Mechanisms of the biofungicide Serenade ( Bacillus subtilis QST713) in suppressing clubroot

This article was downloaded by: [Canadian Agriculture Library, Agriculture and Agri-FoodCanada], [Rachid Lahlali]On: 24 October 2011, At: 08:43Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registeredoffice: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK

Biocontrol Science and TechnologyPublication details, including instructions for authors andsubscription information:http://www.tandfonline.com/loi/cbst20

Mechanisms of the biofungicideSerenade (Bacillus subtilis QST713) insuppressing clubrootR. Lahlali a , G. Peng a , L. McGregor a , B.D. Gossen a , S.F. Hwangb & M. McDonald ca Saskatoon Research Centre, Agriculture and Agri-Food Canada,Saskatoon, Saskatchewan, Canadab Crop Diversification Centre North, Alberta Agriculture and RuralDevelopment, Edmonton, Alberta, Canadac Department of Plant Agriculture, University of Guelph, Guelph,ON, Canada

Available online: 14 Sep 2011

To cite this article: R. Lahlali, G. Peng, L. McGregor, B.D. Gossen, S.F. Hwang & M. McDonald(2011): Mechanisms of the biofungicide Serenade (Bacillus subtilis QST713) in suppressing clubroot,Biocontrol Science and Technology, 21:11, 1351-1362

To link to this article: http://dx.doi.org/10.1080/09583157.2011.618263

PLEASE SCROLL DOWN FOR ARTICLE

Full terms and conditions of use: http://www.tandfonline.com/page/terms-and-conditions

This article may be used for research, teaching, and private study purposes. Anysubstantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,systematic supply, or distribution in any form to anyone is expressly forbidden.

The publisher does not give any warranty express or implied or make any representationthat the contents will be complete or accurate or up to date. The accuracy of anyinstructions, formulae, and drug doses should be independently verified with primarysources. The publisher shall not be liable for any loss, actions, claims, proceedings,

demand, or costs or damages whatsoever or howsoever caused arising directly orindirectly in connection with or arising out of the use of this material.

RESEARCH ARTICLE

Mechanisms of the biofungicide Serenade (Bacillus subtilis QST713)in suppressing clubroot

R. Lahlalia, G. Penga*, L. McGregora, B.D. Gossena, S.F. Hwangb and

M. McDonaldc

aSaskatoon Research Centre, Agriculture and Agri-Food Canada, Saskatoon, Saskatchewan,Canada; bCrop Diversification Centre North, Alberta Agriculture and Rural Development,

Edmonton, Alberta, Canada; cDepartment of Plant Agriculture, University of Guelph, Guelph,ON, Canada

(Received 17 March 2011; final version received 24 August 2011)

Clubroot is a serious threat to canola production in western Canada. Thebiofungicide Serenade† (Bacillus subtilis QST713) reduced the disease substan-tially in controlled environment, but showed variable efficacy in field trials. Tobetter understand how this biofungicide works, two of the product components,i.e., B. subtilis and its metabolites (product filtrate), were assessed undercontrolled conditions for their relative contribution to clubroot control. Theinformation may be used to optimize the product formulation. The bacterium orproduct filtrate alone was only partially effective against clubroot, reducingdisease severity by about 60% relative to untreated controls. In contrast, Serenadecontrolled the disease by over 90%. This pattern of response was mirrored inquantitative PCR assessment on P. brassicae DNA within canola roots; the lowestand highest amounts of pathogen DNA were found in roots of Serenadetreatment (0.02 and 0.01 ng/g) and controls (0.52 and 13.35 ng/g), respectively,at 2 and 3 weeks after treatment. During this period, the amount of DNAchanged little in Serenade-treated roots but increased by almost 30-fold in thecontrol. The product filtrate or B. subtilis also reduced the pathogen DNAsubstantially (0.03�1.16 ng/g). Serenade decreased the germination and viabilityof P. brassicae resting spores only marginally. It is suggested that biofungicideSerenade controls clubroot largely via suppressing root-hair and cortical infectionby P. brassicae zoospores. The bacterial metabolites in the product formulationpossibly assist B. subtilis in rhizosphere colonization and clubroot control byminimizing the competition from other soil microbes.

Keywords: Plasmodiophora brassicae; Brassica napus; lipopeptide; surfactin;iturin A; fengycins

Introduction

Clubroot, caused by the obligate pathogen Plasmodiophora brassicae Woronin, is a

serious disease on crucifer crops worldwide (Dixon 2009). In 2003, the disease was

reported for the first time on canola (Brassica napus L.) in central Alberta, Canada

(Tewari et al. 2004), and by 2009, clubroot had been found in more than 456 canola

fields in the province (Strelkov, Manolii, Zequera, Manolii, and Hwang 2010). There

are about 4.7 million hectares of canola in western Canada yearly, and clubroot has

*Corresponding author. Email: Gary.Peng@agr.gc.ca

Biocontrol Science and Technology,

Vol. 21, No. 11, November 2011, 1351�1362

ISSN 0958-3157 print/ISSN 1360-0478 online

# 2011 Taylor & Francis

http://dx.doi.org/10.1080/09583157.2011.618263

http://www.tandfonline.com

now become a major threat to canola production in the region (Howard, Strelkov,

and Harding 2010).

