VCE 2 Worksheets

unit

Moleculesof life

signatures of life

area of study 01

3outcome 1

Analyse and evaluate evidence from practical investigations related to biochemical processes.

essential knowledge• The chemical nature of the cell:

– Synthesis of biomacromolecules: polysaccharides, nucleic acids and proteins

– The structure and function of lipids– The structure and function of DNA and RNA– The structure and functional diversity of proteins; the

proteome.

• The role of organelles and plasma membranes in the packaging and transport of biomolecules.

• The nature of biochemical processes:– Enzymes as organic catalysts– Energy requirements of cells; catabolic and anabolic

reactions– Energy transformations, including main stages in

and sites of photosynthesis and cellular respiration; ATP–ADP cycle; factors affecting rate of energy transformations.

• Applications of molecular biology in medicine, including the design of drugs, and in medical diagnosis.

2

essential knowledge

Unit 3

Area of S

tudy 01

Biology 2 Student Workbook Copyright @ Pearson Education Australia (a division of Pearson Australia Group Pty Ltd)

Cells and the cell theory Cell theory

The cell theory is a foundation stone in the study of Biology. The cell theory states that:• All organisms are made up of cells.• New cells are produced from existing cells.• The cell is the smallest organisational unit of a

living thing.

There are two different kinds of cells—prokaryoticand eukaryotic.

Differences also occur within the group of eukaryotic organisms. A typical plant cell has cellulosecell walls that provide structural support, chloroplaststhat are the site of photosynthesis, and large vacuoles. These features are not present in animal cells.

Figure 3.1

(a) Plant cell and (b) animal cell.

plant cell animal cell

RIBOSOMES

NUCLEUS

PLASMAMEMBRANE

CYTOPLASM

GOLGIAPPARATUS

MITOCHONDRIA

CHLOROPLASTVACUOLE

CELL WALL

(a) (b)

Table 3.1 Cells and their features

Type of cell Feature Example

Eukaryote Distinct organelles such as ribosomes as well as membrane-bound organelles including nucleus, mitochondria, endoplasmic reticulum, Golgi apparatus, lysosomes, vesicles

Organisms in Kingdoms Protista, Fungi, Plantae, Animalia, but not Monera (bacteria, cyanobacteria)

Prokaryote Lack membrane-bound organelles; nuclear material present as a single, circular thread of DNA; cell membrane surrounded by cell wall of protein and complex carbohydrate; relatively small cells

Organisms in Kingdom Monera, i.e. bacteria, cyanobacteria (blue-green algae), archaeobacteria

3

essential knowledgeU

nit 3A

rea of Study 01

Copyright @ Pearson Education Australia (a division of Pearson Australia Group Pty Ltd) Molecules of life

OrganellesThese are subcellular structures with specialised functions:

BIOLOGICAL MOLECULES

ORGANIC

CARBOHYDRATES

• C, H, O• energy rich• cellular/respiration• structure role eg. cellulose/cell wall in plants• building blocks: carbohydrate polysaccharide composed of simple sugars (monosaccharides)

• C, H, O, N• enzymes• structural• carrier molecules eg. haemoglobin, protein channels in cell membranes

• C, H, O• fatty acids and glycerol• cell membrane structure• omega-3 fatty acids• building blocks: fatty acids and glycerol

• C, H, O, N, P• DNA and RNA• contain genetic information• cell reproduction• protein production• building blocks: nucleotides

• site of chemical reactions

• cellular respiration (aerobic)

• photosynthesis

• protein• nucleic acids

• enzyme ultra structure

PROTEIN

LIPIDS

NUCLEICACIDS

WATER

INORGANIC

NITROGEN

MINERALSCARBONDIOXIDE

OXYGEN

Biological moleculesThe cells that make up living organisms are themselves composed of key chemical elements. Those which occur in greatest proportion include carbon, hydrogen, oxygen and nitrogen. These elements combine to form

a variety of important biomacromolecules. Biologically important molecules can be grouped into two types—organic and inorganic.

Figure 3.2

Chart of biological molecules.

Table 3.2 Organelles and their functionsOrganelle Function

Nucleus Cell reproduction and control of cellular activities

Ribosomes Protein production

Mitochondria Aerobic respiration

Endoplasmic reticulum Transport of materials within cell

Golgi apparatus Protein production completed; proteins packaged for dispatch from cell

Cell wall Structural support in plants

Plasma membrane Encloses cell contents; regulates passage of materials into and out of cell

Cytoplasm Reservoir containing cell contents, including water, ions, dissolved nutrients, enzymes and organelles

Lysosomes Contain enzymes responsible for breakdown of debris

Vacuole Storage facility for fluid, enzymes, nutrients

Chloroplast Photosynthesis

4

essential knowledge

Unit 3

Area of S

tudy 01


Key roles• Enclose cell contents—maintain structure of cell• Regulate the movement of materials into and

out of the cell—maintain a different composition within the cell compared with cell’s external environment.

Membrane features• Protein receptors allow communication between

cells, for example, by hormones, nerves, direct cell-to-cell contact; and allow cell recognition.

Membrane compositionThe plasma membrane is composed of a phospholipid bilayer (two layers of phospholipid molecules) embedded with molecules of protein and cholesterol.

Phospholipid molecules have their hydrophobictails directed into the centre of the plasma membrane and their hydrophilic heads directed towards the fluid medium on either side of the membrane.

Protein molecules serve as channels for facilitated diffusion and active transport.

Cholesterol molecules provide stability for the membrane.

Carbohydrate molecules associated with proteins are involved in cell recognition.

The model of the plasma membrane is referred to as fluid-mosaic because of the ‘fluid’ nature of the phospholipid molecules which are free to move about within the structure of each layer; ‘mosaic’ refers to the proteins scattered throughout the phospholipid layers.

Plasma membranes

protein carbohydrate

phospholipidbilayer

protein channel

phospholipidmolecule

hydrophobic end

hydrophilic end

Figure 3.3

3D fluid-mosaic model of the plasma membrane.

5


nit 3A

rea of Study 01


Table 3.3 Movement across the cell membrane

Process Description Active or passive

Diagram Example in organism

Diffusion Movement of particles from an area of high concentration to an area of low concentration, along a concentration gradient

Passive(does not requireenergy)

Oxygen enters body cells (low in O2 since continually using O2 in cellular respiration) from the capillaries where it is in high concentration (O2

replenished at lungs)

Osmosis Special type of diffusion that involves movement of water molecules across a partially permeable membrane; water moves from an area of high concentration of free water molecules to an area of low concentration of free water molecules, i.e. low solute concentration to high solute concentration

Passive starchmolecule

watermolecule

Cells in kidney medulla absorb water by osmosis due to osmotic gradient between ion concentration in tissue fluid and the kidney tubules

Facilitated diffusion

Movement of particles from high to low concentration through protein channel in cell membrane

Passive proteinchannel

outsidecell

insidecell

protein

Small molecules such as amino acids and glucose enter cell via protein channel

Active transport

Movement of particles from an area of relatively low concentration to an area of high concentration, against a concentration gradient

Active(requiresinput of energy)

outsidecell

insidecell

ion

Uptake of ions by root hair cells of plants and uptake of nutrients by gut epithelium cells of animals, so that concentration within cells exceeds concentration in external medium

Movement across the membraneThe exchange of materials between cells and their external environment occurs through the processes of: • diffusion• osmosis• facilitated diffusion, or• active transport.

