View
242
Download
0
Category
Tags:
Preview:
DESCRIPTION
2012 Women's Soccer Guide
Citation preview
/// UNC ASHEVILLE BULLDOGS ///
1/// F E A R T H E D O G ///
General InformationMedia Information ..................................................................................................................2Primary Media Outlets ..........................................................................................................3
Season PreviewOutlook ................................................................................................................................. 4-5
PlayersElizabeth Keil .............................................................................................................................6Mary Beale .................................................................................................................................7Hannah Jeske .............................................................................................................................8Ferriss Roberts .........................................................................................................................9Amanda Knapp .......................................................................................................................10Tarrah Tate ...............................................................................................................................11Erin Ryan ..................................................................................................................................12Kristen Lawson .......................................................................................................................13Heather Muller .......................................................................................................................14Amanda Dailor........................................................................................................................15Kaitlyn Eckert ..........................................................................................................................16Megan Foster...........................................................................................................................17Newcomers ......................................................................................................................18-23
Coaching Staff Head Coach Michelle Demko ............................................................................................24Assistant Coach Mary Casey .............................................................................................25
Records Section2011 Season Stats .................................................................................................................262011 Big South Final Standings ..........................................................................................27 Big South Tournament History ..........................................................................................282006 Big South Champions ..................................................................................................29Game Records ........................................................................................................................30Team Records .........................................................................................................................31Year-by-Year Leaders .............................................................................................................32All-Time Letterwinners ........................................................................................................33Year-by-Year Results ........................................................................................................34-35All-Time Results .....................................................................................................................36UNC Asheville Hall of Fame ................................................................................................37The Big South Conference .............................................................................................38-39
UNC AshevilleThe University of North Carolina Asheville .............................................................40-43Dr. Anne Ponder, Chancellor ...............................................................................................44Janet R. ConeDirector of Athletics/Senior Administrator for University Enterprises .............45-46Support Staff ....................................................................................................................47-48Head Coaches .......................................................................................................................49Rocky .......................................................................................................................................50NCAA .....................................................................................................................................51The Bulldog Athletics Association .....................................................................................52
Bulldog Coaching Staff Head Coach...................................................... Michelle Demko
.............................................................................(Maryland, 1996)
Overall/years .................................................. 5-31-1/Third Year
at Asheville ...................................................... 5-31-1/Third Year
Assistant Coach ........................................................Mary Casey
.............................................................................(Maryland, 2009)
2011 Team Information2011 Record ....................................................................... 4-15-1
2011 Big South Record/Finish ................................... 3-7-0/8th
Starters Returning/Lost ........................................................ 7/4
Letterwinners Returning/Lost ............................................ 11/7
Soccer Support Staff Athletic Trainer ................................................Jim Wallace, ATC
Athletics Communication ........................................Mike Gore
Greenwood FieldCapacity .....................................................................................300
Press Box Phone ............................................... (828) 575-6649
Message To MediaThis edition of the 2012 UNC Asheville Soccer media
guide has been prepared for you as you cover the Bulldogs
during the season. For additional information, photographs,
interviews with players and coaches, please contact Matt
Pellegrin or Mike Gore in the Athletics Communication
Offi ce.
CreditsDesigner:
Matt Pellegrin
Editor
Mike Gore
Photographers:
Brett Whitsell, Blake Madden, Todd Drexler
UNC Asheville is a selective, public liberal arts institution. UNC Asheville’s Intercollegiate Athletics Program refl ects the attitudes and values underlying the University’s overall mission: academic excellence, diversity, equity, integrity, service, and accomplishment. The UNC Asheville athletics program contributes to this liberal arts culture in two ways. First, athletics programs foster a sense of community and pride by fi elding NCAA Division I teams and developing talented student-athletes who successfully represent UNC Asheville in competition and refl ect the University’s commitment to overall excellence. Accordingly, the athletics program encourages an atmosphere of respect for self and others through the development of ethical conduct, sportsmanship, leadership, and citizenship and provides equitable opportunities for all students and staff, including women, minorities and indivduals of all sexual identities. Second, the program provides an additional campus experience for capable students to grow and develop academically, personally, socially, and athletically. This experience promotes institutional commitment and pride on the part of students, faculty, staff, and alumni.
UNC ASHEVILLE MISSION STATEMENT
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
2 /// F E A R T H E D O G ///
Athletics Media Communications
Mike Gore Associate Athletics Director for
External Affairs / Soccer ContactOffi ce Phone: (828) 251-6923Cell Phone: (828) 215-6387
Email: mgore@unca.edu
Matt PellegrinDirector of Athletics Media Communication
Offi ce Phone: (828) 251-6931Cell Phone: (828) 545-1121Email: mpellegr@unca.edu
Offi ce Fax: (828) 251-6386Web Site: www.uncabulldogs.com
Mailing Address:One University Heights
Justice Center, CPO #2600Asheville, N.C. 28804
COVERING THE BULLDOGSThe Offi ce of Athletics Communication produces stories, pertinent notes about upcoming games, and cumulative statistics, all of which are available at www.uncabulldogs.com, the on-line home of Bulldog athletics.
Press Passes: Please contact the UNC Asheville Athletics Communication Offi ce as early as possible for press passes. Passes will be mailed if time permits.
Broadcasts: There are no phone lines at the Greenwood Field for radio and internet broadcasts. If you would like to broadcast a game please call well in advance to see what arrangements can be made.
Photographers: Photo passes are limited to working press photographers. All photo requests should be made as early as possible to the Offi ce of Athletics Communication.
Services: The UNC Asheville Offi ce of Athletics Communication will provide programs, notes and updated statistics at every home soccer match. After the match, each media member will receive a box score of the match.