The life cycle of P. brassicae can generally be divided into two stages: (i) a

primary stage consisting of germination of resting spores, infection of root hairs by

primary zoospores, and development of primary plasmodia and then secondary

zoospores; and (ii) a secondary phase consisting of cortical infection by secondary

zoospores, colonization of cortex, and development of secondary plasmodia that

stimulate root enlargement and gall formation (Ingram and Tommerup 1972). The

short interval between the emergence of primary zoospores and root-hair infection is

part of the life cycle where the pathogen is most vulnerable to adverse environmental

conditions (Dixon 2009).

Recommendations for managing clubroot include fungicide drenches (Naiki and

Dixon 1987), soil liming (Webster and Dixon 1991), and use of resistant cultivars and

crop rotation (Donald and Porter 2009). Few fungicides are highly effective (Donald

and Porter 2009), and liming is impractical on a large acreage of canola in western

Canada. Most canola cultivars were highly susceptible (Strelkov, Tewari, and Smith-

Degenhardt 2006), but resistant cultivars are now available commercially although

their durability is unknown. The resistance to clubroot is generally race specific

(Diederichsen, Beckmann, Schondelmeier, and Dreyer 2006) and can be eroded when

pathogen race structure changes.Microorganisms have been explored for biocontrol of clubroot, including the

fungi Phoma glomerata (Arie, Kobayashi, Kono, Gen, and Yamaguchi 1999),

Heteroconium chaetospira (Nairsawa, Tokumasu, and Hashiba 1998), and

Acremonium alternatum (Jaschke, Dugassa-Gobena, Karlovsky, Vidal, and Ludw-

ing-Muller 2010). None of these candidates has been registered for commercial uses.

Several biofungicides available in Canada were assessed recently for clubroot control,

and Serenade† ASO (Bacillus subtilis QST713) was highly effective under controlled-

environment conditions, but inconsistent in field trials (Peng et al. 2011). The

objective of this study was to better understand how this biofungicide worked by

assessing two of the components in the Serenade product for their relative

contribution to clubroot biocontrol, including the impact on resting spores and

suppression of pathogen infection and development in canola roots. The information

can be useful to improving product formulation and delivery for optimal efficacy.

Materials and methods

Preparation of Serenade components and pathogen inoculum

To prepare a biofungicide treatment, the Serenade† ASO formulation was diluted to

a 5% concentration (v/v) with sterile deionized water (SDW). The dilution had about

5�107 colony forming units (CFU) mL�1 of B. subtilis cells plus other formulation

components at a 5% concentration. Product filtrates were prepared by filtering the

5% Serenade suspension through a 0.22-mm membrane (Millipore Corp, Billerica,

MA). The filtrate would include three classes of lipopeptides (surfactins, iturins, and

fengycins) based on the information provided by AgraQuest Inc. (manufacturer) and

was kept at 48C until use. Because it was impossible to separate bacterial cells from a

mixture of powdery additives in the Serenade formulation, the B. subtilis QST713

strain was isolated and its inoculum produced on a Bacillus medium (Philip,

1352 R. Lahlali et al.

Lyengar, and Venkobachar 1998) agar at 258C for 48 h; bacterial cultures were

scraped off the medium agar and suspended in SDW to about 5�107 CFU mL�1

based on a plating method.

About 3 g of clubroot galls were cut into small pieces (0.5�0.5�0.5 cm),immersed in 50 mL of SDW in a beaker for 2 h to soften the tissue, and homogenized

in a Waring blender for 1 min. The resulting slurry was filtered through eight layers

of 0.3-mm nylon cloth, centrifuged at 3500�g for 10 min, and the supernatant was

discarded. This process was repeated, and resulting spore pellets were resuspended

with SDW and adjusted to 1�107 spores mL�1 using a haemocytometer.

Resting spores used for germination tests and viability staining were prepared

using the methods described by Strelkov et al. (2006) and Sundelin et al. (2010) with

slight modifications. Briefly, after centrifugation, the pellets of resting spores wereresuspended in 5 mL of a 50% sucrose solution and centrifuged at 3500�g for 10

min. The resulting supernatant was transferred into 30 mL of SDW in a 50-mL

centrifuge tube, and centrifuged again at 3500�g for 10 min. This time, the

supernatant was discarded and resting spores collected in the pellet. The pellet was

re-suspended in 5 mL of SDW and centrifuged at 3500�g for 10 min to remove the

sucrose. The extracted resting spores were washed three more times with streptomy-

cin (100 mg mL�1)-amended SDW plus 10 min of centrifugation at 3500�g with

each washing to minimize bacterial contamination. Pellets of the washed restingspores were stored at �208C until use.

