Verrucophora farcimen gen. et sp. nov. (Dictyochophyceae, Heterokonta)-a bloom-forming ichthyotoxic...

VERRUCOPHORA FARCIMEN GEN. ET SP. NOV. (DICTYOCHOPHYCEAE,HETEROKONTA)—A BLOOM-FORMING ICHTHYOTOXIC FLAGELLATE FROM THE

SKAGERRAK, NORWAY1

Bente Edvardsen2,3, Wenche Eikrem3

Department of Biology, University of Oslo, P.O. Box 1066 Blindern, NO-0316 Oslo, Norway

Norwegian Institute for Water Research, Gaustadalleen 21, NO-0349 Oslo, Norway

Kamran Shalchian-Tabrizi, Ingvild Riisberg

Department of Biology, University of Oslo, P.O. Box 1066 Blindern, NO-0316 Oslo, Norway

Geir Johnsen

Department of Biology, Norwegian University of Sciences and Technology, Realfagbygget, NO-7491 Trondheim, Norway

Lars Naustvoll

Institute of Marine Research, Flødevigen, NO-4817 His, Norway

and Jahn Throndsen

Department of Biology, University of Oslo, P.O. Box 1066 Blindern, NO-0316 Oslo, Norway

Since 1998, a heterokont flagellate initially namedChattonella aff. verruculosa has formed recurrentextensive blooms in the North Sea and the Skager-rak, causing fish mortalities. Cells were isolatedfrom the 2001 bloom off the south coast of Norway,and monoalgal cultures were established and com-pared with the Chattonella verruculosa Y. Hara etChihara reference strain NIES 670 from Japan. Thecells in Norwegian cultured isolates were very vari-able in size and form, being large oblong (up to34 lm long) to small rounded (5–9 lm in diameter)with two unequal flagella, numerous chloroplasts,and mucocysts. The SSU and partial LSU rDNAsequences of strains from Norway and Japan werecompared and differed by 0.4% (SSU) and 1.3%(LSU), respectively. Five strains from Norway wereidentical in the LSU rDNA region. Phylogeneticanalyses based on heterokont SSU and concatenatedSSU + LSU rDNA sequences placed C. aff. verrucul-osa and the Japanese C. verruculosa within the cladeof Dictyochophyceae, with the picoflagellate Florenci-ella parvula Eikrem as the closest relative. Ultrastruc-ture, morphology, and pigment compositionsupported this affinity. We propose the nameVerrucophora farcimen sp. et gen. nov. for this flagellateand systematically place it within the class Dictyoch-ophyceae. Our studies also show that C. verruculosafrom Japan is genetically and morphologically dif-ferent but closely related to V. farcimen. The speciesis transferred from the class Raphidophyceae to the

class Dictyochophyceae and renamed Verrucophoraverruculosa. We propose a new order, Florenciellales,to accommodate V. farcimen, V. verruculosa, andF. parvula.

Key index words: carotenoids; Chattonella; Dictyo-chophyceae; harmful algae; LSU rDNA; new taxon;phylogeny; SSU rDNA; ultrastructure

Abbreviations: GG, gamma; GTR, general timereversible; II, proportion of invariable sites;MCMC, Markov chain Monte Carlo; ML, maximumlikelihood

In April–May 1998, a heterokont phytoflagellateformed a massive bloom in the North Sea and theSkagerrak, off the coasts of Germany, Denmark,Sweden, and Norway, which killed 350 tons offarmed salmon as well as some feral fish (Aure et al.2001, Backe-Hansen et al. 2001). The responsibleorganism was initially identified as Chattonella aff.verruculosa because it resembled this speciesdescribed from Japan, but differed somewhat in cellsize, form, and growth pattern compared to previ-ous studies (Hara et al. 1994, Yamaguchi et al.1997). A bloom of a similar organism took place inApril–May 2000 in the German Bight and off theDanish Jutland coast (Lu and Gobel 2000). In 2001,C. aff. verruculosa again caused fish mortalities inNorway, and 1100 tons of reared salmon were killed.This time, the massive bloom developed in coldwaters (about 2�C–5�C) in the Kattegat and the

1Received 21 October 2006. Accepted 9 April 2007.2Author for correspondence: e-mail bente.edvardsen@bio.uio.no.3These authors contributed equally to this work.

J. Phycol. 43, 1054–1070 (2007)� 2007 Phycological Society of AmericaDOI: 10.1111/j.1529-8817.2007.00390.x

1054

Skagerrak during March–April and overlapped intime with the annual spring bloom of diatoms.Chattonella aff. verruculosa was confined to the upper20 m layer with brackish water (salinity 22–34 PSU),with the highest measured concentration (up to12 · 106 cells Æ L)1) in the upper 2 m (Naustvoll etal. 2002). Chattonella aff. verruculosa again occurredin high cell densities in the Skagerrak and the Katt-egat in January–February 2006.

Previous to these blooms, C. aff. verruculosa hadnot been reported from European waters, and it hasbeen speculated that it was introduced to Europefrom Japan by, for example, ballast water (Hopkins2001). Chattonella marina and C. antiqua (see Table 1for taxonomic authors) have been observed inDutch coastal waters and the central North Seasince 1991 (Vrieling et al. 1995), and Chattonellaspecies (C. subsalsa and C. cf. minima) have alsobeen observed in French coastal waters (Mignot1976, Billard et al. 1998).

In 2001 we established monoalgal cultures ofC. aff. verruculosa from Scandinavian waters thatenabled us to study this organism in detail. Theobjective of the present study was to characterizethis heterokont phytoflagellate with regard to mor-phology, ultrastructure, pigmentation, and DNAsequences to infer its phylogeny and determine itssystematic position. Chattonella aff. verruculosa wascompared with the C. verruculosa reference strainNIES 670 isolated from Seto Inland Sea, Japan.Even at the time of its description, it was realizedthat the placement of C. verruculosa in the genusChattonella could be temporary (Hara et al. 1994),because it lacks some of the distinctive features ofthe genus, such as a cytoplasm clearly divided into acytoplasmic endoplasm and a vacuolated ectoplasm.

In this study, we show that C. aff. verruculosaisolated from the Skagerrak in southern Norway andC. verruculosa from Japan are not related to theraphidophyte genus Chattonella as previouslybelieved, but rather belong to the heterokont classDictyochophyceae. Chattonella aff. verruculosa isolatedfrom the Skagerrak was closely related to, althoughgenetically and morphologically different from,C. verruculosa from Japan. We introduce the nameVerrucophora farcimen sp. et gen. nov. for the algafrom Norway and propose to rename Chattonellaverruculosa from Japan Verrucophora verruculosa. Fur-ther, we introduce a new order, Florenciellales, toaccommodate the taxa V. farcimen, V. verruculosa,and Florenciella parvula.

MATERIALS AND METHODS

Algal cultures. Five strains of Verrucophora farcimen wereisolated from water samples collected during the bloom in theSkagerrak in March 2001. The bloom was dominated by thisspecies and by another heterokont flagellate without distinctmucocysts, tentatively identified as Heterosigma akashiwo. Thestrains UIO 109, UIO 110, and UIO 111 were isolated from awater sample collected off Langesund (58�55¢ N, 09�40¢ E;

0–2 m depth) at the South coast of Norway on March 28 byB. Edvardsen, using the serial-dilution culture method(Throndsen 1978). Strains UIO 112 and UIO 113 originatedfrom single cells from a sample collected off Flødevigen(58�25¢ N, 08�45¢ E; 0 m depth) on March 21 and were isolatedby L. Naustroll by capillary isolation.

Nonaxenic stock cultures were grown in borosilicate tubescontaining IMR ½ medium (Eppley et al. 1967) with a salinityof 25 PSU, supplemented with 10 nM selenite and transferredinto new medium every 3 weeks. The cultures were kept attemperatures 4�C–13�C under white fluorescent light with aphoton flux density (PFD) of about 100 lmol pho-tons m)2 Æ s)1 and a 12:12 light:dark (L:D) cycle. Verrucophoraverruculosa (Chattonella verruculosa) strain NIES 670 was kindlyprovided by Dr. F. Kasai at the National Institute for Environ-mental Studies (NIES; Tsukuba, Japan) culture collection. Thisstrain was isolated by S. Yoshimatsu on July 16, 1987, andoriginates from Harima-Nada, Seto Inland Sea, Japan. It is keptin our laboratory (Department of Biology, University of Oslo)at 16�C–19�C under similar growth conditions as V. farcimen.

Light microscopy. The cultures were studied live or fixed withLugol’s solution, osmium tetroxide vapor, or uranyl acetateunder a Nikon Microphot FX (Nikon, http://www.nikon.com)fitted with phase contrast and differential interference contrast(DIC) optics. Cells were digitally photographed using a SpotRT Camera (Diagnostic Instruments, Sterling Heights, MI,USA).

Electron microscopy. Whole mounts and thin sections wereprepared as described by Eikrem and Moestrup (1998).Specimens for SEM were prepared as described by Klavenesset al. (2005) except that we used the chemical drying agenthexamethyldisilazane (Sigma-Aldrich, Dorset, UK) instead ofcritical-point-drying. Thin sections and whole mounts wereviewed under Philips CM100 and CM200 transmission electronmicroscopes (Philips, Amsterdam, the Netherlands), and SEMspecimens were examined in a JEOL JSM 6400 scanningelectron microscope (JEOL Ltd., Tokyo, Japan) at the ElectronMicroscopy Laboratories for Biosciences, Department ofBiology, University of Oslo.