Interview Policy: The UNC Asheville Offi ce of Athletics Communication and the women’s soccer coaching staff are eager to assist the media with player and coach interview requests. Please contact the Offi ce of Athletics Communication for all player interviews. On the road, please make coach interview arrangements through the Athletics Commincation representative for that sport. Players will not be available for interviews on days of games until the completion of the contest. Your cooperation is appreciated.
Media Guides: UNC Asheville will not print media guides to assist in the department’s cost-containment efforts. The Athletics Communications Offi ce will provide the same material it has in the past through on-line supplements and enhanced notes packages.
Video Streaming: UNC Asheville will once again video stream all of its home soccer matches live on www.bigsouthsports.com. This is a pay per view service. Archives of each broadcast will be available the day after each match. For match highlights or more information video of matches please contact Matt Pellegrin
MEDIA INFORMATION
/// UNC ASHEVILLE BULLDOGS ///
3/// F E A R T H E D O G ///
NEWSPAPERS
Asheville Citizen-TimesPO Box 2090Asheville, NC 28802828/232-5867800/800-4204Fax: 828/251-0585
Hendersonville Times-NewsPO Box 490Hendersonville, NC 28739828/692-0505Fax: 828/692-2319
The MountaineerPO Box 129Waynesville, NC 28786828/452-0661Fax: 828/452-0665
The Charlotte ObserverPO Box 32188Charlotte, NC 28232704/379-6448Fax: 704/379-6506
WIRE SERVICEAssociated Press219 South McDowell St.Raleigh, NC 27602800/662-7075Fax: 919/834-1078
TELEVISION
WLOS-TV110 Technology DriveAsheville, NC 28803828/651-4563Fax: 828/651-4618
WSPA-TVPO Box 1717Spartanburg, SC 29304864/576-7777Fax: 864/587-5430
WYFF-TV505 Rutherford Rd.Greenville, SC 29602864/242-4404Fax: 864/240-5305
RADIO STATIONS1310 WISE Radio1190 Patton Ave.Asheville, NC 28804828/253-1310
WWNC RadioPO Box 6447Asheville, NC 28816828/253-3835
WCQS Radio70 Broadway St.Asheville, NC 28801828/253-6875
Location: Asheville, North CarolinaEnrollment: 3,700Founded: 1927Nickname: BulldogsAffi liation: NCAA Division IConference: Big SouthColors: Royal Blue and WhiteArena (Capacity): Greenwood Field (300)Chancellor: Dr. Anne PonderFaculty Representative: Dr. Herman HoltDirector of Athletics: Janet R. ConeAssociate Athletics Director of Internal Affairs and Compliance: Terri BrneAssociate Athletics Director of External Affairs: Mike GoreAthletics Business Manager: Judith BohanDirector of Marketing: Erin Punter SpenceTicket Manager: Harmon TurnerTicket Offi ce Phone: (828) 251-6904
PRIMARY ATHLETICS LOGO
SECONDARY ATHLETICS LOGOS
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
4 /// F E A R T H E D O G ///
Third-year coach Michelle Demko has been steadily rebuilding the UNC Asheville women’s soccer program and progress should continue in 2012.
Last year the Bulldogs improved from one win in 2010 to four victories. Three of those wins came in Big South Conference play and allowed Asheville to qualify for the Big South Tournament for the fi rst time in three seasons. The Bulldogs were preseason picks to fi nish last in 2011 but that didn’t come close to happening as Asheville came in eighth place out of 11 teams.
Demko’s club showed it wasn’t just happy to be there as it top took top-seeded Radford to penalty kicks before the Highlanders survived the Bull-dog challenge. RU would win its next two matches easily to advance to the NCAA Tournament.
“I thought we became more competitive as the season rolled on,” comment-ed Demko. “We closed the gap on our opponents and gained confi dence. We even found a way to win a few matches.”
Asheville was a young team in 2011 and will be even younger in 2012. Demko has brought in 10 freshmen, many of whom could play right away. The Bull-dog coach believes her team will be better this year but preaches patience.
“I think we’re going to be a much more athletic and dynamic squad this year,” admitted Demko. “Also, for the time since I’ve been here, we’re going to have some real depth. Injuries have really crippled us the past two years. We don’t want injuries this year, but we’ll be able to absorb some injuries a little better.
“However, we’re going to be an extremely young team,” added Demko. “I like the recruits we’ve brought in but there’s a real learning curve going from high school to the college game. We’re all going to have to be patient with this year’s club.”
GOALKEEPER
Sophomore Heather Muller was Asheville’s goalkeeper last year for every minute of every match. Like the Bulldog team, she improved as the season went on, earning All-Tournament honors for her play against Radford.
“Heather learned a great deal last season and should settle in even more as a sophomore,” declared Demko. “She’s very athletic and really helps us when we want to go on a counter-attack. “
Junior Kristen Lawson is a versatile player who will compete for the starting spot in goal. She also has the ability to play midfi eld, as well.
“We really like Kristen’s versatility,” said Demko. “She’ll make a run at play-ing time as our starting goalkeeper. And we like the fact we could use her on the fi eld. She can really strike the ball with power.”
DEFENSE
Asheville’s defense will be anchored by junior Erin Ryan. She’s been a starter in the back for the Bulldogs the past two seasons.
“Erin may be the hardest worker on our team,” explained Demko. “She uses her body well and is physical when she needs to be. Erin has the mentality to always look to go forward which is what we’re looking for.”
Senior Elizabeth Keil missed last year due to studying abroad. She started for half the season in 2010 before injuries slowed her down.