Effect of Serenade and its components on clubroot development

Plastic root trainers (3.5�20 cm, diameter�depth), also called ‘conetainers’ (Stuewe

and Sons Inc., Corvallis, OR) were filled with Sunshine #3 soil-less planting mix (pH

5.8�6.2, SunGro Horticulture, Vancouver, BC) and placed on a plastic rack (14 rows

with 7 holes per row, holds a total of 98 conetainers). The mix was amended with 1% (v/

w) of 16:8:12 (N:P:K) control-released fertilizer, and soaked twice with water (pH 6.3)prior to seeding for even water absorbance during treatment. Each conetainer was pre-

inoculated with 5 mL of a P. brassicae resting-spore suspension (1�107 mL�1).

Four treatments were applied as a soil drench (25 mL/plant) 2 days after the soil

infestation with P. brassicae resting spores: (i) Serenade product formulation, (ii) a

cultural suspension of B. subtilis QST713, (iii) Serenade product filtrate, and (iv) a

water control (untreated). Immediately after the treatment, two canola seeds (cv.

Fortune RR) were planted at 1 cm depth in each conetainer and subsequently

thinned to one seedling at the one true-leaf stage. The plants were maintained for 4�6weeks in a growth cabinet with a 14-h daily photoperiod (500 mmol m�2 s�1) at 23/

188C (day/night), and watered daily to maintain a high level of soil moisture. Each

plant was assessed for clubroot severity using a 0 to 3 scale described by Strelkov

et al. (2006).The trial was laid out in a randomized complete block design and

replicated at three different times (blocks) with seven plants in each block. A disease

severity index (DSI) was calculated over the seven plants using the following

formula:

DSI %ð Þ ¼P

rating classð Þ # plants in the rating classð Þ½ �#plants in treatmentð Þ 3ð Þ

� 100

Biocontrol Science and Technology 1353

Effect on infection and development of P. brassicae in canola roots

The impact of the treatments on infection and early development of the pathogen

was examined using a Quantitative PCR (q-PCR) assay. Roots (including root hairs)

of three seedlings (about 0.2 g) were sampled from each treatment at 2 and 3 weeks

after treatment (WAT), washed repeatedly in tap water to remove debris and

pathogen propagules from the root surface, cut into 1-cm pieces, frozen in liquid

nitrogen, and stored at �208C until use. Roots from positive and negative control

plants (with and without the pathogen inoculation) were processed similarly for

comparisons. Genomic DNA of P. brassicae in the root samples was extracted using

a DNeasy Plant Mini Kit (Qiagen Canada, Inc., Montreal, QC) following

manufacturer’s protocols. The primers Pb4-1 (TACCATACCCAGGGCGATT)

and PbITS6 (CAACGAGTCAGCTTGAATGC) were used to amplify a product

of about 139 bp from the P. brassicae DNA (Sundelin et al. 2010). The DNA was also

extracted directly from P. brassicae resting spores and non-inoculated canola roots

using the same protocol, and amplifications were carried out in triplicates in a total

volume of 20 mL using a StepOne real-time thermocycler (ABI, Streets Ville, ON)

equipped with the StepOne v2.1 software as follows: 10 min at 958C (an initial

denaturation), followed by 50 cycles of 15 s at 958C, and 1 min at 608C. Each of the

20-mL reaction mixture included 2-mL genomic DNA template (20 ng ml�1), 0.1 mL

each of the primers (50 nM), 10 mL 2�SYBR Green master mix (ABI), and 7.8 mL

SDW. Negative controls contained the same mixture with 2 mL canola root extract

(non-inoculated). A template control (water only) was included in every q-PCR

assay. A standard curve made with a serial dilution of P. brassicae DNA (from

resting spores) of known concentrations ranging from 1 to 1�10�3 ng/mL was

included for each run, with fluorescence checked after each thermo cycle. After the

amplification, a melting-curve analysis as well as electrophoresis (on a 2% gel) were

performed to ensure that only the target PCR product had been amplified.