Pigment analysis. For pigment analysis, 250 mL of V. farcimenculture, strain UIO 113, was harvested in the exponentialgrowth phase by centrifugation (3225.6g; Centrifuge Eppendorf5810R; Eppendorf AG, Hamburg, Germany), and the pellet wasfrozen and brought to the Norwegian University of Science andTechnology (NTNU) in liquid nitrogen. Assessment of thepigment composition was performed using a Hewlett-PackardHPLC 1100 Series system (Hewlett-Packard, Ramsey, MN,USA), equipped with a quaternary pump system and diodearray detector. Pigments were separated on a Waters SymmetryC8 column (150 · 4.6 mm, 3.5 lm particle size; Waters Corp.,Milford, MA, USA) using the HPLC method of Zapata et al.(2000). Pellets from algal cultures were extracted in methanol-rinsed glass tubes with 5 mL methanol using a glass rod forgrinding cells. The tube was then placed for extraction innitrogen-bubbled methanol at )20�C for 24 h. All samplepreparations were done in dim light. Extracts were filteredthrough Millipore 0.45 lm filters (Millipore, Billerica, MA,USA) to remove cell and filter debris, and 200 lL of the finalextract was injected in the HPLC system. Chlorophylls andcarotenoids were detected by absorbance at 420, 440, 450, and460 nm and identified by diode array spectroscopy. Spectrawere detected from 350 to 750 nm at 1 nm spectral resolution.HPLC calibration was performed using chl and carotenoidstandards purchased from Sigma-Aldrich (Dorset, UK) and ourown standards according to Johnsen and Sakshaug (1993).

rDNA gene sequencing. DNA from cultures of V. farcimenstrains UIO 109–113 and V. verruculosa strain NIES 670 wasextracted as described by Hayes and Barker (1997) or by theQiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany).

VERRUCOPHORA FARCIMEN GEN. ET SP. NOV. 1055

PCR amplifications of SSU rDNA were performed usingprimers 1 F (5¢AACCTGGTTGATCCTGCCAGT3¢) and 1528R(5¢TGATCCTTCTGCAGGTTCACCTAC3¢) described by Med-lin et al. (1988), and partial LSU rDNA–embracing domainsD1 ⁄ D2 using the primers DIR (5¢ACCCGCTGAATTTAAG-CATA3¢) and D2C (5¢CCTTGGTCCGTGTTTCAAGA3¢)described by Scholin et al. (1994). The PCR reactions were

run in total volumes of 50 lL, consisting of sterile Milli-Q water(Millipore, Billerica, MA, USA), 5 lL of 10· PCR buffer(including 1.5 mM of MgCl2), 200 nM of each primer,200 lM deoxyribonucleotide triphosphatemix, 1 unit of HotStar DNA polymerase (Qiagen), and 1 lL template DNA.Amplification of LSU rDNA was carried out in an EppendorfMastercycler Gradient as follows: initial denaturation at 94�C

Table 1. Heterokont taxa with EMBL accession numbers of SSU and LSU sequences included in the phylogenetic analyses.

Taxon SSU accession no. LSU accession no.

BacillariophyceaeCylindrotheca closterium (Ehrenb.) J. C. Lewin et Reimann AY485471 AF289049Skeletonema pseudocostatum Medlin emend. Zingone et Sarno X85393 Y11512Rhizosolenia setigera Brightw. M87329 AF289048

ChrysophyceaeChrysolepidomonas dendrolepidota M. C. Peters et R. A. Andersen AF123297 AF409121Ochromonas danica Pringsh. M32704 Y07977

DictyochophyceaeApedinella radians (Lohmann) P. H. Campb. U14384 AF289045Ciliophrys infusionum Cienk. L37205Dictyocha fibula Ehrenb. AB096710Dictyocha speculum Ehrenb. U14385 AF289046Florenciella parvula Eikrem AY254857Helicopedinella tricostata (Rouch.) Sekiguchi, Kawachi, T. Nakay. et I. Inouye AB097408Pedinella sp. AB081517Pseudopedinella elastica Skuja U14387Pteridomonas danica D. J. Patt. et Fenchel L37204Rhizochromulina cf. marina D. J. Hibberd et Chret.-Dinet U14388 AF289044Verrucophora farcimen strain UIO 110 AM075624 AM040499-AM040503Verrucophora verruculosa (Y. Hara et Chihara) Eikrem strain NIES 670 (this study) AM075625 AM040504Verrucophora verruculosa (Y. Hara et Chihara) Eikrem strain NIES 670 AY788948Verrucophora verruculosa (Y. Hara et Chihara) Eikrem strain CAWR 21 AY788947

EustigmatophyceaeNannochloropsis salina (Bourr.) D. J. Hibberd AF045046 M87328Vischeria helvetica (Vischer et Pascher) D. J. Hibberd AF045051

HyphochytriaceaeHyphochytrium catenoides Karling X80344 X80345

PelagophyceaeAureococcus anophagefferens Hargraves et Sieburth AF117778 AF289042Pelagococcus subviridis R. E. Norris U14386Pelagomonas calceolata R. A. Anderson et G. W. Saunders U14389 AF289047

PhaeophyceaeAlaria esculenta (L.) Grev. Unpublished dataa AF409123Scytosiphon lomentaria (Lyngb.) Link D16558 D16558

PinguiophyceaeGlossomastix chrysoplasta O’Kelly AF438325 AF409128Phaeomonas parva D. Honda et I. Inouye AF438323Pinguiococcus pyrenidosus D. Honda et I. Inouye AF438324 AF409130

PythiaceaePhytophthora megasperma Drechs. M54938 X75631

RaphidophyceaeChattonella antiqua (Hada) C. Ono AY788920Chattonella marina (Subrahman.) Y. Hara et Chihara AY788928Chattonella ovata Y. Hara et Chihara AY788924Chattonella subsalsa Biecheler U41649 AF409126Chattonella cf. verruculosa strain Delaware AY788946Haramonas dimorpha T. Horig. AY788929Heterosigma akashiwo (Hada) Hada ex Y. Hara et Chihara AB001287 AF409124Vacuolaria virescens Cienk. U41651 AF409125

SynurophyceaeMallomonas asmundae (Wujek et Van der Veer) N. A. Nichols Unpublished dataa AF409122

XantophyceaeHeterococcus caespitosus Vischer AF083399Tribonema aequale Pascher M55286 Y07979Vaucheria bursata (Vauchi) D. C. U41646 AF409127

EMBL, European Molecular Biology Laboratory Nucleotide Sequence Database.aUnpublished sequence included in the concatenated SSU and LSU rDNA alignment kindly provided by Yves Van de Peer, pre-

viously published by Ben Ali et al. (2002).

1056 BENTE EDVARDSEN ET AL.

for 15 min, followed by 30 cycles of denaturation at 94�Cfor 1 min, annealing at 50�C for 1 min, and extension at 72�Cfor 2 min. After the cycles, extension was completed at 72�C for10 min. Amplification of SSU rDNA was performed as above,but with the Taq polymerase enzyme (Qiagen) and an initialdenaturation step at 94�c for 3 min. The PCR products wereloaded onto an ethidium-bromide-stained 0.8% agarose gel intris-acetate-EDTA (TAE) buffer, and checked for purity andcorrect fragment length. Except for amplified SSU rDNA ofstrain NIES 670, the PCR products were purified (Autoseq96;Amersham Biosciences, Champaign, IL, USA) and sequenceddirectly using a DYEnamic ET terminator Cycle sequencing kit(Amersham Biosciences) according to the manufacturer’srecommendation. The PCR fragments were bidirectionallysequenced using the primers as described in Edvardsen et al.(2003) on a MEGABACE 1000 (Amersham Biosciences) auto-matic sequencing device at the Department of Biology,University of Oslo, Norway. The SSU rDNA PCR product ofstrain NIES 670 was purified (Wizard SV gel and PCR clean-upsystem; Promega, Madison, WI, USA) and cloned into the M13vector using the Invitrogen TOPO TA cloning kit (Invitrogen,Carlsbad, CA, USA) according to the manufacturer’s recom-mendations. The nucleotide sequence of two cloned DNAfragments was determined by the MWG Biotech sequencingservice (Ebersberg, Germany), and the consensus sequence ofthese fragments was used in the phylogenetic analyses. TheSSU rDNA sequence of strain UIO 110 was determined twicefrom two separate PCR products to reduce the chance of PCRand sequencing errors. Sequences in both directions were pair-wise aligned, assembled, and manually edited using thesoftware BioEdit v.7.0.5 (Tom Hall, http://www.mbio.ncsu.edu/BioEdit/bioedit.html). The sequences were deposited inthe European Molecular Biology Laboratory NucleotideSequence Database (EMBL; Cambridge, UK; accession num-bers in Table 1).

