Denaturing gradient gel electrophoresis to diagnose multiple endocrine neoplasia type 2

598

Clinical Chemistry 42:4

598-603 (1996)

Denaturing gradient gel electrophoresis todiagnose multiple endocrine neoplasia type 2

ROBERT D. BLANK,l,2,3* CHARLES A. SKLAR,4 and MELISSA L. MARTIN2

Multiple endocrine neoplasia type 2 (MEN 2) is an autoso-

ma! dominant cancer syndrome caused by mutations in the

RET protooncogene. Others have already demonstrated the

value of genetic testing in known MEN 2 kindreds. Previ-

ously described approaches to DNA-level diagnosis, partic-ularly of index cases, are tedious. We developed appropriate

denaturing gradient gel electrophoresis (DGGE) condi-tions for analysis of exons 10, 11, and 16 of this gene, where

many of the pathogenic mutations map. We screened 16members of a three-generation MEN 2 kindred by DGGE

and found five affected but still asymptomatic patients,ranging in age from 5 to 67 years. We used DGGE to

localize the pathogenic mutations and screen at-risk indi-viduals in several other kindreds. DGGE-which requiresno radioactive, fluorescent, or chemiluminescent label-ing-is ideally suited to the diagnosis of MEN 2 because of

the syndrome’s dominant genetics and the rarity of clini-

cally silent variants in the RET gene.

INDEXING TERMS: neurocristopathy . thyroid neoplasms .

Hirschsprung disease #{149}mutational analysis

Multiple endocrine neoplasia type 2 (MEN 2) is a group of

autosomal dominant disorders that include familial medullarycarcinoma of the thyroid (MCT), MEN 2A, and MEN 2B.5

MEN 2 is characterized by hyperplasia of the calcitonin-secreting C cells of the thyroid [1]. These hyperplastic C cells

frequently undergo malignant transformation to MCT in af-

fected individuals. In familial MCT, no other tumors develop.

Division of Endocrinology, Departments of Medicine and ‘ Pediatrics,Memorial Sloan-Kettering Cancer Center, 1275 York Ave., New York. NY 10021.

2 Division of Endocrinology, Depamnent of Medicine, New York Hospital,

525 E. 68 St., New York, NY 10021.

‘Rockefeller University, Box 305, 1230 York Ave., New York, NY 10021.‘Mdress correspondence to this author, at Rockefeller University address. Fax

212-327-7420, e-mail rdblank’@mail.med.cornell.edu.

‘Nonstandard abbreviations: MEN 2, multiple endocrine neoplasia type 2;

MCT, medullary carcinoma of the thyroid; DGGE, denaturing gradient gel

electrophoresis; TBE, Tris-borate-EDTA; and SSCP, single-strand conforma-elonal polymorphism.

Received November 7, 1995; accepted January 15, 1996.

In the MEN 2A syndrome, pheochromocytomas and hyperpar-

athyroidism also develop in -50% and 20% of affected individ-

uals, respectively. In the MEN 2B syndrome, MCT and pheo-

chromocytomas develop in patients who have a characteristic

body habitus and multiple ganglioneuromata of both the entericnervous system and mixed peripheral nerves [2, 3].

Genetic tests for MEN 2 have recently been developed to

simplify the screening of individuals from affected kindreds

whose mutation is known. Most of these feature the use of

altered restriction sites to allow the detection of specific patho-

genic mutations in the RET protooncogene [4-7]. This ap-proach, while extremely useful when a restriction site is altered,

is limited by the fact that some pathogenic mutations do not

result in such an alteration [4]. Moreover, assessing new patients

for the presence of pathogenic RET mutations requires othermeans. Investigation of these individuals is a time-consuming

and labor-intensive task.