“We’re glad to have Elizabeth back,” commented Demko. “She’s a good or-ganizer and was a real spark for us two years ago. We’re glad that we’ll have her senior leadership this season.”
Sophomore Megan Foster missed the fi rst part of the 2011 season with a knee injury before recovering to play in the fi nal part of the year.
“We’re glad to have Megan healthy this year,” stated Demko. “She sees the whole game quite well.”
Five freshmen will all vie for playing time in 2012. Start with 5-4 rookie Kelsey Palmer, who has a little more experience than the other freshmen.
“Kelsey graduated early and was able to join us in January,” said Demko. “She played in the spring and trained with us. We can use her in the back or in midfi eld. Kelsey is an attacking player who can play with both feet. We look for big things from her at UNC Asheville.”
Rachel Kish comes to Asheville from Reagan HS in Winston-Salem.
“Rachel will be a big presence in the back,” stated Demko. “She’s very smart tactically and knows how to organize in the run of play. We expect Rachel to make an immediate impact on the backline starting with this season.”
Melanie Cusi is a player who can play both in midfi eld and in the back.
“Melanie is a good passer and solves pressure easily,” admitted Demko. “She comes from a great club program and is used to a high caliber of play.”
Wake Forest native Alex Stradford is another newcomer who can also play both in the back and in midfi eld.
“Alex is another player who comes from a really good club program,” commented Demko. “She has excellent speed and knows how to play the game.”
A teammate of Rachel Kish’s at Reagan HS, Allie Jacobius, joins the Asheville program in the back.
“Allie is a hard worker who played with Rachel in high school,” said Demko. “She will provide depth in the back this season.”
MIDFIELD
Asheville returns some experience and has added some talented newcom-ers to the midfi eld.
Senior Ferriss Roberts enjoyed a breakout season in 2011. She was Asheville’s fourth leading scorer with fi ve goals and 12 points.
Momentum Building For UNC Asheville Soccer
Hannah Jeske
/// UNC ASHEVILLE BULLDOGS ///
5/// F E A R T H E D O G ///
“Ferriss had a huge impact last season. We can play her up top or at wide midfi eld,” explained Demko. “She’s a good one-on-one player who really strikes the ball hard. Ferriss will be a key player for us this year.”
Senior Hannah Jeske has started and played in all of the Bulldogs’ 53 matches in her career.
“Hannah is one of our toughest players,” declared Demko. “She’s great at winning balls in the air and keeping us balanced on offense and defense. Han-nah is always there and has been a consistent force for our program.”
Junior Tarrah Tate was slowed last season with a shoulder injury that caused her to miss the second half of the year. She should be 100 percent in 2012.
“We missed Tarrah when she couldn’t play last year,” explained Demko. “She’s one of our best technical players and has great vision with good feet.”
The Bulldogs will have two freshmen competing for playing time in midfi eld this season. Both could make an immediate impact.
Local product Shenny Lenhart enjoyed a spectacular career at Reynolds HS. She scored 106 goals in her career.
“Shenny can play anywhere on the fi eld,” commented Demko. “She obvi-ously has the ability to score goals in a lot of different ways, but she’s also an excellent playmaker. Shenny will provide a spark for our team this year. She’s a real competitor.”
Michigan native Bria West has outstanding credentials, and Demko is excited about her potential.
“Bria is very creative on offense and will play center-midfi eld,” stated Dem-ko. “She’s a soccer junkie who knows the game really well.”
FORWARDS
Asheville returns most of its forwards from last season, and all of the return-ees should be even better with a year of experience under their belts. Like everywhere else, Demko believes the newcomers will play a major role up front, too.
The Bulldogs return leading scorer Amanda Knapp to the roster in 2012. The junior forward really blossomed last year with six goals and 14 points. Three of her goals were game-winners.
“Amanda is one of our most dynamic forwards,” declared Demko. “She’s not afraid to get physical and has the speed to get forward and behind the defense. Amanda is tough to defend and has the ability to score a lot of goals for us this season.”
Sophomore Amanda Dailor was one of fi ve players to start and play in all 20 matches for Asheville in 2011. She scored a goal and added two assists.
“Amanda is the total package as she’s one of our best players,” stated Dem-ko. “She’s doesn’t get rattled and really likes to get forward. What we need for Amanda to do more this year is to take more shots and score more goals. She’s more than capable.”
Sophomore Kaitlyn Eckert enjoyed a strong freshman campaign. She fi nished the year tied for the team lead in goals with six and was second in points with 15.
“Kaitlyn is a dangerous player that everyone one of our opponents will have to account for,” explained Demko. “She’s one of our more crafty players and is very good at baiting defenders. When Kaitlyn is at her best, we’re a pretty good soccer team.”
Senior Mary Beale has been a key contributor for the Bulldogs the past two seasons.
“What’s great about Mary is she is always ready to play,” said Demko. “She’s relentless in her pursuit when we attack. Mary has a high work rate, and we’re glad we have her around for one more year.”
Three talented freshmen will have a chance to make an impact up front in 2012. Start with Kennedy Garrett from Cary, N.C.
“Kennedy will be one of our biggest competitors,” stated Demko. “She’s a very strong player who does whatever it takes to win. Kennedy comes from a great club program in Cary and will be someone who will compete for playing time as a freshman.”
Paige Trent is a striker from Winston-Salem.
“Paige is a tremendous forward who has dangerous speed,” said Demko. “Her fi rst instinct is go toward the goal at all times. She’s quite comfortable playing up front, and we’re anxious to see her perform this season.”
Bethany Spano rounds out Asheville’s rookie forwards. She’ll join the Bulldog family from Huntersville, N.C.