Phylogenetic analysis. The SSU rDNA sequences of V. farcimenstrain UIO 110 and V. verruculosa strain NIES 670 were alignedwith 41 additional heterokont sequences (Table 1) using ClustalX (Thompson et al. 1997), followed by editing by eye inMacClade (D. Maddison and W. Maddison, http://macclade.org). Prorocentrum micans (accession no. M14649)was included to form an outgroup. Alignments are availablefrom EMBL under the accession numbers ALIGN_001051 (SSUrDNA) and ALIGN_001050 (SSU + LSU rDNA). Phylogenetictrees of heterokonts were constructed based on single geneanalysis of SSU rDNA (44 taxa and 1359 characters) andconcatenated alignment of almost complete SSU and partialLSU rDNA sequences (26 taxa and 1681 characters, Table 1).The concatenated SSU and LSU rDNA alignment was kindlyprovided by Dr. Yves Van de Peer. Ribosomal DNA sequences ofstrains UIO 110 and NIES 670 were added to this alignment.Secondary structures were considered, and regions that couldnot be aligned reliably were excluded from the analyses.Bayesian inferences were performed using MrBayes v.3 (Ron-quist and Huelsenbeck 2003), applying a general-time-reversible(GTR) substitution model, and G and I (proportion of invariablesites) parameters to accommodate variable rates across sites.Other prior settings were set to default values. The Markov chainMonte Carlo (MCMC) chains lasted for 2,000,000 generations,and trees were saved every 100 generations, in all counting20,000 trees. The analysis implemented one cold and threeheated chains starting from independent, random starting trees.After burn-in, which was set to 300,000 generations based onvisual inspection of the stationary phase of the MCMC chains,17,000 trees were used for calculating the consensus tree andposterior-probability values. To assess the convergence of theMCMC chains, the Bayesian inference was repeated from differ-ent random starting trees. Comparison of the tree topologies,mean-likelihood (ML) scores, and the posterior-probability

values showed almost identical results, and it is thereforelikely that the MCMC had lasted long enough to converge. Inaddition, distance methods were used in PAUP* v4.0b10(Swofford 1999) to estimate trees with ML and LogDet distances.The ML-distance parameters were estimated from a Kimura two-parameter model tree generated with neighbor joining andincluded the following parameters: GTR, G + I, and nucleotidefrequencies. In the LogDet analysis, the I parameter was used byexcluding invariable sites in proportion to nucleotide frequencyestimated from constant sites only. Parsimony analysis was donewith default settings. Tree searches with distance and parsimonymethods were done with 10 heuristic searches from starting treesgenerated by randomly adding the sequences. Branch swappingwas done using the tree-bisection-reconnection algorithm.Nonparametric bootstrap confidence levels were estimatedfrom 100 pseudoreplicates by implementing the same parame-ters and tree search methods as for the initial phylogeneticreconstruction. The phylogenetic analyses were performed atthe BioPortal (http://www.bioportal.uio.no).

Toxicity bioassay. A bioassay using larvae of the crustaceanArtemia franciscana (Creasel Ltd., Deinze, Belgium) was per-formed with fresh seawater samples from the bloom in 2001(off Langesund, 0 m depth, and off Lyngør, 5 m depth,sampled on March 28) as previously described (Edvardsen1993). The water samples were diluted 0, 1, 10, 100, and 1000times and added to 40 2-day-old (naupli stage II) Artemianauplii per concentration. After 24 h exposure in darkness, thenumber of dead nauplii (not moving for 10 s) were countedunder the stereomicroscope. Filtered, autoclaved seawater wasused as the control. Mortality in the control was 0% (n = 80).

RESULTS

Morphology and ultrastructure of Verrucophora farc-imen. The overall morphology of the cells seenwith the light microscope is very variable, and sizeand form seem to change in response to growthphase (Figs. 1 and 2). Cells in seawater samplesfrom the bloom in March 2001 were up to 50 lmlong, sausage to carrot shaped, oval, or round andpossessed numerous mucocysts evenly distributedon the cell surface (Figs. 1 and 2C). Cultured cells

A B D

C

Fig. 1. Semischematic line drawings of Verrucophora farcimenshowing the variation in cell morphology: (A) sausage to carrotshaped, (B) oval, (C) irregular, and (D) small spherical.

VERRUCOPHORA FARCIMEN GEN. ET SP. NOV. 1057

in exponential growth are usually elongated (meanlength 19 lm, range 12–34 lm, n = 194) and can bewider in the anterior end (up to 9 lm wide) thanin the posterior end (4 lm). Some of the cells maybe slightly bent (Fig. 2C). Cells may also be oval(mean length 14 lm, mean width 10 lm, n = 102)or small and spherical (from 5 lm in diameter).Numerous oval mucocysts give the cells a warty(verrucous) appearance (Fig. 2, B and D), but smallcells may occasionally be smooth (Fig. 2A). Thecells possess up to 30–35 chloroplasts (Fig. 2, C–E).Senescent cells can be smaller (usually 5–9 lm indiameter) and rounded (Fig. 2A) with very prono-unced mucocysts (Fig. 2B, arrow) and often possessa trailing cytoplasmic thread (Fig. 2B, tailed arrow)and only a few chloroplasts. An elongated nucleuslocated anteriorly can be seen in osmium-tetroxide-fixed cells. Under the light microscope, usually only

the forwardly directed flagellum (about 9–30 lmlong; Fig. 2, A and B) is visible, but a second shortflagellum may also be seen (Fig. 2, A and E, arrow).The cells are heterokont, thus the longer anteriorlydirected flagellum pulls the cells forward duringswimming, whereas the shorter flagellum may bendbackward. The longer flagellum has a bulge in theproximal part clearly revealed in the SEM (notshown), possibly also under the light microscope(Fig. 2A), but usually not in TEM whole mounts.

Electron microscopy of whole mounts (Fig. 3,A–D) reveals that the longer flagellum bears tripar-tite hairs composed of a base (Fig. 3D, arrow),shaft (Fig. 3D, bidirectional arrow), terminal fila-ment (Fig. 3D, tailed arrow), and a winglike structure(Fig. 3B, arrows); whereas the shorter is smooth(Fig. 3A, tailed arrow) and tapering (Fig. 3A, arrow).The flagellum proper (2–7 lm long) contains nineperipheral doublets and the central pair of micro-tubules, whereas only the central pair extends intothe tapering part (1.0–3.5 lm long, not shown).

Thin sections show that the cells contain numer-ous potato-shaped chloroplasts with an embedded,sometimes slightly bulging pyrenoid (Fig. 4, A, B,and E). The pyrenoid may be penetrated by tubules,some of which appear to be invaginations of thechloroplast membrane (Fig. 5B, arrows). The chlo-roplasts have lamellae composed of three thylakoids,and a girdle lamella (Figs. 4, A, B, and E; 5B).Hollow parts of the hairs covering the long flagel-lum are observed within dilations of the periplas-tidal endoplasmic reticulum (ER; Fig. 5, A [arrow],

A

D E

B C

Fig. 2. Light micrographs of Verrucophora farcimen: (A, B)phase contrast, (C–E) differential interference contrast (DIC).(A–D) live cells; (E) cell fixed in vapor of osmium tetroxide. (A,B, D, and E) cells in culture; (C) cell from bloom in 2001. (A)Small round cell with long and short (arrow) flagella. Scale bar,10 lm. (B) Small cell with protruding mucocysts (arrow) andtrailing cytoplasma thread (tailed arrow). Scale bar, 10 lm. (C)Large ‘‘warty’’ and elongated cell with mucocysts (arrow). Scalebar, 10 lm. (D) Cell with chloroplasts (chl) and mucocyst(arrow). Scale bar, 4 lm. (E) Cell with flagella and prominentnucleus. Note tapering of short flagellum (arrow). Scale bar,5 lm.

A D

B C

Fig. 3. Electron micrographs of whole mounts of Verrucophorafarcimen. (A, C, and D) are shadow-cast preparations; (B) is con-trasted with uranyl acetate. (A) Cell with long and short flagella.Note the tapering of the short flagellum: flagellum proper (tailedarrow), tapering part (arrow). Scale bar, 5 lm. (B) Long flagel-lum with wing (arrows). Scale bar, 0.5 lm. (C) Cell bearing longflagellum with hairs. Note mucocyst (arrow). Scale bar, 2 lm. (D)Long flagellum with tripartite hairs. Note base (arrow), shaft(bidirectional arrow), and terminal fiber (tailed arrow). Scale bar,0.5 lm.

1058 BENTE EDVARDSEN ET AL.

B, and C [bidirectional arrow]). The mucocysts (u)are pointed oval, surrounded by tiny osmiophilicgranules (Fig. 4A), and located within the ER (notshown). The peripheral mucocysts visible in livecells appear to discharge under fixation (Fig. 3C),leaving empty cavities in the cell periphery (Fig. 4B).Vacuoles interpreted as food vacuoles (fv) can alsobe observed (Fig. 4B). The nucleus has a prominent

nucleolus (nl; Fig. 4, A and B) and is situated cen-trally in the anterior part of the cell close to thebasal bodies (b; Fig. 4, C–E). There is a slightdepression in the nucleus where the basal bodiesare located (Fig. 4E, arrow). A remarkable character-istic in V. farcimen is the branched nucleus (Fig. 5B).Very few distinct pores have been detected inthe nuclear envelope (NE), and no direct evidence

A

C D E

F

B

Fig. 4. Electron micrographs of thin sections of Verrucophora farcimen. (A) Cross-section of cell with nucleus (n), nucleolus (nl), chlorop-lasts (chl) with pyrenoid (pyr), and mucocysts (u). Scale bar, 1 lm. (B) Longitudinal section showing nucleus with nucleolus, mitochon-drion (m), the location of flagella insertion (arrow), and the Golgi body (g) running alongside the nucleus. A food vacuole (fv) is alsopresent. Scale bar, 1 lm. (C and D) Two consecutive sections showing the flagella transition region with a distal helix of at least threegyres (arrows) and the two gyres (tailed arrows) of the proximal helix, flagella bases (b), and the fibrous root connecting the two (arrow-heads). Scale bar, 0.25 lm. (E) Flagella insertion region and the location of the basal body in a depression of the nucleus (arrow). Scalebar, 0.5 lm. (F) Longitudinal section of long flagellum with bulge (arrow). Scale bar, 1 lm.

