We have seen that there is abundant evidence for the common descent of human beings and the rest of the living world.In Darwin’s time very little was known of the steps or intermediate stages that led to us. This has changed dramatically in the last 150 years and now we have a wealth of data that enables us to reconstruct much of our origins.

Human beings have always pondered over how they came into existence. This has given rise to a wide variety of speculation and several beautiful stories.The Judeo-Christian tradition has the myth of Adam and Eve and the garden of Eden.

In ancient Indian mythology, Brahma created the world. He along with Siva the destroyer and Vishnu the preserver formed the Hindu trinity of Gods.However, moving beyond mythologies science has pieced together a far more interesting story that is still in the process of development.

The scientific history of the human race would not have been possible but for many great explorer-scientists who combined their love of adventure with their immense scientific curiosity.Though Darwin had surmised that evolution of hominids was in Africa, very soon the majority opinion shifted to Asia as the most likely place for early hominid evolution.Eugene Dubois gave up a prestigious academic career to go looking for the so called ‘missing link’ between apes and humans, in the remote islands of the Malay archipelago.He was rewarded by the find of what came to be known as the Java man in Indonesia. We now recognize this as the ‘Homo erectus’.

The focus shifted back to Africa in the 20th century.Much of the fossil evidence for the current view on human evolution has come from the great rift valley in Africa spanning from Ethiopia to East Africa.

The husband and wife team of Louis Leakey and Mary Leakey were pioneers in the exploration for human origins in Africa.

Most of the studies of the Leakeys were done in the Olduvai gorge and the nearby Laetoli in Tanzania.

The Olduvai gorge is a steep-sided ravine from where fossil remains of human ancestors have been found from as long as 2.5 million years ago. It is also a site from which very old stone tools dating to about the same time were unearthed.These tools called Oldowan tools indicate that our hominid ancestors started using tools from as early as 2.5 million years ago.

Richard Leakey (son of Louis and Mary) and Donald Johanson (right). Richard’s digs near the Lake Turkana in Kenya and Johanson’s in the Afar region of Ethiopia helped discover landmark fossils.

A team of researchers excavating in northern Chad unearthed in 2002 the well-preserved skull and other fossilized remains of what they believe was an early human precursor, that lived six to seven million years ago. It is probably the oldest known ancestor of humans. Named Sahelanthropus tchadensis, it is believed to have walked upright, but not all scientists agree on this.

The term ‘missing link’ is often misinterpreted by those who oppose the theory of evolution, particularly the creationists. It is understandable to talk of a common ancestor, in this case a now extinct ape which led to the lineages of Chimpanzees and Bonobos on one hand and humans on the other. It is to be remembered that both groups have evolved in its own way for millions of years before taking the present characteristics. ‘Missing link’ between chimps and humans is that way absurd, because evolutionary theory does not postulate the existence of such a creature that is half human and half chimp.

It is generally agreed that upright posture and walking on two feet was the most important event that led to the evolution of the hominid branch.This led to the freeing of the hand which in turn led to the making and use of better and better tools. With tool making and the precision and co-ordination required for it, the brain capacity became an important factor for natural selection to operate. The increase in brain size followed in successive hominids reaching a culmination in Homo sapiens.

How do we get clues regarding bipedalism from the available fossil evidence? Foramen magnum is the large hole in the underside of the skull, through which the spinal cord passes. It is found towards the back in animals that walk on all four limbs like that of the chimpanzee on the left. In the bipedal and upright animals like humans, the foramen magnum is seen much more towards the center.

The way bones are joined together in the pelvis and foot and the shape of the leg bones and vertebrae also give us a good idea about bipedalism.

The skeleton of ‘Lucy’, the famous fossil of the definitely bipedal hominid discovered by Donald Johanson in the Afar region of Ethiopia dated to be about 3.2 million years ago. On the right is a reconstruction of how Lucy would have looked like.Since then more remains have been unearthed of this creature named ‘Australopithecus afarensis’.A afarensis had a small brain size like that of the apes. This is proof that bipedalism preceded increase of brain size during evolution of the hominids.