Effect of the biofungicide Serenade on germination of P. brassicae resting spores

Preliminary results indicated that the product filtrate had no effect on germination of

resting spores (data not shown). This experiment was designed to assess if the

Serenade product would suppress the germination effectively. Because resting spores

require stimulation from host root exudates for germination (Suzuki, Matsumia,

Ueno, and Mizutani 1992; Kowalski and Bochow 1996), the protocol by Macfarlane

(1970) was adopted to produce canola root-exudate solutions for this study. Briefly,

canola seeds (cv. Fortune RR) were disinfected in 70% ethanol for 5 min, 0.6%

NaOCl for 30 min, rinsed in SDW, and 50 disinfested seeds were placed on a layer of

cheesecloth fixed to a styrofoam ring on the top of a glass Petri dish (10�7.5 cm,

diameter�depth). The dish was filled with the Hoagland’s nutrient solution (pH 5.8)

to a level that almost touched the cheesecloth. Roots grew into the nutrient solution

within 2 days, and the seedlings were kept in a growth chamber at 258C with a 16-h

photoperiod (500 mmol m�2 s�1) for 7�14 days. The solution was then adjusted to

pH 6.0, filtered through a 0.22-mm membrane (Millipore Corp.) for sterilization, and

stored at 48C until use. From this point, the nutrient solution was called the root-

exudate solution (RES).

Resting spores were added to RES amended with 5% of Serenade product, and to

a RES alone as controls. The fungicide fluazinam (Allegro 500F, ISK Biosciences

Corp., Concord, OH) at a 0.5-mL L�1 concentration was tested similarly for

comparisons. Resting spores were suspended (5�105 mL�1) in amended RES in 15-

mL Falcon tubes and incubated at 258C in darkness. The germination was examined

at 2-day intervals for up to 10 days over five replicates of each treatment or control.

Samples were stained with acetic-orcein (1%) or acetic-carmine (1%) (Sigma-Aldrich

Canada, Edmonton, AB) on glass slides, and the germination counted over 100

spores for each replicate using the protocol described by Naiki, Dixon, and Ikegami

(1987) at 1000� magnification using a light microscope. The empty or shrivelled

spores were considered as having germinated (Figure 1).

Effect of the biofungicide Serenade on viability of P. brassicae resting spores

This experiment was designed to verify the germination observed in previous the

trial by suspending P. brassicae resting spores in SDW amended with the Serenade

product (5%) or in SDW alone (control) for 2�10 days. Unlike in the RES, the

resting spores could not germinate during the process and the viability was

assessed based on reactions to Evan’s blue (Sigma-Aldrich Canada). At 2-day

intervals, a 20-mL sample was taken from each of the three replicates, stained for

10 min on a glass slide, and examined at 400� using a light microscope. Evan’s

blue would only stain dead spores (Tanaka, Kochi, Kunita, Ito, and Kameya-Iwaki

1999); spores with a blue cell wall and reddish cytoplasm (Figure 2A) were

considered dead and those that did not take up the stain were counted as being

alive (Figure 2B).

Figure 1. Germinated and non-germinated resting spores of Plasmodiophora brassicae in a

canola root-exudate solution. Note that germinated spores are empty and often shrivelled

(arrows). Scale bars �5 mm.

Statistical analysis

Analysis of variance (ANOVA) was conducted to assess the impact of the

biofungicide Serenade and its components on DSI and resting spore germination

or viability using SAS (version 9.1, SAS Institute Inc. Cary, NC), a LSD test was

used to separate means when ANOVA was significant (P50.05). All percentage data

were transformed with Arcsine Square Root prior to statistical analysis to obtain

normal distribution, but non-transformed means are reported in results for ease of

discussion.

Results

Effect of Serenade and its components on clubroot development

On average, the Serenade product formulation reduced clubroot by more than 90%

relative to the pathogen control (Table 1), whereas the product filtrate or B. subtilis

cultural suspension had only about 60% efficacy. At 4�6 WAT, root enlargement was

substantial in pathogen controls, noticeable in bacterial or product-filtrate treatment,

but generally absent in the Serenade treatment (Figure 3). No clubroot symptom was

seen on non-inoculated plants.

Figure 2. Dead (A) and living (B) resting spores of Plasmodiophora brassicae stained with

Evan’s blue. Note that the cell wall and cytoplasm of dead spores were stained in blue and pale

red colours, respectively, whereas the living cells were not stained. Scale bars �5 mm.

Effect on infection and development of P. brassicae in canola roots

P. brassicae DNA samples (1�10�3 ng mL�1) extracted from resting spores showed

a single PCR amplicon with 139 bp (data not shown). There was a strong linear

relationship between cycle threshold values and lg DNA concentrations in root

samples (y � �5.41 lg [x]�23.24; r2�0.997[0]). Threshold fluorescence signal for

the DNA from pure pathogen spores was 0.22 over the concentration range

examined.