VERRUCOPHORA FARCIMEN GEN. ET SP. NOV. 1059

A

B

D

C

Fig. 5. Electron micrographs of thin sections of Verrucophora farcimen. (A) Hairs are produced in the endoplasmic reticulum (arrow).Note also the proximity of the basal body (b) to the anterior part of the nucleus (n) and the location of the Golgi body (g) alongside thenucleus. Scale bar, 1 lm. (B) Invaginations of the chloroplast (chl) membranes may protrude into the pyrenoid (pyr). The nucleus isbranched ⁄ reticulated, and mitochondrial profiles (m) and profiles of the endoplasmic reticulum can be seen throughout the cell (bidirec-tional arrow). Scale bar, 1 lm. (C) Longitudinal and cross-section of tubular parts of tripartite hairs (bidirectional arrow). Enlarged androtated detail of (B). Scale bar, 0.25 lm. (D) Transition region of flagella with basal bodies and microtubular roots (arrows). Scale bar,0.3 lm.

1060 BENTE EDVARDSEN ET AL.

for confluence between the NE and the outer chlo-roplast membrane has been observed. The Golgibody (g) is located close to the flagella bases on thelateral side of the nucleus and seems to be inti-mately connected to the latter (Figs. 4B; 5, A and B).The mitochondrion has tubular cristae, and mito-chondrial profiles (m) are present throughout thecell (Figs. 4E; 5, A and B). The transition region ofthe flagella contains two proximal rings (two-gyrehelix; Fig. 4, C and D, tailed arrows) and at leastthree distal rings (three-gyre helix; Fig. 4D, arrow).Fibrous roots (Fig. 4, C and D, arrowheads) con-necting the basal bodies (b) and microtubular roots(Fig. 5D, arrows) are present, but have not beenstudied in detail. The microtubular roots seem toconsist of a few microtubules, and no distinct rhizo-plast has been detected.

Morphology and ultrastructure of Verrucophora verru-culosa. Cells in culture may be elongated, spheri-cal, or pear shaped, often with a trailing antapicalcytoplasmic filament. The many mucocysts give thecells a warty appearance under the light microscope.The cells are 8–18 lm long and 8–12 lm wide. Theheterokont flagella are inserted apically (Fig. 6,A–C). The long anteriorly directed flagellum mea-sures 12–28 lm, and there is a bulge (Fig. 6B,arrow) in the proximal part that is apparent inSEM, possibly also under the light microscope(Fig. 6a), but usually not in TEM whole mounts.The longer flagellum carries tubular hairs with asingle terminal filament. The short flagellum issmooth and tapering and measures 6–11 lm exclu-sive of the tapering part, which measures 0.5–2.5 lm (Fig. 6C). The nucleus is round (Fig. 6, Aand D) with an anterior protrusion and located inthe anterior part of the cell close to the basal bodies(Fig. 6E). The nucleolus (nl) is prominent. Themitochondrion (m) has tubular cristae. The Golgibody (g) is located in the proximity of the nucleusand the basal bodies (Fig. 6E). The transitionregion of the flagella contains two proximal rings(two-gyre helix, arrow) and at least three distal rings(three-gyre helix, arrowheads, Fig. 6F). Fibrous roots(f) connecting the basal bodies (b) are present, anda few structures that may qualify as microtubularroots (tailed arrow) have been encountered (Fig. 6F).The chloroplasts are numerous and potato shaped.They have lamellae composed of three thylakoids, agirdle lamella, and an embedded pyrenoid(Fig. 6G). The oval mucocysts (u) are surroundedby tiny osmiophilic granules (Fig. 6G). We have notobserved the bullet-like inclusion in the mucocystsdemonstrated in the original description (Hara etal. 1994, figs. 29, 30).

Pigment composition of Verrucophora farcimen.HPLC analysis revealed that V. farcimen con-tained the accessory chl c1, c2, and c3 in addi-tion to chl a. The carotenoids present were19¢-butanoyloxyfucoxanthin, fucoxanthin, diadino-xanthin, diatoxanthin, diatoxanthin-like, and

b,b-carotene, while 19¢-hexanoyloxyfucoxanthin app-eared to be absent (Table 2 and Fig. 7). However,further work is needed to verify the absence of 19¢-hexanoyloxyfucoxanthin in V. farcimen grown underdifferent culture conditions, and the pigment dataalso need to be compared with mass spectrometryand nuclear magnetic analyses as described by Jeffreyand Mantoura (1997).

Gene sequences and molecular phylogeny. We obtainedapproximately 550 bp from the five V. farcimen strains(UIO 109–UIO 113) and 525 bp of V. verruculosastrain NIES 670 of LSU rDNA, embracing theD1 ⁄ D2 loop. The LSU sequences of all V. farcimenstrains were identical in this region, but they dif-fered from the V. verruculosa NIES 670 sequence inseven of the 525 positions (1.3% distance). Compar-ison of our complete or almost complete SSU rDNAsequences of V. farcimen strain UIO 110 (1794 bp)and of V. verruculosa NIES 670 (1816 bp) showeddifferences in seven nucleotide sites (0.4% distance)when excluding all ambiguous positions.

Phylogenetic analyses of heterokonts based onconcatenated SSU + LSU rDNA data produced atree topology where all main heterokont classeswere divided into distinct clades with high pos-terior probability and bootstrap support (Fig. 8).Well-supported sister relationships were formedbetween Dictyochophyceae and Pelagophyceae, bet-ween Chrysophyceae and Synurophyceae, andbetween Raphidophyceae and Phaeophyceae. Otherbasal branches linking the groups together hadonly moderate or low statistical support. Verrucophorafarcimen from Norway and V. verruculosa from Japanwere robustly placed as sister taxa within the Dicty-ochophyceae and were most closely related to Dictyo-cha speculum (Florenciella parvula was not included asthe LSU rDNA sequence was not available). Toresolve more precisely the phylogenetic and taxo-nomic position of Verrucophora, we increased thetaxon sampling by using SSU rDNA sequences onlyand adding more sequences particularly from Dicty-ochophyceae (Fig. 9). Similar to the concatenatedSSU + LSU rDNA tree, the SSU rDNA tree sup-ported all main heterokont classes. However, theposition of the Pelagophyceae was more ambiguous,either supported as a sister group to Dictyochophy-ceae in ML and LogDet distances, or as a deeperbranch in parsimony and Bayesian trees. Anotherdifference from the concatenated tree is the cluster-ing of the Raphidophyceae, Phaeophyceae, andXantophyceae. However, these inconsistenciesshould not be considered as significant since manyof the basal branches in both SSU + LSU and SSUtrees received weak support. In the SSU rDNA tree,V. farcimen and V. verruculosa sequences were placedin the Dictyochophyceae together with F. parvulawith high support. Thus, these three taxa seem toform a distinct clade as sister to all other species inDictyochophyceae. In contrast, the Chattonella spe-cies C. antiqua, C. marina, C. ovata, and C. subsalsa

VERRUCOPHORA FARCIMEN GEN. ET SP. NOV. 1061

were robustly placed in the Raphidophyceae, clearlydistantly related to V. farcimen and V. verruculosa.Chattonella cf. verruculosa isolated from Delaware,USA, appeared as a sister taxon to the raphido-phytes and was also distantly related to V. farcimenand V. verruculosa. This is a new heterokont species(Taxon ID 299907 at the National Center for

Biotechnology Information [NCBI], Bethesda, MD,USA) that probably will be described under a newgenus name. Within the Verrucophora cluster, V. farci-men diverged first with high support, separating itfrom the V. verruculosa sequences. The SSU rDNAof V. verruculosa showed intraspecific variation.After excluding all variable positions among the

A

C

F

G

D EB

Fig. 6. Light (A) and electron micrographs (B–G) of Verrucophora verruculosa. (A) Cell fixed in vapor of osmium tetroxide. Scale bar,10 lm. (B) SEM of cell showing the bulge on the long flagellum (arrow). Scale bar, 10 lm. (C) Uranyl-acetate-stained whole mount show-ing cell with long, hairy (arrow) and short, tapering (arrowhead) flagella. Scale bar, 10 lm. (D) Thin section showing the anterior loca-tion and the outline of the nucleus (n). Scale bar, 3 lm. (E) Thin section of nucleus with prominent nucleolus (nl), mitochondrion (m),chloroplast (chl), and Golgi body (g). Scale bar, 1 lm. (F) Thin section through transition region of flagella with flagella base (b), fibrousroot (f), and microtubular root (tailed arrow). Note proximal (arrows) and distal (arrowheads) rings. Scale bar, 0.5 lm. (G) Thin sectionthrough cell showing potato-shaped chloroplasts and mucocyst (u). Scale bar, 5 lm.

1062 BENTE EDVARDSEN ET AL.

V. verruculosa sequences, four bases remained thatdiffered from the V. farcimen sequences.

Toxicity of a natural population of V. farcimen. Themortality of the Artemia nauplii was 2%–7% whenexposed to nondiluted seawater collected off Lang-esund and Lyngør during the bloom in March2001. At lower concentrations (10–1000 times dilu-tion of seawater), the mortality was 0%–5%,although without a clear dose-response relationship.The seawater samples from the bloom in 2001 thusgave only low acute toxicity, but the crustaceanswere also affected by being trapped in mucus.

TAXONOMIC DESCRIPTIONS

Florenciellales Eikrem, Edvardsen et Throndsenordo nov.

Cellulae flagellatae cum chloroplastis aureo-brunneis. Zona transitionis axonematum flagellarium

proximalibus et distalibus anulis instructa. Radicesflagellares praesentes.