6

essential knowledge

Unit 3

Area of S

tudy 01


Metabolism and enzymesThe metabolism of an organism is the sum of all the chemical reactions that occur within its cells. This includes the energy-transforming reactions of cells such as production of organic molecules, breakdown, recycling and excretory processes. Such biochemical processes are universal, that is, they occur in the cells of all living organisms to ensure the survival of the individual.

Enzymes are biological catalysts—they increase the rate of biochemical reactions in cells, e.g. the chemical reactions involved in cellular respiration and photosynthesis.

Properties of enzymes• composed of protein• substrate specific—catalyse a chemical reaction

involving a particular substrate molecule, and not any other; referred to as ‘lock-and-key’ to illustrate specificity between a key fitting a particular lock only

substrate product

active site

molecules

enzyme

enzyme–substratecomplex

• take part in chemical reactions but are not used up or changed by the process; released at the end of a reaction and so are available to be used over and over again

• have optimal conditions under which they work most effectively; will catalyse a reaction so that maximum product is produced per unit of time, e.g. optimal temperature for digestive enzymes in duodenum of humans is 37 C and pH 8

• sensitive to factors such as temperature and pH— when these conditions are not optimal, the activity of enzymes is reduced; extremes of such factors may lead to enzymes becoming denatured; when this happens the enzyme cannot recover its function because the shape of its active site has been permanently altered.

Temperature °C

Rate ofenzymeactivity

Enzyme concentration

Rate ofenzymeactivity

Enzymes are usually denoted by the suffix ‘ase’, e.g. maltase, lactase, protease, amylase, lipase.

The rate of enzyme activity is also dependent upon the:• concentration of substrate—the higher the

concentration of the substrate, the greater the rate of interaction between substrate molecules and enzymes, leading to increased rate of reaction

• concentration of enzyme—the more enzyme available to catalyse a reaction, the more rapidly it will proceed until all enzymes are fully engaged in the reaction.

Figure 3.4

Model of enzyme ‘lock-and-key’ operation.

Figure 3.5

Rate of enzyme activity continues to increase with increasing temperature. Excessive temperature denatures enzymes and activity ceases.

Figure 3.6

Rate of enzyme activity increases with increasing enzyme concentration.

7


nit 3A

rea of Study 01


Activation energy: energy expended to initiate enzyme-catalysed reaction; even catabolic reactions require an initial input of energy to start reaction

Coenzymes: small organic molecules important to the normal functioning of enzymes, e.g. vitamins

Cofactors: inorganic ions important to the normal functioning of enzymes, e.g. Mg++

Energy transformationsLiving organisms require energy for growth, movement, repair of damaged tissue and reproduction. Energy is obtained by the production of energy-rich organic compounds in autotrophic organisms such as plants, and by the consumption of plants and/or other animals by heterotrophic organisms. Different kinds of energy transformations are involved.

Accessing energy-rich molecules: making ATPATP (adenosine triphosphate) is the immediate source of energy for cells. It is produced in a series of chemical reactions that involves the breakdown of organic molecules. The useable energy of ATP is contained in the phosphate bonds of the molecule. The cycling of ATP and ADP (adenosine diphosphate) means that energy continues to be available for use in the cell.

Cells access the energy available in organic molecules through glycolysis (anaerobic) and either cellularrespiration (aerobic) or fermentation (anaerobic).

Cellular respiration is the process in which complex organic compounds are broken down to release energy (ATP). Water is a by-product.

C6H12O6 6O2 6CO2 6H2O + energy (36–38 ATP)

Figure 3.7

ATP/ADP cycle.

Cel

l

Glycolysis

Krebs cycle

Electron transfer inner membraneof mitochondria

inner compartmentof mitochondria

2 pyruvates 6 CO2

(each pyruvate 3 CO2)

glucose 2 pyruvate

2 ATP

2 ATP

32 ATP

in cytosol

mito

chon

drio

ncy

toso

l

Figure 3.8

Energy release in presence of oxygen: glycolysis, Kreb’s cycle and electron transfer.

8

essential knowledge

Unit 3

Area of S

tudy 01


Cytochromes are proteins involved in the process of electron transport on the inner membrane of mitochondria during cellular respiration.

Glucose

animalslactic acid + 2 ATP

plants and yeast alcohol + CO2 + 2 ATP

Since these processes involve the release of energy, they are called exergonic reactions. The release of energy is the result of the breakdown of organic compounds. These reactions are catabolic.

Building energy-rich molecules: photosynthesisThe ultimate source of energy for living things is the sun. Photosynthesis is the process in which green plants use chlorophyll to trap light energy and use it to combine water and carbon dioxide to produce energy-rich organic compounds (glucose). Oxygen is a by-product (Figure 3.10).

Photosynthesis involves the synthesis of biomacro-molecules and is therefore described as anabolic. Since this process requires an input of energy, it is an endergonicreaction.

lightCO2 + 12H2O C6H12O6 +6O2 + 6H2O

chlorophyll

Photosynthesis takes place in the chloroplasts and occurs in steps called the light-dependent reaction and the light-independent reaction.

In contrast, respiration involves the chemical breakdown of glucose in cells for the release of energy. This results in the uptake of O2 and the release of CO2.

Some autotrophic bacteria use inorganic materials to build organic compounds without the involvement of sunlight. This is called chemosynthesis.

Figure 3.9

Energy release in absence of oxygen.

Grana — light-dependent reaction

12 H2O

Stroma — light-independent reaction

24 H+ + 6CO2 (Calvin cycle)

C6 H12 O6 + 6H2O

24 H+ + 6CO2

Figure 3.11

Chloroplast—light-dependent and light-independent reactions.

PHOTOSYNTHESIScarbohydrates produced

RESPIRATIONcarbohydrates used

O2

O2

CO2

CO2

H2O

H2O

H2O

energy

Figure 3.10

Summary of photosynthesis and respiration.