“Bethany is a player who provides immediate pressure on the defense,” commented Demko. “She’s a player who our opponents will have to account for when she’s on the fi eld.”
Ferriss Roberts
Amanda Knapp
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
6 /// F E A R T H E D O G ///
ELIZABETH KEILD • 5-7 • SR • ASHEVILLE, N.C.
Overview: Local product from Asheville HS who earned her way into the starting line-up in the back in 2010...did not play last season as she was attending school in Spain...two-sport athlete at Asheville HS and excelled in fi eld hockey...mother Rebecca Keil works in the Athletic Depar-ment’s as Director of Student-Athlete Affairs...will provide Bulldogs with experienced depth in the back this year. 2011: Did not play. 2010: Played in 11 matches and started seven times...slowed by injuries in latter part of the season. 2009: Played in one match during the year. Before UNC Asheville: Three-year starter in the back at Asheville HS...played forward for fi eld hockey team at Asheville and led the state in goals scored junior and senior year...played club soccer for Highlands Football Club and helped them win Savannah Cup and Riverside tournement in 2006-2007 season.
3
/// UNC ASHEVILLE BULLDOGS ///
7/// F E A R T H E D O G ///
MARY BEALEF • 5-5 • SR • ARDEN, N.C.
Overview: One of four seniors on this year’s roster...gives the Bulldogs some experienced depth up front and in midfi eld...can also play in goal if the need arises...grew up and played high school soccer in Virginia before her family moved to Asheville area prior to her freshman year.
2011: Gave Asheville a real lift off the bench...played in 15 matches and earned a start...had four shots on the season.
2010: Emerged as a key player for the Bulldogs...scored fi rst career goal vs. Francis Marion (9-19) that tied the match as Asheville would go on to record a 2-1 victory...also tallied goal vs. VMI (10-3)...took 11 shots on the season with three coming vs. VMI (10-3).
2009: Played in one match and played the fi nal three min-utes as a goalkeeper in 3-0 victory over Presbyterian Col-lege (10-10).
Before UNC Asheville: Enjoyed a standout career at Halifax County HS in South Boston, Va....earned fi rst team all-district honors as a junior and second team all-district honors as a sophomore and senior...was captain of team senior year...four-year starter at Halifax for head coach Sid Young...also lettered in cross country and basketball...played for Danville Blasts Club team.
7
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
8 /// F E A R T H E D O G ///
HANNAH JESKEMF • 5-7 • SR • CEDARBURG, WI
Overview: Has been a starter for the Bulldogs her entire career and will be a real leader this season...earned Big South All-Rookie honors in 2009...went with Gina Beer in January of 2011 to Nicarauga to teach soccer in Soccer Without Borders Program...excellent student who earned a spot on Big South All Academic team in 2011...has started and played in all 53 matches of her career. 2011: Started and played in every one of Asheville’s 20 matches...fi red fi ve shots during the season. 2010: Played and started in all 17 matches for the Bull-dogs...fi nished the year with three points...scored goal at South Carolina State (9-27)...picked up an assist vs. Wof-ford (9-10)...took six shots on the year. 2009: Started and played in all 16 matches for Asheville and did a great job for the Bulldogs in the midfi eld...has 12 shots on the year, including two at Presbyterian College (10-10) and two at Winthrop (10-23). Before UNC Asheville: Played one year of high school soc-cer at Cedarburg HS in Wisconsin...played as a freshman and earned second team all-conference honors...played club soccer for FC Milwaukee and helped team get to re-gional fi nals.
10
/// UNC ASHEVILLE BULLDOGS ///
9/// F E A R T H E D O G ///
FERRISS ROBERTSMF • 5-5 • SR • LEAWOOD, KS
Overview: Senior midfi elder who turned into one of the most dangerous scorers in the Big South in 2011...will compete for Big South All-Conference honors as a senior...comes to Asheville from Leawood, Kansas.
2011: Tied for second on Bulldog squad in goals scored (5) and fourth in points (12)...scored fi rst goal of the year in key road win at VMI (9-29)...tallied goal in 3-0 home win over PC (10-4)...also scored against Charleston Southern (10-15), at Gardner-Webb (10-20) and at Winthrop (10-22)...fi fth on team in shots taken with 38...earned an assist vs. S.C. State (9-18) and vs. Gardner-Webb (10-20).
2010: Started 12 times and played in 15 matches...tied for third on team in scoring with two goals and four points...scored fi rst career goal at Tennessee Tech (9-5) and tallied again at Coastal Carolina (10-18)...had nine shots during the season with season-high two at Charleston Southern (10-15).
2009: Played in nine matches and gave the Bulldogs some real energy off the bench.
Before UNC Asheville: Attended high school at Blue Val-ley North in Leawood, Kansas...three-year starter at Blue Valley where she led the team in assists throughout her career...helped lead school to 6-A state championship as a sophomore and three straight regional titles...Honorable Mention All-Conference as a junior and senior...played for club team KC Metro Dynamos...led club team to State Cup championships in 2008 and 2009...team earned #15 national ranking...excellent student who made Academic-Principal’s Honor Roll for eight semesters...member of National High School Scholar Hall of Fame...member of Kansas Regional Ballet and American Dance Center for 12 years.
22
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
10 /// F E A R T H E D O G ///
AMANDA KNAPPF • 5-4 • JR • YOUNGSVILLE, N.C.
Overview: One of Asheville’s top strikers and should com-pete for Big South All-Conference honors as as junior...really came into her own in 2011 and ended up leading the Bulldogs in scoring...enjoyed a spectacular high school career at Franklinton.
