UvA-DARE is a service provided by the library of the University of Amsterdam (http://dare.uva.nl)

UvA-DARE (Digital Academic Repository)

The role of abca1 in atherosclerosis: lessons from in vitro and in vivo models

Singaraja, R.R.

Link to publication

Citation for published version (APA):Singaraja, R. R. (2003). The role of abca1 in atherosclerosis: lessons from in vitro and in vivo models.

General rightsIt is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s),other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulationsIf you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, statingyour reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Askthe Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam,The Netherlands. You will be contacted as soon as possible.

Download date: 22 Jan 2021

Chapter r

Humann ABCA1 BAC transgenic mice show increased HDL-CC and ApoAl dependant efflux stimulated by an

internall promoter containing Liver X Receptor Responsee elements in intron 1

Roshnii R. Singaraja1, Virginie Bocher2, Erick R. James3, Susanne M. Gee1, Lin-Huaa Zhang3, Blair R. Leavitt1, Bing Tan4, Angela Brooks-Wilson3, Anita Kwok',

Nagatt Bissada1, Yu-zhou Yang1, Guoqing Liu1, Sherrie R. Tafuri4, Catherinee Fievet2, Cheryl L. Wellington1, Bart Staels2 and Michael R. Hayden\

:: Centre for Molecular Medicine & Therapeutics, Department of Medical Genetics and Children'ss and Women's Hospital, University of British Columbia, 980 West 28:" Avenue,

Vancouverr BC, V5Z 4H4, Canada. Institutt Pasteur de Lille and Faculté de Pharmacie, Université de Lille II - U545, 1 rue du Pr.

Calmette-BP245,, 59019 Lille, Cedex, France. Xenonn Genetics, Inc., Suite 100 - 2386 East Mall, Vancouver BC, V5Z 1Z3.

:: Cardiovascular Molecular Science and Technologies, Pfizer Global Research and Development,, 2800 Plymouth Road, Ann Arbor, Ml, 48105,USA

2 2

Chapterr 2

Abstrac t t Usingg BAC transgenic mice, we have shown that increased human ABCA1 protein expression

resultss in a significant increase in cholesterol efflux in different tissues, and marked elevation in

HDL-CC levels associated with increases in ApoAl and ApoAII. Three novel ABCA1 transcripts

containingg three different transcription initiation sites that utilize seguences in intron 1 have

beenn identified. In BAC transgenic mice there is an increased expression of ABCA1 protein, but

thee distribution of the ABCA1 product in different cells remains similar to wild type mice. An

internall promoter in human intron 1 containing LXREs is functional in vivo and directly

contributess to regulation of the human ABCA1 gene in multiple tissues and to raised HDL-C,

ApoAll and ApoAII levels. A highly significant relationship between raised protein levels, increased

efflux,, and level of HDL elevation is evident. These data provide proof of principle that increased

humann ABCA1 efflux activity is associated with an increase in HDL levels in vivo.

34 4

ABCA11 BAC transgenic mice show increased cholesterol efflux

Introductio n n AA significant step in the elucidation of mechanisms of reverse cholesterol transport resulted

fromm the identification of mutations in ABCA1 underlying Tangier disease, as well as familial

hypodlphdlipüpiotememiaa associated with reduced efflux (1-5). These and further investigation

andd characterization of the biochemical phenotype of heterozygotes for ABCA1 deficiency (6),

havee demonstrated that lipidation of the nascent ApoAl rich HDL particle is a rate limiting step

inn the maintenance and regulation of HDL cholesterol (HDL-C) levels in humans. The ABCA1

genee is also rate limiting for cholesterol efflux and HDL-C levels in different species, including

mousee (7,8) and chicken (9), demonstrating conservation of this pathway in cholesterol

metabolismm over at least 400 million years.

Studiess of heterozygotes for ABCA1 deficiency have also demonstrated a very strong relationship

betweenn levels of cellular cholesterol efflux and HDL-C levels in plasma, with approximately

82%% of the variation in HDL-C levels in these patients being accounted for by the decrease in

cellularr cholesterol efflux. This clearly has demonstrated in these patients that ABCA1 is the

major,, but not the only contributor to cellular cholesterol efflux in humans (6).

Theree have been recent significant additional advances with regard to understanding regulation

off ABCA1 expression. A direct mechanism of sterol-mediated upregulation of gene expression

off ABCA1 has been shown to be due to transactivation of the ABCA1 promoter by LXR and

RXRR (10-12), two members of the nuclear receptor superfamily. This sterol mediated activation

hass been shown to be dependent on the binding of RXR/LXR heterodimers to a DR4 element

inn the promoter of the ABCA1 gene. Transcriptional sequences representing LXR response

elements,, (or LXREs), are composed of direct repeats of the motif AGGTCA separated by 4

nucleotides,, and this element has been shown to be activated by both ligands of RXR (rexmoids)

andd LXR (oxysterols) separately and together (11) These data (10-12) have clearly shown that

thee LXRE in the promoter influences ABCA1 regulation in vitro. However, thus far this has been

thee only LXRE described in the ABCA1 gene, and there has been no in vivo validation of the

steroll responsiveness of the human ABCA1 protein

Levelss of mRNA may be poor predictors of protein expression (12), as mRNA levels can vary

almostt 20X and still yield the same level of gene product Alternatively, the same level of expression

off an mRNA can result in vastly different levels of a protein (13,14). Therefore, even though in

vitrovitro studies have shown an increase of ABCA1 mRNA on oxysterol stimulation (10,11;, it is most

importantt to determine whether there is an increase in ABCA1 protein associated with raised

ABCA11 mRNA expression. Furthermore, while decreases in celluiar cholesterol efflux secondary

too either antisense in vitro inhibition of the gene (1) or in vivo mutations f 1-5) are associated

' j t t

Chapterr 2

withh decreased efflux and decreased HDL-C levels, it is currently unknown whether overexpression

off ABCA1 in vivo is associated with increased HDL-C levels and an increase in tissue specific

cholesteroll efflux.

Thee use of transgenic technologies using BACs offers important advantages for generating

micee expressing human ABCA1. The inclusion of endogenous regulatory elements within the

transgenee allows for assessment of normal temporal, tissue and cell specific expression of

humann ABCA1. Furthermore, inclusion of selected endogenous promoter sequences allows for

dissectionn of the contribution of different sequences to the normal regulation of the ABCA1

gene.. Such information is not possible using cDNA transgenic approaches which often result

inn poorly expressed genes that are not physiologically regulated.

Heree we demonstrate both in vitro and in vivo, that the ABCA1 gene has an internal promoter

containingg LXREs in intron 1. Activation of this functional internal promoter in human intron

11 by oxysterols in vivo, directly contributes to an increase in human specific mRNA in tissue

andd leads to increased protein expression. These experiments have led to the identification of

threee novel ABCA1 transcripts with different transcription initiation sites that utilize sequences

inn intron 1. In addition, increased human ABCA1 expression results in a remarkable and significant

increasee in cholesterol efflux and HDL-C levels. These studies provide important proof of principle

forr therapeutic strategies directed toward the activation of ABCA1 expression and activity.

Experimenta ll procedure s Transien tt transfectio n assa y

Cellss were transfected for 3 hours by lipofection using ExGen 500 (Euromedex) in OPTIMEM 1.

Mediumm was then replaced with Dulbecco's Modified Eagle's Medium (DMEM) containing

0.2%% fetal calf serum and cells were incubated for 48 hours. Cell extracts were prepared and

assayedd for luciferase activity as described (15). Twenty-four hours before transfection, HepG2,

HUH7,, CaCo2, Cos-1 and RK13 cells were plated in 24-well plates in DMEM supplemented

withh 10% fetal calf serum at 5 x 10'' cells/well. Transfection mixes contained 100 ng of tkpGl3

reporterr vector or pGl3 containing an 8 kb fragment f rom ABCA1 intron 1 (pGl3-8kb).

Transfectionn mixes contained 50 ng of reporter plasmid (tkpGl3) containing multiple copies of

thee putative LXREs and 25 ng of LXRu and RXR expression plasmids, in the presence of the

internall control fi-galactosidase expression vector. After transfection, cells were treated for 48

hourss with 1 pM 22(R)-hydroxycholesterol (Sigmaj.

36 6

ABCA11 BAC transgenic mice show increased cholesterol efflux

Gell Mobilit y Shif t Assa y

LXRaa and RXR were transcribed and translated in vitro using pCDNA3-LXRa and pSG5-mRXRu

ass templates and the TNT coupled transcription/translation system (Promega). Gel mobility

shiftt assays (20 [i!) rnntainpd 10 mM Tri- (pH 8), 40 mM KCI, 0 . 1 % Nunidet P-4U, b% glycerol,

11 mM dithiothreitol, 0.2 ug of poly (dldC), 1 ug herring sperm DNA, and 2.5 pi each of in vitro

synthesizedd LXRu and RXR proteins. The total amount of reticulocyte lysate was maintained

constantt in each reaction (5 pi) through the addition of unprogrammed lysate. After a 10

minutee incubation on ice, 1 ng of :P-labeled oligonucleotide was added, and the incubation

continuedd for an additional 10 minutes. DNA-protem complexes were resolved on a 6%

polyacrylamidee gel in 0.5 X TBE. Gels were dried and subjected to autoradiography at .

Multicop yy clonin g

2500 picomoles of each oligonucleotide to which half sites for BamYi I and Bgl II restriction

enzymess had been added, were phosphorylated using PNK kinase (Roche), incubated for 5

minutess at , then 10 min at C and cooled to room temperature. Multimenc copies

weree then generated using T4 ligase, cloned in TKpGI3 vector and verified by sequencing.