9


nit 3A

rea of Study 01


C4 and CAM photosynthesisSome species of plants adapted to hot environments have different photosynthetic pathways. These are solutions for plants that must have their stomata closed for much of the day to avoid excessive water loss and so have less time to acquire carbon dioxide for photosynthesis. C4 plants, such as sugar cane, are more efficient at fixing carbon dioxide than C3 plants—they capture more carbon dioxide per unit time (Figure 3.12). The first stable carbon compound produced

Table 3.4 Factors that affect the rate of photosynthesis in green plants

Factor Effect

Carbon dioxide concentration

The higher the concentration gradient between the intercellular spaces and the external environment, the greater the diffusion rate of carbon dioxide into leaves via stomata, and, therefore, the greater the rate of photosynthesis

Light intensity The greater the light intensity, the greater the rate of photosynthesis, until the point at which other factors limit the process, e.g. high temperatures result in closed stomata

Temperature Increasing temperature results in increasing rate of photosynthesis, until optimal temperature for photosynthetic enzymes is reached; further increases in temperature result in decrease in photosynthetic rate

Water Water is a reactant in photosynthesis; it is also important in the turgidity of guard cells, keeping stomata open for entry of carbon dioxide. Reduced water availability decreases rate of photosynthesis

Chlorophyll Light-trapping pigment; larger amounts of chlorophyll mean more sunlight is harnessed, thereby increasing rate of photosynthesis

Oxygen Not directly involved in photosynthesis; however, high oxygen concentrations reduce rate of carbon fixation in photosynthesis

C3 Plant

C4 Plant

CO

2 ta

ken

up/u

nit

light

ene

rgy

abso

rbed

10 20

heat temp °C

30 40

Figure 3.12

Comparison of CO2 take up as measure of photosynthesis in C3 and C4 plants at increasing temperature.

contains four carbon atoms (hence C4 photosynthesis). CAM plants, such as pineapple, only have their stomata open during the night. The carbon dioxide they collect is converted to crassulacean acid (called crassulacean acid metabolism CAM) which is stored during the night. During the day when the stomata are closed, the carbon dioxide is released from storage and is available to take part in normal C3 photosynthesis.The factors affecting the rate of photosynthesis are summarised in Figure 3.13 and Table 3.4.

Temperature limits rate

High temperature

Low temperature

Light intensity

Rat

e of

pho

tosy

nthe

sis

Ligh

t lim

its ra

te

Figure 3.13

Effect of temperature and light intensity on rate of photosynthesis.

10

essential knowledge

Unit 3

Area of S

tudy 01


T T C C T G G G A DNA template strand

Transcription

mRNA strand

amino acids forming polypeptide chain

Translation

A A G G A C C C U

LYS ASP PRO

Figure 3.15

Protein production begins with transcription in the nucleus and translation at the ribosomes.

DNA, proteomes and proteomicsCommon to all living things on Earth is the presence of the genetic material, DNA (deoxyribonucleic acid). Its structure and function are universal.

The structural unit of DNA is the nucleotide. Nucleotides are named according to the base each includes. The bases in DNA occur in complementary pairs:

Adenine (A) pairs with Thymine (T)Cytosine (C) pairs with Guanine (G)

The sequence of nucleotides in the DNA is significant because of its role in protein production. A specific DNA sequence that codes for a particular protein is called a gene. The genome is the total complement of all of the genes in an individual organism.

P – S – P – S – P – S – P – S – P – IA

IT

IG

IC

Figure 3.14

The DNA in the nucleus of cells unravels to reveal double helix.

11


nit 3A

rea of Study 01


Once polypeptide production is complete, the final formation of the protein can occur.

1 Polypeptide formation primary protein structure

2 Polypeptide becomes coiled or pleated

secondarystructure

3 Coiled polypeptide folds into 3-dimensional form

tertiary structure

4 Two or more 3-dimensional polypeptide molecules bonded together

quaternarystructure

Proteins are key components of cells. There are many different kinds of proteins, each with a different function, and all are vital to the normal functioning of the organism.

The proteome is the total complement of all of the proteins in an individual organism. An organism’s proteome is determined by the DNA sequence of its genome. Proteomics (the study of proteins, including their structure and function) is an expanding field of biology that has enormous potential for increasing our understanding of how organisms function and of diseases and their treatment and management, for the development of pharmaceuticals, and for shedding light on evolutionary relationships.

Bioinformatics (the use of computers and databases to manage biological information) is a vital tool in collecting and analysing biological information as well as making data accessible and manageable. For example, generating the DNA sequence of the human genome and making the data accessible are results of this technology.

Channels in cell membranes

Haemoglobin carrier molecules

transport

catalyst

structural

com

mun

icat

ion

Hormones

Enzymes

Muscle tissue cell membranes

PROTEINS

Figure 3.16

Proteins have many roles in living organisms.

12

Unit 3

Area of S

tudy 01

worksheet


01Cells—crosswordComplete the crossword puzzle to help you check your knowledge and understanding of key terms and processes from Heinemann Biology 2 4th Edition Chapter 1.

Across3 Bilayer that encloses cell contents as well as cellular

organelles [8]4 Passive movement of molecules along a concentration

gradient [9]5 Chemical complex which forms the main structure of

biological membranes [12]10 Cellular apparatus characterised by flat, membranous

sacs involved in the packaging of proteins for secretion from cells [5]

13 Organelle with folded inner membrane that is concerned with energy transformations in cells [12]

18 Type of complex compound containing carbon and hydrogen [7]

20 Energy-rich complex organic compound [12]21 Kind of molecule transport across plasma membranes

that requires the expenditure of energy [6]

Down1 Fluid-filled storage organelle that also has a structural

role in plant cells [7]2 Organic compound composed of fatty acids and glycerol

[5]

5 Cell characterised by the absence of distinct, membrane-bound organelles [10]

6 Kind of essential fatty acid linked to reduced incidence of diseases such as cardiovascular disease [6]

7 Complex organic compound with many functions, including structural roles and catalysing chemical reactions in cells [7]

8 Compound composed of protein and complex carbohydrate that makes up the cell wall of bacteria [6]

9 Passive movement of water molecules across a partially permeable membrane along a concentration gradient [7]

11 Organelle dedicated to the process of photosynthesis [11]

12 Passive form of molecule transport across plasma membranes through protein channels [11]

14 Site of protein production in cells [8]15 Organism whose cells feature a distinct nucleus and

membrane-bound organelles [9]16 Subcellular structure that has a specific function [9]17 Organelle containing genetic material and concerned

with controlling cell activities [7]19 Kind of acid of which DNA and RNA are composed [7]

13

Unit 3

Area of S

tudy 01

worksheet


02Gadget gallery—cell organelles

1 Study the diagrams of the plant and animal cells shown. Identify the organelles indicated in the spaces provided.

2 Examine the electron micrographs of each of the different cell organelles in the table. Use the diagrams above to help you identify each. Complete the details in the table to provide a summary of the structure and function of each organelle.

Figure 3.17

Organelles of plant and animal cells.

Name of organelle: nucleusDescription:

Function:

Name of organelle A: Description:

Function:

Name of organelle B: Description:

Function:

Name of organelle: Description:

Function:

Name of organelle: Golgi apparatusDescription:

Function:

Name of organelle: chloroplastDescription:

Function:

A

B

14

Unit 3

Area of S

tudy 01

worksheet


03Model membranes

1 The diagram represents a fluid-mosaic model of a plasma membrane. Complete the diagram by adding labels and functions where indicated.