2011: One of fi ve players to start and play in all of Asheville’s 20 matches...tied for team lead in goals scored (6)...led Bull-dogs in assists (4) and points (16)...second in shots taken (52)...26 of her 52 shots were on goal...three of her goals were game-winners...scored fi rst goal of season in near up-set of Georgia State (9-16)...tallied twice, including game-winner vs. South Carolina State (9-18)...also had game-win-ning goal in 3-0 BSC win over Presbyterian College (10-4)...scored twice in 5-0 victory over Charleston Southern (10-15)...named Attacking Player of the Week on Sept. 20 after scoring three goals in two matches...picked up two assists vs. S.C. State (9-18)...also had assist vs. Charleston South-ern (10-15).
2010: Played in 16 matches and earned 11 starts...fi nished the season as Asheville’s second leading scorer with three goals, two assists and 11 points...scored at least one goal in last two games of the season at Liberty (10-27) and near upset of Big South champion High Point (10-29)...tallied fi rst career goal vs. VMI (10-3)...also had an assist against Keydets (10-3) and at Liberty (10-27)...second on team in shots taken with 27...had two matches with four shots and fi ve matches with three shots taken.
Before UNC Asheville: Attended Franklinton HS where she was the team MVP all four years she played...scored an amazing 165 goals in her career...fi rst-team all-con-ference all four years she played...served as captain as a sophomore, junior and senior...top goal scoring year was junior year when she scored 51 goals...tallied 49 goals as a sophomore...senior year scored 38 goals with 24 assists...
all-region performer as a sophomore, junior and senior...was named Northern Carolina Conference Player of the Year following senior campaign...earned Wendy’s Heisman Award as junior...member of North squad in North Caro-lina State games in 2008 & 2009...was named as 2010 U.S. Army National Scholar Athlete...named to All-State team as a senior...led Franklinton to conference championship as a senior and helped team advance to third round of state playoffs...also led school to Brassfi eld Commercial Classic Tournament title for four straight years...played club for CASL 91 Spartan Premier...team fi nished fi rst in Premier Division in 2010 and #5 ranking in North Carolina...played in East-West All-Star Game in Greensboro in July of 2010.
6
/// UNC ASHEVILLE BULLDOGS ///
11/// F E A R T H E D O G ///
TARRAH TATEMF • 5-5 • JR • CASTLE ROCK, CO
Overview: One Junior forward who will compete for play-ing time up front in 2012...off to a good start in 2011 be-fore injuries caused her to miss the rest of the year after just seven matches.
2011: Played in seven matches and started fi ve times early in the year but injuries caused her to miss the second half of the season...took four shots during the season.
2010: Played in 15 matches and started 13 times...regis-tered 10 shots...had three shots vs. VMI (10-3) and two shots at Furman (9-15)...started the last seven matches of the year.
Before UNC Asheville: Attended Rock Canyon HS in Cas-tle Rock, Colo....led team in scoring in both her junior and senior seasons...served as team captain as a senior...earned All-Conference honors senior campaign...played for club team Colorado Rush Nike that was ranked fi fth in country at one point...played for Colorado ODP until 2008 and at-tended Region IV camp.
16
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
12 /// F E A R T H E D O G ///
ERIN RYAND • 5-8 • JR • RALEIGH, N.C.
Overview: Junior defender who has gotten better with each season and will be key contributor for the Bulldogs in 2012...versatile player who can play all over the fi eld, including in goal. 2011: Played in 16 matches and earned 11 starts...took fi ve shots during the year. 2010: Started all 17 matches for the Bulldogs, including one as a goalkeeper at Charleston Southern (10-15)...played most of the season as a defender...took 14 shots during the year with three at Presbyterian College (10-9)...made fi ve saves in the CSU match as she played the fi rst half against the Buccaneers. Before UNC Asheville: Four-year starter at Sanderson HS...earned all-conference honors for four straight years...named to all-regional team sophomore through senior year...team captain as a senior and scored three goals with two assists from central defender spot...was named team MVP following senior year...helped lead Sanderson to 13-5-4 overall record and berth in conference and state tourna-ment...excellent student who was academic all-conference for four years...received the Sportsmanship Award at Brit-tany Tournament...played club soccer for ‘91 Triangle Fut-bol Club Navy Girls and team compiled 38-12-7 overall record last year...club team advanced to State Cup fi nals and earned a regional berth...helped lead state cup team to state championship in 2008 and went unbeaten in Premier League.
18
/// UNC ASHEVILLE BULLDOGS ///
13/// F E A R T H E D O G ///
KRISTEN LAWSON GK • 5-8 • JR • CHARLOTTE, N.C.
Overview: Came to UNC Asheville as a goalkeeper but due to injuries ended up playing the majority of the sea-son in the fi eld in her freshman season in 2010...member of UNC Asheville Honors Program...will battle for playing time both as a goalkeeeper and as a midfi elder this season.
2011: Played once in match vs. Liberty (10-29).
2010: Played in 14 matches with four of them being in goal...picked up an assist at Liberty (10-27) and fi red a shot on goal at South Carolina State (9-27)...started as goalkeeper in two matches with one being at Coastal Carolina (10-18) and the second against Gardner-Webb (10-24) at home.
Before UNC Asheville: Attended Providence HS in Char-lotte...earned all-conference and all-region honors as a se-nior...was team captain and was given the Panther Pride Award following senior campaign...team MVP as a junior and also named to all-conference and all-region teams...helped lead Providence to #8 ranking in state...named Best Team Player as a sophomore and was picked to go to North Carolina State Games...lettered in basketball at Providence and was captain of team as senior...played club soccer for Charlotte United Gold 91G...helped lead team to #3 ranking in state in 2008 and fi nalist in Southern Soc-cer Showcase...selected to play in North Carolina East-West All-Star Game in Greensboro...also selected to play in North Carolina-South Clash of the Carolinas.
