active Motif) with minor modifications. For

RIPs, extracts from 5 x107 MCF10A cells were prepared and incubated with specific antibodies (Table S3) using

the Magna RIPTM kit (Millipore), following the manufacturer’s indications. IP RNA was reverse transcribed with

Superscript II (Invitrogen) and the cDNA quantified by qPCR. DNA contamination was controlled with no-RT

negative control qPCR reactions (not included). Binding of non-related IgGs to each mRNA was used as an

internal normalization control for the different input mRNA transcript numbers inherent to each gene. Detailed

supplemental protocols accompany this manuscript.

Chromatin Immunoprecipitation (ChIP) Assays

ChIPs assays were performed essentially as described (Gomes et al., 2006) with the following modifications.

Briefly, MCF10A cultures were grown to 60%-70% confluency and treated with TGF-β1 (5-10 ng/ml) or DoxR

(0.4 µM). Crosslinking was performed by incubating the plates for 15 minutes at room temperature after addition

to the culture media of formaldehyde to 1% and then stopped with 125 mM Glycine for 5 minutes. For pre-

clearing and ChIPs, 40 µl of a 50% slurry Protein G + Protein A Sepharose (PAGS, 1:1) were used. ChIPs were


performed overnight with 2-5 µg of each antibody (listed in Table S2). For analysis of phosphorylated RNA

Polymerase DNA binding, PAGS were first adsorbed over-night with an anti-mouse IgM antibody (Sigma), as

described. Immunocomplexes were washed once with RIPA buffer; 3 times with 0.5M LiCl , 1% NP-40, 1%

Deoxycholate, pH 8.5; once again with RIPA and 2 times with 1X TE. Elution was performed for 15 min at 65°C

in 70 mM Tris pH 8, 1mM EDTA, 1.5% SDS. Crosslinking was reversed during 5 hrs at 65°C in 0.2M NaCl. IP

DNA was purified by phenol/chloroform extraction, resuspended in 0.1 X TE, and quantified by real time PCR in

triplicate using a MX3005P qPCR station (Stratagene), using the ΔCt method. Primers for the described genomic

regions (amplicon sizes: 50-70 bp) were designed using Primer Express 2.0 (Applied Biosystems). Primer

sequences are listed in Table S5. 15 µl PCR reactions included 1x SYBR Green Mix (Applied Biosystems), 250-

500 nM primers and 1/50 fraction of IP DNA or 5 % of input DNA as a calibrator. Standard curves containing

0.008-5% of input DNA were run for each primer pair and used to adjust for the efficiency of the PCR reaction.

Mononucleosome Immunoprecipitation (MnIP)

Mononucleosomes were obtained using the ChIP-IT-enzymatic kit (Active Motif) with minor modifications.

Detailed supplemental protocols accompany this manuscript. Briefly, nuclei from 50x106 cells treated with TGF-

β1 or vehicle for 2 hours were prepared according to the manufacturer’s recommendations. Enrichment of

mononucleosomes (>80%) obtained after digestion of intact nuclei was confirmed by gel electrophoresis.

Immunoprecipitation of 1/20 of the mononucleosomal fraction was performed overnight with 2 µg of either anti-P-

Smad 2 antibody or normal rabbit IgG followed by a 2 hour pull-down with protein G-Sepharose beads. Eluted

DNA was quantified by qPCR as for ChIPs assays. IgG binding was used as an internal normalization control to

correct for variations in mononucleosome purification efficiency.

Cell Proliferation Assays and Cell Counting for Drug Toxicity Determination

Bromo-deoxyuridine incorporation into cells treated with TGF-β1 (5 ng/ml) was measured with an anti-BrdU

antibody (BD, Pharmingen). Cells were pulsed with 10 mM BrdU for 1 hr, harvested and fixed with 70% ethanol

overnight at 4oC. DNA was denatured with 2N HCl for 30 min at room temperature followed by neutralization with


0.1M Sodium Borate, pH 8.5. Cells were then incubated for 30 minutes with an anti-BrdU-FITC-labeled antibody

or an isotype control plus 1 mg/ml RNase A, 0.5% Tween 20 and 1 mg/ml BSA. Cells were washed with PBS-

