LETTER TO THE EDITOR

Mutations in MYH9 Exons 1, 16, 26, and 30 Are InfrequentlyFound in Japanese Patients with Nonsyndromic Deafness

Shinji Kunishima,1 Tatsuo Matsunaga,2 Yoshimi Ito,1 and Hidehiko Saito3

Mutations in MYH9 result in the autosomal dominant giant platelet disorders with leukocyte inclusion bodieswith varying degrees of Alport manifestations, including nephritis, deafness, and cataracts. A specific MYH9mutation in exon 16, R705H, causes nonsyndromic deafness DFNA17. We searched for mutations in MYH9exons 1, 16, 26, and 30 in a total of 157 Japanese patients with nonsyndromic deafness without known cause ofhearing loss, but no mutations were found. We conclude that mutations in MYH9 are infrequently found inpatients with nonsyndromic deafness and suggest that MYH9 mutations infrequently cause isolated sensori-neural hearing loss. Thus, MYH9 may not currently be a good candidate gene for efficient screening of geneticcauses in nonsyndromic deafness.

Introduction

MYH9 encodes a nonmuscle myosin heavy chain IIA(NMMHC-IIA) and is expressed in many different tis-

sues, including blood cells, kidney, and cochlea (Simons et al.,1991; Toothaker et al., 1991; D’Apolito et al., 2002). NMMHC-IIA is a component of the hexameric myosin molecule, whichbinds actin, has ATPase activity, and is required for motoractivity (Sellers, 2000). Mutations in MYH9 result in the au-tosomal dominant giant platelet disorders with leukocyteinclusion bodies with varying degrees of Alport manifesta-tions, including nephritis, deafness, and cataracts (Kelley et al.,2000; The May-Hegglin=Fechtner Syndrome Consortium,2000; Kunishima et al., 2001a). These disorders include May-Hegglin anomaly (OMIM 15100), Sebastian syndrome(OMIM 605249), Fechtner syndrome (OMIM 153640), andEpstein syndrome (OMIM 153650), and were recently re-classified as MYH9 disorders (Heath et al., 2001; Kunishimaet al., 2001b; Seri et al., 2003). In these disorders an MYH9mutation is always associated with giant platelets and leu-kocyte inclusion bodies from birth, but it does not predict thedevelopment of Alport manifestations (Pecci et al., 2008).

Mutations in MYH9 cause not only classical giant plateletdisorders but also autosomal dominant nonsyndromic deaf-ness, DFNA17 (OMIM 603622) (Lalwani et al., 1997, 1999,2000). The affected family members appear to exhibit senso-rineural hearing loss due to cochleosaccular degenerationwithout any hematological manifestations. The hearing lossbegins at the age of 10 years and involves only the high fre-quencies; by the third decade of life, affected family members

have moderate to severe deafness. Nonsyndromic deafnessaccounts for 70% of hereditary hearing loss in prelingualdeafness, and is a highly genetically heterogeneous group ofdisorder (Van Camp et al., 2009). It is not possible to distin-guish DFNA17 from other nonsyndromic deafness based onclinical features. So far the prevalence of DFNA17 has notbeen evaluated.

Materials and Methods

To investigate the prevalence of MYH9 mutations in non-syndromic deafness, the present study was carried out in atotal of 157 unrelated Japanese patients with nonsyndromicdeafness: 92 patients were sporadic cases and the other 65patients had autosomal dominant family history. Patientswere selected based on the following criteria: (i) patients withbilateral hearing loss without known cause or risk factors fordeafness except for family history; (ii) patients without path-ogenic mutations in the connexin 26 gene (GJB2), and withoutA1555G and A3243G mitochondrial DNA mutations (Okaet al., 1993; Matsunaga et al., 2004, 2006); (iii) patients withonset of hearing loss before age 40 (Pecci et al., 2008); (iv)patients without severe or profound hearing loss before age 6;(v) patients without inner, middle, or external ear anomaly;(vi) only one patient from each family (usually the index pa-tient). Because DFNA17 is associated with MYH9 R705Hmutation in exon 16 (Lalwani et al., 2000) and patients withmutations in exons 1, 16, 26, and 30 often develop high-frequency sensorineural hearing loss (Mhatre et al., 2003;Seri et al., 2003; Pecci et al., 2008), we performed mutational

1Department of Advanced Diagnosis, Clinical Research Center, National Hospital Organization Nagoya Medical Center, Nagoya, Japan.2Laboratory of Auditory Disorders, National Tokyo Medical Center, National Institute of Sensory Organs, Tokyo, Japan.3Nagoya Central Hospital, Nagoya, Japan.

