ORIGINAL PAPER

Peter J. Waniek Æ Ulrike B. Hendgen-Cotta

Pia Stock Æ Christoph Mayer Æ Astrid H. Kollien

Gunter A. Schaub

Serine proteinases of the human body louse (Pediculus humanus):sequence characterization and expression patterns

Received: 29 June 2005 / Accepted: 1 July 2005 / Published online: 7 October 2005� Springer-Verlag 2005

Abstract After the previous characterization of onetrypsin gene (Try1) of the human body louse Pediculushumanus, genes encoding a second trypsin (Try2) and achymotrypsin (Chy1) have been cloned using degenerateserine proteinase primers and 5¢- and 3¢-RACE, andsequenced. The deduced 259 and 267 amino acid se-quences of Try2 and Chy1 show an identity of 33%–40% to trypsinogens and chymotrypsinogens of otherinsects. Considering previously published partial se-quences, P. humanus possesses at least one Try1 gene,five variants/isoforms of Try2 and six variants/isoformsof Chy1. The genomic DNA of Try2 contains three in-trons and Chy1 contains five introns. Using wholemount in situ hybridization, gene expression of Try1,Try2 and Chy1 has been localized not only in the dis-tensible anterior region of the midgut of lice but some-times also in the area following the distensible region.The Try2 gene was always expressed at much lowerlevels than Try1 or Chy1. This lower expression, theconstitutive expression of Try1 and Chy1 at 1, 2, 6, 12and 24 h after feeding of adults and the regional differ-ences have been verified in quantitative real-time PCR.

Introduction

The human body louse, Pediculus humanus, and thehuman head louse, Pediculus capitis, are cosmopolitanectoparasites and have been a hygiene problem forthousands of years (Mumcuoglu and Zias 1988;Mumcuoglu et al. 2003). Additionally, P. humanus is

the vector of three pathogenic bacteria, Rickettsiaprowazekii, Borrelia (syn. Spirochaeta) recurrentis andBartonella (syn. Rickettsia, syn. Rochalimaea) quintana,which cause louse-borne epidemic typhus, relapsingfever and trench fever, respectively (Fulton and Smith1960; Maurin and Raoult 1996; Schaub, 2001; Four-nier et al. 2002). In the United States alone, at least100 million dollars are spent annually on head licecontrol (Jones and English 2003; Hipolito et al. 2001).Mainly, insecticides are used but the appearance ofresistance against pediculocides and their potentialtoxicity to the host (Elgart 1999) necessitates investi-gation into other approaches. One way to controlectoparasites is the immunization of the host againstkey antigens of the parasite, which are usually notinoculated into the host, e.g. digestive enzymes (Eastet al. 1993; Willadsen and Billingsley 1996; Wang andNuttal 1999).

Despite the significance of human lice, knowledgeabout their digestive physiology is weak. In contrast toother blood-sucking insects, lice stay continuously ontheir host and ingest small but frequent blood meals,several times per day. The blood is stored and digestedrapidly in the distensible anterior region of the midgut(Buxton 1947; Lehane 1991). Among haematophagousinsects, lice have the fastest digestion, as they need about4 h–6 h for a blood meal and, like the majority of theseinsects, they use several alkaline digestive proteases(Lehane 1991, 1994; Vaughan and Azad 1993). In en-zyme assays, only a trypsin and a leucine aminopepti-dase have been discovered, the latter having beenpartially purified and characterized (Borovsky andSchlein 1988; Ochanda et al. 1998, 2000).

At the molecular level, an analysis of a cDNA libraryshowed 40 clones of 115–810 bp representing putativedigestion-associated proteins (Pedra et al. 2003). Twoclones belong to ATP-dependent peptidases (414 and712 bp), one clone of 728 bp to a cysteine endopepti-dase, one clone of 754 bp to a cathepsin-like cysteineproteinase, 12 clones to trypsin (533–810 bp) and 22clones to chymotrypsin (115–806 bp); two other clones

P. J. Waniek Æ U. B. Hendgen-Cotta Æ P. Stock Æ C. MayerA. H. Kollien Æ G. A. Schaub (&)Department of Special Zoology, Ruhr-University,44780 Bochum, GermanyE-mail: guenter.schaub@rub.deTel.: +49-234-3224587Fax: +49-234-3214787

Parasitol Res (2005) 97: 486–500DOI 10.1007/s00436-005-1463-y

of 691 and 710 bp were classified to belong to differentserine proteinases. In a parallel investigation of trypsinsand chymotrypsins of P. humanus, one 759 bp sequenceencoding one trypsin-like proteinase (Try1) had beencompletely sequenced and characterized (Kollien et al.2004a).

Serine proteinases are a superfamily of proteins withvarious functions and a widespread occurrence in viru-ses, bacteria and eukaryotes (Kraut 1977; Rawlings andBarrett 1994). This family includes many different en-zymes, e.g. trypsin, chymotrypsin, subtilisin and serinecarboxypeptidase (Rawlings and Barrett 1994). Onecharacteristic of serine proteinases is the active triadformed by His, Asp and Ser (Rawlings and Barrett1994). In addition, vertebrate trypsins and chymotryp-sins have eight Cys residues for the formation of disul-phide bridges, whereas in invertebrates these enzymespossess only three bridges formed by six cysteine resi-dues (Davis et al. 1985). The surface of the substrate-binding pocket is made up by three amino acid residues,Asp, Gly and Gly for trypsins and mainly Ser, Gly andGly for chymotrypsin (Kraut 1977; Hedstrom, 2002).The amino acid residue at the bottom of the substrate-binding pocket, the Asp of trypsin, which is replaced bySer in chymotrypsin (Kraut 1977; Lehane et al. 1998;Zhu and Baker 2000) causes the difference in the sub-strate specifity of both proteinases. Whereas trypsinspreferentially hydrolyze peptide bonds following a lysineor an arginine, chymotrypsins cleave after aromaticamino acid residues (Kraut 1977).

Often trypsins together with chymotrypsins are in-volved in protein digestion (Zhu and Baker 2000; Ra-malho-Ortigao et al. 2003). They are the most abundantdigestive proteases in several Lepidoptera, Coleoptera,Siphonaptera and blood sucking Diptera (Noriega et al.1996; Gaines et al. 1999; Zhu and Baker 2000; Yan et al.2001; Hegedus et al. 2003). Other important tasks arereorganization of proteins during developmental pro-cesses of insects and proenzyme activation cleavage(Indrasith et al. 1988; Hong and Hashimoto 1996; Jiet al. 2004). The proenzyme of trypsin is mainly acti-vated by a tryptic cleavage (Davis et al. 1985). However,an unusual activation by an enzyme with chymotrypticactivity was verified for Try1 of P. humanus (Kollienet al. 2004a). Therefore, we focussed on chymotrypsin,initially in parallel with the investigation of Pedra et al.(2003), but then considering their sequences. In thepresent study, we have completely sequenced the cDNAencoding a second trypsin-like and a chymotrypsin-likeproteinase and their respective genomic DNA. In addi-tion, we have localized the site of expression in themidgut using whole mount in situ hybridization. By real-time PCR, we have characterized the expression levels inunfed first instars and in adult lice at different times afterfeeding. Thereby, we showed for the first time that notonly the distensible anterior region of the midgut of licebut also the subsequent part of the narrow posteriorregion is engaged in the digestion of blood via trypsinsand chymotrypsins.

Materials and methods

Insects

Pediculus humanus were obtained from the Umweltb-undesamt Berlin. This strain is adapted to feeding onrabbits (Culpepper 1948) and reared at 31±1�C and70%–80% relative humidity and on a 1/23 h light/darkcycle (Habedank and Schrader 2001). In Bochum, theselice were maintained at 26±1�C, 60%–70% relativehumidity and 18/6 h light/dark cycle and were fed daily,except the weekends, on the arm of volunteers. Firstinstar larvae were collected after hatching and adult liceat different times after feeding. All were killed byimmersion in liquid nitrogen and stored at �80�C.

RNA and genomic DNA isolation

Total RNA was isolated from P. humanus homogenatesusing the RNeasy� Mini Kit (Qiagen, Hilden, Germany)following the manufacturer’s protocol. One adult louseor 20 unfed first instars weighed about 1 mg and con-tained an average amount of 10 ng polyA+ mRNA(Kollien et al. 2004a). Genomic DNA of unfed first in-star larvae was isolated using the Genomic DNA Puri-fication kit (Fermentas, St. Leon-Rot, Germany)following the manufacturer’s protocol.

Primer selection, PCR, cloning and sequencing

The following degenerate primers were designedaccording to the amino acid residues flanking the His andSer of the active site of serine proteinases (Sakanari et al.1989; Elvin et al. 1993): SP-F (5¢-TGGGT(A/C/G/T)GT(A/C/G/T)AC(A/C/G/T)GC(A/C/G/T)GC(A/C/G/T)CA(T/C)TG-3¢) and SP-R (5¢-A(A/G)(A/C/G/T)GG(A/C/G/T)CC(A/C/G/T)CC(A/C/G/T)(G/C)(A/T)(A/G)T-C(A/C/G/T)CC-3¢). Details of the PCR amplificationhave been published previously (Kollien et al. 2004b).Only the annealing parameters in a Hybaid (Omni Gene)thermal cycler (Hybaid, Ashford, Middx, UK) differed(54.2, 55.5, 56.9, 58.4, 59.3 and 59.8�C).