The q-PCR assay also detected the single PCR amplicon in canola roots

inoculated with P. brassicae, but not in the non-inoculated roots. This confirmed the

presence of the pathogen in the roots or root hairs at 2 or 3 WAT. Additionally, a

melt-curve analysis showed only one peak in q-PCR results, confirming the

specificity of the primers used. The amount of pathogen DNA detected in inoculated

roots treated with Serenade or its components was substantially lower (PB0.0001)

than that in pathogen-inoculated roots (control) at 2 and 3 WAT (Table 2). The

amount of DNA increased substantially in roots of the pathogen control between 2

and 3 WAT, only slightly with B. subtilis, but not in roots treated with the Serenade

product or product filtrate.

Table 1. Effect of Serenade and its components on clubroot incidence (%) and disease severity

index (DSI) on canola (n�3).

Treatment Incidence (%) DSI (%)

Untreated control 100b 100c

B. subtilis (cultural suspension) 81b 40b

Product filtrate 71b 39b

Serenade 19a 6a

Means followed by the same letter do not differ based (Protected LSD, P�0.05).

Figure 3. Clubroot development on the susceptible canola cultivar Fortune RR received a

soil-drench treatment of (from left to right): Water (control), Bacillus subtilis QST713 cultural

suspension, Serenade product formulation, and product filtrate.

Effect of the biofungicide Serenade on germination of P. brassicae resting spores

Serenade reduced the germination only slightly relative to the water control, and the

germination reached over 80% after 10-day incubation in a RES amended with 5% of

the Serenade product (Figure 4). In contrast, the fungicide fluazinam was highly

effective, inhibiting the germination almost completely during the entire 10-day

period.

Effect of the biofungicide Serenade on viability of P. brassicae resting spores

The exposure to Serenade reduced the viability of P. brassicae resting spores slightly

(Table 3) relative to the water control, but increasing the exposure duration from 2 to

10 days did not affect the results substantially. With 10-day exposure, the

biofungicide decreased the viability by about 20% when compared to the water

control.

Discussion

Clubroot is a difficult disease to control due to the persistence of resting spores in

soil and a complex infection process with the pathogen (Dixon 2009). Biofungicides

can be reasonable candidates against clubroot because some of the agents can

competitively colonize the rhizosphere (Kinsinger, Shirk, and Fall 2003; Bais, Fall,

and Vivanco 2004), thus providing direct root protection. Previous studies have

1 2 3 4 5 6 7 8 9 10Time (days)

) Water (control)

Serenade productFluazinam

Figure 4. Germination of Plasmodiophora brassicae resting spores in a canola root-exudate

solution amended with the biofungicide Serenade or fungicide fluazinam over a 10-day period.

Table 2. The amount of Plasmodiophora brassicae genomic DNA detected in roots treated

with Serenade and its components at 2 and 3 weeks after treatments (WAT) (n�3).

P. brassicae DNA (ng/g of root)

Treatment 2 WAT 3 WAT

Control 0.52a 13.35a

B. subtilis (cultural suspension) 0.18b 1.16b

Product filtrate 0.04c 0.03c

Serenade 0.02c 0.01c

Means in a column with the same letters do not differ (Protected LSD, P�0.05).

shown the potential of several soil microorganisms or their metabolites against

clubroot (Arie et al. 1999; Narisawa, Tokumasu, and Hashiba 1998; Joo et al. 2004),

and in a recent study, the commercial biofungicides Serenade† (B. subtilis QST713)

and Prestop† (Gliocladium catenulatum Gilman & Abbott.) were found promising

when applied as a soil drench in controlled environment (Peng, Gossen, Strelkov,

Hwang, and McDonald 2009). It has been known that B. subtilis produces

lipopeptides, including surfactin and iturin A (Romero et al. 2007; Ongena and

Jacques 2008) and these antibiotics were detected in the rhizosphere of cucumber

treated with the B. subtilis QST713 (Kinsella, Schulthess, Morris, and Stuart 2009).

However, it was not clear if these antibiotics in the Serenade formulation would be

sufficient for protecting canola roots or root hairs from infection by zoospores, and if

they are of any assistance to the B. subtilis inoculum in the biocontrol of clubroot.

This information can be useful to optimization of fermentation or formulation

processes for maximum efficacy.

Throughout the study, the product filtrate or B. subtilis alone was only partially

effective, and Serenade was consistently more effective than any of the components.

Possibly the secondary metabolites facilitated the performance of B. subtilis by

minimizing the competition from other soil microbes, thus enabling the bacterium

to establish rapidly on the root surface or in the rhizosphere (Kinsinger et al.

2003). The bacterial colonies may feed on root exudates in the rhizosphere

and continue producing lipopeptides (Kinsella et al. 2009), thus sustaining the root

protection. The lipopeptide surfactin produced by this B. subtilis QST713 can also

be a powerful surface-active agent (Peypoux, Bonmatin, and Wallach 1999),

potentially further adding in biocontrol of clubroot by interfering P. brassicae

zoospore activities (Hildebrand and McRae 1998). Therefore an enhanced amount

of lipopeptides in the Serenade formulation, possibly via an improved fermenta-

tion/formulation processes may increase efficacy of clubroot control by this

biofungicide.