0.5% BSA, resuspended in PBS-Propidium Iodide (5 µg/ml), and analyzed by FACS. For crystal violet nuclei

staining-based cell counting, cells were washed with PBS and fixed for 10 minutes with 4% formaldehyde,

stained with 0.04% (W/V) crystal violet for 10 minutes and washed with tap water twice. Retained crystal violet

was removed with methanol and quantified by absorbance at 595 nm.

p53 Promoter Reporter Constructs, Smad-Expressing Plasmids and Luciferase Reporter Assays

Fragments of the genomic p53 promoter from vHMECs were amplified using Phusion Hot Start (Finzyme) and

cloned into the KpnI/XhoI sites of a pGL4.22 reporter plasmid. Mutations were introduced by PCR with the Gene

Tailor Site-directed mutagenesis kit (Invitrogen). C-terminally HA-tagged Smad 2, Smad 3 and Smad 4 proteins

were expressed by introducing their cDNAs into a BamHI/EcoRI site in the pLV-EF1a-HA plasmid. 40,000

MCF10A cells were transfected using Fugene HD reagent (Roche) with luciferase reporter plasmids; 0, 2.5, 5 or

10 ng of the pLV-Smad-HA plasmid; totaling 40 ng with empty vector and 20 ng of pTK-Renilla Luciferease

reporter. After 16 hr cells were treated with TGF-β1 (5 ng/ml) for an additional 6-8 hr and luciferase activity was

determined with the dual-luciferase system (Promega). The TGF-β1–inducible artificial reporter pSBE4-Luc

(Addgene plasmid 16495; (Zawel et al., 1998) was used as a specificity control across all experiments.


Supplemental Table of Antibodies Target protein Antibody name Source # Applications used for Actin-beta AC-15 Sigma A1978 WB CTCF G-8 Santa Cruz 271474 WB E2F-4 C-20 Santa Cruz sc-866 WB/ChIP eEF1a (1-2-3) EF1A1-2-3 ABCAM Ab37969 WB eEF1a1 EF1α-CBP-KK1 Millipore 05-235 RIP HA F7 Santa Cruz SC-‐7392 WB HDM2 IF2/Ab1 Calbiochem OP46 WB HDM2 SMP14 Santa Cruz sc-965 WB Ki67 MIB-1 Dakko M7420 IHC p107 C-18 Santa Cruz sc-318 ChIP p53 DO-1 Calbiochem OP43 WB/ChIP/IP p53 DO-1 Thermo MS-187-P IHC p53 FL-393 Santa Cruz SC-6243 WB p63 p63-alpha Cell signaling #4892 WB p73 P73 (α/β) Millipore AB7824 WB PARP1 PARP1 Cell signaling #9542 WB PARP1 (89 KDa fragment) Cleaved-PARP1 Cell signaling #9541 WB Pre-immune IgG mouse IgGs Santa Cruz sc-2025 ChIP Pre-immune IgG rabbit IgGs Santa Cruz sc-2027 ChIP P-Smad2 ser465/467 Cell signaling #3101 WB, IHC P-Smad2 ser465/467 Abcam ab16509 WB/ChIP PUMA PUMA Cell signaling #4976 IHC RNAPII Active Motif 39097 ChIP/WB RPL26 RPL26 ABCAM ab59567 RIP/WB (1/4000) RPL26 RPL26 BETHYL A303-875A WB (1/4000) S15P-p53 Phospho-p53 Cell signaling #9284 WB/ChIP S2P-RNAPII Abcam ab5095 ChIP S2P-RNAPII H14 Covance MMS-129R ChIP S5P-RNAPII - Active Motif 39749 ChIP S5P-RNAPII H5 Covance MMS-134R ChIP Smad2 7A5 Abcam ab71109 WB/ChIP Smad2/3 FL-425 Santa Cruz sc-8332 WB Smad3 Smad3 Abcam ab28379 ChIP Smad4 B8 Santa Cruz sc-7966 WB Sp1 Sp1 Upstate 07-645 WB/ChIP TBP TBP-N12 Santa Cruz SC-204 WB Tubulin-alpha tubulin Sigma (T9026) WB