To amplify the chymotrypsin sequence the specificoligonucleotides Chy-For1 (5¢-GGATCCATGAAAGGTTTTTTTGCTCTTT-3¢) and Chy-Rev1 (5¢-AAGCTTGTCAGTGTAGTCAGAATTGTC-3¢) weredesigned according to partial sequences published byPedra et al. (2003), including BamHI and HindIIIrestriction sites. Total RNA, isolated 3 h after feeding,was used as template for the reverse transcription withan oligo-dT18VN primer. The amplified product of thepredicted size, approximately 470 bp, was cloned intopGEM T-Easy vector (Promega, Madison, WI, USA)following the manufacturer’s instructions. Sequenceanalysis by MWG-BIOTECH (Ebersberg, Germany)showed that a chymotrypsin sequence had been cloned.

487

To exclude Try1-cDNA, which contains an EcoRIrestriction site at the positions 373–378 in the cDNAsequence, the PCR product was digested with EcoRI,separated on a 1% agarose-gel, and again a 470 bpfragment was cloned (Kollien et al. 2004b).

Specific primers for the genes encoding a secondtrypsin and a chymotrypsin were designed based on the5¢- and 3¢-ends of the complete cDNA sequence con-taining BamHI and HindIII restriction sites at the 5¢-and 3¢-end. cDNA and genomic DNA were used astemplates for PCR with the following primers: Try2-F(5¢-GAGCTCATGATTTGTATAAAAATATTTTG-3¢),Try2-R (5¢-AAGCTTTGAATTTTCTTTCATATGCGT-3¢), Chy1-F (5¢-GGATCCATGAAAGGTTTTTTTGCTCTTT-3¢) and Chy1-R (5¢-GGATCCTACTATCCAGAAGCTCCT-3¢), respectively. After PCR withcDNA, fragments of about 800 bp and after PCR withgenomic DNA as template, fragments of about 1 kbwere cloned into pGEM� -T Easy vector (Promega) andsequenced.

5¢- and 3¢-RACE

For the amplification of the 5¢- and 3¢-ends of the genesencoding trypsin and chymotrypsin, 5¢- and 3¢-RACEkits (Invitrogen, Karlsruhe, Germany) were used, fol-lowing the manufacturer’s protocol (Kollien et al.2004b).

Three reverse primers for the amplification of the5¢-end of cDNA encoding Try2 and Chy1 were designedbased on the partial sequence of the respective clonedfragments. Using 5 lg of total RNA as template, thefirst strand synthesis of Try2-cDNA and Chy1-cDNAoccurred with the 5¢-ATATCATGTCGTTTGA-3¢ and5¢-GAATCCAAAACGTTTT-3¢ oligonucleotides, respec-tively. The other two reverse primers for Try2(5¢-GGCCCACAACGGGCAATTCC-3¢, 5¢-CCGCTTCTCATTATTTGTTCCC-3¢) and Chy1 (5¢-AGAACTGGGCTGATGGTTGTG-3¢, 5¢-CCATCCACTGACTCTAGCGG-3¢) were used with a forward abridged anchorprimer and a subsequent PCR with a nested abridgeduniversal amplification primer (AUAP).

For the amplification of the 3¢-end of the P. humanuscDNA encoding Try2 and Chy1, a first strand wassynthesized from 5 lg of total RNA using the adapterprimer of the kit. For the subsequent amplification oftarget cDNA for Try2 the 5¢-GGAATTGCCCGTTGTGGGCC-3¢ forward primer and for Chy1 the 5¢-CTCGAGTACTATCCAGAAGCTCCTCT-3¢ forwardprimer were used with AUAP as the reverse primer. Theresulting products, 516 bp for Try2 and 506 bp forChy1, were cloned into the pGEM-T Easy and se-quenced by MWG-BIOTECH (Kollien et al. 2004b).

Since the data of Pedra et al. (2003) indicated theexistence of a third trypsin gene, the specific primersused for the 5¢-RACE, Try3-1 (5¢-GGCCAATTTATTATTC-3¢), Try3-2 (5¢-CCCCACTGTCTCCCACGCAA-3¢) and Try3-3 (5¢-GGCCCACAACGGGCAA

TTCC-3¢), and for the 3¢-RACE (Try3-4 (5¢-CAGTGTAGAACAATGAAATACAAAG-3¢) were de-signed according to the sequence of the CB887073 clone(Pedra et al. 2003).

Sequence and identity analysis

Sequences were aligned and analyzed using Clustal W,Version 1.83 (Thompson et al. 1994). The GenBankdatabase was searched using the BLAST-X utility (Altschulet al. 1990). Analysis of the sequence of P. humanusserine proteinase genes was performed using the BLAST-X

v.2.1.1 program (Altschul et al. 1997) and comparing itwith the non-redundant database. In order to calculateits identity with other serine proteinases, complete se-quences of trypsin- and chymotrypsin-like proteinaseswere obtained from the database available at the NCBIwebsite. The deduced amino acid sequences were ana-lyzed using http://www.expasy.org/tools.

Phylogenetic analysis

For the phylogenetic trees, additional sequences wereadded to the trypsin and chymotrypsin data set. Thesequences were again aligned using Clustal W and slightcorrections were made by eye. The highly variable N-and C-terminal regions of the deduced amino acid se-quences, which could not be aligned unambiguously,were excluded, i.e. positions 1–47 and 284-end in thetrypsin and positions 1–62 and 308-end in the chymo-trypsin alignment. The final trypsin and chymotrypsindata sets contained 240 and 250 amino acid residues, ofwhich 35 and 20 were invariable, respectively.

In a phylogenetic analysis of a small set of taxa, as inthe present investigation, best results are expected froma tree reconstruction method based on maximum like-lihood (ML). Therefore, in a first step, the trypsin andchymotrypsin alignments were analyzed with ProtTest1.2.7 (Guindon and Gascuel 2003; Abascal et al. 2005)to determine an appropriate model of amino acid sub-stitutions and to test the influence of invariable sites andrate heterogeneity (assuming a gamma distribution) onthe model. The phylogenetic analysis was then carriedout in a second step using the ProML program withinthe PHYLIP package, Version 3.63 (Felsenstein 1989,2004). Finally, a non-parametric bootstrap analysis wasperformed to estimate the uncertainty due to samplingerrors in our data sets. The bootstrap replicate sequences(100 replicates) were computed and analyzed with theSeqBoot, ProML, and Consense programs withinPHYLIP 3.63.

Comparing the available substitution models inProML, ProTest supported the use of the JTT+Gmodel (Jones et al. 1992) for both alignments, in whichthe +G indicates the use of a gamma distribution todescribe the rate heterogeneity. ProtTest was also usedto estimate the shape parameter a of the gamma distri-

488

bution. Approximating this distribution by eight ratecategories, the estimated values are a=1.03 for thetrypsin and a=1.36 for the chymotrypsin data set.

Whole mount in situ hybridization

The whole mount in situ hybridization for the detectionof RNA in tissues was performed based on the methodof Tautz and Pfeifle (1989) and modifications of Wil-kinson (1992) and adapted by modifications of theperiods of incubation.

Expression of Try1, Try2 and Chy1 was detectedseparately in different midguts using 0.5 lg of therespective antisense mRNA and the respective sensemRNA for control. For the synthesis of RNA probes,the cDNAs encoding Try1, Try2 and Chy1 were clonedinto the pGEM-T Easy vector. These recombinantplasmids were the templates for PCR with M13-F(5¢-GTTTTCCCAGTCACGAC-3¢) and M13-R (5¢-CAGGAAACAGCTATGAC-3¢) oligonucleotides. Theresulting PCR product with amplified SP6- and T7-RNA polymerase promoter sequences was transcribed.The sense and antisense digoxygenin-labeled RNAprobes were produced using the DIG-RNA labeling kit(Boehringer, Mannheim, Germany) following the man-ufacturer’s protocol. These labeled probes were detectedby using an alkaline phosphatase-coupled antibodyagainst digoxygenin and stained with nitrobluetetrazo-liumchloride/5-brom-4-chlor-3-indolyl-phosphate(NBT/BCIP; Roche, Mannheim, Germany) or Fast RedTR/Naphthol (Sigma, Deisenhofen, Germany) in alka-line phosphatase buffer following the manufacturer’sprotocol.

At different times after feeding (2, 4, 6, 12 and 24 h)four guts were dissected at each time: three for theanalysis of each gene and one for the control. However,six and two guts were used 2 h after feeding for Try1 andChy1, respectively, and one gut at 12 and 24 h afterfeeding for Chy1. The contents of whole guts were wa-shed out and the tissues pre-fixed in paraformaldehyde(4% in phosphate buffer, pH 7.5), dehydrated throughan ascending series of ethanols (30%, 50%, and 70%;each 10 min) and stored at �20�C. After rehydration ofthe guts in PBST (127 mM NaCl, 2.7 mM KCl, 25 mMTris, pH 7.5, 0.1% Triton X-100), the tissues wereincubated for 15 min in proteinase K (20 lg/ml) andthen in glycine, washed in phosphate buffer and post-fixed in paraformaldehyde. After pre-hybridization with1 lg of the respective digoxygenin labeled probes at56�C for 2 h and denaturation of the RNA-probes at80�C for 10 min, the hybridization followed at 56�Covernight. After washing with PBST and incubationwith blocking solution (Roche, Mannheim, Germany),the tissues were incubated in anti-DIG antibodies(Roche; 1:2000 in PBST) overnight, washed, stained,examined and photographed in a stereo-microscope SV11 (Zeiss, Jena, Germany) and Color-View imagingsystem (Olympus, Hamburg, Germany).

