Viral Evolution and Recombination

Embed Size (px)

DESCRIPTION

Viral Evolution and Recombination. Peter Norberg peter.norberg@gu.se. Phylogenetic analysis. Reconstruction of evolutionary history Relationship Distance Common ancestors. Tree of Life. Viruses and Viral Evolution. Viruses are not living organisms! but evolving… - PowerPoint PPT Presentation

Text of Viral Evolution and Recombination

  • Viral Evolution and RecombinationPeter Norbergpeter.norberg@gu.se

  • Phylogenetic analysis Reconstruction of evolutionary history Relationship Distance Common ancestors

  • Tree of Life

  • Viruses and Viral EvolutionViruses are not living organisms!but evolvingGenetic material (DNA or RNA)Need to adapt to their environment!

  • Different representations of phylogenetic trees

  • Bootstrap

    -A way to get statistical significance of a certain topology -Construct several new sequence sets (1000 st.)-A new sequence set is generated by randomly picking of columns from the original set-Apply the phylogenetic algorithm on all sets.-Make one consensus tree from all trees

  • BootstrappingA: AACTTAACCACGCTATCGATGCAATTATATAB: AATTTGACTGCGGTACCGATCCAATTATATAC: AATTTGACTGGGCTACCGATCCAATTATATAD: AACTTAACCGCGCTACTGATCGAATTATATAA: CACCB: TGCTC: TGCTD: CAGCADBC9696ABCD33ACBD11

  • Recombination A powerful genetic mechanism Used by all animals (extremely few exceptions) Beneficial despite the cost of sex Speeds up evolution (up to 10,000 times) Accumulate beneficial mutations Expel deleterious mutations Bacteria through HGTViruses!

  • Recombination

  • Recombination and phylogenyXH

  • Recombination and phylogenyXABCDEFGHIH

  • Phylogenetic networksXABCDEFGHIH

  • Methods for detection of recombinants-Detecting conflicting phylogenetic signals Phylogenetic networks (SplitsTree) Can be due to recombination or homoplasy

  • Phylogenetic network

  • Methods for detection of recombinants-Analyze conflicting phylogenetic signals, recombination vs homoplasy, and define breakpointsBootscan (SimPlot)Similarity plots (SimPlot)Statistical tests (phi-test)RDP, Geneconv, MaxChi, Chimaera, SisScan, 3Sec, LARD, Topal, . (RDP)

  • Bootscan

    *********