Supplemental Table of Oligonucleotide Sequences for RT-qPCR and RIPs Gene/Location (genbank ID) Forward Primer Reverse Primer

E2F-4 (NM_001950) CATCTGCTGTTTCTACACCTCCAC CTATTTGGACGTGAGGCTTCCT

HDM2 (NM_006880)# GGCGATTGGAGGGTAGACCT CACATTTGCCTGGATCAGCA

MMP2 (NM_004530)* TGATCTTGACCAGAATACCATCGA GGCTTGCGAGGGAAGAAGTT

PAI-1 (NM_000602) TGCTGGTGAATGCCCTCTACT CGGTCATTCCCAGGTTCT

p21 (NM_078467) CTGGAGACTCTCAGGGTCGAAA GATTAGGGCTTCCTCTTGGAGAA

PUMA *(NM_014417) AGAGGGAGGAGTCTGGGAGTG GCAGCGCATATACAGTATCTTACAGG

TP53 (NM_000546) CCCAGCCAAAGAAGAAACCA GTTCCAAGGCCTCATTCAGCT

Smad 4 mRNA AAAACGGCCATCTTCAGCAC AGGCCAGTAATGTCCGGGA

5’UTR p53(-63/-4 toATG ) GCTTTCCACGACGGTGACA AGTGACCCGGAAGGCAGTCT

3’UTR p53 (415/463) GCTGGCATTTGCACCTACCT CAAGGCCAGATGTACATTATTTCATT

p53 Fw:exon1 / Rv:intron1 (+200 TP53) GGCTGGGAGCGTGCTTT CAGAGAGGACTCATCAAGTTCAGTCA

p53 intron 1 (F/R) (1800TP53) TCACGTCTCTTCCCAGTCGAT TCTCCAACAGGCAAAATGGTT TP53 p53 mRNA exon 4 (11400)

TGTCCCCGGACGATATTGA TGGCATTCTGGGAGCTTCAT

18S RNA CGGCTACCACATCCAAGGAA GCTGGAATTACCGCGGCT

β-actin (NM_ 001101) CAGCCATGTACGTTGCTATCCAGG AGGTCCAGACGCAGGATGGCATG

GAPDH (NM_002046) TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG

* These primers amplify all transcripts of this gene # These primers amplify all transcripts from Promoter P2


Supplemental Table of Oligonucleotide Sequences for qPCR Analysis of ChIP Assays

Gene Amplicon location Forward sequence Reverse sequence -3333 CCTGGCAAGGTATGGGACAA TCCCTTCCTCTGCCTGTC

-788 (SBE) GACACAAGAGAGCCCTCAGGG GACTCCCCACGTGTCCAGACT PAI-1 -44 (p53BE/TSS)

CCAAGAGCGCTGTCAAGAAGA AGGAATTCAGCTGCTGGAGG

-1639 (p53BE) GAGCACACACCCACCAGACA GGTCTCAGTGGGCTTCAGACA MMP2

+2 (TSS) TTTCCGCTGCATCCAGACTT CCTGGCAATCCCTTTGTATGTT

-2283 (p53BE) GTGGCTCTGATTGGCTTTCTG CTGAAAACAGGCAGCCCAAG p21

-20 (TSS) GGGCGGTTGTATATCAGGGC CGGCTCCACAAGGAACTGACTT

HDM2 -87 (p53BE/TSS)