Quantitative real-time PCR

The expression levels of the genes encoding Try2 andChy1 were analyzed by quantitative real-time PCR usingthe Opticon II Real-Time Cycler (MJ Research, Wal-tham, USA), the QuantiTectTM SYBR� Green real-timePCR kit (Qiagen), total RNA (RNeasy� Mini Kit,Qiagen), specific Try1, Try2 or Chy1 oligonucleotides,55�C annealing temperature and forty cycles. RNAisolated from unfed and fed first instar larvae (2 h afterfeeding) and adult lice 1, 2, 6, 12 and 24 h after feedingwas used. In addition, at 2 h after feeding of adult lice,the distensible and the narrow region of the midgut wereused separately. Since 24 h after feeding the major partof the blood meal is digested and first adults die, theselice were considered as unfed adults. In order to quantifythe absolute amount of mRNA of Try1, Try2 andChy1 at different times after feeding, the fluorescenceintensity of SYBR-Green had to be compared with astandard curve for the absolute quantification of mRNAgenerated with different quantities (10000, 1000, 100, 10,1 and 0.1 pg) of the respective cDNA encoding Try1,Try2 and Chy1 (Meijerink et al. 2001). In the blank noRNA was included as template.

For each amplification, 0.2 lg of total RNA and thefollowing primers were used: RT-Try1-F (5¢-GGTTGTTCTTTCTCTTTGCTTGG-3¢), RT-Try1-R(5¢-ACCATTGTTGAGCATGGCAACAA-3¢); RT-Try2-F (5¢-ACAGTATTTCGCCTACGTGTC-3¢), RT-Try2-R (5¢-TGGTTCGGTAGTTTTTACCAGAG-3¢);RT-Chy1 F (5¢-GTCGTGCTTACGATTCTTCCACAA-3¢), RT-Chy1-R (5¢-GACGGATTTGAAAACGGCGAATC-3¢), RT-Try3-For (5¢-GATGATGATGATGACACGAGCC-3¢) and RT-Try3-Rev (5¢-GGTATCTGTTAACTCCTGTCGG-3¢). Using the samesample of RNA, real-time PCR was repeated three timesunder the same conditions, and the respective mean andstandard deviation were calculated. In addition, themelting points of the PCR products were analyzed(Kollien et al. 2004a).

Results

Characterization of the trypsin 2 and chymotrypsin 1proteinase cDNA

After PCR with the degenerate serine proteinase oligo-nucleotides SP-For and SP-Rev, 5¢- and 3¢-RACE andalignment of the cDNA-fragments, a 875 bp nucleotidesequence encoding a trypsin proteinase was obtainedcontaining 22 bp of putative 5¢ untranslated region,76 bp of 3¢ untranslated region and an open readingframe of 777 bp (Try2; NCBI accession numberAY641572; Fig. 1). The sequence contains a stop codon(TGA) at positions 778–780 and a polyadenylation sig-nal (AATAAA) beginning 31 nucleotides downstream ofthe stop codon. On the genomic DNA level, the se-quence of Try2 (NCBI accession number AY641573)

489

contains three introns with lengths of 162 bp (5¢-GTGAGTTCAAATTATTATTATTATTATTATTATCCTTTATTAATTAAATTTTTTTATATTTATATTTTACCATTTCGTTTCAATCAATTTTATTAATTTTTATAAATTTTTGAAATCAATTTTTTTTTTAATGACTCCACGTAACTAATTAAAAATGTTTAG-3¢), 84 bp(5¢-GTAAGTTTTAATTTTTTTTTGTTTGTTTGTAAAAAAAAAAAAAAATATTAATCGAATGAAATAAATTAATCGATCGATTTGAAG-3¢) and 78 bp (5¢-GTACGAATATCAAATATTTAAATAAACAATTACTAAAAATTTAATTTAATACTAATCGTACAAGTTGATGATTTTTAG-3¢) after positions 55, 227 and 492in the cDNA sequence, respectively (Fig. 1). Accordingto the derived amino acid sequence the pre-proenzymeand the respective mature trypsin contain 259 and 234amino acid residues resulting in theoretical MWs of 28.7and 25.7 kDa, respectively. The putative signal peptidecleavage site in the pre-proenzyme is after Gly21. Aputative four amino acid residue activation peptide iscleaved after Arg25. The positions of amino acid resi-dues forming the active triad and the substrate-bindingpocket and those of the cysteine residues known to formthe three disulphide bridges are indicated in Fig. 1.

When compared with homologues in the GenBankdatabase (BLAST-X using NCBI database), Try2 has anidentity between 33.1% and 39.2% with trypsinogens ofother insects and 39.0% identity to Try1 of P. humanus

(Fig. 2). In the phylogram of several trypsins, in whichthe sequences described in Fig. 2 and five additionalsequences were included before the alignment, theputative Try1 sequence of P. humanus clusters togetherwith those of the four variants/isoforms of Try2 (Fig. 3).The separation of the three groups (Pediculus, Ne-matocera, remaining insects) is only supported by lowbootstrap values. Try1 and Try2 are separated bycomparatively long branches.

After the 5¢- and 3¢-RACE with specific oligonucle-otides, designed to obtain a putative third trypsin, nocDNA fragment could be amplified.

After PCR with specific chymotrypsin oligonucleo-tides, 5¢- and 3¢-RACE and alignment, the chymotrypsingene (Chy1) cDNA had 1005 bp and an open readingframe of 801 bp with 26 and 178 bp of putative 5¢ and 3¢untranslated region, respectively (NCBI accessionnumber AY819730; Fig. 4). The sequence contains astop codon (TAA) at positions 802–804 and two AA-TAAA polyadenylation signal sequences starting 137and 145 nucleotides downstream of the stop codon. Onthe genomic DNA level, the sequence of Chy1 (NCBIaccession number AY822027) contains five introns withlengths of 100 bp (5¢-GTAATTTTCTTTTTTTCTTTTTTTTTTCTGTTTTATTAGTTATTTTGGAAATAATAATTATTATTTTTAATTAATTTTATTTTTATTTTTTTAAATTTAG-3¢), 85 bp (5¢-GTAAGTTATA

Fig. 1 Nucleotide sequence of a trypsin-encoding cDNA (Try2)and its deduced amino acid sequence. The black boxed trianglesindicate the putative signal and activation peptide cleavage sitesafter the Gly21 and Arg25 residue, respectively. Presumed activesite residues (His66, Asp119 and Ser212) are black boxed. Theresidues Asp206, Gly231 and Gly239 determining the substratespecificity are gray shaded. The six Cys residues forming disulphide

bridges are in bold and double underlined. Boxed amino acids andthe deduced nucleotides were used for the design of degenerateprimers for PCR amplification. The putative polyadenylationsignal (AATAAA) is dotted underlined. The insertion sites ofintrons in the genomic nucleotide sequence are marked above thecDNA. The GenBank accession numbers of cDNA and genomicDNA are AY641572 and AY641573, respectively

490

Fig. 2 Alignment of the deduced amino acid sequence of a P.humanus second trypsinogen (Try2) with different insect trypsinprecursors and another P. humanus trypsinogen (Try1). Thealignment was optimized by introducing gaps using CLUSTALW (1.83) multiple sequence alignment program. Identical andsimilar amino acid residues between the P. humanus trypsinogenand other trypsinogens are indicated beneath the alignmentsequences by asterisks and dots, respectively. The boxed aminoacid residue is located at the end of the predicted signal peptide(according to the respective publication or to calculations usingSIGNALP (CBS) program from the ExPASy Proteomics tools, thelatter indicated by # after the species name); the black box indicatesthe end of the predicted activation peptide. If given in the respectivepublication, the conserved catalytic site residues (His (H), Asp (D)and Ser (S)) are in bold and indicated by # above the alignment;

amino acid residues involved in determining enzyme substratespecificity and conserved cysteine residues are gray shaded andindicated by S and Cn above the alignment, respectively, where nmatches pairwise the residues predicting to be involved indisulphide bond formation. The exact position of each of the threeamino acid residues of the substrate-binding pocket given in therespective publication is indicated by the respective number belowthe alignment. After the sequences the percentage identity to P.humanus Try2 is shown. The NCBI GenBank accession numbersfor the analyzed sequences are: Stomoxys calcitrans (Lehane et al.1998; AAC39131), Drosophila melanogaster (EAA46240), Culexpipiens (Shen et al. 2002; AAK67462), Aedes aegypti (AAM34268),Anopheles gambiae (Muller et al. 1995; CAA80512), Bombyx mori(Ikeda et al. 1991; Q07943) and Pediculus humanus (Kollien et al.2004a; AY304498)