24
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
14 /// F E A R T H E D O G ///
HEATHER MULLERGK • 5-10 • SO • CARY, N.C.
Overview: Came in as a freshman and became the Bulld-gos starter in goal and was there the entire season...played very well in Big South Tournament and helped Asheville take eventual champion Radford to PK’s...named to All-Tourna-ment team...attended Apex HS in Apex...played in presti-gious East-West High School All-Star game in Greensboro in July. 2011: Started in goal for every one of Asheville’s 20 match-es and was there for every minute of the season...posted shutouts vs. PC (10-4) and Charleston Southern (10-15)...made 120 saves on the year. Before UNC Asheville: Enjoyed a standout prep career for head coach Kevin Todd at Apex...senior year posted seven shutouts and allowed just 14 goals...helped lead Apex to 15-3-1 overall record...named fi rst team All-Conference following senior season...was team MVP as a junior and senior...junior year had six shutouts...played in prestigious East-West High School All-Star game in Greensboro in July of 2011...also lettered in basketball at Apex.
0
/// UNC ASHEVILLE BULLDOGS ///
15/// F E A R T H E D O G ///
AMANDA DAILOR F • 5-4 • SO • CASTAIC, CA
Overview: Midfi elder from California who did a great job as a freshman...will compete for Big South All-Conference honors in 2012...fi rst player from California on Bulldog ros-ter since 1999.
2011: One of fi ve players to start and play in all 20 matches for the Bulldogs...scored one goal and added two assists...fi red 44 shots with 19 on goal...tallied fi rst career goal in fi rst collegiate match vs. Davidson (8-20)...picked up an as-sist vs. Presbyterian College (9-18) and Charleston South-ern (10-15).
Before UNC Asheville: Played prep soccer at West Ranch HS in Stevenson Ranch, Calif....high school coach was Cami Hidding...named Rookie of the Year freshman season...earned top Offensive Player as a freshman, sophomore and junior...team MVP sophomore year...made fi rst team All-Conference as a sophomore and second team as a ju-nior...U18 club team won Far West Regionals...U17 squad reached San Diego Surf Cups Finals of the Super Group...U15 team won Cal South National Cup...U10-U18 club team ranked top 20 nationally.
2
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
16 /// F E A R T H E D O G ///
KAITLYN ECKERTF • 5-5 • SO • KNIGHTDALE, N.C.
Overview: Gifted scorer who only played three years of high school soccer before joining UNC Asheville program in January of 2011 after graduating early from Knightdale HS in Knightdale, N.C....enjoyed an excellent rookie sea-son with the Bulldogs and earned a spot on Big South All-Freshman team. 2011: Asheville’s second leading scorer with six goals and 15 points...tied for the team lead in goals with Amanda Knapp (6)...second on team in assists (3)...scored fi rst ca-reer goal on PK vs. Tennessee Tech (8-28)...tallied goal in fi rst win of the year over South Carolina State (9-18)...scored the game-winning goal in Big South 3-1 road victory at VMI (9-29)...also scored vs. Presbyterian College (10-4), at Campbell (10-6) and against Radford in Big South Tour-nament (11-3)....tied for team lead in shots taken with 56...had assist vs. Georgia State (9-16), VMI (9-29) and Gardner-Webb (10-20). Before UNC Asheville: Completed her three-year career at Knightdale with an amazing 105 goals...junior season compiled 63 goals and 32 assists, the eighth highest scor-ing total in state history...earned All-State, All-Region and All-Conference honors...averaged three goals per game...helped lead team to third round of state playoffs.
4
/// UNC ASHEVILLE BULLDOGS ///
17/// F E A R T H E D O G ///
MEGAN FOSTERD • 5-5 • SO • GAINESVILLE, FL
Overview: Midfi elder from Florida who earned valuable experience as a freshman in 2011 and should have a chance to play more this season.
2011: Played in eight matches and earned one start...took three shots during the year wtih two on target.
Before UNC Asheville: Attended Gainesville HS and was the region’s leading goal scorer as a senior with 29 goals and eight assists...named to All-Conference and All-Area team.
15
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
18 /// F E A R T H E D O G ///
ALEX STRADFORDD • 5-5 • FR • WAKE FOREST, N.C.
Overview: Rookie defender from Wakefi eld HS in Wake Forest, N.C.
Before UNC Asheville: Played for CASL, one of the top club teams in the country...earned a spot with ODP pro-gram...team captain at Wakefi eld where she earned All-State and All-Conference honors as a senior.
5
KELSEY PALMERD • 5-4 • FR • MOORESVILLE, N.C.
Overview: Versatile freshman who can play anywhere on the fi eld...enjoyed great prep and club career at Lake Nor-man HS and Lake Norman Soccer Club...graduated from Lake Norman early and entered school in January 2012.
Before UNC Asheville: Named to All-Region and All-Con-ference team as a junior at Lake Norman HS...earned spot on Region III ODP team in 2011...was invited to the U19 National ODP Camp in 2011...ran track at Lake Norman and was regional qualifi er in the 200.
8
/// UNC ASHEVILLE BULLDOGS ///
19/// F E A R T H E D O G ///
KRISTEN PHELPSF • 5-4 • FR • SOUTHERN PINES, N.C.
Overview: Joined the team in August just as training be-gan…will provide depth up front.
Before UNC Asheville: Enjoyed an excellent career at Pinecrest HS in Southern Pines…earned All-Conference and All-Region honors…helped lead Pinecrest to confer-ence championship as a senior.