GGTTGACTCAGCTTTTCCTCTTG GGAAAATGCATGGTTTAAATAGCC

PUMA -346 P2 p53RE/TSS

GCGAGACTGTGGCCTTGTGT CGTTCCAGGGTCCACAAAGT

NOXA p53RE (TSS) CAGCGTTTGCAGATGGTCAA CCCCGAAATTACTTCCTTACAAAA

-1450 TGCCATCACCACTTACGTGTCT TGGAAAAGCCATGGAAGATACC

-950 GGATCCGACGCAGAGCTAAAG CCGGGAGTCTTCTGCCTACTC

-521 TGCACCTCTTCTGCATCTCATT GGGTAGCAAGTAAGAGCTCGATAATAA

-50 TCGGCGAGAATCCTGACTCT CCTGCCGGAGGAAGCAA

+200 GGCTGGGAGCGTGCTTT CAGAGAGGACTCATCAAGTTCAGTCA

+770 TGTCCTTCCTGGAGCGATCT CCTTCAATTGGATTTTCTCCATCT

+1388 TGATGGGTCGTTTGATAATTTGTC TCCGCTTCACGACGTTCA

+1800 TCACGTCTCTTCCCAGTCGAT TCTCCAACAGGCAAAATGGTT

+11400 TGTCCCCGGACGATATTGA TGGCATTCTGGGAGCTTCAT

TP53

+18106 TTTGAACCCTTGCTTGCAATAG GGAGCCCCGGGACAAAG

GAPDH TSS GTATTCCCCCAGGTTTACAT TTCTGTCTTCCACTCACTCC


Supplemental Table of shRNA-Coding Plasmid Information (Mission shRNAs, Sigma)

Clone designation NM Id Clone ID

Gene Symbol Target Sequence Insert oligo Sequence

A6 NM_001950

NM_001950.3-1923s1c1 E2F4 CCCTCTCTTCATTTCGG

CTTT

CCGGCCCTCTCTTCATTTCGGCTTTCTCGAGAAAGCCGAAATGAAGAGAGGGTTTTT

A7 NM_001950

NM_001950.3-232s1c1 E2F4 CGGATTTACGACATTAC

CAAT

CCGGCGGATTTACGACATTACCAATCTCGAGATTGGTAATGTCGTAAATCCGTTTTT

A8 NM_001950

NM_001950.3-1273s1c1 E2F4 GACCTCTTTGATGTGCC

TGTT

CCGGGACCTCTTTGATGTGCCTGTTCTCGAGAACAGGCACATCAAAGAGGTCTTTTT

A9 NM_001950

NM_001950.3-396s1c1 E2F4 GCAAGAACTAGACCAGC

ACAA

CCGGGCAAGAACTAGACCAGCACAACTCGAGTTGTGCTGGTCTAGTTCTTGCTTTTT

A10 NM_001950

NM_001950.3-1168s1c1 E2F4 GAGGAGTTGATGTCCTC

AGAA

CCGGGAGGAGTTGATGTCCTCAGAACTCGAGTTCTGAGGACATCAACTCCTCTTTTT

C2 NM_005359

NM_005359.3-2038s1c1 SMAD4 GCAGACAGAAACTGGAT

TAAA

CCGGGCAGACAGAAACTGGATTAAACTCGAGTTTAATCCAGTTTCTGTCTGCTTTTTG

C3 NM_005359

NM_005359.3-1191s1c1 SMAD4 CCTGAGTATTGGTGTTC

CATT

CCGGCCTGAGTATTGGTGTTCCATTCTCGAGAATGGAACACCAATACTCAGGTTTTTG

C4 NM_005359

NM_005359.3-1692s1c1 SMAD4 GCTGCTGGAATTGGTGT

TGAT

CCGGGCTGCTGGAATTGGTGTTGATCTCGAGATCAACACCAATTCCAGCAGCTTTTTG

C5 NM_005359

NM_005359.3-636s1c1 SMAD4 CGAGTTGTATCACCTGG

AATT

CCGGCGAGTTGTATCACCTGGAATTCTCGAGAATTCCAGGTGATACAACTCGTTTTTG

C6 NM_005359

NM_005359.3-1848s1c1 SMAD4 GTACTTCATACCATGCC

GATT

CCGGGTACTTCATACCATGCCGATTCTCGAGAATCGGCATGGTATGAAGTACTTTTTG

SCRAMBLE Product #

SHC002 none non human or mouse shRNA

CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT


SUPPLEMENTAL REFERENCES

Crawford, Y.G., Gauthier, M.L., Joubel, A., Mantei, K., Kozakiewicz, K., Afshari, C.A., and Tlsty, T.D. (2004). Histologically normal human mammary epithelia with silenced p16(INK4a) overexpress COX-2, promoting a premalignant program. Cancer Cell 5, 263-273.

Dull, T., Zufferey, R., Kelly, M., Mandel, R.J., Nguyen, M., Trono, D., and Naldini, L. (1998). A third-generation lentivirus vector with a conditional packaging system. J Virol 72, 8463-8471.