Fig. 3 Dendrogram of trypsins from different insect species. Inaddition to sequences used in Fig. 2, the following sequences ofAnopheles gambiae were included: Antryp4, Antryp5, Antryp6(Muller et al. 1995; CAA80515, CAA80514 and CAA80513),

Antryp7 (CAA80516) and one from the NCBI GenBank(EAA15148). Branch labels show the percentage of bootstrapsamples supporting that branch

491

ATTTATATTAATTTTTTTACAAGGTGTACAAAAAAAAATTTATTTATTTATTATTATTATTATATTAAATTACAG-3¢), 89 bp (5¢-GTAGGTTTTTCTTTTTTTTTTAGTATTTAAACTTAATTAATCTATTGTTTATTAAGTTATCATTTTAATGTTTTCTTTTTTTTTGTCAG-3¢), 86 bp (5¢-GTATGTAACTTTTTTTTTTTAATTATTCTTCACCAAAGGAAACATTACTTTGAAAAATTTATTAAATATAAATATATTTTAAATAG-3¢) and 70 bp (5¢-GTAAGTGCTGAAAAATCCATCATAAAATTTCACATTGTTGAAATGGTAATTAATGATTGTTTCATTACAG-3¢) after the positions54, 94, 236, 403 and 636 in the cDNA sequence,respectively (Fig. 4). The deduced pre-proenzyme andthe mature chymotrypsin contain 267 and 232 aminoacid residues resulting in a theoretical MW of 28.6 and24.7 kDa, respectively. The putative signal cleavage sitein the pre-proenzyme is after Ala19 and the putativeactivation cleavage site after an additional 16 amino acidresidues. The positions of amino acid residues formingthe active triad and the substrate-binding pocket andthose of the six cysteine residues known to form disul-phide bridges are indicated in Fig. 4. When comparedwith homologues in the GenBank database, Chy1 has anidentity between 33.5% and 40.3% with other insectchymotrypsinogens (Fig. 5). In the phylogram of several

chymotrypsins, the putative sequences of P. humanuscluster together with those of the coleopteran Phaedoncochleariae and the dipteran Anopheles gambiae(XP315687) (Fig. 6). In addition, different chymotrypsinsequences of a single species occur in different branchesof the tree, e.g. Ae. aegypti (AAL76034) and Ae. aegypti(AAL93243) and Ae. aegypti (AAL85586)/ Ae. aegypti(U56423) or An. gambiae (XP315687) and An. gambiae(S44184)/ An. gambiae (S49129).

Regional expression of the Try1-, Try2- and Chy1-genein the midgut

After staining, the presence of mRNA of Try1, Try2 andChy1 was indicated in the epithelium of the anteriorregion of P. humanus‘ midgut by red precipitate, whichdid not occur if the control sense probes were used(Fig. 7a). Particularly, in the distensible region of themidgut (stomach), a strong reaction was evident(Fig. 7b–d). In the narrow posterior region of the mid-gut, expression was absent or low and then restricted toshort regions following the distensible region. No dif-ferences were obvious 1, 2, 6, 12 and 24 h after feeding.Staining with NBT-BCIP resulted in brown precipitates,

Fig. 4 Nucleotide sequence of a cDNA encoding chymotrypsin(Chy1) and its deduced amino acid sequence. The black boxedtriangles indicate the putative signal and activation cleavage sitesafter the Ala19 and Lys35 residue, respectively. Presumed activesite residues (His75, Asp121 and Ser215) are black boxed. Theresidues (Ser209, Gly240 and Ala247), determining the substratespecificity, are gray shaded. The six Cys residues forming disulphide

bridges are in bold and double underlined. Boxed bases and thededuced amino acid residues were used for the design of degenerateprimers for PCR amplification. The two putative polyadenylationsignals (AATAAA) are dotted underlined. The insertion sites ofintrons in the genomic nucleotide sequence are marked above thecDNA. The GenBank accession numbers of cDNA and genomicDNA are AY819730 and AY822027, respectively

492

indicating a similar distribution of the respective mRNAobserved with Fast-Red staining.

Temporal expression of genes encoding Try1, Try2and Chy1

Using quantitative real-time PCR and the same sampleof total RNA, for three determinations of the transcriptlevel of the respective serine proteinases in the midgut atdifferent times after feeding, the highest and lowest val-ues differed by up to 40% from the mean value. The threeconcentrations showed a standard deviation of 3%–30%of the mean value.

Try1 expression was similarly and significantly lowerin the unfed and fed first instars than in adults and wasconstitutively expressed in adult lice 1, 2, 6, 12 and 24 hafter feeding, at a level of about 2 ng mRNA/lg totalRNA (Fig. 8). Try2 also showed a similarly lowexpression in the unfed and fed first instars. In the adultlice, the maximum expression level was found 2 h afterfeeding followed by a decrease 6 h after feeding. Themean concentrations of Try2 mRNA in the threedeterminations were always below 0.6 ng/lg total RNA.Also Chy1 was expressed at a low level in the unfed andfed first instar larvae, followed by an about twofoldhigher expression 1, 2, 6, 12 and 24 h after feeding in theadult lice. Expression of the three genes in adults 2 h

Fig. 5 Alignment of the deduced amino acid sequence of a P.humanus chymotrypsinogen 1 (Chy1) with different insect chymo-trypsin precursors. The alignment was optimized by introducinggaps using CLUSTAL W (1.83) multiple sequence alignmentprogram. Identical and similar amino acid residues between the P.humanus chymotrypsinogen and other chymotrypsinogens areindicated beneath the alignment sequences by asterisks and dots,respectively. The boxed amino acid residue is located at the end ofthe predicted signal peptide (according to the respective publicationor to calculations using SIGNALP (CBS) program from the ExPASyProteomics tools, the latter indicated by # after the species name);the black box indicates the end of the predicted activation peptide.If given in the respective publication, the conserved catalytic siteresidues (His (H), Asp (D) and Ser (S)) are in bold and indicated by# above the alignment; amino acid residues involved in determining

enzyme substrate specificity and conserved cysteine residues aregray shaded and indicated by S and Cn above the alignment,respectively, where n matches pairwise the residues predicting to beinvolved in disulphide bond formation. The exact position of eachof the three amino acid residues of the substrate-binding pocketgiven in the respective publication is indicated by the respectivenumber below the alignment. After the sequences the percentageidentity to P. humanus Chy1 is shown. The NCBI GenBankaccession numbers for the analyzed sequences are: Rhyzoperthadominica (Zhu and Baker, 2000; AF127088), Aedes aegypti (Jianget al. 1997; U56423), Drosophila melanogaster (AAL49280), Luciliacuprina (U03760), Phaedon cochleariae (Y17904), Anopheles gam-biae (Vizioli et al. 2001; CAA83567), Helicoverpa armigera (Bownet al. 1997; Y12273), Spodoptera frugiperda (AY251276)

493

after feeding was significantly about 35-fold higher inthe anterior than in the posterior region of the gut.

In a comparison of the expression levels of the genes ofthe three enzymes at different dates, the mean concen-trations of Try1 and Try2 were about 12%–46% and78%–97% lower than those ofChy1, respectively (Fig. 8).In melting curve analyses, the PCR products of the ana-lyzed genes of P. humanus had the same melting points.

In real-time PCR carried out with specific oligonu-cleotides of the putative third trypsin, the respectivemRNA could not be detected in unfed first instar larvaeor in adult lice 1, 2, 6, 12 and 24 h after feeding.

Discussion

As serine proteinases have different functions, genefamilies of trypsin and chymotrypsin have been de-

Fig. 6 Dendrogram of chymotrypsins from different insect species.In addition to sequences used in Fig. 4, the following sequences ofAedes aegypti and Anopheles gambiae were included: larval Ae.aegypti chymotrypsin (AAL93243), a putative chymotrypsin-like

serine proteinase (Valenzuela et al. 2002; AAL76034), a chymo-trypsin-like protein (AAL85586) and chymotrypsinogen 1 (S49129)and one from the NCBI GenBank (XP315687). Branch labels showthe percentage of bootstrap samples supporting that branch

Fig. 8 Concentration* of the respective mRNA of Try1 (whitecolumn), Try2 (black column) and Chy1 (gray column) of unfed firstinstars and adult lice at different times after feeding (1, 2, 6, 12 and24 h). *ng mRNA/lg of total RNA

Fig. 7 Whole mount in situhybridization analysis of the gutof P. humanus 12 h after feedingusing sense digoxygenin-labeledRNA for the control (a) anddigoxygenin-labeled Try1 (b),Try2 (c) and Chy1 (d) antisenseRNA. The change of theexpression pattern after theanterior distensible region ofthe midgut is indicated by thetriangle

494

scribed in many insects. In the noctuid moth Mamestraconfigurata and the lesser grain borer Rhyzoperthadominica eight and three genes encoding trypsin wereidentified, respectively (Zhu and Baker 2000; Hegeduset al. 2003). Sequences of seven trypsin-like genes of ablood-sucking crustacean, the salmon louse Lepeopht-heirus salmonis, show high similarities in their nucleo-tides and corresponding amino acid residues, differencesranging from one amino acid residue between trypsintypes 1 and 4 to 18 amino acid residues between types 2and 7 (Johnson et al. 2002). A blood-sucking Diptera,Haematobia irritans exigua, possesses at least four genesencoding trypsin (Elvin et al. 1993). In the malariavector Anopheles gambiae, seven different genes encod-ing trypsins are clustered within 11 kb and two genesencoding chymotrypsins within 6 kb (Muller et al. 1993;Vizioli et al. 2001). In the gut of female Aedes aegyptione constitutively transcribed early trypsin is augmentedby two blood meal-induced late trypsins (Barillas-Muryet al. 1995). Considering chymotrypsins, at least three,three and eight genes are expressed in larvae of theLepidoptera Helicoverpa zea, Agrotis ipsilon and Mam-estra configurata, respectively (Mazumdar-Leighton andBroadway, 2001a; Hegedus et al. 2003). These numbersof trypsin and chymotrypsin encoding genes representonly a minimum number, since more than twenty genesencoding trypsin were identified during genome analysisof the fruit fly Drosophila melanogaster (Wang et al.1999; NCBI GenBank).