In this study, we report the development of denaturinggradient gel electrophoretic (DGGE) assays for exons 10, 11,

and 16 of the RET gene and demonstrate the utility of thismethod in diagnosing individuals in MEN 2 kindreds. Using

DGGE, we localized the RET mutations in the index case of a

new MEN 2B kindred and in a previously uncharacterizedkindred with familial MCT. We were also able to provide rapid

diagnosis of five asymptomatic members of a family with MEN

2A. We anticipate that DGGE methodology will greatly facili-tate the identification of familial disease among new index cases

of MCT.

Matenals and MethodsDNA extraction. Peripheral blood (5 mL) from each patient was

collected in EDTA-containing tubes, and the DNA was purifiedwith the QIAGEN (Chatsworth, CA) blood extraction kit as

recommended by the manufacturer. DNA was resuspended inTris-EDTA buffer (10 mmol/L Tris, pH 8.0, 1 mmol/L EDTA)

at a concentration of 50-200 mg/L and stored at 4 #{176}C.

PCR amplfication.PCR reactions were performed in 50-.tLvolumes in a Perkin-Elmer (Norwalk, CT) 480 thermal cycler.

All reactions were cycled (94 #{176}Cfor I mm, Tannealing for 1 mill,

72 #{176}Cfor 1 mm) for 35 cycles, followed by a 10-mm incubation

at 72 #{176}C.PCR primers, annealing temperatures, magnesium

Exon

10

11

13

16

ClampDouble clamp

mmol/L

1.5

1.0

1.5

1.5

1.0

Reference

8

8

This study

9

10

11

FinaI 6 bases of clamp omitted for this primer.5Sond step of two-step, heminested PCR for exon 11.

Clinical Chemistry 42, No. 4, 1996 599

Table 1. Primers and PCR conditions.

Primers t.,, #{176}C

GCGCCCCAGGAGGCTGAGTG 65

CGTGGTGGTCCCGGCCGCC

Clamp-CGTGGTGGTCCCGGCCGCC

CCTCTGCGGTGCCAAGCCTC 60

ClampaCCTCTGCGGTGCCAAGCCTC

CACCGGAAGAGGAGTAGCTG

Double clamp 60

GAGAAGAGGACAGCGGCTGC

CTCTCTGTCTGAACTtGGGC 65TCACCCTGCAGCAGGCCTtA

AGGGATAGGGCCTGGGCTC 60Clamp-AGGGATAGGGCCTGGGCTFC

TAACCTCCACCCCAAGAGAGCGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCGCGCCCCGCCCGCCCCGCGCGCGCCGCCCGCCGCGCCCCGCGCCCGTC

concentrations, and product lengths are listed in Table 1.Amplification reactions were carried out in 50 .tL of 10 mmol/L

Tris (pH 8.3 at room temperature) containing 50 mmol/L KG!,

0.1 g/L gelatin, 0.2 mmol/L of each dNTP, and 50 ng of DNA.

PCR products were purified from agarose gels with the QIAEX

(QIAGEN) gel extraction kit as recommended by the manufac-

turer.

Exon 11 products for DGGE were prepared in two rounds ofPCR: The first round used the clamped forward and unclamped

reverse primer designed by Donis-Keller et a!. [8]. Purified

product from this amplification was reamplified by using the

double-clamp primer and an internal reverse primer that lies 5’to a neutral polymorphism in this exon.

Restriction digests. Restriction endonucleases were purchased

from New England Biolabs (Beverly, MA) or Boehringer

Mannheim (Indianapolis, IN). Digestions were carried out in

20-pt volumes of the buffers supplied by the manufacturers.

Digests included 100-500 ng of purified PCR product and

0.5-2 U of enzyme. Incubations were for 2-16 h at 37 #{176}Cexcept

for BstUl, which was incubated at 60 #{176}C.

DNA sequencing. Direct sequencing of PCR products was carried

out with the Taquence (US Biochemicals, Cleveland, OH) kit

and use of 32P as recommended by the manufacturer. Electro-phoresis of sequencing ladders was carried out in 8% polyacryl-amide gels containing 7 mol/L urea with 1 x TBE buffer (89

mmol/L Tris, 89 mmol/L boric acid, and 2 mmol/L EDTA, pH8.3 at 25 #{176}G)at a constant power of 70 W.