GENETIC TESTING AND MOLECULAR BIOMARKERSVolume 13, Number 5, 2009ª Mary Ann Liebert, Inc.Pp. 705–707DOI: 10.1089=gtmb.2009.0044

705

analysis of these four exons according to previously describedmethods (Kunishima et al., 2001b). Oligonucleotide primersused for polymerase chain reaction are listed in Table 1. Theethics committees of Nagoya Medical Center and NationalTokyo Medical Center approved this study.

Results and Discussion

No mutations were found in MYH9 exons 1, 16, 26, and 30in 157 unrelated Japanese patients with nonsyndromic deaf-ness.

NMMHC-IIA consists of an N-terminal head domain and aC-terminal tail domain that undergo homodimerization toform a coiled-coil rod structure (Sellers, 2000). R705, the mu-tated residue in DFNA17, lies in the SH1 helix in myosin head,a critical segment for ATPase and motile activities (Lalwaniet al., 2000). So far, several mutations located in or near to theSH1 helix encoded by exons 1 and 16 such as S96L, R702C,and R702H have been described in MYH9 disorders (Heathet al., 2001; Kunishima et al., 2001b, 2005, 2007; Seri et al., 2003;Pecci et al., 2008). These mutations are frequently associatedwith sensorineural hearing loss. Based on these observations,we initially searched for mutations in these two exons in pa-tients with nonsyndromic deafness, but no mutations werefound. We extended our mutational analysis to include exons26 and 30, although the association of deafness is less than thatin exons 1 and 16, but no mutations were found.

Recent in vitro expression studies have shown that R702Ccauses a significant impairment in both ATPase and motileactivities, whereas R689H mutation in Dictyostelium myosinII (R689 is the homologous residue to human NMMHC-IIAR705) results in a significant impairment in motile activity butATPase activity is only slightly affected (Hu et al., 2002; Iwaiet al., 2006). Thus, the differences in ATPase activity mightresult in the different phenotypic consequences of the muta-tions; that is, patients with R702C mutation suffer fromhematological abnormalities and Alport manifestations,whereas patients with R705H mutation=DFNA17 do exhibithematological abnormalities. Further studies are necessary toexamine whether R705H mutation indeed develops isolatedhearing loss only.

We conclude that mutations in MYH9 exons 1, 16, 26, and30 are infrequently found in patients with nonsyndromicdeafness and suggest that MYH9 mutations infrequentlycause isolated sensorineural hearing loss. Thus, MYH9 maynot currently be a good candidate gene for efficient screeningof genetic causes in nonsyndromic deafness using conven-tional DNA sequencing. However, identification of DFNA17cases through future mutational screening of MYH9 in non-syndromic deafness will improve our understanding andclassification of nonsyndromic hereditary deafness.

Acknowledgments

This work was supported by grants from the Japan Societyfor the Promotion of Science; The Ministry of Health, Laborand Welfare (Grant for Child Health and Development19C-2); Charitable Trust Laboratory Medicine Foundation ofJapan; Mitsubishi Pharma Research Foundation; and NationalHospital Organization (network research grants for disordersof sensory organs and congenital thrombocytopenia).

Disclosure Statement

No competing financial interests exist.

References

D’Apolito M, Guarnieri V, Boncristiano M, et al. (2002) Cloningof the murine non-muscle myosin heavy chain IIA gene or-tholog of human MYH9 responsible for May-Hegglin, Se-bastian, Fechtner, and Epstein syndromes. Gene 286:215–222.

Heath KE, Campos-Barros A, Toren A, et al. (2001) Nonmusclemyosin heavy chain IIA mutations define a spectrum of au-tosomal dominant macrothrombocytopenias: May-Hegglinanomaly and Fechtner, Sebastian, Epstein, and Alport-likesyndromes. Am J Hum Genet 69:1033–1045.

Hu A, Wang F, Sellers JR (2002) Mutations in human nonmusclemyosin IIA found in patients with May-Hegglin anomaly andFechtner syndrome result in impaired enzymatic function.J Biol Chem 277:46512–46517.

Iwai S, Hanamoto D, Chaen S (2006) A point mutation in theSH1 helix alters elasticity and thermal stability of myosin II.J Biol Chem 281:30736–30744.

Kelley MJ, Jawien W, Ortel TL, et al. (2000) Mutation of MYH9,encoding non-muscle myosin heavy chain A, in May-Hegglinanomaly. Nat Genet 26:106–108.

Kunishima S, Kojima T, Matsushita T, et al. (2001a) Mutations inthe NMMHC-A gene cause autosomal dominant macro-thrombocytopenia with leukocyte inclusions (May-Hegglinanomaly=Sebastian syndrome). Blood 97:1147–1149.

Kunishima S, Matsushita T, Kojima T, et al. (2001b) Identificationof six novel MYH9 mutations and genotype-phenotype rela-tionships in autosomal dominant macrothrombocytopeniawith leukocyte inclusions. J Hum Genet 46:722–729.

