Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing efficiency

Embed Size (px)

Text of Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing efficiency

  • Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing efficiency

    Rolf Turk PhD, Staff ScientistIntegrated DNA Technologies

    1

  • OutlineAlt-R CRISPR-Cas9 System

    Ribonucleoprotein complex (RNP) Generation of RNP complex Stability of RNP complex Editing efficiency of RNP

    Cas9 electroporation enhancer Increases editing efficiency

    RNP delivery using the Amaxa Nucleofector System (Lonza) Optimization

    RNP delivery using the Neon System (Thermo Fisher) Optimization

    2

  • CRISPR genome editingDNA incorporation or gene knockout Homology-directed repairadd or

    replace gene sequences Non-homologous end joining

    destroy a gene

    CRISPR guide RNAs

    3

    Cas9 proteinRNA-directed dsDNA

    endonuclease

  • Implementing CRISPR-Cas9 gene editing

    4

  • CRISPR-Cas9 products from IDT

    5

  • 3-step transfection using Alt-R CRISPR-Cas9 System

    6

    +

    +

    gRNA complex formation

    RNP complex formation

    RNP delivery

    Step 1

    Step 2

    Step 3

    15 minutes

    1020 minutes

    3060 minutes

  • Cas9 protein is rapidly degradedfewer off-target effectsWestern blot Off-target indel production

    7

    Liang X, Potter J, et al. (2015) Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection. J Biotechnol, 208:4453.

  • Benefits of RNP: Cas9 protein rapidly degraded, fewer OTEs

    8

    05

    101520253035404550

    0.1 M 0.3 M 1 M 3 M

    T7EI

    cle

    avag

    e (%

    )

    HEK-293Cas9 cellsNucleofection, EMX1 targeting gRNA, 48h

    On target Off target

    Sustained expression of Cas9 allows for OTEs. Even low-expression HEK-293Cas9 cells allow for off target editing.

    RNP is fast on and fast off, and has fewer OTEs

    05

    101520253035404550

    0.1 M 0.3 M 1.0 M 5.0 M 10 M

    T7EI

    cle

    avag

    e (%

    )

    RNP, HEK-293 cellsNucleofection, EMX1 targeting gRNA, 48h

    On target Off target

  • Ribonucleoprotein ease of usehighly stable Cas9 system

    9

    0102030405060708090

    100

    FreshComplex

    80C 20C 4C FreshComplex

    80C 20C 4C

    T7EIclea

    vage(%

    )

    5monthRNPcomplexstabilityRNPstoredat[1M]HEK293cells,10nM RNP(1.2L),RNAiMAX(1.2L), 48hr

    Cas9Buffer OptiMEM PBS

    Loss in activity seen at 20C (likely due to freezethaws) Premade complexes are stable at 4C and 80C with no loss in activity

    HPRT site 1 HPRT site 2

  • CRISPR workflow

    10

    AssembleRNP

    DesigngRNAs

    LipofectionEasier to transfect cells

    ElectroporationHarder to transfect cells,primary cells

    MicroinjectionMouse model generationand other research organisms

    Collect genomic

    DNA

    Analyze

  • Delivery of RNP by electroporation

    Amaxa Nucleofector (Lonza) 1-, 16-, or 96-well format Online database

    Cell lines Primary cells

    Expensive Electroporation parameters

    unknown hard to optimize

    Neon Transfection System (Thermo Fisher) Single cuvette Online database

    Cell lines Known parameters Easy optimization Expensive

    11

  • 12

  • Considerations when doing electroporation

    Requires higher ribonucleoprotein concentrations [24 M] compared to lipofection

    Cas9 ribonucleoprotein complex is not encapsulated More accessible to nucleases More accessible to proteinases

    Electroporation parameters differ per cell line Amaxa Nucleofector

    Cell database Optimization protocol (96-well format)

    Neon Transfection System Optimization protocols

    13

  • Optimization strategy for electroporation

    Find optimal electroporation parameters Nucleofector System: Electroporation program Neon Transfection System: Voltage, pulse width, number of pulses

    Pay close attention to cell viability Use cells with low passage numbers Use appropriate cell density (should be sub-confluent)

    Follow recommendations from IDT user guides and protocols If necessary, test a range of RNP concentrations Include positive and negative controls Use Cas9 electroporation enhancer to boost editing efficiency

    14

  • Electroporationverify reagents free of RNases

    15

    0102030405060708090

    100

    EMEM EMEM+FBS EMEM EMEM+FBS EMEM EMEM+FBS EMEM EMEM+FBS

    T7EIclea

    vage(%

    )ElectroporationoptimaldissociationmethodAlt-RCRISPRcrRNA[4M]HEK293Cas9Cells

    No PBS wash PBS wash No PBS wash PBS wash

    Cell dissociation method

    Cell resuspension media

    Testing shows that commercially purchased trypsin contains RNases RNaseAlert Assay (IDT)

    Trypsin Non-enzymatic celldissociation solution

  • Electroporation enhancer DNA improves gene editing efficiency Use of electroporation enhancer DNA improves outcome in RNP

    electroporation Effect varies with cell type and electroporation protocol

    (Nucleofector > Neon)

    16

  • Cas9 electroporation enhancer

    IDT custom Ultramer Oligonucleotide; available atwww.idtdna.com/ultramer

    Sequence:TTAGCTCTGTTTACGTCCCAGCGGGCATGAGAGTAACAAGAGGGTGTGGTAATATTACGGTACCGAGCACTATCGATACAATATGTGTCATACGGACACG (100 nt)

    Note: This oligo does not have significant homology to the human, mouse, or rat genomes, and has been tested as carrier DNA in multiple human cell lines, including HEK-293, Jurkat, and K562.