DGGE. Gels were 8% polyacrylamide (acrylamide:bisacrylam-

ide 19:1 by wt.) in 0.5x TBE and were used within 3 h of

casting. DGGE was performed in a Bio-Rad (Hercules, CA)

Miniprotean apparatus at 45 V for 3-5 h. The 100% denaturant

was 7 mollL urea + 10 mol/L (40% by vol) formamide.

Intermediate denaturants were prepared by diluting 100% de-

naturant with 8% acrylamide in 0.5x TBE. In all experiments,

we used 1.5-mm spacers, which resulted in a gel volume of -9

mL. Gradients were prepared bottom-up by gravity flow in a

20-mL gradient maker with 5 mL of each acrylamide solution.

Details of the conditions used for each exon of RET are

summarized in Results. Samples were heated to 95 #{176}Cfor 5 mm

and allowed to cool to room temperature for 15 mm before

loading. Samples were visualized by staining in ethidium bro-

mide and using ultraviolet transillumination.

Results

We undertook DNA-level analysis of the RET gene in members

of known MEN 2 kindreds and in patients in whom the

existence of familial disease was uncertain. Because -90-95%[12] of the mutations causing MEN 2 had previously been found

in exons 10, 11, 13, and 16 of the RET gene [8, 10, 13-15], we

limited our analysis to these four exons. Full discussion of the

molecular and clinical features of MEN 2 in this patient

population will be presented elsewhere.

After extracting DNA from the peripheral blood from each

patient and at-risk individual, we carried out PCR amplification

and direct sequencing of the PCR products for each kindred’s

index case and for each sporadic patient. Both strands of thePCR products were sequenced. As we developed the DGGE

assays, we used these assays as the initial screen for their

respective exons. The presence and the absence of mutationswere confirmed by restriction digestion. Additional members of

known kindreds were screened by DGGE or restriction diges-

tion. We confirmed RET genotypes for all individuals by

repeating the genotyping with complementary methods.

DEVELOPMENT OF DGGE ASSAYS FOR RET GENE MUTATIONS

Because of the substantial effort required to seek mutations in

the RET gene by direct sequencing, we sought to develop a

reliable method with which we could find mutations more

rapidly. DGGE, which detects differences in the melting behav-

Fig. 2. Pedigree of family with C620R.

The arrow indicates the index case. Filling of symbols is as follows: upper left =medullary carcinoma of the thyroid, upper right = pheochromocytorna, lower left= hyperparathyroidism, and lower right = Hirschsprung disease. Note thataffected status is defined by clinical presentation at the time of genetic testing.not by the results of biochemical testing, so newly diagnosed cases are shownby open symbols.

600 Blank et a!.: DGGE to diagnose multiple endocrine neoplasia type 2

Fig. 1. DGGE assays for RET exons 10, 11,and 16.Lanes are numbered from left to right. (A) Exon 10:20-60% gradient run at 60 C. Lane 1, C620F;lane2, wild type; lane 3, C620R. (B) Exon 11:0-50% gradient run at 68 #{176}C.Lane 1, C634Y; lane2. wild type; lane 3, C634R. (C) Exon 16: 0-50%gradient run at 60 ‘C. Lane 1, M918T; lane 2. wildtype.

ior of PCR products as they migrate through a gradient of

formamide and urea in a polyacrylamide gel matrix [16], ap-

peared to be an appropriate technique for this use [11]. Because

affected individuals are heterozygotes, amplification of the

mutated exon of the RET gene, denaturation, and annealing will

result in four products: wild-type and mutant homoduplexes,

and two heteroduplexes (wild-type coding strand and mutant

coding strand). In particular, the heteroduplexes will have

nonhomologous “bubbles” present at the site of the mutation.