Screening of a cDNA library of P. humanus alsoindicated the occurrence of at least four serine protein-ase genes encoding one trypsin, one chymotrypsin andtwo other unclassified serine proteinases (Pedra et al.2003). Since these sequences had not been compared indetail, all serine proteinase sequences described by Pedra

et al. (2003) that of the completely sequenced Try1(Kollien et al. 2004a) and those of the present investi-gation were aligned. In this comparison, the sequencesof Try1, Try2 and Chy1 were grouped with those ofPedra et al. (2003), which were similar. Within the threegroups, replacement of nucleotides was only consideredas relevant if it occurred in at least two clones. Insertionsof single nucleotides in single clones were always clas-sified as sequencing inaccuracies, as were differences upto 20 nucleotides before the ends of the sequences of theclones, where inaccuracies often occur.

Pedra et al. (2003) classified 12 clones as similar to thetrypsin 1 precursor of An. gambiae. Eleven clones weregrouped together and separated from the cloneCB887208. Five of these clones included the start codon,but did not contain the stop codon; two others lackedabout 130 or 200 bp of the 5¢-end, but contained thestop codon. In the alignment, the clone CB887518 con-tained several differences, which would have changed thededuced amino acid sequence completely. Some of theother clones contained only differences at the 3¢-end ofthe sequence, which would have also resulted in a dif-ferent sequence of the deduced amino acid residue.Considering the restrictions specified above, the se-quences described by Pedra et al. (2003) and by Kollienet al. (2004a) are identical, indicating that Try1 is onlypresent as one copy or as identical copies in the genomeof P. humanus. Also clone CB887208, which had beenlisted separately by Pedra et al. (2003) belongs to Try1.Since it is lacking 38 nucleotides within the sequence,causing a shift of the open reading frame and additionalstop codons, it remains to be investigated whether it isan inaccuracy of sequencing or a clone representing apseudogene.

Another clone, CB886962, was classified by Pedraet al. (2003) to be similar to a serine proteinase ofChrysomya bezziana. The sequence did not contain anuntranslated 5¢-region and also parts of the coding re-gions at the 5¢- and 3¢-end were missing. In an alignmentwith 12 sequences of genomic DNA and cDNA from thepresent investigation, this clone was classified as Try2.However, the sequence of clone CB886962 containedone transition at position 666 (numbering according tothe sequence of Try2), which caused a change of theamino acid residue from Leu to Trp. In the alignment ofthis sequence and sequences of clones of Try2 from thepresent investigation, at least two clones showed tran-sitions of nucleotides at 12 positions (Table 1). This re-sulted in a change of six amino acid residues at thepositions 33 from Thr to Ser, at 96 from Val to Thr, at97 from Ile to Thr, at 118 from Phe to Tyr and at 141from Val to Ala. This indicated an occurrence of at leastthree additional variants/isoforms of a trypsin nearlyidentical to Try2.1.

Another sequence described by Pedra et al. (2003),CB887073, had highest similarity to a serine proteinaseof An. gambiae (68% identity of amino acid residues)and, in a recent analysis of the NCBI database, lesssimilarity to a trypsin-like serine proteinase of Apis

Table 1 Nucleotides and amino acid residues (amino acid residuesare included in parentheses; those differing from Try2.1 are in boldand underlined) at specific positions of different Try2 sequences

bp no.a Try2 variants/isoforms

2.1b, c 2.2c 2.3c 2.4c

87 T (G) T (G) G (G) – d

98 C (T) C (T) G ðSÞ –105 C (L) C (L) T (L) –183 A (I) T (I) T (I) T (I)286 G (V) A ðTÞ A ðTÞ A ðTÞ287 T (V) C ðTÞ C ðTÞ C ðTÞ290 T (I) T (I) C ðTÞ C ðTÞ297 T (N) C (N) T (N) C (N)303 A (E) G (E) G (E) G (E)353 T (F) A ðYÞ A ðYÞ A ðYÞ420 A (L) C (L) C (L) A (L)422 T (V) T (V) C ðAÞ T (V)

a Numbering according to the sequence of Try2 in Fig. 1b This sequence has been included in Fig. 1c Five, three, three and two clones possessed this pattern of ex-changes of nucleotides resulting in a classification as Try2.1,Try2.2, Try2.3 and Try2.4d Region not included in the respective clone

495

mellifera (65% identity). The clone possessed the tryp-sin-characteristic initial amino acid residues (Ile-Val-Gly-Gly) and His and Asp of the catalytic triad, butneeded a long gap to be aligned at the C-terminus. In analignment with the other trypsinogens, the identities toTry 1 and Try 2 were 28.3% and 29.9%, respectively.Performing two sets of experiments to search for thisputative third trypsin of P. humanus, no amplificationoccurred in 5¢- and 3¢-RACE, as well as in the real-timeexperiments. This indicates a very low expression levelor an inducible characteristic of this gene and the ab-sence of transcripts under the conditions used in thepresent investigation.

Focussing on the number of chymotrypsin genes, twoof the 22 clones described by Pedra et al. (2003),CB886714 and CB887131, had to be combined to obtaina putative amino acid sequence identical to that of Chy1in the present investigation. Six clones, sequenced byPedra et al. (2003), had single insertions or deletions ofnucleotides, which were classified as inaccuracies. Con-sidering also the four independent clones from thepresent investigation, exchanges in at least two cloneswere evident at the following positions: 19, 234, 351,501, 513, 538 and 678 (numbering according to the se-quence of Chy1; Table 2). The deduced changes ofamino acid residues were the following: at position 7from Leu to Phe and at position 180 from Asn to His.Therefore, P. humanus had at least five very similarvariants/isoforms of Chy1, but only one of them pos-sessing two differences in the deduced amino acid se-quence. Eight clones, which contained the putative 5¢untranslated region, possessed the nucleotides A or T atposition -4. Whereas clones of the variants/isoformsChy1.1 and Chy1.5 all possessed a T at this position,three clones of Chy1.3 possessed the nucleotide A and

one a T. This indicates the existence of at least six genes/alleles of Chy1.

The final number of genes encoding trypsin andchymotrypsin of P. humanus can only be clarified bygenome analyses. The Southern blot technique could behelpful, but the high identity of the respective gDNAwould complicate this analysis.

If the deduced amino acid sequences of P. humanusTry2 and Chy1 are aligned with trypsinogen- andchymotrypsinogen-like serine proteinases of other in-sects, low percentages of identity are evident, indicatingthe high variability of the enzymes. Including sevensimilar insect trypsinogens and eight chymotrypsino-gens, the range of identities of the trypsinogens andchymotrypsinogens are similar from about 33 to 40%(Figs. 2, 5).

In the phylogram of trypsins, three groups are sepa-rated: the trypsins of Nematocera, those of P. humanusand those of the remaining three insects (Fig. 3). How-ever, the bootstrap support for all three groups is quitelow, indicating that the present data set is too small toprovide a reliable distinction of these groups. Interest-ingly, Try1 and Try2 of P. humanus are separated bylong branches, indicating an ancient separation of thecorresponding genes. The situation is more complicatedin the phylogram of chymotrypsins, which shows nosimilarity to the classical phylograms of insect se-quences. Some sequences show lower identities tochymotrypsins of the same species than to those of otherspecies, e.g. chymotrypsins of An. gambiae or Ae. aegypti(Fig. 6). This could be explained if the relationshipamong the chymotrypsins is primarily determined byfunction rather than the phylogenetic relationship ofthese species. The current placement of the two chy-motrypsin isoforms of P. humanus within the tree is stilluncertain as indicated by the low bootstrap values. Amore detailed analysis of the function of respective en-zymes is necessary to clarify whether or not a groupingof the respective serine proteinases is possible accordingto their function.