Flagellates with golden brown chloroplasts. Tran-sition zone of flagella axonemes with proximal anddistal rings (helix). Flagella roots present.

Type genus: Florenciella Eikrem.

Verrucophora Eikrem, Edvardsen et Throndsengen. nov.

Cellulae flagellatae heterocontae; flagellum lon-gum pilos partitos alamque partialem parvam por-tans, virga autem paraxiali carens, cum tumore partisproximalis flagelli; corpora basalia radicibus fibrosisconnexa; chloroplasti multi et aureo-brunnei, uttubera solani globosi vel elongati tribus thylacoidibusin lamellis positis atque lamella cingulari peripheralipraediti, pyrenoides cum intrusionibus tubularibusinclusae; nucleus anterior complexu Golgi lateraliterappresso. Mucocystes ovales amplae protrudentes submembrana cellulari aequaliter distributae.

Species typica: Verrucophora farcimen Eikrem,Edvardsen et Throndsen.

Heterokont flagellates; long flagellum bearingpartite hairs and a small partial wing, but lacking aparaxial rod, with bulge at proximal part of flagel-lum; basal bodies connected by fibrous roots; manygolden brown, round to elongate potato-shapedchloroplasts with three thylakoids in the lamellaeand a peripheral girdle lamella, embedded pyre-noids with tubular intrusions; nucleus anterior, withGolgi body laterally adpressed; large protruding ovalmucocysts evenly distributed under the cell mem-brane.

Type species: Verrucophora farcimen Eikrem,Edvardsen et Throndsen.

Fig. 7. HPLC chromatogram at 440 nm of Verrucophora farcimen strain UIO 113 showing peaks identified in Table 2. Only pigmentscorresponding to own standards are named. Retention time in minutes on the x-axis, and absorbance units (AU) on the y-axis.

Table 2. Pigment composition in Verrucophora farcimenstrain UIO 113 determined by HPLC. Solvent is describedin the text.

Peak no. Time Pigment Absorbance max. (nm)

1 2.97 Chl c3 456, 5892 3.81 Chl c2 446, 549, 588, 6353 3.95 Chl c1 447, 583, 6334 16.73 19¢-

Butanoyloxyfucoxanthin446, 470

5 17.65 Fucoxanthin 450, 4726 22.61 Diadinoxanthin (427), 449, 4787 26.08 Diatoxanthin-like (427), 455, 4838 26.76 Diatoxanthin (427), 455, 4829 32.78 Chl a 431, 580, 616, 66310 35.52 b,b-Carotene-like 454, 48211 41.14 Chl a–like 437, 668

VERRUCOPHORA FARCIMEN GEN. ET SP. NOV. 1063

Verrucophora farcimen Eikrem, Edvardsen etThrondsen sp. nov.

Cellulae longae, cylindricae, ovales, sphaericae velpyriformes, interdum filamento cytoplasmico serpenti

antapicali praeditae duobus flagellis inaequalibusapicaliter insertis; flagellum longum anterius direc-tum pilos tripartitos portans cum filamentoterminali unico dimidii longitudinis pili; flagellum

Fig. 8. Phylogenetic tree inferred from a concatenated alignment of heterokont SSU and partial LSU using Bayesian inference. Sup-port values marked at the nodes are from top to bottom: posterior probability, maximum parsimony, maximum-likelihood distance, andLogDet distance. Sequences from present study are in bold.

1064 BENTE EDVARDSEN ET AL.

breve cuneatim decrescens. Cellulae 5–50 lm lon-gae, 4–17 nm latae; flagellum longius 9–30 lm, fla-gellum brevius 2–7 lm parte decrescenti metienti1.0–3.5 lm excepta. Nucleus ramosus unicus inparte anteriore cellae locatus. Nucleolus prominens.Corpora basalia in depressione nuclei locata.

Radices microtubulares praesentes. Sequentiae nu-cleotidis genorum SSU et LSU rRNA distinctae.

Cells long, cylindrical, oval, spherical, orpear shaped, sometimes with antapical trailingcytoplasmic filament; with two apically insertedunequal flagella; long anteriorly directed flagellum

Fig. 9. Phylogenetic tree inferred from heterokont SSU rDNA sequences using Bayesian inference. Support values marked at the nodesare from top to bottom: posterior probability, maximum parsimony, maximum-likelihood distance, and LogDet distance. Sequences frompresent study are in bold.

VERRUCOPHORA FARCIMEN GEN. ET SP. NOV. 1065

carrying tripartite hairs with single terminal filamentabout half the length of hair; short flagellum taper-ing. Cells 5–50 lm long and 4–17 lm wide; lengthof long flagellum 9–30 lm, short flagellum 2–7 lmexclusive of tapering part that measures 1.0–3.5 lm.Single, branching nucleus located in anterior partof cell. Prominent nucleolus. Basal bodies locatedin depression of nucleus. Microtubular roots pres-ent. Nucleotide sequences for the SSU and LSUrDNA distinct.

Habitat: Marine.Holotype: Figure 4a; TEM section embedding

Vf-B07 deposited at Department of Biology, Univer-sity of Oslo, Norway.

Isotype: Figures 3c and 4, b–e; strain UIO 113deposited at Department of Biology, University ofOslo, Norway.

Type locality: The Skagerrak off Flødevigen, Nor-way (58�25¢ N, 08�45¢ E).

Etymology: The name refers to the cell shape(verrucophora = wart bearer, farcimen = sausage).

Verrucophora verruculosa (Y. Hara et Chihara)comb. nov. Eikrem.

Basionym: Chattonella verruculosa Y. Hara et Chiharain Hara, Y., Doi, K. & Chihara, M. 1994. Jpn. J. Phycol.42:417, fig. 32.

DISCUSSION

Phylogeny and systematic position. Our phylogenetictrees based on heterokont rDNA have a topologysimilar to several recently published phylogenies(Guillou et al. 1999, Ben Ali et al. 2002, Kawachi etal. 2002, Eikrem et al. 2004, Bowers et al. 2006). Inall these phylogenies, members of Dictyochophyceaeform a monophyletic clade well separated from theraphidophytes.

Members of Dictyochophyceae are commonlydivided into three orders (Moestrup and O’Kelly2000): Dictyochales (silicoflagellates sensu stricto),Pedinellales (pedinellids), and Rhizochromulinales(rhizochromulinoids). Currently, Dictyochales con-sists of the characteristic skeleton-bearing species ofDictyocha Deflandre (Moestrup and O’Kelly 2000,Hernandez-Becerril and Bravo-Sierra 2001) and thepicoflagellate Florenciella parvula (Eikrem et al.2004)—all photosynthetic. Pedinellales is the largestgroup containing >25 species, both heterotrophicand phototrophic (Sekiguchi et al. 2003), whereasRhizochromulinales (O’Kelly and Wujek 1995) con-tains only the amoeboid Rhizochromulina marina(Hibberd and Chretiennot-Dinet 1979) and hetero-trophic Ciliophrys spp. (Sekiguchi et al. 2002, 2003).This classification is supported by various SSU rDNAphylogenies (Sekiguchi et al. 2003, Eikrem et al.2004, this study). All our phylogenetic analysesplaced V. farcimen as a sister taxon to V. verruculosa(C. verruculosa) from Japan (NIES 670) and NewZealand (CAWR 21; 1.0 posterior probability and

100% bootstrap values). The SSU trees also groupedthese two taxa together with F. parvula in a separateclade with high support. The SSU phylogeny, whichincludes two or more taxa from each order of Dicty-ochophyceae, shows that Verrucophora and Florenciellaform a sister clade to all other dictyochophytes, sup-porting the erection of a new order accommodatingmembers of these genera.

Morphology and ultrastructure. Verrucophora has het-erokont flagella, a trait characterizing the Hetero-konta; one is forwardly directed and covered by thintubular hairs, and a second shorter, smooth flagel-lum can be more or less reduced in some species.The presence of partite tubular hairs is a character-istic of Heterokonta, but the morphology of thehairs and their distribution on the flagellum differamong taxa. As in other heterokont algae, the tubu-lar parts of the hairs found in Verrucophora are pro-duced in the periplastidal ER. Some heterokonts,such as Ochromonas Wyssotski, have hairs with bothlateral and distal elements, and these are added tothe tubular parts when they reach the Golgi body(Inouye 1993). The process of distal element additionhas not been observed in Verrucophora, and membersof the Dictyochophyceae lack lateral elements.

Verrucophora has several of the features character-izing the dictyochophytes, such as inconspicuous orno microtubular roots, basal bodies in a depressionof the nucleus, one transitional plate and a proxi-mal two-gyre helix (two rings) in the flagellar transi-tional zone, and no rhizoplast. Like in Dictyocha, thenucleus is located in the central to anterior part ofthe cell with a Golgi body alongside the anteriorpart of the nucleus. In addition, Verrucophora cellshave a bulge on the hairy flagellum. In contrast,members of Raphidophyceae typically have exten-sive flagellar root systems, sometimes including acharacteristic layered structure (Vesk & Moestrup1987) and no distal or proximal helix in the transi-tion region of the flagella. They may have a rhizo-plast, but lack flagellar swellings (Heywood 1990,Heywood & Leedale 2000, Andersen 2004). Verruco-phora also lacks a cytoplasm clearly divided into acytoplasmic endoplasm and a vacuolated ectoplasm,as well as the osmiophilic granules in the peripheralcytoplasm that are characteristic in electron micro-graphs of the Chattonella (Raphidophyceae) species(Hara et al. 1994). Mucocysts have not previouslybeen reported for the Dictyochophyceae, whereasthey are common in, for example, Fibrocapsa japonicaToriumi et Takano and Chattonella globosa Y. Hara etChihara of the Raphidophyceae (Fukuyo et al.1990).