The lipopeptides produced by B. subtilis QST713 are powerful antibiotics and

some B. subtilis strains may also produce fungal cell-wall degrading enzymes and

antifungal volatiles (Arrebola, Sivakumar, and Korsten 2009). However, the

Serenade biofungicide or product filtrate (data not shown) had only limited effect

on the germination of P. brassicae resting spores. In contrast, the fungicide

fluazinam inhibited the spore germination almost completely. In a previous study,

the fungicide calcium cyanamide also inhibited the germination of resting spores

completely (Naiki and Dixon 1987). These results suggest that, unlike these

fungicides, the lipopeptides and B. subtilis QST713 inoculum in the Serenade

product are not sufficiently effective against P. brassicae resting spores. The slightly

Table 3. The viability (%) of Plasmodiophora brassicae resting spores exposed to Serenade

(n �2).

Duration of exposure (days)

Treatment 2 4 6 8 10

Control 96b 91b 92b 87b 84b

Serenade 74a 77a 75a 72a 67a

Means in a column with the same letter do not differ (Protected LSD, P�0.05).

reduced germination may be connected to the lower viability of resting spores

exposed to the product. The lipopeptides, however, may be more antagonistic

towards zoospores due to greater vulnerability (Dixon 2009). In a soil-drench

treatment as used in the current study, lipopeptides in Serenade or produced by B.

subtilis in the rhizosphere (Kinsella et al. 2009) can be directly toxic to zoospores.

In addition, the surfactant effect of surfactin may further add to the interference

with zoospore activities. Although the impact on zoospores is still a deduction

because direct assessment was not reliable due to unpredictability and swiftness of

zoospore release, the low effect on pathogen resting spores indicates additional

mechanisms are at works. In contrast, many fungicides inhibit or kill resting spores.

To target both primary and secondary zoospores, this biofungicide may need to

remain effective in the soil for some time, which may warrant further investigations

in product formulation and delivery timing in relation to duration of the product

activity in field soils.

The q-PCR assay adopted from Sundelin et al. (2010) provided rapid detection

and quantification of P. brassicae in early stages of root infection. A separate study

showed that the peak of canola root-hair infection would occur at about 2 WAT at

208C (Sharma, Gossen, and McDonald 2010). The significant less amounts of P.

brassicae DNA at 2 and 3 WAT in canola roots treated with Serenade or its

components, relative to the pathogen control, indicates that these treatments possibly

control clubroot via the reduction of root-hair and cortical infection. The amount of

P. brassicae DNA detected at this stage was correlated with the frequency of root-

hair infection (r�0.86) assessed microscopically (data not shown). At 3 WAT, the

amount of P. brassicae DNA in the pathogen control had increased substantially

from 2 WAT, which potentially reflected greater infection of cortical tissues and the

development of P. brassicae plasmodia in the cortex. In contrast, the DNA in roots

treated with Serenade or its components increased only slightly or not at all within

the period, indicating a lower level of infection and pathogen development. The

amount of P. brassicae DNA at 3 WAT was positively correlated with final clubroot

severity index (r�0.99, P50.001), confirming that the greater amount of infection

or pathogen development also contributed to the disease severity observed later. The

q-PCR technique provides an early assessment on P. brassicae infection and

development in response to biocontrol treatments.

To control clubroot, a treatment may be aimed at killing or inhibiting resting

spores, preventing infection from zoospores, or blocking pathogen development in

root hairs and cortical tissues (Naiki and Dixon 1987). Our results indicate that the

biofungicide Serenade has limited impact on P. brassicae resting spores and its

efficacy on clubroot is possibly due to the antibiotic and surfactant effects on highly

sensitive zoospores. The partial efficacy of the product filtrate or bacterial inoculum

towards clubroot may point to an additive effect between the two components; the

metabolites (lipopeptides) in the Serenade product, in addition to their direct impact

on zoospores, may also assist B. subtilis in colonizing the rhizosphere by minimizing

the competition from other soil microbes. It may be desirable to optimize lipopeptide

yields in the Serenade product by tweaking the fermentation process for maximum

efficacy against clubroot. Product formulation and delivery may also be investigated

for better targeting the peaks of zoospore releases.

Acknowledgements

We thank Terry Tran and Jehn Francisco for technical assistance. We also acknowledgeSaskatchewan Agriculture Development Fund and SaskCanola for partial funding support tothis research.

References

Arie, T., Kobayashi, Y., Kono, Y., Gen, O., and Yamaguchi, I. (1999), ‘Control of Clubroot ofCrucifers by Phoma glomerata and Its Product Epoxydon’, Pesticide Science, 55, 602�604.