The bubbles in the heteroduplexes result in their having a lower

melting temperature than the homoduplexes. Consequently, an

affected individual will display two to four bands on DGGE, one

for each DNA species. In contrast, normal subjects will display

only a single band, as their PCR products contain only wild-type

homoduplex DNA. This difference in pattern is dramatic and

evident.

Thus far, we have found appropriate DGGE conditions for

the detection of mutations in exons 10, 11, and 16, as shown in

Fig. 1. We used the primer program [17] to estimate the melting

behavior of each PCR product by processively calculating the

annealing temperature of 20-hp windows. This analysis revealed

that residue 634 is contained within an unusually high melting-

point region of the RET gene. This fact required that we use a

61/62-base GG clamp and a higher gel temperature to detect

mutations at this site. We used a two-step amplification protocol

to incorporate this “double” GC clamp.

APPLICATION OF DGGE TO A THREE-GENERATION KINDRED

We used the exon 10 DGGE assay to test 16 members of a

family carrying the C620R mutation, as shown in Fig. 2. Five of

the individuals diagnosed with MEN 2 in this family were

asymptomatic on presentation; that is, they were first diagnosed

on the basis of the DGGE results. These results were in perfect

concordance with those obtained by BstUI digestion (data not

shown), which cleaves mutant but not wild-type exon 10. One of

these five asymptomatic individuals was in fact an obligate

affected individual, her son being clinically affected with

Hirschsprung disease and MCT.

Exclusion of disease is also important. Excluded individuals

need not undergo further assessment for the development of any

MEN 2-associated tumors, and their progeny are not at risk of

developing MEN 2.

DiscussionMOLECULAR PATHOLOGY OF THE RET GENE

The evidence is compelling that mutations of the RET protoon-

cogene cause MEN 2. Genetic studies had demonstrated that

the autosomal dominant locus causing MEN 2 was closely

linked to RET on chromosome lOq [18-20]. A limited set ofgermline mutations in RET have been found in -95% of MEN

2 kindreds, and several of these mutations have been found in

sporadic MCTs. Documentation of new RET mutations and denovo MEN 2 [21-23] also provides compelling evidence estab-

lishing RET mutation as the molecular lesion underlying MEN2. Most cases of MEN 2A and familial MTC are caused by

substitution of cysteine by another amino acid at one of five sites

near the transmembrane segment of the affected protein

[8, 15, 24, 25]. MEN 2B kindreds and one kindred with familial

MTC carry germline missense mutations at two sites withinRETs kinase domain [10, 13, 14, 20, 26]. Mutations at these

seven sites account for nearly all MEN 2 cases [12, 27].RET mutations also cause an autosomal dominant form of

Hirschsprung disease, in which a segment of bowel lacksinnervation; this presents clinically as intestinal obstruction in

infancy. Mutations in Hirschsprung disease span the entire RET

Clinical Chemistiy 42, No. 4, 1996 601

gene and include nonsense, frameshift, and deletion mutations

[9, 28-30]. Rarely, Hirschsprung disease and MEN 2A are both

present in a single kindred. These families have been found to

carry mutations characteristic of MEN 2A [31].

CLINICAL FEATURES OF MEN 2 AND SCREENING ISSUES

The tumors classified as MEN 2 may occur either as compo-nents of the syndrome or as sporadic neoplasms-and the

clinician must be able to distinguish between these. Various

features, including pathological findings and age of onset, help

to distinguish familial from sporadic disease but are far from

absolute criteria for doing so [32-36]. The increase of stimulated

calcitonin concentrations [37] is limited by age-dependent sen-

sitivity [34] and the occurrence of C cell hyperplasia in individ-

uals for reasons unrelated to MEN 2 [5, 38, 39].

Genetic methods overcome most limitations of the combined

use of clinical and biochemical methods for diagnosing MEN 2.