Generatio nn of BAC transgeni c mic e

BAC'ss containing the ABCA1 gene were identified by screening high density BAC grid filters

fromm a human BAC library. Four BACs containing ABCA1 were sequenced as previously described

(1,6).. Version 1.7 of Clustal W with modifications was used for multiple sequence alignments

withh Boxshade for graphical enhancement. The 5' end of BAC 269 is at position -13491 in

intronn 1 (i.e. 13491 nucleotides from the 5' end of exon 2). This BAC was chosen for further

purificationn as it alone contained intron 1 sequence without the human ABCA1 promoter,

allowingg us to test for functionality of the putative intronic regulatory elements. The BAC's

weree purified for injection using the Qiagen Maxi Prep kit, fol lowed by cesium chloride

purificationn (16) and dialysis overnight. BACs were quantified using agarose gel electrophoresis,

andd sets of 300 C57BL/6xCBA eggs were injected with 30ng of the purified BAC DNA. Founders

weree genotyped with DNA extracted from tail pieces, followed by subsequent PCR amplification

off exon 2, exon 26, and exon 49 of the ABCA1 gene.

Feedin gg of hig h cholestero l diet s

BACC mice and control littermates were provided free access to water and a high fat / high

cholesteroll or a control chow diet for 7 days. The diets were purchased from Harlan Teklad

withh the high fat/high cholesterol diet (TD 90221) containing 15.75% fat, 1.25% cholesterol,

andd 0.5% sodium cholate. This diet has previously been shown to result tn upregulation of

ABCA1ABCA1 mRNA levels in mouse liver, assessed at 7 days after feeding (17). The control diet

containedd 0.5% sodium cholate (TD 99057).

37 7

Chapterr 2

Quantificatio nn of huma n and mous e ABCA 1 transcript s

RNAA from mouse liver and peritoneal macrophages were isolated using Tnzol (Gibco BRL), and

3ugg of total RNA was reverse transcribed using Superscript II {Gibco BRL). Human and mouse

specificc primers were used along with 18S primers (Ambion Inc.) to quantitate transcript

abundance.. Human specific primers are as follows:

Ex3F:: CAAACATGTCAGCTGTTACTGGAAG

Ex4R'' GAGCCTCCCCAGGAGTCG

Mousee specific primers are as follows:

Ex5F:: CATTAAGGACATGCACAAGGTCC

Ex6R:: CAGAAAATCCTGCAGCTTCAATTT

Standardd cycling conditions of denaturation at 94UC for 30 seconds, annealing at 60gC for 45

secondss and extension at 72yC for 1 minute were used. PCR products were separated on 2%

agarosee gels and images captured using BioRad multianalyst software using a geldoc system.

Bandss were quantified using NIH image Version 1.6. All values are ratios with the corresponding

18SS bands.

Quantitativ ee real-tim e PCR fo r huma n and mous e ABCA 1 level s

Thee human ABCA1 primers, mouse ABCA1 primers and their Taqman probes were designed

usingg Primer Express software (Applied Biosystems, Fostercity, CA). The TaqMan probe contains

aa reporter dye at the 5' end, and a quencher dye at the 3' end. The sequences of the primers

andd the probes are:

Humann ABC1 Forward Primer (5'CCTGACCGGGTTGTTCCC3');

Humann ABC1 Reverse Primer (5'TTCTGCCGGATGGTGCTC3');

Humann ABC1 TaqMan probe (5'ACATCCTGGGAAAAGACATTCGCTCTGA3'),

Mousee ABC1 Forward Primer (5TCCGAGCGAATGTCCTTC3'),

Mousee ABC1 Reverse Primer (5'GCGCTCAACTTTTACGAAGGC 3'),

Mousee ABC1 Taqman probe (5'CCCAACTTCTGGCACGGCCTACATC3').

Thee RT-PCR reaction was carried out on ABI P .. 7700 in a final volume of 50 pi, containing

40ngg of total RNA, 200 uM primers and 600 pM probe in 1x TaqMan One-Step RT-PCR Master

mixx (PE Biosystems, CA), according to the manufacturer's instruction. The primers and probe

forr 18s or rodent GAPDH were used as the internal controls for human ABCA1 and mouse

ABCA11 respectively. The reverse transcription reaction was run at 48'C for 30 minutes. After

activationn of the AmpliTaq Gold at 95 C for 10 minutes, the PCR reaction was carried out for

400 cycles (denaturation at 95 C for 1 5 seconds, annealing and extention at 60"C for 1 minute).

Dataa quantification and analysis were performed according to the manufacturer's protocol (PE

Biosystems).. Values were calculated relative to the level of the control. Each sample was

assayedd in triplicate during two independent experiments.

38 8

ABCA11 BAC transgenic mice show increased cholesterol efflux

Detectio nn of al ternat e transcript s involvin g intro n 1 sequenc e arisin g f ro m thre e

differen tt transcriptio n star t site s

Inn order to identify the transcript generated in the BAC mice lacking exon 1, ARCA1 intron 1

sequencee was searched by ProScan for putative transcription sites, and several likely sites were

determined.. Primers were synthesized, and Clontech marathon ready mouse and human liver

cDNAA was used to amplify putative transcripts using the predicted transcript primers and an

ABCA1ABCA1 exon 3 reverse primer, following manufacturer's instructions. Positive transcripts were

confirmedd using nested PCR, and sequenced. In addition, RNA was isolated from BAC transgenic

andd control littermate tissue using Trizol (Gibco BRL}, and 5' RACE was performed using

previouslyy described primers (18) following manufacturer's instructions (Clontech). All products

weree TA cloned (Invitrogen) and sequenced using an AB! 3100 automated DNA sequencer

Primerss used for transcript amplification were:

Exonn 1bF: GTTGTCATCTTTGAACAAACTG

Exonn 1cF: GAGAAGGGAACTCACATTGCTTTG

Exonn IdF: CACGGTAGAACTTTCTACTGTG

Ex3R:: CATTCATGTTGTTCATAGGGTG

Standardd cycling conditions were used for PCR amplification of all three transcripts.

Wester nn blo t analysi s of th e distributio n of ABCA 1

BACC transgenic mice and control littermates were sacrificed by CO inhalation, various tissues

weree isolated and placed in 500pl of low salt lysis buffer containing complete protease inhibitor

tabletss (Boehnnger Mannheim) on ice. The tissues were homogenized and sonicated. The

resultingg homogenate was centrlfuged at 14000rpm for 10 minutes at 4-C, and the supernatant

wass aiiquoted into tubes. Protein levels were quantified using the Lowry assay. 100 - 1 50ug

off protein was separated on 7.5% polyacrylamide gels, and was transferred to PVDF membranes

(Millipore).. Membranes were probed with ABCA1PEP4 polyclonal rabbit antibody (directed

againstt residues 2236 to 2259 in ABCA1) (Wellington et al, manuscript in preparation) or

monoclonall anti-glyceraldehyde phosphate dehydrogenase (Chemicon) as a control . The

membranee was dipped in ECL (Amersham), and exposed to X-OMAT blue film (Kodak). Protein

levelss were quantitated usinq NIH image software

ABCA 11 immunocytochemistr y

Too further compare the in vivo cellular expression pattern of ABCA1 protein in both ABCA1

BACC transgenic mice and their wild-type littermates, immunocytochemistry was performed on

aa variety of fixed tissues using the polyclonal ABCA1PEP4 antibody described above. Transgenic

andd wild type mice were deeply anesthetized with pentobarbital, injected intraperitoneal^-'

withh 100 units of heparin in sterile water, and then transcardially perfused with cold o

39 9

Chapterr 2

paraformaldehydee in 0.1M phosphate buffered saline (PBS). The brain and liver were removed

fromm each mouse and post-fixed for 24-48 hours in the same fixative. For each organ 30-50

mmm sections were cut on a vibrating microtome (Vibratome). Sections were collected in sterile

PBSS at 4 C, rinsed in 0.1 M PBS with 0.3% Tween 20, and incubated in blocking solution

(0 .1%% PBS with 0.3% Tween 20, 3% whole goat serum, and 5% bovine serum albumin) for 2

hourss at room temperature.

Sectionss of liver were incubated for 48 hours with ABCA1PEP4. Brains from each mouse were

processedd for combined immunocytochemistry with a neuron-specific (NeuN, Chemicon)

antibody,, and ABCA1PEP4. Sections were sequentially placed into primary antisera against

ABCA11 (diluted 1:2500 in block solution) and NeuN (dilution 1:50 in block solution) for 48

hourss at 4 C. Following incubation with the primary antibody, sections were washed several

timess in blocking solution and incubated in secondary antibody for 48 hours at AZC Secondary

antibodiess (Molecular probes) were used as foflows: goat anti-mouse Alexa 488 with NeuN at

aa dilution of 1:200, and goat anti-rabbit CY-3 with ABCA1 primary at a dilution of 1:200.

Followingg further washes with 0.1 M PBS the sections were dry mounted on gelatin-coated

slides,, dehydrated by serial ethanol washes, and permanently mounted with Fluoromount

(Gurr).. Sections were analyzed using an upright fluorescence microscope (Zeiss), and digital

imagess captured on a CCD camera (Princeton Instrument Inc.). Combined and NeuN/ABCA1

stainedd sections were processed into double immunofluorescence figures using Northern

exposuree image program.