2 Outline the features of plasma membranes that have led to their description as ‘fluid-mosaic’.

3 Describe the role of the following molecules in plasma membranes:

a cholesterol:

b carbohydrate:

4 Plasma membranes play an important role in exchange of materials into and out of cells. Complete the table outlining these processes and identify the components of plasma membranes involved in each.

Process Description of process Example of material exchanged

Component of plasma membrane involved

Simple diffusion

Facilitated diffusion

Osmosis

Active transport

CHOLESTEROL

PHOSPHOLIPID MOLECULE

PROTEIN STRUCTURE:FUNCTION:

Figure 3.18

Fluid-mosaic model of a plasma membrane.

15

Unit 3

Area of S

tudy 01

worksheet


04Enzyme ABC—amazing biological catalysts

1 Make a selection from the list below to fill in the missing words. This will give you a complete summary of enzymes and their functions.

biomolecules deficiency substrate-specific optimal

denatured catabolic catalysts temperature

protein active site photosynthesis cellular respiration

metabolism anabolic coenzymes

Enzymes are biological . They increase the rate at which chemical reactions occur in living cells.

They are organic compounds composed of . Enzymes are important facilitators of energy-

transforming reactions, recycling processes, synthesis of some compounds and breakdown of others—all of the

processes that make up the of cells.

Enzymes are involved in both the construction and breakdown of . Chemical reactions in which

larger molecules are constructed from smaller ones are called reactions. is

an example that typically occurs in plant cells. reactions involve the breakdown of large molecules

into smaller ones. is an example of such a reaction in cells.

Enzymes are - , that is, they have an active site that fits a particular

substrate molecule only. This feature of enzymes is sometimes referred to as ‘lock-and-key’.

Enzymes have conditions, that is, they operate most efficiently under particular conditions.

Enzymes are sensitive to factors such as and pH. Their rate of activity can also be influenced

by the concentration of substrate or enzyme. Cofactors and also affect enzyme action.

The of an enzyme can be by excessive

temperatures or pH.

Enzyme can result in disease.

2 Circle the word(s) that make the following statements about enzymes correct.

Enzymes are needed in small/large amounts.

Enzymes are used up/not used up in chemical reactions.

Enzymes can/cannot be used over and over again.

Enzymes do/do not affect the final amount of product in a reaction.

Enzymes increase/decrease the activation energy required to initiate reactions.

16

Unit 3

Area of S

tudy 01

worksheet


Active enzymes Enzyme action

Enzymes catalyse chemical reactions in cells in two directions, that is, the reactions are reversible. The example below illustrates an enzyme catalysing the production of the disaccharide (two sugar) sucrose from the simple sugars glucose (G) and fructose (F).

1 Complete the diagram by inserting the glucose and fructose molecules into the active site of the enzyme. Then draw the newly constructed molecule of sucrose after it is released from the enzyme.

Use coloured pencils to colour-code your diagram. Use different colours for each of the different kinds of sugar molecule and for the enzyme.

2 Explain why the relationship between enzymes and their substrates is described as ‘lock-and-key’.

3 Name two factors that can affect the active site of enzymes.

4 Describe what happens to the active site of an enzyme if it is denatured. What are the consequences for enzyme activity when this occurs?

05

ENZYME

GF

Figure 3.19

Active site of enzyme.

17

Unit 3

Area of S

tudy 01

worksheet


Activation energyChemical reactions need a minimum energy input to ‘kick start’ them. This is called the activation energy of the reaction. Enzymes reduce the amount of energy needed to provide this kick start.

In the reaction in Figure 3.19, a more complex molecule is being constructed from two simpler ones. This involves a change in energy ( G) from an initial low level of energy to a final higher state. That is, there has been an overall input of energy into this reaction to construct the larger molecule. The energy that has been channelled into the reaction is contained within the chemical bonds that hold the two sugar subunits together. This reaction is called an endergonic reaction.

Graph A shows the activation energy for the sucrose-building reaction.

The same enzyme catalyses the breakdown of sucrose into glucose and fructose in an exergonic reaction.

Complete graph B to illustrate the activation energy for this reaction.

6 Why is the reaction in Graph B described as exergonic?

Totalenergy

COURSE OF REACTION

FINALSTATE

INITIALSTATE

GΔ

Figure 3.20

Activation energy

Totalenergy

COURSE OF REACTION

Graph A: Endergonic Graph B: Exergonic

5

18

Unit 3

Area of S

tudy 01

worksheet


Energy transformations—matchmaker1 Read the definitions listed in the boxes on the right side of the page. Choose the correct term from the list below to match

each definition. Write each term in the box corresponding to its definition.

exergonic reaction chloroplast electron transport ATP energyKrebs cycle anaerobic respiration endergonic reaction mitochondrion lactic acid

organelle—site of cellular respiration in cells

compound produced during anaerobic respiration in animal cells

series of energy-releasing reactions during cellular respiration in which electrons are transferred by cytochromes

chemical reaction in which energy is released

organelle—site of photosynthesis

energy-releasing reaction in cellular respiration—pyruvate molecules converted to carbon dioxide and water

chemical reaction in which energy is consumed

capacity to do work

energy-rich molecule generated in cellular respiration—immediate source of energy for cells

process in which organic compounds are broken down by cells in the absence of oxygen to release energy

2 Examine each of the diagrams below carefully. Write a couple of sentences about each to explain the process involved.

06

on.

glycolysis+ 2ATP

c cc

cc

cc ccc cc

6CO2 + 12H2O

light chlorophyll

C6H2O6 + 6O2 + 6H2O

19

Unit 3

Area of S

tudy 01

worksheet


Mighty mitochondria1 Define cellular respiration.

2 Write a balanced equation for cellular respiration in the box below.

3 Cellular respiration occurs in three stages. These are glycolysis, and

. occurs in the cytoplasm.

The Krebs cycle and occur in the .

4 Complete the pictograph of the cell and mitochondria to build a summary of the different steps involved in the process of cellular respiration and the sites where each step occurs within the cell.

5 Mitochondria are sometimes referred to as the ‘powerhouse’ of cells. Suggest the reason for this.

07

GLYCOLYSIS OCCURS IN

GLUCOSE 2 + ENERGY YIELD:

CONTAINS CYTOCHROME MOLECULESTHAT ARE INVOLVED IN

ENERGY YIELD:

ENERGY YIELD:

+6CO2

CYCLE

KREBS

2

INNER COMPARTMENT

MITOCHONDRION

PLASMA

MEM

BRANE

INN

ERFO

LDED

MEM

BR

ANE

Figure 3.22

Process of cellular respiration.