Kunishima S, Matsushita T, Shiratsuchi M, et al. (2005) Detectionof unique neutrophil non-muscle myosin heavy chain-A lo-calization by immunofluorescence analysis in MYH9 disorderpresented with macrothrombocytopenia without leukocyteinclusions and deafness. Eur J Haematol 74:1–5.

Kunishima S, Yoshinari M, Nishio H, et al. (2007) Haematolo-gical characteristics of MYH9 disorders due to MYH9 R702mutations. Eur J Haematol 78:220–226.

Lalwani AK, Goldstein JA, Kelley MJ, et al. (2000) Human non-syndromic hereditary deafness DFNA17 is due to a mutationin nonmuscle myosin MYH9. Am J Hum Genet 67:1121–1128.

Table 1. Primers Used for Polymerase Chain Reaction DNA Sequence Analysis of MYH 9 (50> 30)

Exon Sense Antisense Product (bp)

1 GTGATCTTGTGTGGCTGACG CTTCTCAACCAGAGAGCCAG 52716 TTGCCCTGTCAGGTTCATAG CCTCTGGGACTCACTGCAC 27626 CTCTTTGGTCAGGGAAGAGC AGAACCCTGCAACTGCTCTG 32230 ATAACTGGGCAGATCCCTGG TTGCTTTGGACTCAGTGCTTG 438

706 KUNISHIMA ET AL.

Lalwani AK, Linthicum FH, Wilcox ER, et al. (1997) A five-generation family with late-onset progressive hereditaryhearing impairment due to cochleosaccular degeneration.Audiol Neurootol 2:139–154.

Lalwani AK, Luxford WM, Mhatre AN, et al. (1999) A new locusfor nonsyndromic hereditary hearing impairment, DFNA17,maps to chromosome 22 and represents a gene for co-chleosaccular degeneration. Am J Hum Genet 64:318–323.

Matsunaga T, Hirota E, Bito S, et al. (2006) Clinical course ofhearing and language development in GJB2 and non-GJB2deafness following habilitation with hearing aids. AudiolNeurootol 11:59–68.

Matsunaga T, Kumanomido H, Shiroma M, et al. (2004) Deafnessdue to A1555G mitochondrial mutation without use of ami-noglycoside. Laryngoscope 114:1085–1091.

Mhatre AN, Kim Y, Brodie HA, et al. (2003) Macrothrombo-cytopenia and progressive deafness is due to a mutation inMYH9. Otol Neurotol 24:205–209.

Oka Y, Katagiri H, Yazaki Y, et al. (1993) Mitochondrial genemutation in islet-cell-antibody-positive patients who wereinitially non-insulin-dependent diabetics. Lancet 342:527–528.

Pecci A, Panza E, Pujol-Moix N, et al. (2008) Position of non-muscle myosin heavy chain IIA (NMMHC-IIA) mutationspredicts the natural history of MYH9-related disease. HumMutat 29:409–417.

Sellers JR (2000) Myosins: a diverse superfamily. Biochim Bio-phys Acta 1496:3–22.

Seri M, Pecci A, Di Bari F, et al. (2003) MYH9-related disease:May-Hegglin anomaly, Sebastian syndrome, Fechtner syn-drome, and Epstein syndrome are not distinct entities butrepresent a variable expression of a single illness. Medicine(Baltim) 82:203–215.

Simons M, Wang M, McBride OW, et al. (1991) Human non-muscle myosin heavy chains are encoded by two genes lo-cated on different chromosomes. Circ Res 69:530–539.

The May-Hegglin=Fechtner Syndrome Consortium (2000)Mutations in MYH9 result in the May-Hegglin anomaly, andFechtner and Sebastian syndromes. Nature Genet 26:103–105.

Toothaker LE, Gonzalez DA, Tung N, et al. (1991) Cellular my-osin heavy chain in human leukocytes: isolation of 5’ cDNAclones, characterization of the protein, chromosomal localiza-tion, and upregulation during myeloid differentiation. Blood78:1826–1833.

Van Camp G, Smith RJH. March (2009) Hereditary hearingloss homepage. Available at http:==webho1.ua.ac.be=hhh=.Accessed March, 2009.

Address correspondence to:Shinji Kunishima, Ph.D.

Department of Advanced DiagnosisClinical Research Center

National Hospital Organization Nagoya Medical Center4-1-1 Sannomaru

Naka-kuNagoya 4600001

Japan

E-mail: kunishis@nnh.hosp.go.jp

Tatsuo Matsunaga, M.D., Ph.D.Laboratory of Auditory Disorders

National Institute of Sensory OrgansNational Tokyo Medical Center

2-5-1 HigashigaokaMeguro

Tokyo 152-8902Japan

E-mail: matsunagatatsuo@kankakuki.go.jp

INFREQUENT MYH9 MUTATIONS IN NONSYNDROMIC DEAFNESS 707