Measuremen tt of plasm a lipi d and apoprotei n level s

Micee were either bled by saphenous vein withdrawal or by cardiac puncture, and the collected

bloodd was added to tubes containing 5pl of 0.1M EDTA. For the measurement of HDL-C, the

plasmaa was mixed 1:1 with 20% PEG20, vortexed, incubated at room temperature for 10

minutes,, and spun at maximum speed for 5 minutes at room temperature (19). 20pl of the

resultantt supernatant was added to 96 well maxisorp plates (Millipore), and 200ul of Infinity

cholesteroll reagent (Sigma) was added to the wells. The plates were quantified in an ELISA

readerr at 492nm. For the measurement of total cholesterol, 5ul of plasma was added to the

samee plates, 200ul of Infinity cholesterol reagent was added, and the plate quantified as

above.. Triglycerides were measured by adding 10pl of the plasma to a 96 well plate, followed

byy the addition of lOOul of solutions from a triglyceride kit (Boehringer mannheim). FPLC

separationn of plasma lipoproteins was performed using two Superose"' 6 (Pharmacia) columns

inn series as previously described (19). Equal volumes of plasma (40ul) from mice (n=8) in each

groupp were pooled for the analysis. The cholesterol and TG content in each 0.5ml fraction was

40 0

ABCA11 BAC transgenic mice show increased cholesterol efflux

assessedd using commercially available enzymatic kits (Boehringer Mannheim). Apoproteins

weree measured as previously described (20,21).

Establishmen tt of primar y fibroblas t and macrophag e culture s

Forr the isolation of macrophages, mice were injected intraper i toneal^ with 2ml of 3%

thioglycollate,, and 3 days later were sacrificed by CO inhalation. 5ml of DMEM containing

10%% FBS, L-glutamme, and penicillin/streptomycin (all Gibco BRL) was injected into the body

cavity.. The mouse was gently massaged, and the media was withdrawn and placed in tubes on

ice.. The cell pellet was resuspended in 1 ml of the above media, and plated at a density of

5x10''' cells/ml in a volume of 300ul. The cells were incubated in a humidified atmosphere of

5%% CO., at 3 7 0 until used. Fibroblasts were isolated by dissecting the femurs of the mice, and

trituratingg the above media through the bone to remove all bone marrow. The media was

addedd to tubes on ice, spun at 1200rpm, for 5 minutes at , and the pellet was resuspended

inn 10 ml of media. The cells were plated on 10cm tissue culture plates (Corning) and left in a

humidifiedd atmosphere with 5% CO, at 37=C.

Measuremen tt o f efflu x in fibroblas t and macrophag e cell s

244 hours post plating of the macrophage cells, [3H] cholesterol (2uCi/ml) (NEN Dupont), and

50ug/mll AcLDL (Intracel) were preincubated at C for 30 minutes. Media was made containing

DMEM,, 1%FBS, pen/strep, L-glutamine, 1pM ACAT inhibitor (CI-976, a kind gift from Dr.

Minghann Wang) and the preincubated 50ug/ml AcLDL and [3H] cholesterol. The media in the

244 well plates were replaced with 300pl of this cholesterol containing media, and the plates

weree incubated for 24 hours. The labeled media was then replaced with 0.2% defatted BSA

(Sigma)) or 10% delipidated serum (Sigma) containing media for about 24 hours. The media

wass again replaced with 300ul of DMEM, pen/strep, L-glutamine, either with or without 20pg/

mll ApoAl (Calbiochem), and the treatment compounds (9)cis-retinoic acid (Sigma) and 22(R)-

hydroxyy cholesterol (Steraloids). 24 hours later, the media was withdrawn and centrifuged at

maximumm speed for 5 minutes at room temperature. 100ul of the supernatant was added to

scintillationn vials, and radioactivity was quantitated. 200pl of 0.1N NaOH was added to each

welll containing the cells and incubated for 20 minutes at room temperature. 100ul of this

lysatee was added to scintillation vials and quantified. Efflux was calculated as the total counts

inn the medium divided by the sum of the count in the medium plus the cell lysate.

Statistica ll analyse s

Alll statistical analyses were performed using one way anova follwed by the Newman-Keuls

postt test, except for the protein quantification and the analyses of the statistical significance

betweenn the means and standard deviations of the data provided in the footnote of Table 4.

Thee statistical analyses of these two data sets were performed using unpaired t-tests.

41 1

Chapterr 2

Results s Intro nn 1 contain s a functiona l promote r

Too investigate whether the internal intron 1 fragment could drive transcription of a reporter

gene,, we transfected an 8 kb fragment of intron 1 upstream of exon 2 into different cell types,

includingg several hepatic (HepG2 and HuH7), intestinal (CaCo ) and renal (RK13) cell lines.

Indeed,, in these cell lines, a significant activation of the reporter gene was observed as compared

too transfection of the empty pGI3 vector alone (Figure 2A).

Inn order to detect the presence of regulatory elements, we scanned the human ABCA1 intron 1

fromm position -1 to -24156 and discovered several putative regulatory elements. Among these,

TGACCGATAGTAACC T T

+4bp p

Humann ABCA1 Genomi c DNA

GGATCACCTGAGGTCA A

-4686bp p

AGATCACTTGAGGTC A A

-7174bp p

AGGTTACTGAAGGCC A A

-7656bp p

ATG G

Promote r r Exon l l Intron l l Exon2h h 1bp p

Humann ABCA1 BAC269 Intron l l III INN*»»"

-13491bp p Eldd E1b

E1c c

Figur ee 1. Localizatio n of LXRE element s in the ABCA1 5' regio n AA schematic diagram of the putative LXRE elements discovered in intron 1 is shown. ABCA1 genomic organization att the 5' end is shown above, and the ABCA1 BAC269 is shown below. The BAC contains 13.5kb of intron 1 sequencee followed by the rest of the gene, with the ATG occurring in exon 2. Novel putative LXR elements.were identifiedd at positions -7656bp, -7174bp and -4686bp in the ABCA1 genomic DNA and are also contained within thee BAC.

42 2

ABCA11 BAC transgenic mice show increased cholesterol efflux

Tablee 1. LXR elements ;n the ABCA1 gene

Targett Sequenc e AGGTCA (NNNN) AGGTCA

LXREE position

Promoter : : +4 4

Intro nn 1: -4686 6 -7174 4 -7656 6

LXREE sequence

AGGTTAA CTAT CGGTCA

GGATCAA CCTG AGGTCA AGATCAA CTTG AGGTCA AGGTTAA CTGA AGGCCA

%% match

83 3

83 3 92 2 83 3

Ratio o

11 0/1 2

10/12 2 11/12 2 10/12 2

wee discovered several possible LXRE's containing imperfect direct repeats of the nuclear receptor

halff site AGGTCA separated by four nucleotides (DR4) (Figure 1, Table 1) (22). LXRE's are regulated

byy oxysterols (23,24) and are important transcription control points in cholesterol metabolism

(25).. An LXRE in exon 1 of ABCA1 had previously been shown to be active in the regulation of

thee gene in vitro (10-12). All the putative LXREs are contained within the 8 kb fragment.

Too investigate whether these DR4 elements were indeed able to bind LXR-RXR heterodimers,

gell retardation assays were performed (Figure 2B). As shown before when LXRa and RXR

proteinss were incubated with the labeled CYP7-LXRE oligonucleotide in vitro, a complex was

observedd in the presence of the LXR-RXR heterodimer (24). An excess of unlabeled CYP7

competedd efficiently for binding to the probe but no competition for binding was observed

withh a DR-2 oligonucleotide. As a control, the unlabeled LXRE previously described in ABCA1

exonn 1 (+4-LXRE) (10,11) also competed efficiently for binding. The signal was then competed

withh increasing quantities of each unlabeled putative LXRE. As shown in figure 2B, all three

constructss competed for binding of the CYP7A probe in a dose dependant manner, although

withh seemingly different efficiencies.

Too determine whether these potential LXREs also possessed functional relevance, multiple

copiess of these oligonucleotides cloned in front of a luciferase reporter gene were assayed by

cotransfectionn with the expression plasmids for LXRa and RXR in cos-1 cells (Figure 3). As

previouslyy described, 3 copies of the consensus LXRE (3XLXRE), 5 copies of the CYP7 LXRE

(5XX CYP7-LXRE), 2 copies of the +4 LXRE in ABCA1 exon 1 (2X +4-LXRE) showed a strong

activationn m the presence of cctransfected LXR and RXR piasmids (10,24), I he 3 copies of the

putativee 4686 LXRE and 7656 LXRE of ABCA1 intron 1 showed a 2-fold and 6-fold induction,

respectively.. In contrast, 2 copies of the 7174 LXRE showed a weaker activation by the LXR-

RXRR heterodimer.

Detectio nn of alternat e transcript s in intro n 1

Inn order to determine if the LXRE's in intron 1 that we identified by biomformatic and in vitro

methodss are functional ih vivo, we generated mouse lines transgenic for the ABCA1 gene in

43 3

Chapterr 2

1 1

161 1

cc 14' O O

"§§ 12 "O O

ii 10 o o Li-- 8

66 '

4 4

2 2

pGI33 pGI3-8kb pGI3 pGI3-8kb pGI3 pGI3-8kb pGI3 pGI3-8kb

HepG2 2 HuH7 7 CaCo2 2 RKK 13

B B

Competitor r

LXR R

RXR R

LXR-RXR R

CYP7-LXREE +4-LXRE 4686-LXRE 7174-LXRE 7656-LXRE DR-2

++ +

++ +

++ + + +

++ + + +

, ,

liUiiAiiil l l CYP7-LXRE E CYP7-LXRE--

Figur ee 2. Intron 1 of ABCA1 has promoter activity. (A)) HepG2 (liver), HuH7 (hepatoma), CaCo (intestinal) and RK13 (kidney) cell lines were cotransfected with emptyy pGI3 vector or pGI3 containing an 8kb fragment upstream of exon 2 of ABCA1 intron 1 (pGI3-8kb). Cells weree then incubated for 48h. Luciferase activity was determined and plotted as fold activation relative to empty pGI3-transfectedd cells, (B) Gel mobility shift assays are shown in which IXRu and RXR were incubated as indicated withh the radiolabeled probe corresponding to CYP7-LXRE. Binding of the LXRc/.-RXR heterodimer was tested by competition,, by adding 5-, 25-, or 50-fold molar excess of each unlabeled oligonucleotide corresponding to the putativee LXREs shown in Figure 1 and Table 1

44 4

ABCA11 BAC transgenic mice show increased cholesterol efflux

o o H—' '

O O

"O O

c c T3 3 O O

15 5

14 4

12 2

10 0

Contro l l

LXRR + RXR ++ - +

3XX LXRE 5X CYP7 2X +4 -LXREE -LXRE

3X46866 3X7656 2X7174 -LXREE -LXRE -LXRE

Figur ee 3. Functional assessment of LXREs by LXRa transactivation. Cos-11 cells were cotransfected with multiple copies of the putative LXREs in the reporter plasmid TKpGI3 and expressionn plasmids for LXRu and RXR. Cells were then treated for 48 h with 1 pM 22(R)-hydroxycholesterol. Luciferasee activity was determined and plotted as fold activation relative to vehicle-treated cells.

whichh the promoter and exon 1 regions had been deleted. BAC 269 was used to aid in the

identificationn of novel elements differing from the previously known active LXR element (10)

inn the promoter Protein expressed from this BAC would be predicted to be full-length as the

translationn initiation site is in exon 2. We obtained several BAC founder lines, and all analyses

weree performed on two individual founder lines.