Gomes, N.P., Bjerke, G., Llorente, B., Szostek, S.A., Emerson, B.M., and Espinosa, J.M. (2006). Gene-specific requirement for P-TEFb activity and RNA polymerase II phosphorylation within the p53 transcriptional program. Genes Dev 20, 601-612.

Gomis, R.R., Alarcon, C., Nadal, C., Van Poznak, C., and Massague, J. (2006). C/EBPbeta at the core of the TGFbeta cytostatic response and its evasion in metastatic breast cancer cells. Cancer Cell 10, 203-214.

Hammond, S.L., Ham, R.G., and Stampfer, M.R. (1984). Serum-free growth of human mammary epithelial cells: rapid clonal growth in defined medium and extended serial passage with pituitary extract. Proc Natl Acad Sci U S A 81, 5435-5439.

Ivanovic, V., Demajo, M., Krtolica, K., Krajnovic, M., Konstantinovic, M., Baltic, V., Prtenjak, G., Stojiljkovic, B., Breberina, M., Neskovic-Konstantinovic, Z., et al. (2006). Elevated plasma TGF-beta1 levels correlate with decreased survival of metastatic breast cancer patients. Clin Chim Acta 371, 191-193.

Ivanovic, V., Todorovic-Rakovic, N., Demajo, M., Neskovic-Konstantinovic, Z., Subota, V., Ivanisevic-Milovanovic, O., and Nikolic-Vukosavljevic, D. (2003). Elevated plasma levels of transforming growth factor-beta 1 (TGF-beta 1) in patients with advanced breast cancer: association with disease progression. Eur J Cancer 39, 454-461.

Kang, Y., He, W., Tulley, S., Gupta, G.P., Serganova, I., Chen, C.R., Manova-Todorova, K., Blasberg, R., Gerald, W.L., and Massague, J. (2005). Breast cancer bone metastasis mediated by the Smad tumor suppressor pathway. Proc Natl Acad Sci U S A 102, 13909-13914.

Liao, W., Nguyen, M.T., Imamura, T., Singer, O., Verma, I.M., and Olefsky, J.M. (2006). Lentiviral short hairpin ribonucleic acid-mediated knockdown of GLUT4 in 3T3-L1 adipocytes. Endocrinology 147, 2245-2252.

O'Brien, P.J., Ramanathan, R., Yingling, J.M., Baselga, J., Rothenberg, M.L., Carducci, M., Daly, T., Adcock, D., and Lahn, M. (2008). Analysis and variability of TGFbeta measurements in cancer patients with skeletal metastases. Biologics 2, 563-569.

Ramirez, R.D., Sheridan, S., Girard, L., Sato, M., Kim, Y., Pollack, J., Peyton, M., Zou, Y., Kurie, J.M., Dimaio, J.M., et al. (2004). Immortalization of human bronchial epithelial cells in the absence of viral oncoproteins. Cancer Res 64, 9027-9034.


Romanov, S.R., Kozakiewicz, B.K., Holst, C.R., Stampfer, M.R., Haupt, L.M., and Tlsty, T.D. (2001). Normal human mammary epithelial cells spontaneously escape senescence and acquire genomic changes. Nature 409, 633-637.

Tiscornia, G., Singer, O., Ikawa, M., and Verma, I.M. (2003). A general method for gene knockdown in mice by using lentiviral vectors expressing small interfering RNA. Proc Natl Acad Sci U S A 100, 1844-1848.

Xie, W., Mertens, J.C., Reiss, D.J., Rimm, D.L., Camp, R.L., Haffty, B.G., and Reiss, M. (2002). Alterations of Smad signaling in human breast carcinoma are associated with poor outcome: a tissue microarray study. Cancer Res 62, 497-505.

Zawel, L., Dai, J.L., Buckhaults, P., Zhou, S., Kinzler, K.W., Vogelstein, B., and Kern, S.E. (1998). Human Smad3 and Smad4 are sequence-specific transcription activators. Mol Cell 1, 611-617.


Documents

Supplemental Information Coordinate Transcriptional and