To avoid self-digestion in vivo, serine proteinases aretranslated as inactive pre-proenzymes. At the site ofaction, which is determined by the signal peptide, thispeptide and the activation peptide are cleaved to obtainthe active enzyme (Davis et al. 1985). Two serine pro-teinases of Stomoxys calcitrans are expressed as pre-proenzymes and cleaved to the mature enzyme in themidgut (Lehane et al. 1998). Also Try2 and Chy1 areexpressed as pre-proenzymes with a signal peptide tocontrol luminal secretion. In insect trypsinogens, signaland activation peptides are in total 25–50 amino acidresidues long (Kollien et al. 2004a) and in chymotryp-sinogens 20–59 amino acid residues (Fig. 5). In Try2 ofP. humanus, the putative signal peptide of 21 amino acidresidues is similar in length to those of other insecttrypsin-like proteinases and is five amino acid residueslonger than in Try1. In Chy1, the length of the signalpeptide of 19 amino acid residues is identical to that ofR. dominica.

Table 2 Nucleotides and amino acid residues (amino acid residuesare included in parentheses; those differing from Chy1.1 are in boldand underlined) at specific positions of different Chy1 sequences

bp no.a Chy1 variants/isoforms

1.1b,c 1.2c 1.3c,d 1.4c 1.5c

19 C (L) C (L) C (L) C (L) T ðFÞ234 C (V) C (V) C (V) T (V) T (V)351 T (T) C (T) C (T) C (T) C (T)501 C (S) G (S) C (S) C (S) G (S)513 C (S) C (S) T (S) T (S) C (S)538 A (N) A (N) A (N) A (N) C ðHÞ538 A (N) A (N) A (N) A (N) C ðHÞ678 A (G) –e T (G) C (G) A (G)

a Numbering according to the sequence of Chy1 in Fig. 4b This sequence has been included in Fig. 4c Eight, one, five, six and seven clones possessed this pattern ofexchanges of nucleotides resulting in a classification as Chy1.1,Chy1.2, Chy1.3, Chy1.4 and Chy1.5; two clones with low numbersof bp contained only the nucleotide C at position no. 19 or 234, andone clone could belong to the variant/isoform 1.3 or 1.4d According to differences in the putative 5¢ untranslated region, atleast two genes of this variant/isoform existe Region not included in the respective clone

496

Activation peptides of eukaryotic trypsinogens are 5–24 amino acid residues long, contain an amino acidresidue with a large side chain (Lys and Arg) at the endand are activated by a tryptic cleavage (Roach et al.1997; Chen et al. 2003). The putative short Try2 acti-vation peptide of four amino acid residues is atypical ofinsect trypsin-like proteinases, which usually possess anactivation peptide of 7–26 amino acid residues (Kollienet al. 2004a), but an activation peptide of five amino acidresidues has been found in the trypsinogen of Xenopus(Roach et al. 1997). The Chy1 activation peptide of 16amino acid residues is slightly shorter in comparison tothose of other insects (Fig. 5). In contrast to Try1, whichis activated by chymotrypsin (Kollien et al. 2004a), Try2and Chy1 contain putative trypsin restriction sites forthe cleavage of the activation peptide after Arg25 andLys35, respectively.

The N-terminal residue of the active serine protein-ases is mainly an Ile, but it may be Leu, Met or Val(Rawlings and Barrett 1994). After cleavage of theactivation peptide, Try1 begins at the N-terminal endwith the deduced amino acid residues Ile-Val-Gly-Gly(Kollien et al. 2004a), Try2 with Ile-Ile-Gly-Gly andChy1 with Val-Val-Gly-Gly.

In the mature enzyme, the catalytic triad of His, Aspand Ser which is characteristic for serine proteinases(Kraut 1977; Rawlings and Barrett 1994; Hedstrom2002) is present in Try2 and Chy1 at the positions 66,119 and 212 and 75, 121 and 215, respectively. Theconsensus sequence Gly-Asp-Ser-Gly-Gly around theactive site Ser, which is usually diagnostic of a serineprotease (Krem et al. 1999) occurs in both sequences.The six cysteine residues that form the disulphidebridges characteristic of invertebrate serine proteinasesare located in the translated cDNAs of P. humanus at thepositions 51, 67, 184 197, 208, 232 in Try2 and 60, 76,187, 201, 211, 241 in Chy1 (Lehane et al. 1998; Zenget al. 2002; Zhu et al. 2003).

Three amino acid residues are important for thesubstrate specifity of trypsins and chymotrypsins. TheAsp located six residues before the catalytic active Ser atthe N-terminus stabilizes the Lys and Arg residues of thesubstrate during catalysis, lies at the bottom of thesubstrate-binding pocket and is conserved in all trypsins(Foissac et al. 2002; Zeng et al. 2002). In chymotrypsinsthis residue is usually occupied by a Ser or Gly (Hegeduset al. 2003). Residues lining the substrate-binding pocketare usually two glycines in trypsin and Gly (or Pro orTyr) and Gly (or Ala, Asp, Asn, Ile or Thr) in chymo-trypsin (Vizioli et al. 2001; Zhu and Baker 2000; Hed-strom 2002). The two amino acid residues lining thesubstrate-binding pocket not only vary between differentchymotrypsins, but also in exact positions in the align-ment (Fig. 5). Try1 in the previous investigation, andalso Try2 of the present investigation, possess the Asp-Gly-Gly residues in the substrate-binding pocket atidentical positions (Fig. 2). At the bottom of the pocket,Chy1 has a Ser in the position 209, and the substrate-binding pocket is lined by Gly and Ala (Fig. 5).

In contrast to cDNA-sequences, genomic sequencesof serine proteinases of insects are rarely published. TheLepidoptera Choristoneura fumiferana and A. ipsiloncontain two and three introns in their genomic trypsinnucleotide sequences, respectively (Wang et al. 1995;Mazumdar-Leighton and Broadway 2001b). In the earlytrypsin of Ae. aegypti, one intron of 64 nucleotidesinterrupts the codon for Val at the end of the signalpeptide (Noriega et al. 1996), but in An. gambiae none ofseven trypsin-related genes contains introns (Muller et al.1993). The genomic nucleotide sequence of P. humanusTry1 possesses three introns that are 104, 81 and 80 bplong. The first one is located also at the end of the signalpeptide, the second one 15 nucleotides after the codon ofHis69 of the catalytic triad and the third one after posi-tion 465 (Kollien et al. 2004a). Try2 also contains threeintrons, 162, 84 and 78 bp long that are located eightnucleotides before the end of the signal peptide, 29 nu-cleotides after the codon of His66 and after position 492.

The genomic nucleotide sequence encoding a chy-motrypsinogen of the lepidopteran H. zea contains fourintrons of 281, 134, 84 and 88 bp, and the respectivegene of Agrotis ipsilon possesses three introns, the largestof 750 bp. In two investigations of the genomic DNA ofchymotrypsinogens of the malaria vector An. gambiae,two introns of 68 and 76 or 65 and 65 bp were found(Mazumdar-Leighton and Broadway, 2001a; Vizioliet al. 2001). The five introns in the genomic DNA of P.humanus encoding Chy1 represent a previously unre-ported phenomenon in insects. All introns of serineproteinase genes of the louse correspond to the con-sensus GT-AG rule of the major-class spliceosomal in-trons (Patel and Steitz 2003).

Focussing on the expression patterns, in investiga-tions of the regional expression of digestive enzymes,Manduca sexta possessed high levels of trypsin mRNAin the central region of the midgut, a lower level in theposterior region and an absence of expression in theanterior region (Peterson et al. 1994). The opaque zoneof the midgut tissue posterior of the distensible reservoirzone contained the highest levels of mRNA of twotrypsinogens in Stomoxys calcitrans (Billingsley andLehane 1996; Lehane et al. 1998). In this publication, theauthors emphasized the difficulties of separating tinyregions to use the mRNA for Northern blots. This dif-ficulty can be overcome by using in situ hybridization(Tautz and Pfeifle 1989). In in situ hybridizations usingparaffin sections, the site of mRNA expression of acarboxypeptidase A of Ae. aegypti could be detected inthe distensible posterior midgut, but not in the anteriormidgut (Edwards et al. 2000). These data support pre-vious investigations of the distribution of digestive en-zymes, e.g. the immunocytochemical localization oftrypsin (Graf et al. 1986). So far, whole mount in situhybridization has not been used to detect the mRNA ofserine proteinases in the gut of a blood-sucking insect.The expression of the serine proteinases of the bodylouse occurred mainly in the anterior distensible regionof the midgut and, sometimes, in a short section of the

497

narrow midgut posterior to the distensible region. Thisexpression pattern indicates a similar strategy of diges-tion to that of mosquitoes, with storage and primarydigestion of proteins in the distensible anterior region ofthe midgut of lice and the distensible but posterior re-gion of midgut of the mosquitoes. In the lice, all threegenes were expressed in the same pattern a short time(1 h) and a longer interval (24 h) after feeding. However,the three-serine proteinase genes of the lice were tran-scribed at different levels. Midguts incubated with Try1and Chy1 probes showed a high level of staining 1 hafter incubation in the Fast-Red solution, whereas dur-ing the staining with Try2 probes, the gut had to beincubated for 3 h in the solution to achieve the sameintensity of staining.