Thesee two founder lines had different copy numbers of human BACs. Southern blot analysis

revealedd founder XA with 3-4 BACs and founder XB with 1-2 BACs (data not shown). In order

too elucidate the transcript generated by the BAC transgenic mice lacking exon 1 of the ABCA1

<i r r

Chapterr 2

241566 bp

3033 bp E l l

156bp p 788 bp 136 bp 120 bp"---- E2 .

-2566 6 II lb

TGGAGAGCAGC 1 1

AAAAAA A

CTG11 \ I G \GA \AAA'l 'C AGCTAATTATTTATTT CC \GTGTCT< IGGA \ I GC VAGCTCTGTCCTG A -19100 -|Rf>(,

GCCACT ll U3AAAACAA 1 I rGGGATG \ (' \ \G( \ k , I G l l ' l l \( \ \ I (i( ' I l.C I CTGGT1 G( < AG I G( TGTGCTG < CA

GTTGT CC VTCTTTG A U \ V\ ( TG kTGCAGTGCTGG ' -1746 6

(( CTG fGTCCTT( TAGA ̂ GTTTGCTG VGCAA VTG 111 A\c i( i"ie t TC r i T N G G U . I LAGAAACTTTGGAG G

II lc -2-11 1 2372 2

CAGAA w e re \CAATGG VTTTGCTAGAAATA ^TGG VACGTCCTGTTTGG \C \GG \TATAAC C \ r r r r K AGGI \C,M, -234(. .

GG \i \TTGTTGGAATGAAGAAAGATAAATGGGGAGAAGGGAACTCACATTGCTTTGGCACTTAAATTAAGCCA T

(,, rAC'TGTGTTGGGAAATTATTTATATTATCTCGTT G VATCCACAGTAG A ^C'ACAGTTG A VCACCATACAA G

!! Id

GTATTGG \ I C \ I KiTG I rCTGAGATGGGGGAGGAAATTGTGI \GGAGG< CAGGTC \GIG( ( \ \GGTGGGTGGG \GGA

\TTGGG \GGAGG \ \ ( J( I T G Cn \ \GTGTGCCCAGC VAAGCC'ACGGTAG \ A( I I "I'C I \C I (. I( .G ( 10 1 \ ' l ( , ( 1 \( I I

CTTAGCAACCTTCTCCATGTGCTTCCTGGAGAGTCGTTGGAGTCAGAACCTTTTTCTT GG kAACCCA G VC'ACTT T

ACTTCCAAGAAAATGCTGTCCAAGAAAACTCATCCT KK ( CTTCTTCTCATGAACGTTGTGTAGA G

B B

-E1c c -E1d d

Figur ee 4. Characterizatio n of th e alternativ e splic e variant s containin g ABCA1 intro n 1.

(A )) Schematic diagram indicating the location of the splice variants discovered in the BAC transgenic mice, and

alsoo confirmed in wild type mice and humans. Exon 1b is 120bp in length and contains a TA rich region

approximatelyy 2.5kb upstream. Exon 1c is 136bp in length, and exon 1d 178bp in length. ACAATbox is located

upstreamm of exon 1 b and CAAT and TATA boxes are found immediately upstream of exon 1c. (B) Identification

off the alternative transcript involving exon 1b, 1c and 1d in wild type mouse and human liver tissue. Duplex RT-

PCRR was performed on mouse RNA with primers generating an exon 1 b transcript fragment of ~360bp, and a

fragmentt corresponding to the previously characterized transcript of ~2B0bp. Both transcripts were found in

wildd type and transgenic mice, with the alternative transcript being highly upregulated in the BAC transgenic

mice.. Different levels of each transcript were seen in liver from humans compared to wild type mice. RT-PCR

generatedd fragments of ~380bp, and 450bp for exon 1c and exonld transcripts respectively These transcripts

weree found to be present in both mouse and human liver RNA.

: :

ABCA11 BAC transgenic mice show increased cholesterol efflux

gene,, we performed RT-PCR and 5' RACE. Utilizing these approaches followed by sequencing,

wee identified three novel transcripts containing published exon 2 and exon 3 sequences, and

additionall sequence from intron 1 (Figure 4A). These transcripts were seen at different levels in

hepaticc tissue, hut example, the transcript with exon 1b was expressed at the highest level in

liverss from chow fed BAC transgenics compared to wild-type mice fed the same diet. Furthermore,

alll three transcripts occur in wild type mice and humans {Figure 4B).

Huma nn specifi c ABCA 1 mRNA is upregulate d in BAC transgeni c mic e in respons e t o cholestero ll feedin g

Inn order to determine if the human specific transcript is present in BAC transgenic mice, and

furtherr upregulated upon stimulation when mice are fed a high cholesterol containing

atherogenicc diet, we performed human and mouse specific quantitative RT-PCR and quantitative

reall time PCR on mouse tiver RNA, normalized to 18S RNA (Figure 5A and C). Human ABCA1

specificc primers indicated the presence of human ABCA1 transcript only in the BAC transgenic

lines.. Quantitation of mRNA levels by real time PCR resulted in a 1.4-2.3 fold induction of the

humann ABCA1 transcipt when the BAC mice were fed an atherogenic diet (Figure 5C). In the

samee samples, the endogenous mouse transcript is also increased in both wild type and BAC

micee by 1.2-1.8 fold. (Figure 5C). In the conventional RT-PCR assay, the human ABCA1 band

showedd an increase of - 38% when the BAC mice were fed an atherogenic diet (Figure 5B). In

thee same assay, the endogenous mouse transcript in both the wild type and BAC mice were

increasedd by - 1 7 % in response to feeding of the atherogenic diet (Figure 5B). There was no

differencee observed in the amount of the endogenous mouse transcript in BAC mice when

comparedd to wild type mice under chow or atherogenic diet conditions in both assays. Similar

increasess in both the human and the endogenous mouse ABCA1 transcripts was observed in

peritoneall macrophage cells isolated from mice on atherogenic diets (data not shown). This

clearlyy shows that the human ABCA1 gene contained within the BAC is regulated in response

too dietary cholesterol in vivo. This induction is most likely due to the oxysterol dependent

activationn of LXRu or LXRp1 from the LXREs present within the first intron of the ABCA1 gene.

Huma nn ABCA 1 protei n is increase d in BAC transgeni c mic e

Inn order to determine if the ABCA1 protein is expressed in the absence of its upstream promoter

andd exon 1 sequences, we first performed western blot analysis of several different tissues in

thee mice. We observed that there was indeed an increase in ABCA1 protein levels in the liver,

smalll intestine, testis, stomach, and brain compared to nontransgenic mice, that was

distinguishablee by our anti-ABCA1 antibody (Figure 6A). When the mice were fed an atherogenic

diet,, of the various tissues tested, the levels of ABCA1 protein were further induced in the liver

(Figuree 6C), giving us our first indication that ABCA1 expression levels could be up regulated

byy elements separate from those found in its promoter and exon 1 regions, and that LXRE's

47 7

Chapterr 2

Figur ee 5. Regulation of human and mouse ABCA1 transcripts (A)) Quantitative human and mouse ABCA1 specific RT-PCR was performed on wild type and BAC mouse tissue, bothh on chow and an atherogenic diet- An 18S primer control was included with each sample. The PCRs were separatedd on agarose gels and quantified using NIH image Lanes 1,4,7 and 10 were amplified using mouse specificc ABCA1 primers, lanes 2,5,8 and 1 1 were amplified using human specific primers and lanes 3,6,9 and 1 2 weree amplified using 1 8S specific primers Mouse and 18S specific transcripts were amplified in all the four mice Humann specific transcripts were only amplified in the BAC transgenic mice. (B) The transcripts were quantitated usingg NIH image, and the ratio between the transcripts and the corresponding 18S bands were obtained The humann transcript was upregulated by 38% (p<0.001) in the BAC mice fed atherogenic diet compared to those fedd chow diet. The endogenous mouse transcript was upregulated by 17% (p<0.001) in both the wild type and BACC mice fed an atherogenic diet when compared to those fed a chow diet There was no significant difference observedd in endogenous mouse transcript levels when comparing wild type and BAC mice both on chow diet or whenn comparing wild type and BAC mice both on atherogenic diet. (C) Quantitative real time PCR was performed onn RNA isolated from the liver of wild type and BAC transgenic mice, both on an atherogenic diet and a control choww diet. Two sets of mice were used in this analysis (solid bars representing one set, and the mottled bars representingg the next set), each analysed in two separate experiments in triplicate. As observed with the conventionall RT-PCR method, both the human and the endogenous mouse transcript showed induction in responsee to the atherogenic diet. The human ABCA1 gene was upregulated by 1.4-2.3 fold in response to the highh cholesterol diet and endogenous mouse ABCA1 transcript showed an upregulation of 1 2-1.8 fold in responsee to the same diet.

identifiedd in intron 1 are likely to be functional in vivo. This alternative promoter is also active

inn macrophages and fibroblasts as determined by the increase in ABCA1 protein in these

tissuess in BAC transgenic mice and their response to oxysterol stimulation (Figure 6B),

Proteinn expression in tissues does not necessarily give any indication of the cellular distribution

off a protein and can lead to misinterpretation of the expression level of a protein in a particular

cell.. We performed further immunohistochemical analysis on liver and brain (Figures 7A to M)

off wildtype littermates and BAC transgenic mice. We observed qualitative increases in ABCA1

expressionn in the liver in the transgenic mice (Figures 7B and D) compared with wild type

littermatess (Figures 7A and C). There was no observable alteration in the subcellular distribution

off ABCA1. For example, in the cortex, ABCA1 is predominantly located in the nucleus of

neuronss in both transgenic (Figures 7K-M) and wildtype mice (Figures 7H-J). This is the first

indicationn of ABCA1 protein expression in different tissues including brain. There was virtually

noo staining observed in the primary antibody omitted control (Figure 7E).