In the case of members of known MEN 2 kindreds, one must

determine only whether the pathogenic mutation is present in

the at-risk individual. A search for pathogenic mutations need be

performed only once for each kindred. Thus far, -95% offamilies with MEN 2 have had one of several characteristic

mutations in exon 10, 11, 13, or 16 of the RET gene. Availability

of an improved assay for these mutations would simplify genetic

diagnosis of the familial disease. We have achieved this by

establishing the conditions for DGGE of exons 10, 11, and 16.

DGGE COMPARED WITH OTHER APPROACHES TO GENETIC

DIAGNOSIS OF MEN 2

DGGE is ideally suited for diagnosis of MEN 2 for several

reasons. First, very few neutral polymorphisms are known in

these exons [40, 41]. Second, the dominant genetics of the

syndrome means that virtually all affected individuals are het-

erozygotes, which allows formation of heteroduplexes on PCR

amplification of DNA from affected individuals. The heterodu-plexes have early melting nonhomologous bubbles that are

readily apparent on DGGE. The presence of these heterodu-

plexes greatly simplifies the distinction of affected individuals,who display multiple bands on DGGE, from normal subjects,

who display a single band on DGGE. Moreover, DGGE does

not require the use of fluorescent, chemiluminescent, or radio-

active labeling for performance of the assay. These features,

together with the technical ease of performing an established

assay, make this an attractive method for use in clinical settings.

The sensitivity of DGGE in detecting single-base substitu-tions is -95% when performed with GC-clamping and PCRproducts <500 bp long [11]. Because the method cannot detectmutations in the highest melting temperature domain of the

molecule, GG-clamping introduces a high melting-point seg-

ment of DNA at the end of a PCR primer so as to placeamplified mutations in a context that maximizes their chance of

detection [16]. In the case of RET exon 11, the standard GC

clamp did not allow the detection of codon 634 mutations, but

these were revealed by extending the clamp length. In a recent

report, Attie et al. used DGGE of the RET gene to uncover a

7-bp deletion leading to Hirschsprung disease [28], but this

application required distinguishing between molecules that dif-

fered over the length of the microdeletion rather than at a single

base. Here, we have shown that DGGE with GC clamping is

sufficiently robust to detect the single-base substitutions that

result in MEN 2. Every RET mutation we have tested thus far

has been detectable by DGGE, and every individual tested has

had the results of DGGE confirmed by either restriction

digestion or sequencing of the PCR product. Two of our index

cases have had their status as MEN 2 patients established

initially by DGGE, one with the G620F mutation and another

with M918T.

A major limitation of DGGE is that neutral polymorphisms

will yield false-positive results. Thus, DGGE is inappropriate

for seeking exon 13 mutations, because the known pathogenic

mutation and a common neutral polymorphism [14, 41] occur at

consecutive residues in this exon; this mutation is a rare cause of

MEN 2, however. Another known polymorphism in exon 11

[40] of the RET gene is sufficiently distant from codon 634 that

a PCR product excluding the polymorphic site can be prepared

and analyzed.

Single-strand conformational polymorphism (SSCP) is an

alternative strategy for seeking mutations in defined regions of a

gene. SSCP conditions for all of the RET exons have recently

been published [41]. This method depends on the differencebetween the snap-back conformations of mutant and wild-type

DNA molecules subjected to heat denaturation and rapid cool-

ing. SSCP reportedly has a sensitivity of -80% and is easy to

perform. However, subtle differences in technique can have a

substantial impact on its results, and labeling of samples is

required [11]. Although DGGE conditions may be more diffi-cult to establish, once found, they are easily reproduced.

Alternative methods of mutation analysis are less attractive in

screening for MEN 2. Restriction digestion, chemical mismatchcleavage, and direct sequencing all require additional manipu-

lations after PCR and before electrophoretic analysis. Each

manipulation increases the opportunity for human error or

technical failure. In addition, some pathogenic mutations of

RET do not result in alteration of restriction sites. The accu-

mulation of heteroduplexes over the course of PCR amplifica-

tion results in reduced digestion, and distinguishing heterozy-

gosity from partial digestion is sometimes difficult. Finally,

restriction digestion is ill-suited to seeking mutations in new

index cases, because a large number of reactions must be used to

screen for all pathogenic mutations detectable by this approach.