20

Unit 3

Area of S

tudy 01

worksheet


Zooming in on photosynthesisIn photosynthesis, green plants manufacture their own organic compounds using the raw materials of carbon dioxide and water. The process requires the input of light energy harnessed from sunlight. The pigment responsible for photosynthesis is chlorophyll. In green plants, the chlorophyll is contained in organelles called chloroplasts.

Photosynthesis occurs in two stages: the first in the presence of light, called the light-dependent reaction; the second in the absence of light, called the light-independent reaction.

1 Complete the sentences below that summarise key structures and reactions in the process of photosynthesis.

Electron microscopy allows us to zoom in on the structure of chloroplasts. This technology reveals a complex network of stacked membranes that contain the chlorophyll. These membranous stacks are surrounded by a fluid matrix.

• The chlorophyll-filled membranous stacks are called the .

• These membrane stacks are the site of the reaction.

• The fluid matrix that surrounds these membranous stacks is called the .

• The fluid matrix is the site of the reaction.

2 Fill in the spaces to complete the diagram.

3 Name two factors that affect the rate of photosynthesis. Outline the effect in each case.

Factor 1:

Factor 2:

08

Figure 3.23

Electron micrograph of chloroplast.

LIGHT-DEPENDENT REACTION

REACTION: WATER +

EQUATION: 12H2O +

LIGHT

CHLOROPHYLL

occurs in the

LIGHT-INDEPENDENT REACTION

REACTION: HYDROGEN: WATER

CA

LVIN

CY

CLE

+ +

EQUATION: 24H+

occurs in the

WATER+ +

Figure 3.24

Ultra-structure of chloroplast.

21

Unit 3

Area of S

tudy 01

worksheet


Energy transformations in cells: cellular respiration and photosynthesis—a concept mapA concept map is a map of ideas related to a particular topic. The ideas in the concept map are linked together by lines that include a brief explanation of how the ideas are linked. When the concept map is complete you will have a one-page summary of all of the key ideas related to your topic. Use trigger words to help you get started. Trigger words are useful in triggering or suggesting other words or terms related to the topic. For example, trigger words related to energy transformations in cells might include:

Cellular respiration, which triggers mitochondria 3 stages

Photosynthesis chloroplasts

Add to the concept map below until you have covered all of the key ideas. Use your text book as a reference for words and explanations.

09

CELLULAR RESPIRATION

CYTOSOL + glycolysis

MITOCHONDRIA

SU

MM

AR

ISE

DB

Y E

QU

ATIO

N

PHOTOSYNTHESIS

USESO

2R

ELEASESO2

Figure 3.25

Concept map—cellular respiration and photosynthesis.

22

Unit 3

Area of S

tudy 01

worksheet


Cell’s user manual—a concept mapAn organism’s genome and its corresponding proteome can be likened to a dictionary in which the genome represents all of the words and the proteome outlines the meanings of those words. The genome includes all of the genes that are the instructions for building all of the proteins in the body. In this concept map you begin with the genome and follow the steps to finally reach the cell’s functional destination—its proteome.

Use the boxes to write in the definition of terms. Add your own branches and words to the concept map to build a word picture of the key structures and processes that occur as the cell follows its genetic instructions to build its proteins.

10

GENOME: FULL COMPLEMENT OF GENES IN AN INDIVIDUAL ORGANISM

PROTEOME:

GENES

individual genes a read-out of genome

composed of

leaves nucleus for

mRNA codons code for

deoxyribonucleic acid

Building blocks of

primary protein structureCHAIN

nucleotide building blocks

in nucleus

DNA

TRANSCRIPTION

mRNA

RIBOSOMES

AMINO ACIDS

COILS

FOLDS

PROTEINSFunctions

Figure 3.26

Concept map—cell’s user manual.

23

Unit 3

Area of S

tudy 01

worksheet


Nuclear puzzle—same pieces, different picture!11

AGGTTAGGTTCAGACTGTCGATAT

AGGTTCAGACTGTCGATATCGAGGTTCAGACTGTCGATATCGTAGGTTCAGACTGTCGATATCG

AGGTTCAGACTGTCGATATCGAGGTTCAGACTGTCGATATCGT

AGGTTCAGACTGTCGATATCGTTAGGTT A G CGATATCG

GG T GA GTCGAGGTCTTCCTGAAGTTCAGATGTATAGTTTCG

ACTG

A GAGGTTC GACTGT CGATATCGATCGATATCGAGA CGATATCGAGGTTCAG

TTCAG GTTCAGACTGTCGATATCGTTCG ATATCGAGGTTCAGACTGTCGAG CAGGTTCAGACTGTCGATATCGTCAG CGAGGTTCAGACTGTCTCGAGGTTTCAG ATATCGAGGTTCAGACTGTCGATATCGAGGTTCAGACTGTCGATATCGAGGTTCAGACTGTCGATAGACTGTCGATATCGAGGTTCAGACTGTCGATATCGT

TCAGACTGTCGATATCGAGGTTCAGACTGTCGATATAGGTTCAGACTGTCGATATCGAGGTTCAGAC

CGATATCGAGGTTCAGACTGTCGATTCGATATCGAGGTTCA

AG

Millions of different species of organisms have evolved on Earth—plants, animals, algae, fungi, protists, bacteria and more. Within a single species there is also enormous diversity. And yet, we account for every individual using the same fundamental threads of genetic material—DNA. Not only this, the DNA that codes for the staggering number of different organisms and the features that make each one unique comes in only four different forms. The pieces of the DNA puzzle, the nucleotides, are characterised by a different base molecule—adenine, thymine,cytosine or guanine. It is the infinite number of combinations that gives us such a titanic degree of variety.

1 Nucleotides are composed of the same three components. Name the molecule represented by

P: S:

A, T, C, G:

2 The nucleotide sequence in Figure 3.27 is part of the human -haemoglobingene.

Use coloured pencils to colour-code the nucleotide bases in the legend.

Follow your code to colour the different bases along the base sequence.

3 Use appropriate symbols and colour-coding to draw the complementary DNA strand against this template strand.

4 Look carefully at the details of your double-stranded DNA. Describe two features of DNA that ensure complementary base-pairing occurs.

Feature 1:

Feature 2:

5 Add another symbol to the base legend above that will allow the construction of an RNA molecule.

6 Use the space at the right of the DNA template strand in Figure 3.27 to draw in the complementary RNA strand.

Figure 3.27

Sequence of nucleotide bases in the human haemoglobin gene.

5’

S

S

S

S

S

S

S

A

T

C

G

S

S

3’

LEGEND

24

Unit 3

Area of S

tudy 01

worksheet


Hypothetical halitosis—a proteomics simulationYou are a science graduate recently employed at a pathology clinic that specialises in proteomics. Your first assignment is to process saliva samples from volunteers taking part in trials designed to diagnose and treat individuals with chronic halitosis (bad breath).

It is found that degrees of bad breath are influenced by the presence of particular proteins in body fluids. A sample of sweat or saliva can be used to determine the presence of these proteins. Six subjects have volunteered their services and saliva.