ABCA 11 BAC transgeni c mic e sho w increase d HDL-C apoprotei n level s

Wee next determined if the increase in ABCA1 protein in the BAC mice resulted in an increase

inn its activity by measuring the plasma lipid levels in these mice. A significant increase in HDL-

CC levels in the ABCA1 BAC transgenic mice compared to control littermates, was seen both on

choww and atherogenic diet (n=4) (p=0.005 and 0.007 respectively) (Table 2 and Figure 8A).

Thesee data show that the alternate promoter in intron 1 is important and sufficiently functiona

too result in increased expression of ABCA1 protein and increased HDL-C levels. Furthermore, in

bothh the BAC transgenic mice and wildtype littermates, the HDL-C levels increased significantly

48 8

ABCA11 BAC transgenic mice show increased cholesterol efflux

Primer s s

500bp p

Wt t Cho ww Diet

CD D t/) ) ZJ ZJ O O

E E

c c

t t

CO O CO O

Wt t Atherogeni cc Diet

CDD t= V)V) TO

oo E w EE J £

BAC C Choww Diet

CDD C (/)) CD

aa E co 22 3 CO bb .£= T-

BAC C Atherogenicc Diet

mo

use

e

hu

ma

n n

18S

S

-10 0 %% chang e in transcrip t

00 10 20 30 40 50 0

Humann transcript M H BACC chow vs BAC atherogenic ^ ^

Mous ee transcrip t Wtt chow vs. Wt atherogeni c ^ ^

Mous ee transcrip t BACC chow vs. BAC atherogeni c

Mous ee transcrip t * J Wtt chow vs. BAC cho w H

Mous ee transcrip t L _ Wtt atherogeni c vs. BAC T atherogeni c c

^ ^ ^ ^ ^ ^

^ ^ ^ ^ ^ ^ ^

H—ii * -i

-** *

-- 1 i

** p<0.001

*** p>0.05

Mous ee ABCA 1 HumanABCA 1 1 350 0

3.00 0

2.50 0

22 00

1.50 0

1.00 0

050 0

0.00 0

23000.00 0

1800000 0

130000 00

800000 0

300000 0

55 ~ oo CC

-£ZZ H -üü f

o o

u u U U (U U

tu u

TO TO

u u TO TO CQ Q

g g o o SZ SZ O O

O O TO TO

CO O

CD D

*̂— — O O TO TO tu u

5 5 ID o

OO CD CDD CO

CD D

33 „ OO CD

J ZZ ^ uu o OO CD COO CO

CO O

49 9

Chapterr 2

Tablee 2. Analysis of plasma lipid profiles in, ABC A 1 BAC transgenic mice

Alll mg/dl Tota ll cholestero l HDL-C C Triglyceride s s Non-HD LL cholestero l

Wt t Choww diet

nn = 4 Meann SD

65.299 5.8 36.988 1.8

42.666 7.55 28.311 3.77

BAC C Choww diet

n = 4 4 Meann SD

92.655 4.6 61.188 0 49.955 3 62 31.477 4.80

Wt t Atherogenicc Diet

nn = 4 Meann SD

112.844 14.2 77.844 8.8

50.600 2.33 35.000 4.50

BAC C Atherogenicc D>et

BACC chow

nn = 4 D D 55 5

137.30+277 9 57.300 4.43 43.388 8

uponn feeding of a cholesterol-rich diet (n=4, p<0.001 and p=0.002 respectively) (Table 2),

consistentt with upregulation of the ABCA1 protein The level of upregulation of HDL-C in the

BACC mice on atherogenic compared with chow diet was higher than the level of HDL-C

increasee in the wild type littermates on atherogenic versus chow diet, providing additional

prooff that the human ABCA1 transcript is indeed upregulated upon stimulation through the

LXRR pathway.

Apoproteinss Al and All were also significantly increased in the BAC transgenic compared to

wildtypee mice on a chow diet (n=16, p<0.05 and pO.0001 respectively) (Table 3).

Too assess for qualitative differences in lipoprotein particles between the human ABCA1 BAC

transgenicss and their littermate controls, FPLC analysis was performed (Figure 8B).

HDL-CC levels, as indicated by the total area of the HDL peak (fractions 30-38), were increased

inn the transgenic mice, compared to the non-transgenic controls. The size distribution of the

HDLL particles appears slightly different, as the peak appears in fraction 34 in the wildtype and

355 in transgenic mice, indicating an increase in slightly smaller HDL particles, with increased

Figur ee 6. Expressio n of ABCA1 protei n in BAC transgeni c mous e tissue . (A)) Western blot analysis of various mouse tissues from BAC transgenic mice and control littermates on chow diet.. Tissue from two different founder lines were analyzed and showed similar results. ABCA1 was detected in liver,, brain, small intestine, testis, lung and stomach, with highest level of upregulation in the BAC mouse liver whenn compared to control. (B) Increase of ABCA1 protein levels in liver in response to ad libitum feeding of an atherogenicc diet for 7 days. There was a graded increase in ABCA1 protein levels, with liver from wild type chow fedd animals showing the lowest levels, and transgenic animals fed the atherogenic diet showing the highest levels. Alll western blots were probed with an anti GAPDH antibody (Sigma) to ensure equal protein loading levels, and thee corresponding GAPDH lanes are shown below the western blots. (C) Western blot analysis was also performed onn cultured macrophage and fibroblast cells that were used for efflux assays. ABCA1 protein was detected in bothh peritoneal macrophage and fibroblast cells, with the transgenic animals showing higher levels of protein thatt the control littermates The protein levels in these tissues were also increased in response to feeding of an atherogenicc diet.

50 0

ABCA11 BAC transgenic mice show increased cholesterol efflux

W tt c h o w

vs. .

W tt a therogen ic

PP value

0 .0003 3

0 . 0 0 5 5

0 .17 7

0 .34 4

W tt chow

vs. .

BACC atherogenic

PP value

0 .01 1

<0 .0001 1

0 .09 9

0.07 7

BACC c h o w

vs. .

PP value

< 0 . 0 0 0 1 1

0 .002 2

0 . 0 4 4

0 .03 3

W tt atherogenic vs.

BACC atherogenic

PP value

0 .0007 7

0 .007 7

0 .04 4

0 .04 4

Tabl ee 3. Quantitation of Apoprotein levels in BAC transgenic mice

Wtt chow diet BAC chow diet

Apoo A-l Apoo A-ll Apoo B Apoo Gil

nn = 16 Mean SD 0.433 0.018 0.355 0.022

0.155 0.0009 0.399 0.027

nn = 16 Mean SD 0.499 0.018 0.577 0.032

0.133 0.0059 0.477 0.032

Wtt chow Vs. BACC chow

PP value <00 05

<00 0001 0.19 9 0.07 7

<uu ~a c 2

< • •

< < t r r

SS ~ U Ï U £ Ü << ^ < *L < J . < CCCC g CD g CD g co

<. . < < t r r

? » U 5 ü ïï 6 << J. < ^ < -i < trtr g CD g co g in

< < < < on on

< < < < ac ac

--*L *L

Ï Ï

cz z

ff 1

< < CD CD

E E o o

en n * i --

g g

ro ro OO 03

CC ro

TnTn u ro Ó

'' < -£ < CDD g

CD CD

200kDa--

42kDaa . GAPDH H

B B

>00kDa--

42kDa--

32kDa--

§ §

< <

--

5 5 or r

M a c r o o

Uj j

"O O

e, , a a

f l i i

^ ^ ro ro

1 1

' 1 ; ;

u u CJ J

T T ' I I I

(!) )

^ ^ O O

< < CO O

Dha a

" D D

g g

O O

1 1

ge e

,, . (1) )

g g r r

O O

< < CD D

F ib rob las t t

OJ J

TD D

() ) ^ ^ Ul l n n

rr~ ~ ra ra

5 5

' 1 ! !