In the present investigation, also quantitative real-time PCR was used for the first time to compare thechanges of the expression level of proteinases of a blood-sucking insect at different time after feeding. Comparingwhole mount in situ hybridization and the real-timePCR, both showed a higher expression of Try1, Try2and Chy1 in the anterior than the posterior region and alower expression level of Try2 in comparison to Try1and Chy1, but the different levels of expression ofTry2 at different times after feeding of adults could beobserved only by quantitative real-time PCR. Using thesame sample of total RNA followed by three separatedamplifications, high standard deviations occurred.However, standard deviations of up to 30% occurredalso in previous investigations (e.g., Lee et al. 2004).Considering this, Try1 and Chy1 are expressed at asimilarly low level in the unfed and fed first instar larvaeand constitutively expressed 1, 2, 6, 12 and 24 h afterfeeding in adult lice. The pattern of Try1 expressioncorresponds to that indicated by a Northern blot anal-ysis in the previous study (Kollien et al. 2004a). Thenon-constitutive expression pattern and the much lowerexpression level of Try2 seem to indicate a different taskof this proteinase in comparison to Try1 and Try2.

These different expression levels of Try1, Try2 andChy1 are confirmed indirectly by the observations ofPedra et al. (2003), who sequenced 11 clones of Try1,one clone of Try2 and 22 clones of Chy1. Therefore,Try1 and Chy1 seem to be mainly digestive enzymes inthe body louse. Further investigations are necessary toclarify whether or not Try2 plays a role in digestionprocesses or has other functions, e.g. in the activation ofthe highly expressed Chy1 or other enzymes.

Acknowledgements The authors thank Mrs. Schrader from theUmweltbundesamt, Berlin for the supply of insects, Prof. Dr. U.Kuck and Prof. Dr. T. Stutzel for their cooperation in using theOpticon II Real-Time Cycler and the microscopical documentationsystem, respectively. We deeply appreciate the helpful suggestionsof Dr. R. Herbst to the real-time PCR technique, HD Dr. S.Poggeler and Dr. A.J. Nisbet, Moredun Research Institute forcorrecting the English style and also critical suggestions on themanuscript. This work was supported by the Ruhr-UniversityBochum by the ‘Anschubfinanzierung fur junge Nachwuchswis-senschaftler’ for A.H.K. and a PhD scholarship of the ‘AllgemeinesPromotionskolleg’ for P.J.W.

References

Abascal F, Zardoya R, Posada D (2005) ProtTest: selection of best-fit models of protein evolution. Bioinformatics (in press)

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990)Basic local alignment search tool. J Mol Biol 215:403–410

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, MillerW, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a newgeneration of protein database search programs. Nucl Acid Res25:3389–3402

Barillas-Mury CV, Noriega FG, Wells MA (1995) Early trypsinactivity is part of the signal transduction system that activatestranscription of the late trypsin gene in the midgut of themosquito, Aedes aegypti. Insect Biochem Mol Biol 25:241–246

Billingsley PF, Lehane MJ (1996) Structure and ultrastructure ofthe insect midgut. In: Lehane MJ, Billingsley PF (eds) Biologyof the insect midgut. Chapman and Hall, London, pp 323–344

Borovsky D, Schlein Y (1988) Quantitative determination oftrypsinlike and chymotrypsinlike enzymes in insects. Arch In-sect Biochem Physiol 8:249–260

Bown DP, Wilkinson HS, Gatehouse JA (1997) Differentiallyregulated inhibitor-sensitive and insensitive protease genes fromthe phytophagous insect pest, Helicoverpa armigera, are mem-bers of complex multigene families. Insect Biochem Mol Biol27:625–638

Buxton PA (1947) The louse. Edward Arnold, LondonCasu RE, Pearson RD, Jarmey JM, Cadogan LC, Riding GA,

Tellam RL (1994) Excretory/secretory chymotrypsin from Lu-cilia cuprina: purification, enzymatic specificity and amino acidsequence deduced from mRNA. Insect Mol Biol 3:201–211

Chen J-M, Kukor Z, Le Marechal C, Toth M, Tsakiris L, Rag-uenes O, Ferec C, Sahin-Toth M (2003) Evolution of trypsin-ogen activation peptides. Mol Biol Evol 20:1767–1777

Culpepper GH (1948) Rearing and maintaining a laboratory col-ony of body lice on rabbits. Am J Trop Med Hyg 28:499–504

Davis CA, Riddell DC, Higgins MJ, Holden JJA, White BN (1985)A gene family in Drosophila melanogaster coding for trypsin-like enzymes. Nucl Acid Res 13:6605–6619

East IJ, Fitzgerald CJ, Pearson RD, Donaldson RA, Vuocolo T,Cadogan LC, Tellam RL, Eisemann CH (1993) Lucilia cuprina:inhibition of larval growth induced by immunization of hostsheep with extracts of larval peritrophic membrane. Int JParasitol 23:221–229

Edwards MJ, Moskalyk LA, Donelly-Doman M, Vlaskova M,Noriega FG, Walker VK, Jacobs-Lorena M (2000) Character-ization of a carboxypeptidase A gene from the mosquito, Aedesaegypti. Insect Mol Biol 9:33–38

Elgart ML (1999) Current treatments for scabies and pediculosis.Skin Therapy Lett 5:1–8

Elvin CM, Whan V, Riddles PW (1993) A family of serine proteasegenes expressed in adult buffalo fly (Haematobia irritans ex-igua). Mol Gen Genet 240:132–139

Felsenstein J (1989) PHYLIP - Phylogeny Inference Package(Version 3.2). Cladistics 5:164–166

Felsenstein J (2004) PHYLIP (Phylogeny Inference Package),Version 3.6. Department of Genome Sciences, University ofWashington, Seattle

Foissac X, Edwards MG, Du JP, Gatehouse AMR, Gatehouse JA(2002) Putative protein digestion in a sap-sucking homopteranplant pest (rice brown plant hopper; Nilaparvata lugens: Delp-hacidae)—identification of trypsin-like and cathepsin B-likeproteases. Insect Biochem Mol Biol 32:967–978

Fournier P-E, Ndihokubwayo J-B, Guidran J, Kelly PJ, Raoult D(2002) Human pathogens in body and head lice. Emerg InfectDis 8:1515–1518

Fulton JD, Smith PJC (1960) Carbohydrate metabolism in Spiro-chaeta recurrentis. Biochem J 76:491–499

Gaines PJ, Sampson CM, Rushlow KE, Stiegler GL (1999) Clon-ing of a family of serine protease genes from the cat flea Cte-nocephalides felis. Insect Mol Biol 8:11–22

498

Graf R, Raikhel AS, Brown MR, Lea AO, Briegel H (1986)Mosquito trypsin: immunocytochemical localization in themidgut of blood-fed Aedes aegypti (L.). Cell Tissue Res 245:19–27

Guindon S, Gascuel O (2003) A simple, fast, and accurate algo-rithm to estimate large phylogenies by maximum likelihood.Syst Biol 52:696–704

Habedank B, Schrader G (2001) Evaluation of nutrition mediaderived from human blood transfusion units DFP, EC and BCfor the in vitro feeding of Pediculus humanus corporis (Anopl-ura: Pediculidae). Altex 18:170

Hedstrom L (2002) Serine protease mechanism and specifity. ChemRev 102:4501–4523

Hegedus D, Baldwin D, O’Grady M, Braun L, Gleddie S, SharpeA, Lydiate D, Erlandson M (2003) Midgut proteases fromMamestra configurata (Lepidoptera: Noctuidae) larvae: char-acterization, cDNA cloning, and expressed sequence tag anal-ysis. Arch Insect Biochem Physiol 53:30–47

Hipolito RB, Mallorca FG, Zuniga-Macaraig ZO, Apolinario PC,Wheeler-Sherman J (2001) Head lice infestation: single drugversus combination therapy with one percent permethrin andtrimethoprim/sulfamethoxazole. Pediatrics 107:30–34

Hong CC, Hashimoto C (1996) The maternal nudel protein ofDrosophila has two distinct roles important for embryogenesis.Genetics 143:1653–1661

Ikeda M, Yaginuma T, Kobayashi M, Yamashita O (1991) cDNAcloning, sequencing and temporal expression of the proteaseresponsible for vittelin degradation in the silkworm, Bombyxmori. Comp Biochem Physiol B 99:405–411

Indrasith LS, Sasaki T, Yamashita O (1988) A unique proteaseresponsible for selective degradation of a yolk protein inBombyx mori. J Biol Chem 263:1045–1051

Ji C, Wang Y, Guo X, Hartson S, Jiang H (2004) A pattern rec-ognition serine proteinase triggers the prophenoloxidase acti-vation cascade in the tobacco hornworm, Maduca sexta. J BiolChem 279:34101–34106

Jiang Q, Hall M, Noriega FG, Wells M (1997) cDNA cloning andpattern of expression of an adult, female-specific chymotrypsinfrom Aedes aegypti midgut. Insect Biochem Mol Biol 27:283–289

Johnson SC, Ewart KV, Osborne JA, Delage D, Ross NW, MurrayHM (2002) Molecular cloning of trypsin cDNAs and trypsingene expression in the salmon louse Lepeophtheirus salmonis(Copepoda: Caligidae). Parasitol Res 88:789–796

Jones DT, Taylor WR, Thornton JM (1992) The rapid generationof mutation data matrices from protein sequences. Comp ApplBiosci 8:275–282

Jones KN, English JC (2003) Review of common therapeutic op-tions in the United States for the treatment of Pediculosis ca-pitis. Clin Infect Dis 36:1355–1361