Microtubular and fibrous roots are generallyabsent in the Dictyochophyceae (Moestrup 1995),but both Verrucophora and Florenciella (Eikrem et al.2004) have distinct fibrous roots connecting thebasal bodies, and Verrucophora even have microtubu-lar roots. Microtubular and fibrous roots were alsofound in Sulcochrysis biplastida D. Honda, Kawachi et

1066 BENTE EDVARDSEN ET AL.

I. Inouye, a heterokont of uncertain affiliation thatlike the dictyochophytes, possesses two proximalrings (two-gyre helix) in the transitional region ofits flagella and has a depression in the nucleuswhere the basal bodies are located (Honda et al.1995). Verrucophora and Florenciella share many addi-tional features. Both appear to lack the microtu-bules that originate within distinct pads on the NEand may extend into the axopodia in other mem-bers of Dictyochophyceae. This microtubular struc-ture is one of the main characteristics of the class(Moestrup and O’Kelly 2000). Verrucophora and Flo-renciella have both proximal and distal rings (helix)in the transition region of the flagella, whereasother dictyochophytes only have a proximal transi-tional helix (Moestrup 1995). To our knowledge,the presence of both proximal and distal rings hasnot been observed in other heterokont alga. LikeDictyocha, Verrucophora has a wing extending at leastpart of its long flagellum, but the prominent rodpresent in some members of the Dictyochophyceae(Moestrup 1995) has not been detected in Verruco-phora. Both Verrucophora and Dictyocha speculum con-tain numerous chloroplasts that are located towardthe periphery of the cells, and in neither one has aconfluence between the nucleus envelope and theER surrounding the chloroplast been verified. InD. speculum, the chloroplasts contain an embeddedpyrenoid, which is intruded by short triplets of thy-lakoids (Moestrup and Thomsen 1990). This specialfeature has not been observed in Verrucophora or inFlorenciella (Eikrem et al. 2004). The silica skeletonthat is so prominent in Dictyocha is also lacking inthese two taxa. These characteristics and the distinctSSU and LSU rDNA signatures set Verrucophora andFlorenciella apart from other dictyochophytes andwarrant their separation into a new order.

A comparison of V. farcimen from Norway toV. verruculosa strain NIES 670 from Japan under thelight microscope reveals that both species are vari-able in cell size and form and do not show clear-cutdifferences. The appearance and location of thechloroplasts, the mucocysts, and the type and inser-tion of flagella are similar. However, the long cellsobserved in material from the Skagerrak have notbeen observed in V. verruculosa strain NIES 670 fromJapan. In the original description of V. verruculosaby Hara et al. (1994), the cell is described asspherical. Their ultrastructure is also similar, but inV. verruculosa, the nucleus is round and notbranched. This difference seems persistent based onthe study of Hara et al. (1994) and the presentstudy. Further, the flagella hairs in V. verruculosaappear to be bipartite, not tripartite. The presenceof tripartite hairs cannot be precluded, however, asthis structure can be difficult to reveal. Also, thebase of the tripartite hairs in V. farcimen is not verypronounced. As for V. farcimen, profiles of tubularhairs are observed within the periplastidal ER. Ourobservations of V. verruculosa are in accordance with

those of the original authors, except that we inter-pret the chloroplasts to be potato shaped and notdisk shaped, and we have not observed the bullet-like inclusion in the mucocysts demonstrated in theoriginal description in either of the species. Wehave made some additional observations in V. verru-culosa, like the bulge and partial wing of the longflagellum, the tapering nature of the short flagel-lum, and the proximal and distal rings (helix) inthe transition region of the flagella.

Strains of V. farcimen also differed in temperaturepreference and tolerance compared to V. verruculosafrom Japan. Cultures of V. farcimen showed maximalgrowth rate at temperatures 5�C–10�C and did nottolerate >15�C (Skjelbred and Naustvoll 2006),whereas V. verruculosa from Japan showed maximalgrowth rate at 17�C and could tolerate up to 24�Cin culture (Yamaguchi et al. 1997). Differences inSSU and LSU rDNA signatures further show thatthey are separate taxa. In a preliminary study, Riis-berg and Edvardsen (2006) showed that a strain iso-lated from a bloom in the Skagerrak in 2006 wasidentical in SSU and partial LSU rDNA to thestrains from 2001. Partial LSU rDNA sequences ofV. farcimen diverged with high support fromsequences of six strains termed Chattonella verrucul-osa from Japan (including NIES 670, accession num-bers AB217642 and AB217643), New Zealand, andGermany, which all clustered together. The lattersix strains were identical in this region, suggestingthat they all belong to V. verruculosa (Riisberg andEdvardsen 2006).

Pigment composition. The pigment composition inV. farcimen shows similarities to pelagophytes such asPelagococcus subviridis (Bjørnland et al. 1989); to thechl c3–containing dinoflagellates Karlodinium micrum(B. Leadb. et J. D. Dodge) J. Larsen (= Gymnodiniumgalatheanum) and Karenia mikimotoi (Miyake etKomin ex Oda) Ge. Hansen et Moestrup (= Gyrodi-nium aureolum) (Johnsen and Sakshaug 1993); andto the chl c3–containing haptophytes of the generaChrysochromulina, Emiliania, Imantonia, and Phaeocystiswith pigment types 3 or 4 according to Jeffrey andWright (1994) or type 6–8 according to Zapata et al.(2004; Table 3). Verrucophora farcimen, known pela-gophytes, and these haptophytes all possess chl a,c1, c2, c3, fucoxanthin, diadinoxanthin, diatoxanthin,and 19¢-butanoyloxyfucoxanthin and lack violaxan-thin and zeaxanthin; but in contrast to the hapto-phytes, V. farcimen and pelagophytes (Bjørnlandet al. 1989, Andersen et al. 1993) do not appearto possess 19¢-hexanoyloxyfucoxanthin. The pela-gophyte P. subviridis contains in addition ane,e-carotene (Bjørnland et al. 1989) not detected inV. farcimen. The pigmentation in V. farcimen alsoshows clear similarities to the dictyochophyteF. parvula (Eikrem et al. 2004). However, diatoxan-thin and chl c1 were detected in V. farcimen, but not inF. parvula (Table 3). The dictyochophyte D. speculumalso possesses chl c3, 19¢-butanoyloxyfucoxanthin,

VERRUCOPHORA FARCIMEN GEN. ET SP. NOV. 1067

diadinoxanthin, and diatoxanthin; but in contrastto V. farcimen and F. parvula, it also contains19¢-hexanoyloxyfucoxanthin, violaxanthin, and zea-xanthin (Daugbjerg and Henriksen 2001). The ped-inellids Apedinella radians (Lohmann) P. H.Campbell and Mesopedinella arctica Daugbjerg (Dicty-ochophyceae) differed from V. farcimen also by thelack of 19¢-butanoyloxyfucoxanthin and chl c3

(Daugbjerg and Henriksen 2001). Bjørnland andLiaaen-Jensen (1989) compared the pigment compo-sition of various chromophytes, and according totheir study, the pigment composition in V. farcimenfound in this study differs from marine raphidophytesby the presence of 19¢-butanoyloxyfucoxanthin andby the lack of violaxanthin and zeaxanthin. Mostaertet al. (1998) determined the pigment compositionin 11 raphidophytes and similarly found that allmarine raphidophyte genera possessed violaxanthinand zeaxanthin, and all except Haramonas lackedthe 19¢-acyloxyfucoxanthins. However, Haramonasdimorpha, which clusters with other raphidophytesin our SSU tree (Fig. 9), contained 19¢-but-anoyloxyfucoxanthin (Mostaert et al. 1998). Becausedifferences in pigmentation can occur among clo-sely related species of heterokont algae, this charac-ter should be used with caution to infer phylogenyat taxonomic levels below the class level. Further,cells of different species of chl c3 –containinggenera, such as Chrysochromulina, Karlodinium, andKarenia, may alter the fraction of fucoxanthins,depending on physiological status ( Johnsen et al.1992, 1997).

Toxicity. We found only low toxicity to Artemianauplii, an organism that has proved to be very sen-sitive to several marine toxic microalgae, such as thehaptophytes Chrysochromulina polylepis Manton etParke (Edvardsen 1993) and Prymnesium parvumN. Carter (Meldahl et al. 1994) and dinoflagellates inthe genus Alexandrium (Lush and Hallegraeff 1996).Christopher Miles and co-workers (unpublished)analyzed by use of enzyme-linked immunosorbentassay (ELISA) and liquid chromatography–massspectrometry (LC-MS) the toxin concentration in150 L of seawater from the bloom in 2001, off Lang-esund Norway. They could not, however, detectbrevetoxins or other known algal toxins in this sea-water. A taxon called Chattonella cf. verruculosa wasreported to form ichthyotoxic blooms in coastal Del-aware, USA (Bourdelais et al. 2002). In water sam-ples containing C. cf. verruculosa from such a bloomin September 2000, the brevetoxins PbTx-2, PbTx-3,and PbTx-9 were claimed to be detected (Bourdelaiset al. 2002). This organism differs from Verrucophoraby having green coloration (Bourdelais et al. 2002),and our phylogenetic analyses verified that thisorganism is not identical to either V. farcimen orV. verruculosa but is possibly related to the raphido-phytes.