(J J

O O

c; ; ' l ; ;

ra ra u u

^ ^ ro ro (3 3

< < CD CD

(D D

"oo g

ii r o VV o

>> < SS CO

+ + < < < < IT T

•? ? < < LZ LZ

T3 3

g g C C

O O

J--g g

--o o o o O O

< < co o

c c (D D

n; ; +L L s s

CD D x: :

f ) )

< < CD CD

200kDa--

GAPDH H

51 1

Chapterr 2

F F 44 |

ü ü f f

r *

»» * •• * *

* *

| |

ft ft

1 1

Figur ee 7.: Distributio n of ABC1 protei n in wil d typ e and ABC1 BAC transgeni c mice . Localizationn of ABCA1 protein was determined by immunocytochemical analysis using an ABCA1 specific polyclonal antibodyy (ABCPEP4) in liver and brain tissues. Endogenous levels of ABCA1 are identified in sections from wild typee liver (low power, A and high power C). Elevated ABCA1 levels are seen in liver tissues from BAC transgenics (loww power, B and high power, D). The tissue distribution of ABCA1 is similar in sections from cerebral cortex fromm both wild type and BAC transgenic brains (F and G) ABCA1 was predominantly neuronal as shown by co localizationn with the neuronal marker NeuN in wild type (H,I,J) and BAC transgenic brains (K,L,M). A primary antibodyy omitted control showing no staining is shown in panel E. the scale bars are panel A-B 40mm, C-E 25mm, F-GG 25mm, H-M 20 urn.

52 2

ABCA11 BAC transgenic mice show increased cholesterol efflux

2000 -i

EE 100 • o o _ i i o o i i

nn .

** * T T

" "

* ** (JC,

l ll 1 P<0.01 1

rr 1 < < m m rc rc

O O < < m m

§ § O O < <

b: : -_ _ x x ? ?

w w 1; ; x: : re e O O <̂J J Li , ,

A A

Cho

lest

erol

l (m

g/dl

)

oo

o o

c - o - W T T

—•—Transgenicc *

cc n - I T -17 9-1 QC o q 0 0 0 7 4 1 4 c

Fractionn Numbers

288 31 34 37 40

Fractionn Numbers

Figur ee 8. Analysis of plasma lipid levels in transgenic mice (A)) BAC transgenic mice show a 65% increase in HDL-C levels compared to control littermates on a chow diet. Furthermore,, HDL-C levels in both BAC transgenic and wild type mice were increased by >100% in response to feedingg of the atherogenic diet, with the BAC transgenic mice having close to 2x the HDL-C seen in the nontransgenicc littermates. (B) While quantitative changes are apparent, there are no major qualitative changes inn HDL-C in transgenic versus nontransgenic mice, either on chow (A) or atherogenic diets (B).

expressionn of ABCA1. This is in keeping with the role of ABCA1 in the initial lipidation of

ApoAll and not its subsequent enlargement. Remnant lipoproteins and LDL-C (fractions 12-20,

24-28,, respectively) were not readily different between transgenics and controls. HDL-C levels

weree further increased on feeding with the atherogenic diet (Figure 8B, panel B) with peaks

occurringg in the same fraction. Thus, the increased HDL-C concentration in ABCA1 BAC

transgenicc mice likely reflects an increased number of HDL particles, and not the presence of

largerr HDL particles.

53 3

Chapterr 2

ABCA1ABCA1 BAC transgeni c mic e sho w increase d efflu x

AA defect in cholesterol and phospholipid removal mediated by apolipoproteins has been

previouslyy observed in ABCA1 defective Tangier disease fibroblasts (26) and ABCA1 has been

shownn to mediate cholesterol efflux to ApoAl or HDL from cells (4,27). In order to determine if

theree was an increase in efflux of cholesterol in the mice expressing high levels of ABCA1, we

establishedd primary peritoneal macrophage and fibroblast cultures from these mice. We observed

increasedd efflux of [3H]-cholesterol to ApoAl from both peritoneal macrophage (Figure 9A)

(Tablee 4) and fibroblast (Figure 9B) (Table 4) cultures obtained from the transgenic mice when

comparedd to wildtype littermates. These efflux levels were further significantly increased when

thee mice were fed the atherogenic diet (Figure 9A and 9B). We observed that there was no

increasee in efflux when ApoAl was omitted as the efflux acceptor (data not shown). In addition,

wee observed that stimulation of cultures with 9(cis) retinoic acid and 22{R)-hydroxy cholesterol

whichh are specific activators of the LXR/RXR pathway also significantly upregulated the efflux

levelss from both the macrophage (Figure 9A) and fibroblast cells {Figure 9B) (Table 4). BAC

micee on atherogenic versus chow diets showed higher levels of upregulation of efflux when

comparedd to wildtype littermates on atherogenic and chow diets, indicating a larger induction

off efflux, and a larger response to LXR/RXR activation in the presence of the human ABCA1

gene,, especially in fibroblasts where the difference in upregulation of efflux between stimulated

BACss and stimulated wildtype mice was 73%.

Discussio n n Heree we show that increasing human ABCA1 protein expression results in a significant increase

inn HDL-C, ApoAl and ApoAII levels in vivo. No major change in the distribution of HDL particles

iss seen, suggesting that this increase in ABCA1 protein predominantly results in an increase in

thee number of HDL particles. We have previously shown based on families with low HDL-C, a

strongg correlation between the reduction in cholesterol efflux and the decrease in plasma HDL-

Figur ee 9. Analysis of efflux levels in primary macrophage and fibroblast cells. (A)) Primary macrophage cultures were established from mice as described. Efflux was measured 24 hours after thee addition of ApoAl and after stimulation by 9(cis) retinoic acid and 22(R)-hydroxy cholesterol (n=4, see Table 4).. We observed a significant increase (46%) in efflux levels of BAC transgenic macrophages when compared to macrophagess from wild type (wt) littermates on the same chow diet (p<0.001). Both sets of animals showed an increasee in efflux upon stimulation of the cultures with 9(cis) retinoic acid and 22(R)-hydroxy cholesterol. BAC transgenicc mice on the atherogenic diet showed an increase in efflux when compared to BAC and wt mice on the controll chow diet (p<0.0001 and p=0.0004 respectively). This efflux rate was further increased when the culturess were stimulated with 9(cis) retinoic acid and 22(R)-hydroxy cholesterol (p-'O.OI). (B) Efflux was also performedd on fibroblast cultures established from BAC transgenic and control mice (n = 4, see Table 4). An increasee in efflux was seen in BAC transgenic mice when compared to wt littermates on chow diet (p=0 03). This levell is further increased in both transgenic and wt mice by 55.8% in response to stimulation by 9(cis) retinoic acidd and 22(R)-hydroxy cholesterol. BAC transgenic mice fed the atherogenic diet showed a significant (>100%, p<0.0001)) increase in efflux levels when compared to chow fed transgenic animals. These levels were mildly increasedd (by 1 1.2%) when the cultures were stimulated with 9(cis) retinoic acid and 22(R)-hydroxy cholesterol.

54 4

ABCA11 BAC transgenic mice show increased cholesterol efflux

/5 5

SO O

/'5 5

untreated d 22(R)-hydroxyy cholesterol

9(cis)retinoicc acid

*P<00 01

*P<0.001 1

0. .

— — s s o o

> >

o o

— — u u c c Ol l

o o _i i

--i i

X X " D D

§ § O O

1 1

aj j

"• • S S O O

_c c

u u < <

<x> >

— — :— — c c c_ _ o o CD D

_c c (T3 3

5 5

o o " C C u u c c D D 0 0

ai i c c 03 3

u u < < CD D

ai i

— — s s o o

1 1

a; ;

— — s s o o

u u < <

QJ J

— — ~ ~ C C dJ J

--0) )

^ ^ 03 3

1 1

a. .

—: : u u c c

_ _ o o

f~ ~

rD D i ; ; < < CD D

400 n

30 0

20 0

'0 0

untreated d 22(R)-hydroxyy cholesterol

9(cis)retinoicc acid

c. . QJ J — — — —

0JJ 0J

T33 "O — — uu u

* ** P<0.001

en n C C

>> < en n o o

C7! ! C C

u u < <

uu en ii ', O << aJ

OJJ OJ en n O O

033 03

33 <

55 5

Chapterr 2

Tablee 4. Analysis of [3H]-cholesterol efflux to ApoAl m ABCA1 BAC transgenic mice

Wtt BAC Wt BAC Wt chow choww diet chow diet atherogenic diet atherogenic diet Vs.

BACC chow

nn =4 n =4 n =4 n =4 DD MeaniSD Mean D MeaniSD D value

Macrophagee 0 31+0 014' 0.45 ' 0.40 2 0.54 0 0077^ -0.0001 Macrophagee 22^-OH choi. 0.46 5 0.49 7 0.52 4 0.59 5 0.002 9(cis)) RA

Fibroblastt r 0.14 ' 0 16 ' 0.29 1 0.03 Fibroblastt 22(Rj-OH chol. 0.19 4 0.22 5 0.27 4 0.32 3 0.01 9(cis)RA A

PP values for unmduced vs. induced in each condition: a,b,c,g: p<0.0001, d: p<0.001, e: p<0.0002, f: p<0.0004, h p<0.C

CC in these patients (6). Here we demonstrate that increasing efflux is associated wtth a

proportionatee and predictable increase in HDL-C and raised ApoAl and ApoAII levels. The

relationshipp between the increase in efflux and increase in HDL-C appears to be linear, with a

correlationn coefficient ( r ) of 0.87 (p=0.007) showing that raised efflux levels are associated

directlyy with a proportionate increase in HDL-C in vivo. Furthermore, the rate of efflux was

almostt completely correlated with the level of ABCA1 protein (r2=0.98, p=0.001}, showing

thatt any approach which results in an increase in net functional ABCA1 protein levels in the

celll could be expected to have a proportionate increase in cholesterol efflux. Moreover, the

establishmentt of BAC transgenic mice containing sequence from all of the introns, including

intronn 1 without promoter sequence, has allowed for the identification of three novel transcripts

initiatingg in intron 1 and demonstrated that an internal promoter containing LXREs in intron 1

contributess to the normal regulation of ABCA1 and its responsiveness to oxysterol stimulation.