In summary, we have developed DGGE assays for exons 10, 11,

and 16 of the RET gene. Mutations in these three exons arefound in >90% of MEN 2 cases. DGGE is particularly well

suited to the diagnosis of this syndrome because of the dominantgenetics involved and low prevalence of neutral polymorphism,

and because of the sensitivity and ease of performance and

interpretation of the assay. These tnethods allow detection of

most currently known pathogenic mutations in a simple, rapid

assay without the use of radioactive, fluorescent, or chemilumi-

nescent labels. They are suitable for both investigating members

of known kindreds and seeking pathogenic mutations in new

index cases.

602 Blank et a!.: DGGE to diagnose multiple endocrine neoplasia type 2

We thank the patients who participated in this study and their

physicians. Special thanks go to Julianne Imperato-McGinley,Murray Brennan, Jeffrey Friedman, and John Hall. This work

was supported in part by the Feer-Crawer Fund, Memorial

Sloan-Kettering Cancer Center. R.D.B. was supported by NIH

NRSA award F32-HG00084.

References1. Wolfe Hi, Melvin KEW, Cervi-SkinnerSJ, Al Saadi AA, Juliar iF,

Jackson CE, et al. C-cell hyperplasia preceding medullary thyroidcarcinoma. N EngI J Med 1973:289:437-41.

2. Carney IA, Go VLW, Sizemore GW, Hayles AB. Alimentary-tractganglioneuromatosis: a major component of the syndrome ofmultiple endocrine neoplasia, type 2b. N EngI i Med 1976;295:

1287-91.

3. Camey JA, Hayles AB. Alimentary tract manifestations of multipleendocrine neoplasia, type 2b. Mayo Clin Proc 1977;52:543-8.

4. Chi DO, Toshima K, Donis-Keller H, Wells SA Jr. Predictive testingfor multiple endocrine neoplasia type 2A (MEN 2A) based on the

detection of mutations in the RET protooncogene. Surgery 1994;

116:124-33.5. McMahon R, Mulligan LM, Healey CS, Payne Si, Ponder M,

Ferguson-Smith MA, et al. Direct, non-radioactive detection ofmutations in multiple endocrine neoplasia type 2A families. Hum

Mol Genet 1994;3:643-6.6. Wells SAJ, Chi DO. Toshima K. Dehner LP, Coffin CM, Dowton SB,

et al. Predictive DNA testing and prophylactic thyroidectomy in

patients at risk for multiple endocrine neoplasia type 2A. Ann Surg1994:220:237-50.

7. Xue F, Yu H, Maurer LH, Memoli VA, Nutile-McMenemy N, SchusterMK, et al. Germline RET mutations in MEN 2A and FMTC and theirdetection by simple DNA diagnostic tests. Hum Mol Genet 1994;

3:635-8.8. Donis-Keller H, Dou S, Chi 0, Carlson KM, Toshima K, Lairmore

TC, et al. Mutations in the RET proto-oncogene are associated withMEN 2A and FMTC. Hum Mol Genet 1993:2:851-6.

9. Romeo G, Ronchetto P, Luo Y, Barone V, Sen M, Cecchenini I, et

al. Point mutations affecting the tyrosine kinase domain of the RETproto-oncogene in Hirschsprung’s disease. Nature 1994;367:377-8.

10. Hofstra RMW, Landsvater RM, Ceccherini I, Stulp RP, StelwagenT, Luo Y, et al. A mutation in the RET proto-oncogene associatedwith multiple endocrine neoplasia type 2B and sporadic medullary

thyroid carcinoma. Nature 1994;367:375-6.11. Grompe M. The rapid detection of unknown mutations in nucleic

acids [Reviewl. Nature Genet 1993;5:111-7.