Arrebola, E., Sivakumar, D., and Korsten, K. (2009), ‘Effect of Volatile Compounds byBacillus Strains on Post-harvest Decay in Citrus’, Biological Control, 53, 122�128.

Bais, H.P., Fall, R., and Vivanco, J.M. (2004), ‘Biocontrol of Bacillus subtilis against Infectionof Arabidopsis Roots by Pseudomonas syringae is Facilitated by Biofilm Formation andSurfactin Production’, Plant Physiology, 134, 307�319.

Diederichsen, E., Beckmann, J., Schondelmeier, J., and Dreyer, F. (2006), ‘Genetics ofClubroot Resistance in Brassica napus ‘‘Mendel’’’, Acta Horticulturae, 706, 307�311.

Dixon, G.R. (2009), ‘Plasmodiophora brassicae in Its Environment’, Journal of Plant GrowthRegulation, 28, 1�17.

Donald, C., and Porter, I. (2009), ‘Integrated Control of Clubroot’, Journal of Plant GrowthRegulation, 28, 289�303.

Hildebrand, P.D., and McRae, K.B. (1998), ‘Control of Clubroot Caused by Plasmodiophorabrassicae with Nonionic Surfactants’, Canadian Journal of Plant Pathology, 20, 1�11.

Howard, R.J., Strelkov, S.E., and Harding, M.W. (2010), ‘Clubroot of Cruciferous Crops �New Perspectives on an Old Disease’, Canadian Journal of Plant Pathology, 32, 43�57.

Ingram, D.S., and Tommerup, I.C. (1972), ‘The Life History of Plasmodiophora brassicaeWoron’, Proceeding of the Royal Society [Biol], 108, 103�112.

Jaschke, D., Dugassa-Gobena, D., Karlovsky, P., Vidal, S., and Ludwing-Muller, J. (2010),‘Suppression of Clubroot (Plasmodiophora brassicae) Development in Arabidopsis thalianaby the Endophytic Fungus Acremonium alternatum’, Plant Pathology, 59, 100�111.

Joo, G.J., Kim, Y.M., Kim, J.W., Kim, W.C., Rhee, I.K., Choi, Y.H., and Kim, J.H. (2004),‘Biocontrol of Cabbage Clubroot by the Organic Fertilizer Using Streptomyces sp. AC-3’,Korean Journal of Microbiology and Biotechnology, 32, 172�178.

Kinsella, K., Schulthess, C.P., Morris, T.M., and Stuart, J.D. (2009), ‘Rapid Quantification ofBacillus Antibiotics in the Rhizosphere’, Soil Biology and Biochemistry, 41, 374�379.

Kinsinger, R.F., Shirk, M.C., and Fall, R. (2003), ‘Rapid Surface Motility and BiofilmFormation in Bacillus subtilis is Dependent on Extracellular Surfactin and Potassium Ion’,Journal of Bacteriology, 185, 5627�5631.

Kowalski, K., and Bochow, H. (1996), ‘Observations on the Behaviour of Resting Spores ofPlasmodiophora brassicae in the Presence of Cruciferous and Non-cruciferous Plant Roots’,Acta Horticulturae, 407, 419�422.

Macfarlane, I. (1970), ‘Germination of Resting Spores of Plasmodiophora brassicae’,Transaction British Mycological Society, 55, 97�112.

Naiki, T., and Dixon, G.R. (1987), ‘The Effects of Chemicals on Developmental Stages ofPlasmodiophora brassicae (clubroot)’, Plant Pathology, 36, 316�327.

Naiki, T., Dixon, G.R., and Ikegami, H. (1987), ‘Quantitative Estimation of SporeGermination of Plasmodiophora brassicae’, Transaction British Mycological Society, 89,569�609.

Narisawa, K., Tokumasu, S., and Hashiba, T. (1998), ‘Suppression of Clubroot Formation inChinese Cabbage by the Root Endophytic Fungus, Heteroconium chaetospira’, PlantPathology, 47, 206�210.

Ongena, M., and Jacques, P. (2008), ‘Bacillus Lipopeptides: Versatile Weapons for PlantDisease Biocontrol’, Trends in Microbiology, 16, 115�125.

Peng, G., Gossen, B.D., Strelkov, S.E., Hwang, S.F., and McDonald, M.R. (2009), ‘Effect ofSelected Biofungicides for Control of Clubroot on Canola’, Canadian Journal of PlantPathology, 31, 145�146.

Peng, G., McGregor, L., Lahlali, R., Gossen, B.D., Hwang, S.F., Adhikari, K.K., Strelkov,S.E., and McDonald, M.R. (2011), ‘Potential Biological Control of Clubroot on Canolaand Crucifer Vegetable Crops’, Plant Pathology, 60, 566�574.