9
KENNEDY GARRETTF • 5-6 • FR • CARY, N.C.
Overview: Talented freshman striker who will have a chance to play in her rookie season.
Before UNC Asheville: Attended Panther Creek HS in Cary...named to All-Conference team following senior sea-son...served as team captain...played club soccer for CSAL.
11
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
20 /// F E A R T H E D O G ///
BETHANY SPANOF • 5-3 • FR • HUNTERSVILLE, N.C.
Overview: Rookie striker from Huntersville who played at Southlake Christian Academy and for Lake Norman Soccer Club.
Before UNC Asheville: Earned All-State and All-Confer-ence honors senior season at Southlake...led team in scor-ing and was named team MVP.
12
ALLIE JACOBIUSD • 5-4 • FR • WINSTON-SALEM, N.C.
Overview: One of two incoming freshmen to come from Reagan HS as she’ll join teammate Rachel Kish with the Bulldogs in 2012...will work hard for playing time as a de-fender.
Before UNC Asheville: Four-year starter at Reagan...named Player of the Week as a senior...earned MVP honors for 93’ Lady Twins White club team...also served as team captain of club squad.
13
/// UNC ASHEVILLE BULLDOGS ///
21/// F E A R T H E D O G ///
SHENNY LENHARTMF • 5-6 • FR • ASHEVILLE, N.C.
Overview: Local product from nearby Reynolds HS...mid-fi elder who was a dominant player for Reynolds during her prep career...could make an immediate impact with the Bulldogs as a freshman.
Before UNC Asheville: Finished her career at Reynolds as the program’s all-time leading goal scorer with 106...senior year set a school record for goals with 41...was the 2011
and 2012 Asheville Citizen-Times Player of the Year...Moun-tain Athletic Conference Offensive Player of the Year for two straight seasons...earned All-State and All-Conference honors for four consecutive years...played in the East-West All-Star Game in Greensboro and Clash of the Carolinas in Charleston, S.C....club soccer team was Highland Football Club.
17
PAIGE TRENTF • 5-6 • FR • WINSTON-SALEM, N.C.
Overview: Freshman forward from Winston-Salem...at-tended Mount Tabor HS...could make an impact in 2012.
Before UNC Asheville: Led Mount Tabor as a senior with 11 goals and was second in assists...four-year starter...se-nior year named to All-State and All-Region team...served as team captain.
19
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
22 /// F E A R T H E D O G ///
RACHEL KISHD • 5-7 • FR • WINSTON-SALEM, N.C.
Overview: One of two incoming freshmen from Reagan HS in Winston-Salem...central defender who should have a chance to play and make an impact in 2012.
Before UNC Asheville: Earned All-Conference and All-Region honor senior year at Reagan...played for NC Fusion Elite club program.
20
BRIA WESTMF • 5-4 • FR • WEST OLIVE, MI
Overview: One of 10 freshmen on 2012 roster...freshman midfi elder from West Olive, Michigan.
Before UNC Asheville: Three-year starter at West Otta-wa HS where she earned All-Conference honors for three consecutive years...named team captain as a senior...played club soccer for West Michigan Hawks.
21
/// UNC ASHEVILLE BULLDOGS ///
23/// F E A R T H E D O G ///
MELANIE CUSID • 5-4 • FR • FAYETTEVILLE, N.C.
Overview: Freshman defender from Fayetteville, N.C....should have a chance to play in 2012.
\
Before UNC Asheville: Excellent student-athlete at Terry Sanford HS where she lettered in soccer, basketball, tennis and track and fi eld...played soccer for four years and was named All-Conference three times...served as team captain as a senior...played club soccer for Triangle Football Club.
23
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
24 /// F E A R T H E D O G ///
MICHELLE DEMKOHEAD COACH • THIRD SEASON • MARYLAND, 1996
Michelle Demko is in her third year as head coach of the UNC Asheville women’s soccer program.
The former Maryland star is steadily rebuilding the Bulldog program and determined to get it back to the top of the Big South Conference. After winning only one match in her fi rst season as head coach in 2010, Asheville was the most improved team in the Big South a year ago. The Bulldogs won four matches and qualifi ed for the Big South Tournament for the fi rst time in three seasons. Asheville took eventual Big South champion and NCAA participant Radford to a shoot-out before falling to the Highlanders in the quarterfi nals of the league tourney. This past spring, she was selected to work with U.S. Under-20 Women’s National team as they began prepara-tions for FIFA U-20 Women’s World Cup. Demko, a former standout at the University of Mary-land, came to Asheville after working at the University of Nebraska as an assistant coach. She replaced Michele Cornish, the Big South’s and UNC Asheville’s all-time winningest coach. “When we began to look at the applicants for this posi-tion, we were determined to fi nd a Champion in Athletics and a Leader in Life,” declared Director of Athletics Janet R. Cone upon Demko’s hiring. “Michelle fi t our vision perfect-ly. She has been a champion on the fi eld both collegiately and professionally. Michelle has also coached at two out-standing universities. We believe she will do an exemplary job leading our women’s soccer program.” Demko had been at Nebraska for three years and served as the Huskers recruiting coordinator. Nebraska posted three straight winning seasons and improved its win total each year.
Before going to Nebraska, Demko spent four years with North Carolina State, helping to improve the Pack from a record of 9-9-1 in 2003 to 11-9-1 in 2006. Before her stint at N.C. State, Demko played profes-sionally with the Philadelphia Charge. She was selected in the eighth round (63rd overall) by the Charge and played two seasons in the WUSA, leading Philadelphia into the WUSA Founders Cup semifi nals twice.