    Before use in other species, verify that this oligo does not have similarity to your host cell genome to limit participation of the oligo in the double-stranded DNA break repair process.

    17

  • RNP Nucleofectioneffect of electroporation enhancer

    18

    0

    5

    10

    15

    20

    25

    30

    35

    0 M 1 M 4 M 10 M 1 M 4 M 10 M 1 M 4 M 10 M 1 M 4 M 10 M

    No Carrier

    20 nt 95 nt 200 nt tRNA

    T7EIto

    tale

    ditin

    geffic

    ienc

    y(%

    )

    3.3 M RNP30 L volume= 100 pmol (16 g)

    Cas9 RNP, HEK-293

  • Positive and negative controls

    19

  • 20

  • Amaxa Nucleofection Nucleofection Solution SF Protocol 96-DS-150 2 x 105 cells/Nucleofection HPRT locus: 38285 crRNA:tracrRNA:Cas9 =

    1.2:1.2:1 RNP concentrations,

    0.1254 M Electroporation enhancer DNA,

    4 M 48 hr incubation, following

    Nucleofection 3X genomic DNA dilution Digest with T7EI, 2 U Fragment Analyzer

    (Advanced Analytical Technologies)

    21

    0102030405060708090

    100

    0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5

    T7EIto

    tale

    ditin

    geffic

    ienc

    y(%

    )

    Ribonucleoproteincomplexconcentration(M)

    NucleofectionRNPdilutionseriesHEK-293cellsTheeffectofcarrierDNAandsequenceoneditingefficiency

    4Melectroporationenhancer Noelectroporationenhancer

    Conditions:

  • Amaxa Nucleofection Nucleofection Solution SE Protocol 96-CL-120 5 x 105 cells/Nucleofection HPRT locus: 38285 crRNA:tracrRNA:Cas9 =

    1.2:1.2:1 RNP concentrations,

    0.1254 M Electroporation enhancer DNA,

    4 M 48 hr incubation, following

    Nucleofection 3X genomic DNA dilution Digest with T7EI, 2 U Fragment Analyzer

    (Advanced Analytical Technologies)

    22

    0102030405060708090

    100

    0 0.5 1 1.5 2 2.5 3 3.5 4 4.5

    T7EIto

    tale

    ditin

    geffic

    ienc

    y(%

    )

    Ribonucleoproteincomplexconcentration(M)

    NucleofectionRNPdilutionseriesJurkatcellsTheeffectofcarrierDNAandsequenceoneditingefficiency

    4Melectroporationenhancer Noelectroporationenhancer

    Conditions:

  • Amaxa Nucleofection Nucleofection Solution SF 96-FF-120 protocol 5 x 105 cells/Nucleofection HPRT locus 38285 crRNA:tracrRNA:Cas9 =

    1.2:1.2:1 RNP concentrations,

    0.1254 M Electroporation enhancer DNA,

    4 M 48 hr incubation, following

    Nucleofection 3X genomic DNA dilution Digest with T7EI, 2 U Fragment Analyzer

    (Advanced Analytical Technologies)

    23

    Conditions:

    0102030405060708090

    100

    0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5

    T7EIto

    tale

    ditin

    geffic

    ienc

    y(%

    )

    Ribonucleoproteincomplexconcentration(M)

    NucleofectionRNPdilutionseriesK562cellsTheeffectofcarrierDNAandsequenceoneditingefficiency

    4Melectroporationenhancer Noelectroporationenhancer

  • 24

  • Workflow

    HEK-293 cells: 1 x 105 cells per electroporation HPRT 38285 RNPcrRNA:tracrRNA:Cas9 = 1.8:1.8:1.5 M 12 L volume (10 L electroporated) Electroporation enhancer, 1.8 M 24 different protocols

    Voltage Pulse width Pulse length

    gDNA isolation 48 hr after electroporation T7EI assay

    25

  • HEK-293 electroporation optimizationNeonSystem

    26

    Test -Enhancer +Enhancer -Enhancer +Enhancer -Enhancer +Enhancer Voltage(V) Width(ms) NumberProt_01 2 1 0 1 1Prot_02 31.2 52.0 0.2 3.0 3 3 1400 20 1Prot_03 39.0 63.2 0.7 8.1 4 2 1500 20 1Prot_04 44.8 59.9 0.5 3.7 4 2 1600 20 1Prot_05 44.5 59.9 1.3 3.2 2 2 1700 20 1Prot_06 23.3 42.4 0.8 1.6 3 3 1100 30 1Prot_07 33.8 49.3 1.4 1.2 3 3 1200 30 1Prot_08 41.5 58.8 1.0 1.2 3 3 1300 30 1Prot_09 44.6 61.1 0.8 1.6 3 3 1400 30 1Prot_10 22.3 39.9 1.5 2.3 3 4 1000 40 1Prot_11 34.9 53.9 0.7 2.4 3 3 1100 40 1Prot_12 46.2 62.4 0.8 4.8 4 4 1200 40 1Prot_13 30.2 48.9 0.7 2.1 3 4 1100 20 2Prot_14 42.6 51.4 0.9 1.8 4 3 1200 20 2Prot_15 50.5 66.2 0.5 2.1 4 2 1300 20 2Prot_16 61.1 67.4 1.0 2.7 2 1 1400 20 2Prot_17 12.3 24.9 0.5 2.2 3 3 850 30 2Prot_18 27.3 37.5 0.7 0.6 4 4 950 30 2Prot_19 41.4 46.4 1.0 1.8 4 4 1050 30 2Prot_20 53.0 60.4 0.5 1.8 4 3 1150 30 2Prot_21 36.2 52.6 1.3 1.8 4 4 1300 10 3Prot_22 47.4 57.2 0.8 1.2 4 4 1400