12. Ledger GA, Khosala 5, Lindor NM, Thibodeau SN, Gharib H.

Genetic testing in the diagnosis and management of multipleendocrine neoplasia type II. Ann Intern Med 1995;122:118-24.

13. Carlson KM, Dou 5, Chi 0, Scavarda N, Toshima K, Jackson CE, etal. Single missense mutation in the tyrosine kinase catalyticdomain of the RET protooncogene is associated with multipleendocrine neoplasia type 2B. Proc Nati Acad Sci U S A 1994;91:1579-83.

14. Eng C, Smith DP, Mulligan LM, Healey CS, Zvelebil Mi, Stone-

house Ti, et al. A novel point mutation in the tyrosine kinasedomain of the RET proto-oncogene in sporadic medullary thyroidcarcinoma and in a family with FMTC. Oncogene 1995:10:509-

13.

15. Mulligan LM, Kwok JBJ, Healey CS, Elsdon Mi, Eng C, Gardner E,et al. Germ-line mutations of the RET proto-oncogene in multipleendocrine neoplasia type 2A. Nature 1993;363:458-60.

16. Sheffield VC, Cox OR, Lerman LS, Myers RM. Attachment of a

40-base-pair G+C-rich sequence (GC-clamp) to genomic DNA

fragments by the polymerase chain reaction results in improveddetection of single-base changes. Proc NatI Acad Sci U S A1989;86:232-6.

17. Lincoln SE, Daly MJ, Lander ES. Primer: a computer program forautomatically selecting PCR primers (version 0.5). Cambridge,MA: Whitehead Institute for Biomedical Research, 1991.

18. Lairmore IC, Howe iR, Korte JA, Dilley WG, #{194}meL, Aine E, et al.Familial medullary thyroid carcinoma and multiple endocrine neo-plasia type 28 map to the same region of chromosome 10 asmultiple endocrine neoplasia type 2A. Genomics 1991;9:181-92.

19. Mole SE, Mulligan LM, Healey CS, Ponder BAJ, Tunnacliffe A.Localisation of the gene for multiple endocrine neoplasia type 2Ato a 480 kb region in chromosome band lOqll.2. Hum Mol Genet1993;2:247-52.

20. Norum RA, Lafreniere RG, O’Neal LW, Nikolai TF, Delaney iP,Sisson iC, et al. Linkage of the multiple endocrine neoplasia type2B gene (MEN2B) to chromosome 10 markers linked to MEN2A.Genomics 1990:8:313-7.

21. Eng C, Smith DP, Mulligan LM, Nagai MA, Healey CS, Ponder MA,et al. Point mutation within the tyrosine kinase domain of the RETproto-oncogene in multiple endocrine neoplasia type 2B andrelated sporadic tumours. Hum Mol Genet 1994:3:237-41.

22. Mulligan LM, Eng C, Healey CS, Ponder MA, Feldman GL, Li P, etal. A de novo mutation of the RET proto-oncogene in a patient withMEN 2A. Hum Mol Genet 1994:3:1007-8.

23. Zedenius i, Wallin G, Hamberger B, Nordenskjold M, Weber G,Larsson C. Somatic and MEN 2A de novo mutations identified in

the RET proto-oncogene by screening of sporadic MTCs. Hum MolGenet 1994;3:1259-62.

24. Schuffenecker I, Billaud M, Calender A, Chambe B, Ginet N,

Calmettes C, et al. RET proto-oncogene mutations in French MEN2A and FMTC families. Hum Mol Genet 1994;3:1939-43.

25. Takiguchi-Shirahama 5, Koyama K, Miyauchi A, Waksugi T, Oishi5, Takami H, et al. Germline mutations of the RET proto-oncogenein eight Japanese patients with multiple endocrine neoplasia type2A (MEN2A). Hum Genet 1995:95:187-90.