CONCLUSIONS

Data on morphology, ultrastructure, pigmentcomposition, and phylogeny based on rDNAsequences show that the bloom-forming flagellatefrom the Skagerrak, tentatively called Chattonella aff.verruculosa, is not a raphidophyte but represents anew lineage within the heterokont class Dictyocho-phyceae. We propose the name Verrucophora farcimensp. et gen. nov. for this organism and a new order,Florenciellales, to accommodate this taxon and thepicoflagellate Florenciella parvula. We further pro-pose the transfer of F. parvula from the order Dict-yochales to the order Florenciellales. We haveshown that C. verruculosa from Japan is a separatetaxon and propose that it be renamed Verrucophoraverruculosa and transferred to the order Florenciell-ales. Verrucophora farcimen has up to now, with cer-tainty, only been found in Scandinavian coastalwaters. Additional studies of further strains andmore sensitive molecular methods are essential toclarify whether it is indigenous to northern Euro-pean waters or has been introduced from someother geographic region in recent times.

We would like to thank Sissel Brubak for technical assistancewith cultures and Kjersti Andresen for assistance with HPLCisolation of pigments, Senior Lecturer Bjørg Tosterud fortranslating the diagnoses into Latin, and Professor EysteinPaasche for constructive comments on the manuscript. Wealso thank Dr. Fumie Kasai for kindly providing a culture ofthe strain NIES 670. This work was supported by the Norwe-gian Research Council, research program MARE, throughgrants 146749 ⁄ 120 and 140286 ⁄ 120.

Table 3. Pigment composition in various microalgae.

PigmentVFa

DFPb

DDSc

DARc

DPSd

PCPe

HCMf

R

Chl a + + + + + + +Chl c3 + + + nd + + ndChl c2 + + +g +g + + +Chl c1 + nd +g +g + + +19¢-Butanoyloxyfucoxanthin + + + nd + + nd19¢-Hexanoyloxyfucoxanthin nd nd + nd nd + ndFucoxanthin + + + + + + +Diadinoxanthin + + + + + + +Diatoxanthin + nd + nd + + ndb,b-Carotene + + + + + + +Violaxanthin nd nd + + nd nd +Zeaxanthin nd nd + + nd nd +

Dictyochophyceae (D): Verrucophora farcimen (VF), Florenciel-la parvula (FP), Dictyocha speculum (DS), and Apedinella radians(AR); Pelagophyceae (P): Pelagomonas subviridis (PS); Hap-tophyta (H): Chrysochromulina polylepis (CP); and Raphidophy-ceae (R): Chattonella marina (CM); +, present; nd, notdetected.

aThis study.bEikrem et al. 2004.cDaugbjerg and Henriksen 2001.dBjørnland et al. 1989.eZapata et al. 2001.fMostaert et al. 1998.gChl c1 and c2 were not separated by the methods used.

1068 BENTE EDVARDSEN ET AL.

Andersen, R. A. 2004. Biology and systematics of heterokont andhaptophyte algae. Am. J. Bot. 91:1508–22.

Andersen, R. A., Saunders, G. W., Paskind, M. P. & Sexton, J. P.1993. Ultrastructure and 18S rRNA gene sequence for Pelago-monas calceolata gen. et sp. nov. and the description of a newalgal class, the Pelagophyceae classis nov. J. Phycol. 29:701–15.

Aure, J., Danielssen, D. S., Skogen, M., Svendsen, E., Dahl, E.,Søiland, H. & Pettersson, L. 2001. Environmental conditionsduring the Chattonella bloom in the North Sea and Skagerrakin May 1998. In Hallegraeff, G. M., Bolch, C. J. S., Blackburn,S. I. & Lewis, R. [Eds.] Harmful Algal Blooms 2000. Intergov-ernmental Oceanographic Commission of UNESCO, Paris,pp. 82–5.

Backe-Hansen, P., Dahl, E. & Danielssen, D. S. 2001. On thebloom of Chattonella in the North-Sea ⁄ Skagerrak in April–May 1998. In Hallegraeff, G. M., Bolch, C. J. S., Blackburn,S. I. & Lewis, R. [Eds.] Harmful Algal Blooms 2000. Inter-governmental Oceanographic Commission of UNESCO,Paris, pp. 78–81.

Ben Ali, A., De Baere, R., De Wachter, R. & Van de Peer, Y.2002. Evolutionary relationships among heterokont algae(the autotrophic stramenopiles) based on combined analysesof small and large subunit ribosomal RNA. Protist 153:123–32.

Billard, C., Erard-Le Denn, E. & Crassous, M. P. 1998. New obser-vations of Raphidophyceae. Harmful Algae News 17:5–6.

Bjørnland, T. & Liaaen-Jensen, S. 1989. Distribution patterns ofcarotenoids in relation to chromophyte phylogeny and sys-tematics. In Green, J. C., Leadbeater, B. S. C. & Diver, W. L.[Eds.] The Chromophyte Algae: Problems and Perspectives. Claren-don Press, Oxford, UK, pp. 37–61.

Bjørnland, T., Liaaen-Jensen, S. & Throndsen, J. 1989. Carotenoidsof the marine chrysophyte Pelagococcus subviridis. Phytochemistry28:3347–53.

Bourdelais, A. J., Tomas, C. R., Naar, J., Kubanek, J. & Baden, D. G.2002. New fish-killing alga in coastal Delaware produces neu-rotoxins. Environ. Health Perspect. 110:465–70.

Bowers, H. A., Tomas, C., Tengs, T., Kempton, J. W., Lewitus, A. J. &Oldach, D. W. 2006. Raphidophyceae [Chadefaud ex Silva]systematics and rapid identification: sequence analyses andreal-time PCR assays. J. Phycol. 42:1333–48.

Daugbjerg, N. & Henriksen, P. 2001. Pigment composition and rbcLsequence data from the silicoflagellate Dictyocha speculum: aheterokont alga with pigments similar to some haptophytes.J. Phycol. 37:1110–20.

Edvardsen, B. 1993. Toxicity of Chrysochromulina species (Prymne-siophyceae) to the brine shrimp, Artemia salina. In Smayda, T.J. & Shimizu, Y. [Eds.] Toxic Phytoplankton Blooms in the Sea.Elsevier, Amsterdam, pp. 681–6.

Edvardsen, B., Shalchian-Tabrizi, K., Jakobsen, K. S., Medlin, L. K.,Dahl, E., Brubak, S. & Paasche, E. 2003. Genetic variability andmolecular phylogeny of Dinophysis species (Dinophyceae)from Norwegian waters inferred from single cell analyses ofrDNA. J. Phycol. 39:395–408.

Eikrem, W. & Moestrup, Ø. 1998. Structural analysis of the flagellarapparatus and the scaly periplast in Chrysochromulina scutellumsp. nov. (Prymnesiophyceae, Haptophyta) from the Skagerrakand the Baltic. Phycologia 37:132–53.

Eikrem, W., Romari, K., Latasa, M., Le Gall, F., Throndsen, J. &Vaulot, D. 2004. Florenciella parvula gen. et sp. nov. (Dicty-ochophyceae, Heterokontophyta), a small flagellate isolatedfrom the English Channel. Phycologia 43:658–68.

Eppley, R. W., Holmes, R. W. & Paasche, E. 1967. Periodicity in celldivision and physiological behaviour of Ditylum brightwellii, amarine planktonic diatom during growth in light-dark cycles.Arch. Mikrobiol. 56:305–23.

Fukuyo, Y., Takano, H., Chihara, M. & Matsuoka, K. 1990. Red TideOrganisms in Japan: An Illustrated Taxonomic Guide. Uchida Ro-kakuho, Tokyo, Japan, 407 pp.

Guillou, L., Chretiennot-Dinet, M.-J., Boulben, S., Moon-van derStaay, S. Y. & Vaulot, D. 1999. Symbiomonas scintillans gen. et sp.nov. and Picophagus flagellatus gen. et sp. nov. (Heterokonta):

two new heterotrophic flagellates of picoplanktonic size. Protist150:383–98.

Hara, Y., Doi, K. & Chihara, M. 1994. Four new species of Chatto-nella (Raphidophyceae, Chromophyta) from Japan. Jpn.J. Phycol. 42:407–20.

Hayes, P. K. & Barker, G. L. A. 1997. Genetic diversity within BalticSea populations of Nodularia (Cyanobacteria). J. Phycol.33:919–23.

Hernandez-Becerril, D. U. & Bravo-Sierra, E. 2001. Planktonic sili-coflagellates (Dictyochophyceae) from the Mexican PacificOcean. Bot. Mar. 44:417–23.

Heywood, P. 1990. Phylum Raphidophyta. In Margulis, L., Corliss, J.O., Melkonian, M. & Chapman, D. J. [Eds.] Handbook of Pro-toctista. Jones and Bartlett, Boston, pp. 318–25.

Heywood, P. & Leedale, G. F. 2000. Order RaphidomonadidaHeywood & Leedale, 1983. In Lee, J. J., Leedale, G. F. &Bradbury, P. [Eds.] The Illustrated Guide to the Protozoa. 2nd ed.Vol. 2. Society of Protozoologists, Lawrence, Kansas, pp. 744–51.

Hibberd, D. J. & Chretiennot-Dinet, M.-J. 1979. The ultrastructureand taxonomy of Rhizochromulina marina gen. et sp. nov., anamoeboid marine chrysophyte. J. Mar. Biol. Assoc. U. K. 59:179–93.

Honda, D., Kawachi, M. & Inouye, I. 1995. Sulcochrysis biplastida gen.et sp. nov.: cell structure and absolute configuration of theflagellar apparatus of an enigmatic chromophyte alga. Phycol.Res. 43:1–16.