3.6 million year old footprints (dated by radiometric methods) discovered by Mary Leakey in Laetoli.The prints are strikingly different from those of a chimpanzee, and in fact are hardly distinguishable from those of modern humans. The only known hominid fossils of that age in that location are those of Lucy and her kind, the small-brained but upright-walking hominids classified as Australopithecus afarensis. While the detailed interpretation of the prints remains a matter of debate, they remain an extraordinary and fascinating fossil find, preserving a moment in prehistoric time.

Homo habilis existed from 2.3 million to 1.6 million years ago. It displayed human like traits not seen in earlier hominids like the shape of its upper jaw. But they retained a number of ape like characters like long arms and short legs.Homo habilis is believed to be one among the first tool users.

Homo habilis tools were simple stone flakes with a sharp edge. They probably used these tools for cleaving meat off of dead animals rather than hunting.

Homo ergaster which lived 1.9 million to 1.3 million years ago had a larger brain than Homo habilis. Some regard this as a subspecies of Homo erectus.

Homo erectus which lived from 1.8 million to less than 100000 years ago was the first human ancestor to leave Africa and reach various parts of Asia and Europe. They had brain sizes varying fro 850cc in the older to about 1100 cc in the later specimens.Many consider Homo erectus to be the direct predecessor of modern humans and the Neanderthals.

Homo ergaster and Homo erectus made tools which were more sophisticated than the stone flakes used by Homo habilis. The tools indicate that they were definitely hunters. These type of tools called the Acheulean tools have been recovered from all over the world and had remained unchanged for nearly a million years.

Homo erectus was the first to have definitely used controlled fire, though whether they made fire is debatable.

Neanderthal and modern humans. Both spread from Africa to Europe and Asia and co-existed till about 30000 years ago when the Neanderthals disappeared. There is difference of opinion whether to regard them as two sub-species of Homo sapiens or as separate species ie. H sapiens and H neanderthalis. Both the groups had similar brain size of about 1400 cc.

Brain size increased progressively during hominid evolution to the 1400 cc or so in the moderns and neanderthals. We have seen that bipedalism preceded increase in brain size and that resulted in freeing of hands and its it use in fine co-ordinated movements. This is reflected in the anatomy of the human brain.

This is the human brain. Areas shown in red and blue are those concerned with voluntary movements and their coordination.

See the various parts of the body represented in the motor areas of the brain according to scale. Note that about one third of the area is just for the hand.

The Neanderthals were our closest cousins. They spread from Africa to the colder climates of Europe and Northern Asia earlier than us. Their body was more adapted to cold. They were stockier and had large noses and a heavy ridges on the brows.

Their tools were far more sophisticated than that of Homo erectus.

Reconstruction of how a Neanderthal girl would have looked like. We wouldn’t have recognized her in a crowd of modern humans as someone belonging to a different species.Did we interbreed with the Neanderthals? Current evidence from DNA isolated from Neanderthal remains says no.

Both Neanderthals and modern humans buried their dead. Modern humans frequently buried other artifacts along with their dead indicating rituals.Here is a Homo sapiens woman and a baby buried together in a cave in Israel some 100,000 years ago.

Homo sapiens tools were superior and used material like quartz. They also made new kind of tools like arrowheads.

One thing that seems to have set apart Homo sapiens from others is the capacity for abstract thought and expression. Animal figures engraved in the Cussac cave (France) about 22000 years ago.

A 24000 year old sculpture of a woman’s head (France)

The family tree of hominids spanning about 4 million years. It has branching shape some branches leading to dead ends.

1. There have been two theories regarding the origin of modern humans ie. Homo sapiens sapiens.

2. One view called the ‘Multiregional model’ is that modern humans arose separately in the different continents from the predecessor species ie. Homo erectus.

The second view dubbed the ‘Out of Africa model’ holds that modern humans rose in Africa and spread to rest of the world.

The multiregional model. The model according to some of its proponents also holds that the different races like Africans, Europeans and Asians evolved separately.