26. Rossel M, Schuffenecker I, Schlumberger M, Bonnardel C,Modigliani E, Gardet P, et al. Detection of a germline mutation at

codon 918 of the RET proto-oncogene in French MEN 2B families.Hum Genet 1995:95:403-6.

27. van Heyningen V. One gene-four syndromes [Reviewl. Nature1994:367:319-20.

28. Attie T, Pelet A, Sarda P, Eng C, Edery P, Mulligan LM, et al. A 7bp deletion of the RET proto-oncogene in familial Hirschsprung’sdisease. Hum Mol Genet 1994:3:1439-40.

29. Edery P, Lyonnet S, Mulligan LM, Pelet A, Dow E, Abel L, et al.Mutations of the RET proto-oncogene in Hirschsprung’s disease.Nature 1994;367:378-80.

30. Luo Y, Cecchenini I, Pasini B, Matera I, Bicocchi MP, Barone V, etal. Close linkage with the RET proto-oncogene and boundaries ofdeletion mutations in autosomal dominant Hirschsprung disease.Hum Mol Genet 1993:2:1803-8.

31. Mulligan LM, Eng C, Attie I, Lyonnet 5, Marsh Di, Hyland Vi, et al.Diverse phenotypes associated with exon 10 mutations of the RETproto-oncogene. Hum Mol Genet 1994;3:2163-7.

32. Bergholm U, Adami H-0, Bergstrom R, Akerstrom G, Group SMS.Clinical characteristics in sporadic and familial medullary thyroidcarcinoma: a nationwide study of 249 patients in Sweden from

1959 through 1981. Cancer 1989;63:1196-204.33. Block MA, iackson CE, Greenawald KA, Yott JB, Tashjian AH in.

Clinical characteristics distinguishing hereditary from sporadicmedullary thyroid carcinoma. Arch Sung 1980;115:142-8.

34. Easton OF, Ponder MA, Cummings T, Gagel RF, Hansen HH,

Clinical Chemirtiy 42, No. 4, 1996 603

Reichlin 5, et al. The clinical and screening age-at-onset distribu-tion for the MEN-2 syndrome. Am i Hum Genet 1989:44:208-15.

35. Neumann HPH, Berger DP, Sigmund G, Blum U, Schmidt 0,

Parmer Ri, et al. Pheochromocytomas, multiple endocrine neopla-sia type 2, and von Hippel-Lindau disease. N EngI i Med 1993;

329:1531-8.36. Ponder BAJ, Coffey R, Gagel RF, Semple P, Ponder MA, Pembney

ME, et al. Risk estimation and screening in families of patientswith medullany thyroid carcinoma. Lancet 1988;i:397-400.

37. Wells SA in, Baylmn SB, Linehan WM, Farrell RE, Cox EB, CooperCW. Provocative agents and the diagnosis of medullary carcinomaof the thyroid gland. Ann Sung 1978;188:139-41.

38. Kempter B, Ritter MM. Unexpected high calcitonin concentrations

after pentagastnin stimulation [Tech Brief]. Clin Chem 1991:37:473- 4.

39. Landsvaten RM, Rombouts AGM, te Meerman Gi, iansen Schill-horn-van Veen iM, Berends MJH, Geerdink RA, et al. The clinicalimplications of a positive calcitonin test for C-cell hyperplasia ingenetically unaffected members of an MEN2A kindred. Am i HumGenet 1993:52:335-42.

40. Bugatho MJM, Cote Gi, Khorana 5, Schultz PN, Gagel RF. Identi-fication of a polymorphism in exon 11 of the RET proto-oncogene.Hum Mol Genet 1994;3:2263.

41. Ceccherini I, Hofstra R, Luo Y, Stulp RP, Barone V, Stelwagen I, etal. DNA polymorphisms and conditions for SSCP analysis of the20 exons of the ret proto-oncogene. Oncogene 1994;9:3025-9.