Testing procedure: A drop of saliva is placed in each well of a SPIT card (Salivary Protein Indicator Test). Each well contains an indicator that tests for the presence of a specific protein.

The proteins that have been identified in saliva are:

• JM—linked to strong, unsavoury odour

• PU—linked to strong, unsavoury odour

• TP—fresh smelling odour, so named due to its similarity totoothpaste

• NS—a neutral protein linked to no smell

The effect of the different proteins is cumulative, so that the presence of more than one protein in the saliva of an individual increases the magnitude of the halitosis. On the other hand, protein TP appears to proportionally negate or cancel out the effect of an undesirable protein, e.g. TP cancels effect of PU.

The SPIT results for the six volunteers are shown in Figure 3.28, together with a standard against which the test cards are assessed.

Shaded wells indicated the presence of the protein in question.

Unshaded wells indicate the protein is not present.

1 a Two individuals share the ranking of most acute halitosis. List these individuals.

b These two individuals have different SPIT results. Explain how the degree of halitosis can be the same.

2 Subject 4 tests positive for three salivary proteins but has more pleasant breath than subject 1. Explain these results.

3 Subjects 3 and 6 are competing for the same date. Based on SPIT results alone, decide which subject is more likely to be successful. Explain your choice.

4 Rank the subjects in order from highest to lowest degree of halitosis.

12

STANDARD

SUBJECT 1

SUBJECT 2

SUBJECT 3

SUBJECT 4

SUBJECT 5

SUBJECT 6

JM PU TP NS

Figure 3.28

Salivary protein testcards and standard.

practical activity

25

Unit 3

Area of S

tudy 01practical activity


Partially permeable membranespurpose

To investigate the effect of a partially permeable membrane on the movement of particles in solution.

background information

To test for the presence of starch, add a few drops of iodine/potassium iodide solution to the test solution. If starch is present the solution will change to a blue-black colour.

To test for the presence of glucose, dip a piece of testape into the test solution. If glucose is present, the tape will change from yellow to green.

materials

• dialysis tubing• iodine/potassium iodide• testape• 5% starch solution• glucose solution• thistle funnel• 2 gas jars• retort stand and clamp• test tubes• test tube rack• rubber bands• 50 mL beaker

procedure

APresenting partial permeability

1 Pour glucose solution into a 50 mL beaker to a depth of about 1 cm. Dip in one end of a piece of testape.

1 Describe your observations.

2 Fill a gas jar with water until it is about three-quarters full. Test the water in the same way with a piece of testape.

2 a Note the result.

b Explain why you have tested the water in the gas jar with testape.

3 Use the equipment listed to construct an experimental set-up similar to the one shown in Figure 3.29.

Set up the retort stand to support the thistle funnel first. Then secure the dialysis tubing. Moistening the dialysis tubing will help to open the ends. Tie one end firmly closed with a rubber band. Tie the other end so that it is securely fastened to the thistle funnel. Gently pour glucose solution into the thistle funnel until the level rises about 2 cm up the stem of the funnel. Place the gas jar beneath the thistle funnel. Use the clamp to lower the dialysis tubing completely into the water/testape solution. Leave the set-up undisturbed for 30 minutes (longer if possible).

3 a Use the testape to once again test the solution in the gas jar. Describe your observations.

b Explain what has happened.

thistlefunnel

level of glucose solnin thistle funnel

cellulose bagfastened tothistle funnelwith rubber band

gas jar ormeasuringcylinder

retort standand clamp

cellulose bag filled with glucose solution

Figure 3.29

Equipment set-up for experiment.

01

practical activity

26

Unit 3

Area of S

tudy 01

practical activity


Modelling osmosisProcedureprocedure

1 Pour starch solution into a test tube to a depth of about 1 cm. Add a few drops of iodine/potassium iodide solution.

4 Describe any colour change that occurs.

2 Fill the second gas jar with water until it is about three-quarters full. Add several drops of iodine/potassium iodide solution.

5 a What colour is the solution?

b What does the colour of the solution indicate about the presence of starch?

3 Use the equipment listed to construct an experimental set-up similar to the one shown in Figure 3.30(a).

Prepare the set-up in the same way as you did for Part A, except that this time you will pour starch solution into the thistle funnel/dialysis tubing. Place the gas jar beneath the thistle funnel. Lower the dialysis tubing completely into the water and iodine/potassium iodide solution. Leave the set-up undisturbed for 30 minutes (longer if possible).

B

level of starchin thistle funnel

iodine/potassiumiodide and water

cellulose bagfilled withstarch solution(a)

Figure 3.30

Equipment set-up—(a) before, (b) after.

(b)

30 minutes later

practical activity

27

Unit 3

Area of S



conclusions

In this activity, you considered evidence that indicates some kinds of molecules move across partially permeable membranes while others do not.

Write the definition for:

9 a osmosis

b diffusion

10 Explain why some kinds of molecules are able to pass through partially permeable membranes and others are not. Use specific examples.

6 Use coloured pencils to colour Figures 3.30(a) and 3.30(b) to reflect your observations at the start of the activity and again after 30 minutes.

7 Describe any changes you observe.

8 Account for the colour changes you have observed. Where did the molecules of water, iodine/potassium iodide and starch begin and where did they move to?

practical activity

28

Unit 3

Area of S

tudy 01

practical activity


02Factory facilitators—investigating enzyme activity

materials

• water baths set at 5°C, 20°C and 40°C

• 2 clean test tubes• test tube rack• thermometer• 2 10 mL measuring

cylinders• dropping pipette • white spotting tile with at

least 10 wells• iodine solution• 1% starch solution

– class stock• 1% diastase solution

– class stock• toothpicks

introduction

The cells of living organisms are like tiny factories, each the centre of a great deal of activity, including biochemical reactions that involve the breakdown of some molecules and the construction of others. Enzymes are the biological catalysts that facilitate these biochemical reactions. Without them, critical chemical reactions cannot occur or occur too slowly to maintain the wellbeing of cells, and the cells would die. As well as cellular respiration and photosynthesis, many other life-sustaining biochemical pathways occur in cells. In plant cells, the carbohydrate-reducing enzyme diastase (an amylase) is an important enzyme involved in converting starch in storage organs to simple sugars that can be transported to growing tissue.

purpose

To investigate the activity of the plant enzyme diastase.To investigate the effect of temperature on enzyme activity.