Kollien AH, Waniek PJ, Prols F, Habedank B, Schaub GA (2004a)Cloning and characterization of a trypsin-encoding cDNA ofthe human body louse Pediculus humanus. Insect Mol Biol 13:9–18

Kollien AH, Waniek PJ, Nisbet AJ, Billingsley PF, Schaub GA(2004b) Activity and sequence characterization of two cysteineproteases in the digestive tract of the reduviid bug Triatomainfestans. Insect Mol Biol 13:569–579

Kraut J (1977) Serine proteases: structure and mechanism ofcatalysis. Annu Rev Biochem 46:331–358

Krem MM, Rose T, Di Cera E (1999) The C-terminal sequenceencodes function in serine proteases. J Biol Chem 274:28063–28066

Lee PHA, Trowbridge JM, Taylor KR, Morhenn VB, Gallo RL(2004) Dermatan sulfate proteoglycan and glycosaminoglycansynthesis is induced in fibroblasts by transfer to a three-dimensional extracellular environment. J Biol Chem 279:48640–48646

Lehane MJ (1991) Managing the blood meal. In: Lehane MJ (ed)Biology of blood sucking insects. Harper Collins Academics,London, pp 79–105

Lehane MJ (1994) Digestive enzymes, haemolysins and symbiontsin the search for vaccines against blood-sucking insects. Int JParasitol 24:27–32

Lehane SM, Assinder SJ, Lehane MJ (1998) Cloning, sequencing,temporal expression and tissue-specifity of two serine proteasesfrom the midgut of the blood-feeding fly Stomoxys calcitrans.Eur J Biochem 254:290–296

Maurin M, Raoult D (1996) Bartonella (Rochalimaea) quintanainfections. Clin Microbiol Rev 9:273–292

Mazumdar-Leighton S, Broadway RM (2001a) Identification of sixchymotrypsin cDNAs from larval midguts of Helicoverpa zeaand Agrotis ipsilon feeding on the soybean (Kunitz) trypsininhibitor. Insect Biochem Mol Biol 31:633–644

Mazumdar-Leighton S, Broadway RM (2001b) Transcriptionalinduction of diverse midgut trypsins in larval Agrotis ipsilon andHelicoverpa zea feeding on the soybean trypsin inhibitor. InsectBiochem Mol Biol 31:645–657

Meijerink J, Mandigers C, van de Locht L, Tonnissen E, GoodsaidF, Raemaerkers J (2001) A novel method to compensate fordifferent amplification efficiencies between patient DNA sam-ples in quantitative real-time PCR. J Mol Diagn 3:55–61

Muller H-M, Crampton JM, della Torre A, Sinden R, Chrisanti A(1993) Members of a trypsin gene family in Anopheles gambiaeare induced in the gut by blood meal. EMBO J 12:2891–2900

Muller H-M, Catteruccia F, Vizioli J, della Torre A, Crisanti A(1995) Constitutive and blood meal-induced trypsin genes inAnopheles gambiae. Exp Parasitol 81:371–385

Mumcuoglu YK, Zias J (1988) Head lice, Pediculus humanus capitis(Anoplura: Pediculidae) from hair combs excavated in Israeland dated from the first century B.C. to the eight century A.D. JMed Entomol 25:545–547

Mumcuoglu KY, Zias J, Tarshis M, Lavi M, Stiebel GD (2003)Body louse remains found in textiles excavated at Masada, Is-rael. J Med Entomol 40:585–587

Noriega FG, Wang X-Y, Pennington JE, Barillas-Mury CV, WellsMA (1996) Early trypsin, a female-specific midgut protease inAedes aegypti: isolation, aminoterminal sequence determina-tion, and cloning and sequencing of the gene. Insect BiochemMol Biol 26:119–126

Ochanda JO, Oduor EAC, Galun R, Imbuga MO, Mumcuoglu KY(1998) Partial characterization and post-feeding activity ofmidgut aminopeptidase in the human body louse, Pediculushumanus humanus. Physiol Entomol 23:382–387

Ochanda JO, Oduor EAC, Galun R, Imbuga MO, Mumcuoglu KY(2000) Partial purification of the aminopeptidase from themidgut of the human body louse, Pediculus humanus humanus.Physiol Entomol 25:242–246

Patel AA, Steitz JA (2003) Splicing double: insights from the sec-ond spliceosome. Nature 4:960–970

Pedra JHF, Brandt A, Li H-M, Westerman R, Romero-Severson J,Pollack RJ, Murdock LL, Pittendrigh BR (2003) Transcrip-tome identification of putative genes involved in proteincatabolism and innate immune response in human body louse(Pediculicidae: Pediculus humanus). Insect Biochem Mol Biol33:1135–1143

Peterson AM, Barillas-Mury CV, Wells MA (1994) Sequence ofthree cDNAs encoding an alkaline midgut trypsin fromManduca sexta. Insect Biochem Mol Biol 24:463–471

Ramalho-Ortigao JM, Kamhawi S, Rowton ED, Ribeiro JMC,Valenzuela JG (2003) Cloning and characterization of trypsin-and chymotrypsin-like proteases from the midgut of the sand flyvector Phlebotomus papatasi. Insect Biochem Mol Biol 33:163–171

Rawlings ND, Barrett AJ (1994) Families of serine peptidases.Meth Enzymol 244:21–61

Roach JC, Wang K, Gan L, Hood L (1997) The molecular evo-lution of the vertebrate trypsinogens. J Mol Evol 45:640–652

Sakanari JA, Staunton CE, Eakin AE, Craik CS, McKerrow JH(1989) Serine proteases from nematode and protozoan para-sites: isolation of sequence homologs using generic molecularprobes. Proc Natl Acad Sci USA 86:4863–4867

499

Schaub GA (2001) Lice. In: Mehlhorn H (ed) Encyclopedic refer-ence of parasitology, vol 1. Biology, structure, function, 2ndedn. Springer-Verlag, Heidelberg, pp 339–343

Shen B, Tian HS, Ma L, Li XL, Zhen SZ, Zhou DH, Zhu CL(2002) Cloning and sequence analysis of full-length trypsincDNA of Culex pipiens pallescens. Sheng wu hua hsueh yusheng wu wu li hsueh pao 34:28–32 (in Chinese)

Tautz D, Pfeifle C (1989) A non-radioactive in situ hybridizationmethod for the localization of specific RNAs in Drosophilaembryos reveals translational control of the segmentation genehunchback. Chromosoma 98:81–85

Thompson JD, Higgins DG, Gibson TJ (1994) Clustal W:improving the sensitivity of progressive multiple sequencealignment through sequence weighting, position-specific gappenalties and weight matrix choice. Nucl Acid Res 22:4673–4680

Valenzuela JG, Pham VM, Garfield MK, Francischetti IMB,Ribeiro JMC (2002) Toward a description of the sialome of theadult female mosquito Aedes aegypti. Insect Biochem Mol Biol32:1101–1122

Vaughan JA, Azad AF (1993) Patterns of erythrocyte digestion bybloodsucking insects: constraints on vector competence. J MedEntomol 30:214–216

Vizioli J, Catteruccia F, della Torre A, Reckmann I, Muller H-M(2001) Blood digestion in the malaria mosquito Anophelesgambiae. Eur J Biochem 268:4027–4035

Wang H, Nuttal PA (1999) Immunoglobulin-binding proteins inticks: new target for vaccine development against a blood-feeding parasite. Cell Mol Life Sci 56:286–295

Wang S, Young F, Hickey DA (1995) Genomic organization andexpression of a trypsin gene from the spruce budworm, Chori-stoneura fumiferana. Insect Biochem Mol Biol 25:899–908

Wang S, Magoulas C, Hickey D (1999) Concerted evolution withina trypsin gene cluster in Drosophila. Mol Biol Evol 16:1117–1124

Wilkinson DG (1992) The theory and practice of in situ hybrid-ization. In: Wilkinson DG (ed) In situ hybridization: a practicalapproach. Oxford University Press, New York, pp 1–13

Willadsen P, Billingsley PF (1996) Immune intervention againstblood-feeding insects. In: Lehane MJ, Billingsley PF (eds)Biology of the insect midgut. Chapman and Hall, London, pp323–344

Yan J, Cheng Q, Li C-B, Aksoy S (2001) Molecular characteriza-tion of two serine proteases expressed in gut tissue of theAfrican trypanosome vector, Glossina morsitans morsitans. In-sect Mol Biol 10:47–56

Zeng F, Zhu Y-C, Cohen AC (2002) Molecular cloning and partialcharacterization of a trypsin-like protein in salivary glands ofLygus hesperus (Hemiptera: Miridae). Insect Biochem Mol Biol32:455–464

Zhu Y-C, Baker JE (2000) Molecular cloning and characterizationof a midgut chymotrypsin-like enzyme from the lesser grainborer, Rhyzopertha dominica. Arch Insect Biochem Physiol43:173–184

Zhu YC, Zeng F, Oppert B (2003) Molecular cloning of trypsin-likecDNAs and comparison of proteinase activities in the salivaryglands and gut of the tarnished plant bug Lygus lineolaris(Heteroptera: Miridae). Insect Biochem Mol Biol 33:889–899

500