The ‘Out of Africa’ model

The ‘Out of Africa’ model. The numbers shown is the time (in years) when the earliest fossils of modern humans have been found in different parts of the world.

The multiregional hypothesis by its implication of separate evolution of different races over a long duration of time has been used by racists to justify their theories. Nineteenth century textbooks used misleading imagery to suggest that "Negroes" had been created to rank between "Greeks" and chimpanzees.

Craniometry, the technique of measuring the bones of the skull and finding the cranial capacity was used in the nineteenth century to justify the hierarchical ordering of races with Europeans at the top and Africans at the bottom.These studies have now been shown to be unscientific or even fabricated in some cases.But such studies have been cited to support the idea that negroes had been created unequal, suited to slavery

Human zoos were 19th and 20th century public exhibits of human beings, usually in a "natural" or "primitive" state. The displays often emphasized the cultural differences between Western and non-European peoples. Ethnographic zoos were based on scientific racism, and a version of Social Darwinism. A number of them placed indigenous people (particularly Africans) in a continuum somewhere between the great apes and human beings of European descent.

Saartjie Baartman (Hottentot Venus)

Caricature of Saartjie Baartman (1789 - 1815) who was exhibited – nearly nude – in various shows in 19th century Europe under the name Hottentot Venus.

Starting from the 17th century and lasting to the nineteenth, 10 to 12 million Africans were taken to the Americas and sold in slavery.They were packed into ships like this like cattle. Many thousands died on the way.

Inhuman treatment was meted out to them. A photograph from 1863. Whipping was a common punishment in the Southern states of America.

Hitler and his Nazi Party published many books on scientific racism maintaining that the Aryan race was the most superior.

These ideas led to the concentration camps where millions perished.

Millions were put to death in gas chambers in camps like Auschwitz and Belsen. Their main fault was belonging to the allegedly inferior races.

So called scientific theories of racism was used to justify such horrors.

Segregation based on color of the skin was practiced as late as the second half of the twentieth century in Southern United States and South Africa.

In South Africa, the oppressive system of Apartheid was practiced. This was also based on theories of racial superiority and inferiority.

IQ

The most recent pseudo-science is the theory of heritable racial differences in IQ. In its crudest form it states that

1. General intelligence or the ’g factor’ is inherited as a simple phenotypic trait2. Determinant of IQ is predominantly genetic and environment has very little

influence3. There are IQ differences between races and the blacks are inferior in this respect.

Books like the bell curve publlshed in 1994 still peddle these outmoded theories. They maintain that black children in America score less in IQ tests consistently and that this is due genetic reasons. The political message they convey is that affirmative action and special education for black children are of no use.

The graph shows average IQ of different racial groups residing in the United States according to one study.Though these statistics are used to establish genetic differences in intelligence between groups, it appears prima facie fallacious. The average IQ shown correlates best with the average income. It is significant that Asians have the highest average IQ. They also have the highest income since the immigrants to USA from Asia are generally better educated and contain a large number of professionals.

Black Spanish White Asians

Average IQ of different racial groups residing in the United States

Even if a trait is almost fully heritable, the group differences need not be genetic. In the example shown the height of corn plants is almost 100% heritable. But there is marked difference in height between plants that get adequate nutrients and those that do not.

Adequate nutrients Not adequate nutrients

Equal light

The pseudo-scientific theories regarding racial differences and social inequality are sometimes called ‘Social Darwinism’. This is an unfortunate term since it has nothing to do with Darwinism.Darwin himself believed in the unity of the human species and was against polygenic theory of races. He was a staunch opponent of slavery.

Let us briefly see what current studies in molecular biology tell us about our past

This is a landmark paper published by Allan Wilson and colleagues in the journal Nature in 1987. They examined mitochondrial DNA variations in different human populations from all round the world.

Mitochondria are tiny organelles in eukaryote cells that generate most of its chemical energy.

They are believed to have originally been bacteria that colonized a proto eukaryotic cell.