Starch is a complex carbohydrate molecule made up of many glucose molecules (single sugars) joined together by chemical bonds. Starch stains a deep blue-black colour when mixed with iodine solution. Glucose and other simple sugars are not affected by iodine solution and so remain the brown colour of the iodine solution.Diastase is a plant amylase, an enzyme that hydrolyses (breaks by the addition of water) the chemical bonds between the glucose units in starch (Figure 3.31).This activity makes the best use of the time available when working in groups, with each group selecting a different temperature to test the diastase activity. Results for the different groups then can be shared and collated at the end of the experiment. Your teacher will help you organise your groups.It will be useful to have the water baths set at the required temperatures prior to the commencement of class.

diastase

separate glucose moleculespart of starch molecules

diastase

Figure 3.31

Effect of diastase on starch.

procedure

1 Use the measuring cylinder to collect 5 mL of starch solution and pour it into one of the clean test tubes. Place the test tube in the test tube rack. Use the second measuring cylinder to collect 5 mL of diastase solution. Pour this into the other test tube and place the test tube in the test tube rack.

practical activity

29

Unit 3

Area of S



2 Check the temperature of the water in your water bath using the thermometer. Record the water temperature assigned to your group at the top of Table 3.6. If the water is at the required temperature, place the test tube rack in water. Allow 5 minutes for the solutions to adjust to the temperature of the water bath. While you are waiting, go on to the next step.

3 Use the marker pen to label the wells on the spotting tile. Mark the first two wells with the letters ‘D’ (diastase) and ‘S’ (starch) respectively. Then mark the remaining wells with the numbers 1 to 8. Place a drop of iodine solution into each well.

4 Use the dropping pipette to take a sample of the diastase solution. Place a drop into the first well. Record the colour observed in Table 3.5. Thoroughly rinse the pipette before repeating this procedure with the starch solution in the second well. Be sure to thoroughly rinse the pipette each time you use it.

5 After 5 minutes, quickly pour the contents of one test tube into the other, shake to mix and then return the tube to the water bath. Note the time, and then use the pipette to pick some of the starch/diastase mixture and place a drop into well no. 1on your spotting tile. Use a toothpick to mix the solutions in the well. Record your observations in Table 3.6.

6 After 60 seconds, take another drop of the starch/diastase solution and place it in well no. 2. Use a fresh toothpick to mix the solutions. Record your results. Repeat this procedure every minute until no further colour changes are observed.

7 Dispose of the solutions and equipment as directed by your teacher.

8 Use an overhead projector to pool the class data. Enter the data from the different groups in your class into Table 3.7.

1 Suggest why it is important to test the starch solution and the diastase solution with the iodine at the start of this activity.

2 Why is it important to use a fresh pipette each time you test the starch/diastase mixture?

3 Suggest a hypothesis being tested in this activity.

4 Look carefully at the class data. Use your knowledge and understanding of enzymes to explain the results obtained at:

a 0 C

b 20 C

c 40 C

Table 3.5 Colour resultsSolution Iodine

Starch

Diastase

Table 3.6 Observation of colour changes at __ CStarch/diastase solution

with iodineTime(min)

Colour

0

1

2

3

4

5

6

7

8

9

10

Table 3.7 Class data

Group Start End

0 C

20 C

40 C

practical activity

30

Unit 3

Area of S

tudy 01

practical activity


conclusions

5 Write a sentence that summarises the action of the enzyme diastase.

6 Referring to the experimental data in this activity, outline an environmental factor that appears to affect enzyme activity. Describe the evidence that supports your conclusion.

practical activity

31

Unit 3

Area of S



03Tracking photosynthesis—energy conversions in plants

introduction

Green plants are remarkable for their ability to harness light energy and then use it to convert simple inorganic compounds into energy-rich organic compounds. They do this using the process of photosynthesis (‘photo’: light; ‘synthesis’: to make). The products of photosynthesis are utilised in different ways by plants. Some of the glucose formed may be converted to starch for storage; some is transported to other parts of the plant, e.g. growing tissue, where energy is required. Oxygen produced as a by-product of photosynthesis is recycled in the process of cellular respiration. Excess oxygen is released to the atmosphere via the stomata, where it becomes available to other organisms that also need oxygen for cellular respiration.Iodine solution is a standard indicator used to test for the presence of starch. Iodine, typically a dark yellow/brown, colour turns blue-black in the presence of starch.

purpose

To design and carry out a simple experiment to test the hypothesis that ‘green plant tissue produces starch when exposed to light’.

procedure

Use the materials listed to write your own ‘recipe’ that other students could easily follow, to test the hypothesis that ‘green plant tissue produces starch when exposed to light’.

1 Write your experimental procedure in step-by-step format with clear instructions.

2 When you have completed your experimental design, check it with your teacher before setting out to follow your own instructions to undertake the activity.

Experimental designA

materials

• small pot plant with broad green leaves, e.g. geranium

• light source• tin foil• iodine solution• paper towel• fine scissors• fine forceps

practical activity

32

Unit 3

Area of S

tudy 01

practical activity


Running the recipe

1 Collect the materials you need to set up this activity.

2 Carry out your experiment.

3 Evaluate the experimental method you designed.

1 a Discuss the limitations you encountered.

b How would you refine your procedure?

2 a Describe the results of your experiment. Use diagrams of leaves to illustrate your results.

b Account for the results that you obtained.

procedure

B

conclusion

3 Explain whether your experimental results support or negate the hypothesis.

33

Unit 3

Area of S

tudy 01sample assessment task


01

SERUM AMINO ACIDS PROTEOMIC PATTERN

MASS SPECTROSCOPY

1 2 3 4 5 6 7 AMINOACIDS

SE

RU

M L

EV

EL

OF

AM

INO

AC

ID

• array of amino acids in serum binds to specific recognition sites on protein chip

relative proportionsof various amino acidsconverted tographical data

PROTEIN CHIP

Figure 3.32

Preparation of blood sample for mass spectroscopy analysis.

using a technique called Tandem Mass Spectroscopy (TMS). Infants diagnosed with PKU are placed on a special diet free of phenylalanine, usually for the rest of their lives, and most importantly, throughout childhood to puberty when brain development is still occurring. This means a strictly vegetarian diet—no meat or animal products including milk, butter, yoghurt, cheese or eggs, as these are sources of phenylalanine. Since many food items such as bread and pasta are processed using animal products such as milk and eggs, PKU patients must have specially prepared foods to ensure no dietary intake of phenylalanine.

The amino acid tyrosine is further metabolised in the body through a biochemical pathway that involves the enzyme tyrosinase. Tyrosinase acts on tyrosine to produce melanin, the pigment that gives skin its varying degrees of colour. When no melanin is produced, the skin, hair and eyes are characteristically pale.

purpose

To investigate the use of mass spectroscopy in the diagnosis of a medical condition.

To explore the implications of enzyme deficiencies in protein metabolism.

outcomes


assessment task

A summary report of a practical activity related to a biochemical process.