Itt could be argued that the increase in ABCA1 protein and HDL levels in this study is due to in

vivovivo regulation of the endogenous mouse ABCA1 protein alone. Numerous findings argue

againstt this. Firstly, the baseline and increase in ABCA1 protein in the BAC transgenic mice

wass significantly greater than seen in the control littermate mice (p=0.049, n=3). This could

onlyy reasonably be ascribed to the effects of the human ABCA1 protein. In addition, quantitative

PCRR using mouse and human specific primers clearly has shown an increase after feeding

(38%)) of human ABCA1 mRNA which was more than 2x greater than the increase in endogenous

mousee mRNA in the same experiments. This provides formal proof that transcription of the

humann ABCA1 with only intron 1 shows cholesterol responsive regulation in vivo.

Thee human ABCA1 gene comprises 50 exons spanning 149kb genomic DNA (28). Translation

beginss in exon 2 and transcription had previously been shown to be initiated at a 303bp exon

56 6

ABCA11 BAC transgenic mice show increased cholesterol efflux

Wtt chow BAC chow Wt atherogenic Vs.. Vs Vs.

Wtt atherogenic RAC atherogenic BAC nthrronenir

Rvalue e

0.0004 4 <0.0001 1

0.002 2 0.0002 2

Rvalue e

-0.0001 1 <0.0001 1

<0.0001 1 <0.0001 1

Pvalue e

<0.0001 1 0.0002 2

<0.0001 1 0.0003 3

locatedd 24,459bp upstream of exon 2 (18). Here we have shown three other transcription

initiationn sites utilizing sequence from intron 1 and giving rise to three new ABCA1 transcripts.

Att the present time, approximately 35 mutations have been described in the ABCA1 gene (1-6).

However,, in our own studies, in some patients in whom mutations have been mapped to this

particularr gene, no DNA sequence variation in the coding region or splice donor/acceptor sites

hass been detected which could account for the phenotype observed. The approach to assessing

thee mutations had been to look at each splice site and exon, as well as the regular promoter in

ann effort to identify potential DNA variants that could account for the disruption of protein

functionn (1,6). The failure to detect mutations in some of these patients, together with the

findingg of the importance of these alternate transcripts in the regulation of the ABCA1 gene,

mayy explain how expression could be compromised in some patients with defects in efflux

whichh map to this gene, but in whom no mutations have yet been described. One example of

mutationss disrupting the ratios of alternative protein isoforms implicated as the cause of abnormal

phenotypee is that affecting urogenital development in Denys-Drash syndrome (29). Further

analysiss and comparison of the sequence of the different ABCA1 transcripts may help to

identifyy missing mutations and confirm the functional significance of thesesequences.

Itt is apparent that different transcription start sites using an alternate promoter involving

sequencee in intron 1 can be used to enhance the information contained with the ABCA1 gene.

Alternatee splicing of nuclear pre-mRNA is a general mechanism for controlling gene expression

leadingg to various RNA isoforms from a single primary transcript (30-32). What is unusual here

iss that the splicing event involves intronic sequence, which in contrast to alternate splicing of

exonicc sequence, has only been described infrequently (33-35). The specific capacities of these

sequencess in intron 1 for protein interactions and the importance of the contribution of these

specificc sequences in modulating cellular responses to physiological signals, such as oxysterol

57 7

Chapterr 2

stimulation,, when compared to the promoter LXRE's, remains to be determined. However, it is

clearr that alternate transcript decisions in regard to intron 1 sequence are influenced by specific

factorss which may vary in different cell types, suggesting this event is of primary importance.

Thesee newly discovered alternate transcripts are not seen equally in all tissues and, therefore,

mayy provide further insights into the complex tissue-specific regulation of this gene, with

certainn transcripts likely to play a more major role in certain tissues. The presence of these

alternatee transcripts is also seen in endogenous mouse tissues, but there appears to species-

specificc regulation of ABCA1, with these transcripts not being detected in all tissues at the

samee level as they are seen in humans.

Species-specificc regulation of other genes involved in HDL metabolism has been reported. Fibrates,

ass an example, decrease the transcription of the ApoAl gene in rats, whilst in humans this clearly

resultss in activation of ApoAl gene expression (20,21). The availability of human ABCA1 transgenic

micee further allows the investigation of the role of other transcription factors influencing the

responsivenesss of the intron 1 promoter to oxysterol stimulation. The breeding of these mice to

otherss where various transcription factors are no longer present will help to determine their role

inn influencing the responsiveness of this promoter to oxysterol stimulation.

Wee have shown that intron 1 of the ABCA1 gene contains an internal promoter that is sufficient

too drive ABCA1 protein expression and can regulate responsiveness to LXR/RXR stimulation in

vitrovitro and in vivo. These LXREs, which are more than 1 5 kb away from the previously identified

promoter,, clearly identify the importance of intragenic sequences for the regulation of ABCA1.

Thee LXREs we identified appear functional in vivo, resulting in significantly raised HDL-C levels

andd increased ABCA1 protein expression, particularly in liver, brain, small intestine, macrophages

andd fibroblasts. Our experiments also demonstrate cross species functional complementarity

withh murine LXR-a, B and RXR-u sufficient to transactivate the human ABCA1 gene.

Cavalierr et al(36) have recently described a similar line of human BAC transgenic mice lacking

exonn 1 of the ABCA1 gene although its effects on plasma lipid levels and cholesterol efflux are

nott reported. Interestingly, they only describe one transcript in these mice, which is equivalent

too our exonlc transcript. They also describe a line of transgenic mice containing a full-length

BAC,, but were unable to demonstrate differences in cholesterol efflux and plasma lipid levels

inn these mice.

Thee mice described by Cavalier et al (36) were created on the FVB background. Our mice are

C57BL/6xCBA/JJ hybrids. Strain differences in HDL and its metabolism and response to a high fat

diett are well documented (37-47). As we are unaware of any studies comparing lipid metabolism

58 8

ABCA11 BAC transgenic mice show increased cholesterol efflux

inn FVB mice to other strains, a direct comparison cannot be made. However, there are numerous

wayss these strain differences might affect HDL-C levels in transgenics created in them. For example,

strainn differences may contribute to factors such as ApoAl acceptor levels, which may, in turn,

influencee the ability ul increased ABCA1 to increase plasma HDL-C concentrations. Similarly,

factorss influencing cholesterol removal from HDL or the turnover of various HDL subspecies may

alsoo influence the ability to observe ABCA1-mediated increases in HDL-C.

Thee availability of mice described in this manuscript will now allow us to address the question

ass to how effectively these animals can resist experimental atherosclerosis. Since the first

descriptionn of the cellular defect in Tangier disease, where decreased HDL levels appeared to

bee associated with a decrease in cholesterol efflux (48,49), the question as to whether increasing

effluxx would result in an increase in HDL-C levels and decreased atherosclerosis has been

present.. This challenge assumed greater importance with the discovery of the ABCA1 gene as

thee gene mutated in Tangier Disease (1-6). The discovery and demonstration that increasing

cholesteroll efflux can indeed be associated with an increase in HDL-C levels, provides additional

supportt for the development of therapeutics influencing ABCA1 protein expression.

Acknowledgement s s Wee thank Dr. Alan Attie, Dr. Minghan Wang and Dr. Mark Gray-Keller for helpful discussions,

XiaoHuaa Han for sequence generation, and Anita Borowski, Diana Carlsen and the transgenic

mousee unit staff for mouse injections and maintenance. This work was supported by grants

fromm CIHR to Michael R. Hayden, and also supported by the Canadian Networks of Centre of

Excellencee (NCE Genetics), and Xenon Genetics, Inc. Michael R. Hayden is a holder of a

Canadaa Research Chair.

Reference s s 1.. Brooks-Wilson, A., Mardl, M , Clee, S. M., Zhang, L, Roomp, K., van Dam, M., Yu, L, Brewer, C, Collins, J. A.,

Molhuizen,, H. 0. F., Loubser, 0., Ouellette, B. F. F.. Fichter, K., Ashbourne Excoffon, K. J. D„ Sensen, C. W., Scherer,, S., Mott. S.. Denis, M , Martindale, D , Frohlich, J., Morgan, K., Koup, B., Fimstone, S. N., Kastelein, JJ J. P., Genest, J., Jr., and Hayden, M R. (1999) Nat. Genet. 22, 336-345

2.. Bodzioch, M., Orsó, E., Klucken, J., Langmann, T., Bottcher, A., Diederich, W., Drobnik, W., Barlage, S., Buchler,, C , Porsch-Ozcurumez, M , Kaminski, W. E., Hahmann, H. W., Oette, K., Rothe, G., Aslanidis, C, Lackner,, K J., and Schmitz, G. (1999) Nat. Genet. 22, 347-351

3.. Rust, S., Rosier, M., Funke, H , Amoura, Z., Piette, J.-C, Deleuze, J.-F., Brewer, H, B., Jr., Duverger, N.. Denèfle, P.,, and Assmann, G. (1999) Nat Genet. 22, 352-355

59 9

Chapterr 2

4.. Marcil, M., Brooks-Wilson, A., Clee, S. M., Roomp, K., Zhang, L., Yu, L., Collins, J. A,, van Dam, M., Molhuizen,

H.. 0 . F., Loubser, 0., Ouellette, B. F. F., Sensen, C. W., Fichter, K., Mott, S., Denis, M., Boucher, B., Pimstone,

S,, Genest, J , Jr., Kastelein, J J. P, and Hayden, M. R. (1999) Lancet 354, 1341-1346

5.. Lawn, R. M.,Wade, D. P., Garvin, M. R., Wang, X., Schwartz, K., Porter, J G., Seilhamer, J.]., Vaughan, A. M ,

andd Oram, J F. ( 1 9 9 9 ) / O / n . Invest. 104, R25-R31

6.. Clee, 5. M., Kastelein, J, J. P., van Dam, M., Marcil, M., Roomp, K., Zwarts, K Y., Collins, J. A,, Roelants, R.,