Peypoux, F., Bonmatin, J.M., and Wallach, J. (1999), ‘Recent Trend in the Biochemistry ofSurfactin’, Applied Microbiology and Biotechnology, 51, 553�563.

Philip, L., Lyengar, L., and Venkobachar, C. (1998), ‘Cr (VI) Reduction by Bacillus CoagulansIsolated from Contaminated Soils’, Journal of Environmental Engineering, 124, 1165�1170.

Romero, D., De Vicente, A., Rakotoaly, R.H, Dufour, S.E., Veening, J.W., Arrebola, E.,Cazorla, F.M., Kuipers, O.P., Paquot, M., and Perz-Garcia, A. (2007), ‘The Iturin andFengycin Families of Lipopeptides are Key Factors in Antagonism of Bacillus subtilistoward Podosphaera fusca’, Molecular Plant-Microbe Interactions, 20, 430�440.

Sharma, K., Gossen, B.D., and McDonald, M.R. (2010), ‘Effect of Temperature on Clubroot(Plasmodiophora brassicae) Symptom Initiation on Shanghai pak choy’, Phytopathology,,100 S, S117.

Strelkov, S.E., Tewari, J.P., and Smith-Degenhardt, E. (2006), ‘Characterization ofPlasmodiophora brassicae Populations from Alberta, Canada’, Canadian Journal of PlantPathology, 28, 467�474.

Strelkov, S.E., Manolii, V.P., Zequera, M., Manolii, E., and Hwang, S.F. (2010), ‘Incidence ofClubroot on Canola in Alberta in 2009’, Canadian Plant Disease Survey, 90, 123�125.

Sundelin, T., Christensen, C.B., Larsen, J., Møller, K., Lubeck, M., Bødker, L., and Jensen, B.(2010), ‘In planta Quantification of Plasmodiophora brassicae Using Signature Fatty Acidsand Real Time PCR’, Plant Disease, 94, 432�438.

Suzuki, K., Matsumia, E., Ueno, Y., and Mizutani, J. (1992), ‘Some Properties ofGermination-stimulating Factors from Plants for Resting Spores of Plasmodiophorabrassicae’, Annual Phytopathological Society of Japan, 58, 699�705.

Tanaka, S., Kochi, S., Kunita, H., Ito, S.I., and Kameya-Iwaki, M. (1999), ‘Biological Modeof Action of the Fungicide, Flusulfamide, against Plasmodiophora brassicae (clubroot)’,European Journal of Plant Pathology, 105, 577�584.

Tewari, J.P., Orchard, D., Hartman, M., Lange, R., Turkington, T.K., and Strelkov, S. (2004),‘First Report of Clubroot of Canola Caused by Plasmodiophora brassicae in the CanadianPrairies’, Canadian Journal of Plant Pathology, 26, 228�229.

Webster, M.A., and Dixon, G.R. (1991), ‘Calcium, pH and Inoculum ConcentrationInfluencing Colonisation by Plasmodiophora brassicae’, Mycological Research, 95, 65�73.

Mechanisms of the biofungicide Serenade ( Bacillus subtilis QST713) in suppressing clubroot

Documents

Production of Milk-Clotting Protease from Bacillus subtilis

Deacetylation of p53 induces autophagy by suppressing Bmf expression

Special Issue: Clubroot, a persistent threat to Swedish oilseed rape production

Xanthan Induces Plant Susceptibility by Suppressing Callose Deposition1(OA

How mathematical modelling elucidates signalling in Bacillus subtilis

Selenium‑enriched Bacillus subtilis yb‑114246 improved

Erythromycin Ameliorates Bleomycin-induced Lung Injury by Suppressing Alveolar Macrophages Activity

Anticholinesterases induce multigenic transcriptional feedback response suppressing cholinergic neurotransmission

Molecular mechanisms involved in Bacillus subtilis biofilm formation

SUPPRESSING HARMONICS IN STANDING-WAVE THERMOACOUSTIC ENGINE

The Cytokine IL-22 Promotes Pathogen Colonization by Suppressing Related Commensal Bacteria

Role of heterochromatin in suppressing subtelomeric recombination in fission yeast

Arginase Induction Represses Gall Development During Clubroot Infection in Arabidopsis

Bacillus subtilis Spore Surface Display Technology

Bacillus Subtilis Bacillus Stearotermofilus Bacillus Subtilis

The methionine salvage pathway in Bacillus subtilis

Suppressing Flow-Induced Vibrations by Parametric Excitation

Gene Network Holography of the Soil Bacterium Bacillus subtilis

The messenger ribonucleic acid content of Bacillus subtilis 168

Transcriptional regulation of the spo0F gene of Bacillus subtilis