They have their own circular DNA, which is very similar in all vertebrate cells. There are 37 genes in all of them and this again is evidence of common descent. The differences between the various groups is exactly as predicted by the evolutionary relationships.

ATTTCGGCCTTACCGTTAAGTCCTTTTAAGT

ATTTCGGCCTTACCATTAAGTCCTTTTAAGT

ATTTCGGCCTTACCATTAAGTGCTTTTAAGT

ATTTCGGCCTTACCATTAAGTGCTTTTAAGAThe differences in the mitochondrial genes can also be used in another way. Random mutations occur in certain regions of the mitochondrial DNA ate a fixed rate. They thus serve as a sort of molecular clocks.This is what Allan Wilson and colleagues did in the study mentioned earlier.

All the mitochondria in our cells come from our mothers. When the egg and sperm unite to form an embryo the few mitochondria present in the sperm is lost and only those in the egg are passed onto the baby.So all the mitochondrial DNA that each of us have belongs to our mothers.

My mitochondrial DNA comes from my mother. Hers from her mother and so on. Five generations back I would have had a maximum of 32 ancestors – 16 men and 16 women. But of these all my mitochondrial DNA would have come fro a single woman.

If there are 3 billion women in the world today, the number of their female ancestors in the previous generation would have been less than that number, since some would have had more than one daughter. If we go back in time long enough, the female ancestor of all living women today would be only one.

So all of us living in this world today have inherited our mitochondrial DNA from a woman who lived about 160000 years ago in Africa. Studies done by different people using the molecular clock concept agree on this, though the time estimate varies from about 1 to 2 lakh years.It is to be noted that we have not inherited all our genes from this woman. For each gene the convergence may be to a different ancestor.In that sense use of the term ‘Eve’ is inappropriate.

When mitochondrial DNA sequences from people living in different parts of the world are studied, they can be divided into different groups. They are named L, M, N etc. Depending on the mutation patterns it can be inferred which group followed which. For example L is the most ancient, additional mutations in the sequence gives rise to M, more mutations to N etc. By looking at the predominant group found among indigenous people in each area, the patterns of migration can be inferred.Such studies unmistakably point to Africa as the cradle of the human species.

Y chromosomeY chromosome is the smallest chromosome. It is seen only in males

Y chromosome is inherited from father to son. Similar to what we have seen in case of mitochondrial DNA, the Y chromosome of every male in the world today can be traced back to a single male ancestor in the remote past.And by studying the mutation patterns in the Y chromosome, it can be estimated how long ago that ancestor lived. It is further possible to study the migration patterns of humans using this tool just as in the case of the mitochondrial DNA.

All current evidence point to a man in Africa who lived around 60000 to 90000 years back as our Y chromosome ancestor. Needless to say the rest of our genes may be traced to other ancestors and so the term Adam is again inappropriate.

Migration patterns established by studying the mutations in Y chromosome DNA again unequivocally proves our African origin.

Because of the popular usage of terms like mitochondrial Eve and Y-chromosome Adam it may be confusing when we say that this Adam and Eve may have lived in different times. In fact every one of our genes will converge on a different ancestor in the past.But we can say with some degree of confidence that all of us, without exception have descended from a rather small band of modern humans in Africa sometime around 200000 years ago.

Adam and Eve might not have met

This means that we human beings are a very young species. Only about 7500 generations separate us from the first band of modern humans in Africa. This means that the differences between all human beings are only the equivalent of the changes that occur in a species of bacteria in a period of 2 months.The differences amongst are cultural rather than genetic.

Sewall Wright was a pioneer in population genetics. He evolved a measure called Fixation Index (FST) which is a measure of population differentiation based on genetic polymorphism data.According to him, if within a species the FST is more than 0.25 between two groups, then it can be called a separate sub-species or races.

The differences between human beings based on various genes is only about 0.1.To talk of races among Homo sapiens is thus scientifically invalid.

We are misled by the differences in rapidly evolving traits like skin color into imagining bigger differences between human beings than what actually exists.Race in human beings is only skin deep.

Human oneness and equality are not mere ethical concepts. It is true.