An average of one in 12 000 Australians has phenylketonuria (PKU). PKU is a genetic condition caused by the absence of an important biomolecule, phenylalanine hydroxylase. This enzyme has a critical role to play in the metabolism of proteins—converting the amino acid phenylalanine to tyrosine. In the absence of phenylalanine hydroxylase, tyrosine is not formed. Instead, phenylalanine accumulates in the blood and tissues of the body. Too much phenylalanine interferes with normal development from birth to adolescence, resulting in brain damage. All babies in Australia are routinely screened for PKU a few days after birth using the Guthrie test, more commonly called the ‘heel prick’ test. In this test, a sample of blood is taken from the baby, usually from the heel, and tested for the levels of the amino acids phenylalanine and tyrosine,

Absent enzymes—phenylketonuria and albinism

34

Unit 3

Area of S

tudy 01

sample assessment task


Proteomic patterns and disease diagnosis—Tandem Mass Spectroscopy (TMS)Proteomics is the study of the proteins produced by an organism and includes the structure, function and interactions of the proteins. Tandem Mass Spectroscopy, one of the techniques available to analyse these proteins, is used to sort different kinds of molecules according to their weight. In this case, the resulting proteomic pattern reveals differences between the levels of the amino acids phenylalanine and tyrosine.

In the Guthrie test, a blood sample to be analysed by TMS is the ‘sample data’. The proteomic pattern for the sample data is compared to standard data for ‘normal’ blood proteins.

The pattern of proteins present can be presented graphically. Analysis of the pattern of peaks provides information useful in making a diagnosis. During TMS, all the different amino acids present in the blood serum are separated according to weight. Bioinformatic software is used to manipulate the data into graphical form. The graphs below include only the data relevant to phenylalanine and tyrosine.

1 Describe the proteomic pattern for the amino acids phenylalanine and tyrosine for an individual with normal protein production.

2 How does the sample data shown compare with the standard in this case?

3 What does the data reveal about the infant to whom the sample data belongs?

4 Use the graphical data and your understanding of enzymes to account for the different blood serum levels of the amino acids phenylalanine and tyrosine in:

a the individual represented by the standard.

b the individual identified with PKU.

AMINO ACIDS

BLOODSERUMLEVEL

OF AMINOACIDS

PHENYLALA

NINE

TYROSIN

E AMINO ACIDS

BLOODSERUMLEVEL

OF AMINOACIDS

PHENYLALA

NINE

TYROSIN

E

Graph A: Standard data Graph B: Sample data

Figure 3.33

Graphs comparing standard data and sample data for amino acids phenylalanine and tyrosine.

35

Unit 3

Area of S



Double-take enzymesLook carefully at the flowchart illustrating the biochemical pathways involved in the metabolism of the amino acids phenylalanine and tyrosine.

5 What kind of biomolecule is:

a phenylalanine:

b phenylalanine hydroxylase:

c tyrosine:

d tyrosinase:

6 Outline the importance of these biomolecules in normal body functioning.

7 The flowchart clearly indicates that PKU patients do not convert phenylalanine to tyrosine. Despite this, PKU patients are not necessarily albino. Explain why this is so.

8 Outline the health implications for a person born with albinism.

9 Suggest lifestyle strategies that will be important to an albino to minimise health risks related to their condition.

DIETARY PROTEIN

digested to

PHENYLALANINE

no phenylalaninehydroxylase

phenylalaninehydroxylaseproduced

TYROSINE

accumulationof phenylalanineor phenylpyruvic

acid

PHENYLKETONURIA

notyrosinase

tyrosinaseproduced

ALBINISM MELANIN

• brain damage if not under dietary management

• lack of pigment in skin, eyes, hair | pale appearance

• variations in depth / shade of skin, hair, eye colour

Figure 3.34

Flowchart of biochemical pathways—phenylalanine, tyrosine.

36

Unit 3

Area of S

tudy 01



summary report

10 Write a report summarising the key points addressed in this activity. Include a discussion of the following in your report:

a The metabolic pathways important in the normal functioning of the body in relation to the amino acids phenylalanine and tyrosine, including:

• the enzymes that catalyse the various reactions • the consequences of enzyme deficiencies • technologies used to make diagnoses • management strategies for affected individuals.

b The importance of proteomic pattern analysis in disease diagnostics.

37

Unit 3

Area of S



procedure

1 Set out six sample cups and label them in the following way: 0% NaCl, 0.5% NaCl, 1% NaCl, 2% NaCl, 5% NaCl and 10% NaCl.

2 Cut a number of cores from a fresh potato using a no.6 (or bigger) cork borer. Push the cores out of the borer using the blunt end of a pencil. Trim the ends square and cut twelve 2 cm-long cylinders.

3 Weigh two cylinders using a top-loading balance.

1 Record the mass for the potato cylinders in Table 3.8.

4 Place the first two potato cylinders in the sample cup labelled 0% NaCl.

5 Repeat this process for each of the sample cups in order.

6 Note the time, then fill each cup to the same depth with the respective NaCl solutions.

7 After 30 minutes, remove the potato cylinders from the 0% NaCl solution using a dissecting needle. Place them on paper towel. Gently roll the potato cylinders against the paper towel to absorb excess surface water, then quickly move them to the balance for weighing. After weighing the cylinders, return them to the cup.

2 Record their final mass.

8 Repeat this drying and weighing process for the cylinders in each of the different NaCl solutions. You will need to work rather quickly to minimise the difference in time that the cylinders are exposed to the different solutions.

3 Complete the calculations in Table 3.8 using the formula provided. Note: The change in mass may be negative in some cases.

% change in mass = mass change ( ve or ve) × 100

initial mass

Table 3.8 Change in mass of potato cylinders

% NaCl

0 0.5 1 2 5 10

Initial mass (g)

Final mass (g)

Change in mass (g)

% change in mass

Porous potatoes—osmosis in living cells02

outcome


assessment task

A written report of a practical activity on the movement of substances across membranes.

purpose

To investigate osmosis in living cells.

materials

• 6 30 mL disposable drink sample cups or 100 mLbeakers

• marking pen• dissecting board and scalpel• dissecting needle• paper towel and tissues• cork borer no. 6 (6 mm) or bigger• centimetre ruler• stock solutions of distilled water, and 0.5%, 1%, 2%,

5% and 10% sodium chloride• access to top-loading electronic balance accurate to

two decimal places (0.01 g)• millimetre graph paper• potatoes

38

Unit 3

Area of S

tudy 01



4 Remove a potato cylinder from each cup in turn. Observe the appearance and feel of each. Describe your observations.

5 Use the millimetre paper provided to graph the percentage change in mass of the potato cylinders against the concentration of NaCl. Be sure to label the axes fully and accurately.

6 Which of the cups contained solutions that were:

a less concentrated than the solution in the cells?

b more concentrated than the solution in the cells?

c about the same concentration as the solution in the cells?

7 Use your knowledge of osmosis and cell membranes together with the observations made in this activity to explain what has occurred in the potato cells in each of the sample solutions grouped in 6 . Use diagrams to complement your explanations.

8 Describe two control measures taken in this experimental procedure.

9 What is the variable in this activity?

10 Outline two limitations related to this activity.

Documents

VCE 2 Worksheets