Tamasawa,, N., Stulc, T , Suda, T , Ceska, R., Boucher, B., Rondeau, C, DeSouich, C, Brooks-Wilson, A.,

Molhuizen,, H.O.F., Frohlich, J., Genest, J., Jr., and Hayden, M. R. (2000W Clin. Invest. 106, 1263-1270

77 Christiansen-Weber, T., Voland, J. R., Wu, Y., Ngo, K., Roland, B. L , Nguyen, S., Peterson, P. A., and Fung-

Leung,, W.-P. (2000) Am. J. Pathol. 157, 1017-1029

8.. McNeish, J , Aiello, R.J., Guyot, D, Turi, T„ Gabel, C, Aldinger, C, Hoppe, K L, Roach, M. L, Royer, L. J., de

Wet,, J., Broccardo, C, Chimmi, G , and Francone, O. L. (2000) Proc. Natl. Acad. So 97, 4245-4250

9.. Attie, A D., Brooks-Wilson, A., Gray-Keller, M. E., Zhang, L, Tebon, A., Mulligan, J., Bitgood, J J , Cook, M. E.,

Kastelein,, J, J. P., and Hayden, M. R. (2000) Circulation 102, 1312-

10.. Schwartz, K , Lawn, R. M., and Wade, D. P. (2000) Biochem. Biophys. Res. Commun. 274, 794-802

11 1. Costet, P., Luo, Y., Wang, N., and Tall, A. R. (2000) J. Biol. Chem. 275, 28240-28245

11 2. Chawla, A., Boisvert, W. A., Lee, C.-H., Laffitte, B. A., Barak, Y., Joseph, S. B„ Liao, D., Nagy, L, Edwards, P. A ,

Curtiss,, L. K., Evans, R. M., andTontonoz, P. (2001) Mol. Cell 7, 161-171

13.. Aebersold, R., Rist, B., and Gygi, S. P. (2000) Ann. N. Y. Acad. So'. 919, 33-47

14.. Gygi, S. P., Rochon, Y., Franza, B. R., and Aebersold, R. (1999) Mol. Cell. Biochem. 19, 1720-1 730

11 5. Delnve, P., Furman, C, Teissier, E., Fruchart, J.-C, Duriez, P., and Staels, B. (2000) FEBS Lett. 471 , 34-38

16.. Sambrook, J , Fritsch, E. F.and Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2' : Ed , Cold

Springg Harbor Laboratory Press, Cold Spring Harbor, NY

11 7. Hedrick, C. C., Hassan, K., Hough, G. P., Yoo, J , Simzar, S., Quinto, C. R., Kim, S.-M., Dooley, A., Langi, S.,

Hama,, S Y., Navab, M., Witztum, J L, and Fogelman, A M. (2000) Artenoscler. Thromb Vase Biol. 20, 1946-

1952 2

18.. Pullmger, C R., Hakamata, H , Duchateau, P. N , Eng, C, Aouizerat, B E., Cho, M. H , Fielding, C. J , and Kane,

J.. P. (2000) Biochem. Biophys. Res. Commun. 271, 451-455

19.. Liu, M.-S., LeBoeuf, R. C, Henderson, H., Castellani, L. W., Lusis, A. J., Ma, Y., Forsythe, I. J., Zhang, H., Kirk,

E.,Brunzell,, J. D, and Hayden, M. R. (1994) ƒ Biol. Chem. 269, 11417-11424

20.. Vu-Dac, N., Chopm-Delannoy, S., Gervois, P., Bonnelye, E., Martin, G., Schoonjans, K., Fruchart, J.-C , Laudet,

V.,, and Staels, B (1998)7 Biol. Chem. 273, 25713-25720

21.. Berthou, L , Duverger, N , Fmmanuel, F,, Langouet, S., Auwerx, J , Guillouzo, A , Fruchart, J.-C, Rubin, E.,

Denefle,, P., Staels, B., and Branellec, D. (1996) J. Clin. Invest. 97, 2408-2416

222 Willy, P. J, Umesono, K., Onge, E. S., Evans, R. M., Heyman, R. A., and Mangelsdorf, D J (1995) Genes Dev.

9,, 1033-1045

60 0

ABCA11 BAC transgenic mice show increased cholesterol efflux

23.. Janowski, B. A., Willy, P. J., Devi,T. R., Falck, J R., and Mangelsdorf, D. J. (1996) Nature 383, 728-731

244 Lehmann, J. M., Kliewer, 5. A., Moore, L B., Smith-Oliver, T, A., Oliver, B. B., Su, J.-L., Sundseth, S. S., Winegar,

DD A , Blanchard, D. E , Spencer, T. A., and Wilson, T M (1997)7. Biol. Chem. 272, 3137-3140

255 Peet, D. J., Turley, S. D , Ma, W , Janowski, B A., Lobaccaro, J.-M. A., Hammer, R. E., and Mangelsdorf, D. J i1998)) Cell 93, 693-704

26.. Marcil, M., Yu, L., Knmbou, L, Boucher, B , Oram, J. F , Cohn, J S , and Genest, J., Jr. (1 999) Artenosder. Thromb.Thromb. Vase Biol. 19, 1 59-169

27.. Langmann, T., Klucken, J , Reil, M., Liebisch, G., Luciani, M.-F., Chimini, G , Kammski, W. E., and Schmitz, G

(1999)) Biochem. Biophys. Res. Commun 257, 29-33

288 Santamarina-Fojo, S , Peterson, K., Knapper, C , Qiu, Y , Freeman, L, Cheng, J.-F , Osorio, J., Remaley, A,,

Yang,, X.-P., Haudenschild, G , Prades, C , Chimini, G , Blackmon, E., Francois, T., Duverger, N., Rubin, E. M.,

Rosier,, M., Denefle, P , Frednckson, D. S., and Brewer, H. B., Jr. (2000) Proc. Natl. Acad. So. 97, 7987-7992

29.. Bruening, W., Bardeesy, N., Silverman, B. L, Cohn, R. A , and Machin. (1992) A/at. Genet. 1, 144-148

30.. Lopez, A J. (1998) Annu. Rev. Genet. 32, 279-305

31 .. Adams, M. D., Rudner, D Z , and Rio, D. C. (1996) Curr. Opin. Cell Biol. 8, 331-339

32.. Boggs, R. T., Gregor, P., Idriss, 5., Belote, J. M., and McKeown, M. (1987) Cell50, 739-747

33.. Lejeune, F., Cavaloc, Y., and Stevenin, J. (2001)7. Biol. Chem. 276, 7850-7858

34.. McQueen, K. L, Wilhelm, B. T., Takei, F., and Mager, D. L. (2001) Immunogenetics 52 , 212-223

35.. Fatyol, K., Hies, K., and Szalay, A. A. (1999) Mol. Gen. Genet. 261 , 337-345

36.. Cavelier, L. B„ Qiu, Y., Bielicki, J. K„ Afzal, V., Cheng, J.-F , and Rubin, E. M. (2001) 7. Biol. Chem. Papers in Press, Online-Mar.. 13

37.. Ishida, B. Y., Blanche, P. J , Nichols,, A. V„ Yashar, M., and Paigen, B (1991)). Lipid Res. 32, 559-568

38.. Paigen, B., Holmes, P. A., Mitchell, D , and Albee, D. (1987) Atherosder. 64, 215-221

39.. Gu, L, Johnson, M. W., and Lusis, A. J. (1999) Artenosder. Thromb. Vase. Biol. 19, 442-453

400 Machleder, D., Ivandic, B., Welch, C, Castellani, L W., Reue, K., and Lusis, A. J. (1997)7. Clin. Invest. 99, 1406-1419 9

41.. Nishina, P. M., Wang, J , Toyofuku, W „ Kuypers, F. A., Ishida, B. Y., and Paigen, B. (1993) Lipids 28, 599-605

42.. Purcell-Huynh, D A., Weinreb, A., Castellani, L W , Mehrabian, M., Doolittle, M. H., and Lusis, A. J. (1995)7. Clin.Clin. In vest. 96, 1845-1858

43.. Nishina, P. M., Verstuyft, J. G., and Paigen, B (1990)7. Lipid Res. 31, 859-869

444 Albers, J. J., Pitman, W., Wolfbauer, G., Cheung, M. C, Kennedy, H., Tu, A.-Y , Marcovina, S. M , and Paigen, B.. (1999) J. Lipid Res. 40, 295-301

61 1

Chapterr 2

45.. Mehrabian, M , Castellani, L. W., Wen, P.-Z., Wong, J., Rithaporn, T., Hama, S Y , Hough, G P., Johnson, D.,

Albers,, J. J., Mottmo, G A., Frank, J. S., Navab, M , Fogelnnan, A M , and Lusis, A. J. (2000)7. Lipid Res. 41 ,

1936-1946 6

466 Srivastava, R A K., Tang, J., Krul, E 5 , Pfleger, B., Kitchens, R T , and Schonfeld, G. (1992) Biochim. Biophys.

ActaActa 1125, 251-261

47.. Ishida, B. Y. and Paigen, 8. (1989) Atherosclerosis in the mouse. In Lusis, A. J. and Sparkes, S. R., editors

GeneticGenetic factors in atherosclerosis: Approaches and model systems, Karger, Basel

48.. Rogier, G., Trumbach, B., Klima, B , Lackner, K J , and Schmitz, G. (1995) Artenoscler. Thromb Vase. Biol. 15,

683-690 0

49.. Francis, G. A., Knopp, R. H., and Oram, J. F (1995) ƒ Clin. Invest. 96, 78-87

62 2