Hopkins, C. C. E. 2001. A review of introductions and transfers ofalien marine species in the North Sea area. In Report to Direc-torate for Nature Management (DN). DN, Oslo, Norway, 96 pp.

Inouye, I. 1993. Flagella and flagellar apparatuses of algae. InBerner, T. [Ed.] Ultrastructure of Microalgae. CRC Press, BocaRaton, Florida, pp. 99–133.

Jeffrey, S. W. & Mantoura, R. F. C. 1997. Minimum criteria foridentifying phytoplankton pigments. In Jeffrey, S. W., Manto-ura, R. F. C. & Wright, S. W. [Eds.] Phytoplankton Pigments inOceanography. UNESCO Publ., Paris, pp. 631–2.

Jeffrey, S. W. & Wright, S. W. 1994. Photosynthetic pigments inthe Haptophyta. In Green, J. C. & Leadbeater, B. S. C.[Eds.] The Haptophyte Algae. Clarendon Press, Oxford, UK,pp. 111–32.

Johnsen, G., Prezelin, B. B. & Jovine, R. V. M. 1997. Fluorescenceexcitation spectra and light utilization in two red tide dino-flagellates. Limnol. Oceanogr. 42:1166–77.

Johnsen, G. & Sakshaug, E. 1993. Bio-optical characteristics andphotoadaptive responses in the toxic and bloom-formingdinoflagellates Gyrodinium aureolum, Gymnodinium galathea-num, and two strains of Prorocentrum minimum. J. Phycol.29:627–42.

Johnsen, G., Sakshaug, E. & Vernet, M. 1992. Pigment composition,spectral characterization and photosynthetic parameters inChrysochromulina polylepis. Mar. Ecol. Prog. Ser. 83:241–9.

Kawachi, M., Inouye, I., Honda, D., O’Kelly, C. J., Bailey, J. C.,Bidigare, R. R. & Andersen, R. A. 2002. The Pinguiophyceaeclassis nova, a new class of photosynthetic stramenopiles whosemembers produce large amounts of omega-3 fatty acids. Phycol.Res. 50:31–47.

Klaveness, D., Shalchian-Tabrizi, K., Thomsen, H. A., Eikrem, W. &Jakobsen, K. S. 2005. Telonema antarcticum sp.nov., a commonmarine phagotrophic flagellate. Int. J. Syst. Evol. Microbiol.55:2595–604.

Lu, D. & Gobel, J. 2000. Chattonella sp. bloom in North Sea, spring2000. Harmful Algae News 21:10–1.

Lush, G. J. & Hallegraeff, G. M. 1996. High toxicity of the red tidedinoflagellate Alexandrium minutum to the brine shrimp Art-emia salina. In Yasumoto, T., Oshima, Y. & Fukuyo, Y. [Eds.]Harmful and Toxic Algal Blooms. Intergovernmental Oceano-graphic Commission of UNESCO, Tokyo, pp. 389–92.

Medlin, L., Elwood, H. J., Stickel, S. & Sogin, M. L. 1988. Thecharacterization of enzymatically amplified eukaryotic 16S-likerRNA-coding regions. Gene 71:491–9.

Meldahl, A.-S., Edvardsen, B. & Fonnum, F. 1994. Toxicity of fourpotentially ichthyotoxic marine phytoflagellates determined

VERRUCOPHORA FARCIMEN GEN. ET SP. NOV. 1069

by four different test methods. J. Toxicol. Environ. Health42:289–301.

Mignot, J. P. 1976. Complementary study of Chloromonadida––finestructure of Chattonella subsalsa Biecheler, a flagellate frombrackish water. Protistologica 12:279–93.

Moestrup, Ø. 1995. Current status of chrysophyte ‘splinter groups’:synurophytes, pedinellids, silicoflagellates. In Sandgren, C. D.,Smol, J. P. & Kristiansen, J. [Eds.] Chrysophyte Algae: Ecology,Phylogeny and Development. Cambridge University Press, Cam-bridge, UK, pp. 75–91.

Moestrup, Ø. & O’Kelly, C. J. 2000. Class Silicoflagellata. In Lee,J. J., Leedale, G. F. & Bradbury, P. [Eds.] An Illustrated Guideto the Protozoa. Allen Press, Lawrence, Kansas, pp. 775–82.

Moestrup, Ø. & Thomsen, H. A. 1990. Dictyocha speculum(Silicoflagellata, Dictyochophyceae), studies on armoured andunarmoured stages. K. Dan. Vidensk. Selsk. Biol. Skr. 37:1–57.

Mostaert, A. S., Karsten, U., Hara, Y. & Watanabe, M. M. 1998.Pigments and fatty acids of marine raphidophytes: a chemo-taxonomic re-evaluation. Phycol. Res. 46:213–20.

Naustvoll, L., Dahl, E., Danielssen, D., Aure, J., Skogen, M. &Budgell, P. 2002. Chattonella i Skagerrak – en ny trussel foroppdrettsnæringen? Havets Miljø, Fisken og Havet, særnummer2:126–9 (in Norwegian).

O’Kelly, C. J. & Wujek, D. E. 1995. Status of the Chrysamoebales(Chrysophyceae): observations on Chrysamoeba pyrenoidifera,Rhizochromulina marina and Lagynion delicatulum. In Sandgren,C. D., Smol, J. P. & Kristiansen, J. [Eds.] Chrysophyte Algae:Ecology, Phylogeny and Development. Cambridge University Press,Cambridge, UK, pp. 361–72.

Riisberg, I. & Edvardsen, B. 2006. Genetic variation in ribosomalDNA of Chattonella aff. verruculosa, a new harmful dictyocho-phyte forming recurrent blooms in Scandinavian waters. In12th International Conference on Harmful Algae, Programme andAbstracts, Copenhagen, Denmark, 4–8 September, 2006. Interna-tional Society for the Study of Harmful Algae and the Inter-governmental Oceanographic Commission, Paris, pp. 270.

Ronquist, F. & Huelsenbeck, J. P. 2003. MrBayes 3: Bayesian phy-logenetic inference under mixed models. Bioinformatics19:1572–4.

Scholin, C. A., Herzog, M., Sogin, M. & Anderson, D. M. 1994. Identi-fication of group- and strain-specific genetic markers for globallydistributed Alexandrium (Dinophyceae). II. Sequence analysis ofa fragment of the LSU rRNA gene. J. Phycol. 30:999–1011.

Sekiguchi, H., Kawachi, M., Nakayama, T. & Inouye, I. 2003. Ataxonomic re-evaluation of the Pedinellales (Dictyochophy-ceae), based on morphological, behavioural and moleculardata. Phycologia 42:165–82.

Sekiguchi, H., Moriya, M., Nakayama, T. & Inouye, I. 2002. Vestigialchloroplasts in heterotrophic stramenopiles Pteridomonasdanica and Ciliophrys infusionum (Dictyochophyceae). Protist153:157–67.

Skjelbred, B. & Naustvoll, L. 2006. Growth preferences and toxicityof Chattonella aff. verruculosa (Heterokontophyta). In 12thInternational Conference on Harmful Algae, Programme andAbstracts, Copenhagen, Denmark, 4–8 September, 2006.International Society for the Study of Harmful Algae and theIntergovernmental Oceanographic Commission, Paris, pp.281–2.

Swofford, D. L. 1999. PAUP*4.0. Phylogenetic Analysis Using Parsimony(*and Other Methods), Version 4.0. Sinauer Associates, Sunder-land, Massachusetts.

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. &Higgins, D. G. 1997. The CLUSTAL X windows interface:flexible strategies for multiple sequence alignment aided byquality analysis tools. Nucleic Acids Res. 25:4876–82.

Throndsen, J. 1978. The dilution-culture method. In Sournia, A.[Ed.] Phytoplankton Manual. UNESCO, Paris, pp. 218–24.

Vesk, M. & Moestrup, O. 1987. The flagellar root system in Het-erosigma akashiwo (Raphidophyceae). Protoplasma 137:15–24.

Vrieling, E. G., Koeman, R. P. T., Nagasaki, K., Ishida, Y., Peperzak,L., Gieskes, W. W. C. & Veenhuis, M. 1995. Chattonella andFibrocapsa (Raphidophyceae): first observation of, potentiallyharmful, red tide organisms in Dutch coastal waters. Neth.J. Sea Res. 33:183–91.

Yamaguchi, M., Itakura, S., Nagasaki, K., Matsuyama, Y., Uchida, T.& Imai, I. 1997. Effects of temperature and salinity on thegrowth of the red tide flagellates Heterocapsa circularisquama(Dinophyceae) and Chattonella verruculosa (Raphidophyceae).J. Plankton Res. 19:1167–74.

Zapata, M., Edvardsen, B., Rodrıguez, F., Maestro, M. & Garrido,J. L. 2001. Chlorophyll c2 monogalactosyldiacylglyceride ester(chl c2-MGDG). A novel marker for Chryso chromulina species.Mar. Ecol. Prog. Ser. 219:85–98.

Zapata, M., Jeffrey, S. W., Wright, S. W., Rodrıguez, F., Garrido, J. L.& Clementson, L. 2004. Photosynthetic pigments in 37 species(65 strains) of Haptophyta: implications for oceanography andchemotaxonomy. Mar. Ecol. Prog. Ser. 270:83–102.

Zapata, M., Rodrıguez, F. & Garrido, J. L. 2000. Separation of chlo-rophylls and carotenoids from marine phytoplankton: a newHPLC method using a reversed-phase C8 column and pyridine-containing mobile phases. Mar. Ecol. Prog. Ser. 195:29–45.

1070 BENTE EDVARDSEN ET AL.