Demko also had a successful professional career over-seas, spending three years in Germany in the competitive Frauen Bundesliga for the SC Klinge Seckah, FSV Frankfurt and Bayern Munich. She was a starter for all three teams and led Bayern Munich to a league championship. In addition, Demko cap-tured a national title while playing with the W-League’s Maryland Pride from 1994 to 1996. Demko, who played soccer at the University of Mary-land under former U.S. National Team Coach April Hein-richs, was named to the Atlantic Coast Conference’s 50th Anniversary Women’s Soccer Team. While playing at Mary-land, she served as a two-year captain and was voted MVP by her team. She also earned fi rst-team All-ACC honors. Demko played in three Olympic Festivals (1994-96), as well as being called into national team training camps in 1995, 1996 and 1997. Demko also owns a cap with the U.S. Women’s National Team while playing against Germany in 1997. A native of Largo, Fla., Demko received a bachelor’s de-gree of science-kinesiology from Maryland in 1996. Prior to her arrival at Maryland, she played soccer at Barry Univer-sity in Miami, Fla. She helped lead Barry to the 1992 NCAA Division II national title as she scored in the championship match against Adelphi.
/// UNC ASHEVILLE BULLDOGS ///
25/// F E A R T H E D O G ///
MARY CASEYTHIRD SEASON • MARYLAND, 2009
Former Maryland standout Mary Casey is in her third year as an assistant coach with the UNC Asheville women’s soccer program.
Casey was an All-Atlantic Coast Conference perform-er for Maryland and played professionally for the Northern Virginia Majestics of the United Soccer Leagues’ W-League and was drafted by the Los Angeles Sol of Women’s Profes-sional Soccer (WPS).
Casey played both defender and goalkeeper during her playing career and was an All-ACC fi rst team selection in 2008. She was named a team captain at Maryland her se-nior season and helped lead the Terrapins to an appearance in the Sweet 16 of the 2009 NCAA Tournament.
That season Casey anchored a defense that posted nine shutouts, including fi ve of the Terps’ fi rst seven games. Maryland went 14-6-2 in 2009 as Casey posted 76 saves in goal while only allowing 22 goals over the course of the season.
For her career with the Terrapins she played in 74 con-tests, recording 136 saves and 13 shutouts.
She excelled academically as well, earning a spot on the 2008 All-ACC Academic team. Casey was named to the National Soccer Coaches Association of America Scholar All-American second team and the NSCAA All-East Schol-ar fi rst team.
Mary Casey at Maryland
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
26 /// F E A R T H E D O G ///
2011 UNC ASHEVILLE STATISTICS
## Name GP-GS G A Pts Sh Sh% GW PK-ATT 6 KNAPP, Amanda 20-20 6 4 16 52 .115 3 0-0 4 ECKERT, Kaitlyn 19-18 6 3 15 56 .107 1 1-1 12 HALKIOTIS, Leilani 20-20 5 3 13 56 .089 0 0-0 22 ROBERTS, Ferriss 19-15 5 2 12 38 .132 0 0-0 2 DAILOR, Amanda 20-20 1 2 4 44 .023 0 0-0 9 STAELIN, Frances 20-20 1 1 3 11 .091 0 0-0 16 FLEWELLING, Margo 18-17 1 1 3 4 .250 0 0-0 17 TUCKER, Mary Kate 19-18 0 3 3 2 .000 0 0-0 8 O’BRIEN, Carolyn 18-13 0 1 1 3 .000 0 0-0 18 RYAN, Erin 16-11 0 0 0 5 .000 0 0-0 10 JESKE, Hannah 20-20 0 0 0 5 .000 0 0-0 7 BEALE, Mary 15-1 0 0 0 4 .000 0 0-0 5 TATE, Tarrah 7-5 0 0 0 4 .000 0 0-0 15 FOSTER, Megan 8-1 0 0 0 3 .000 0 0-0 21 BEER, Gina 4-0 0 0 0 1 .000 0 0-0 24 LAWSON, Kristen 1-0 0 0 0 0 .000 0 0-0 20 GOODHAND-SELL, Emma 6-1 0 0 0 0 .000 0 0-0 Total 20 26 20 72 288 .090 4 1-1 Opponents 20 53 34 140 308 .172 14 1-2
RECORD: OVERALL BIG SOUTH HOME AWAY NEUTRALALL MATCHES 4-15-1 3-7-0 3-6-0 1-9-0 0-0-1
TEAM STATISTICS AVL OPP
SHOT STATISTICS Goals-Shot attempts 26-288 53-308 Goals scored per game 1.30 2.65 Shot pct. .090 .172 Shots on goal-Attempts 131-288 175-308 SOG pct. .455 .568 Shots/Game 14.4 15.4 Assists 20 34 CORNER KICKS 68 95 PENALTY KICKS 1-1 1-2 PENALTIES Yellow cards 7 9 Red cards 0 0 ATTENDANCE Total 1716 3206 Dates/Avg Per Date 9/191 10/321 Neutral Site #/Avg 1/0
2011 RESULTSDATE OPPONENT W/L SCORE ATTAug 20 at Davidson L 1-8 1072Aug 28 Tennessee Tech L 1-4 249Sep 02 Eastern Kentucky L 0-4 487Sep 04 at Wofford L 0-5 127Sep 09 at Western Carolina L 0-4 456Sep 11 at Appalachian State L 0-1 297Sep 16 Georgia State L 2-3 187Sep 18 South Carolina State W 5-1 109Sep 25 at ETSU L 0-3 261Sep 29 at VMI* W 3-1 103Oct 01 at Radford* L 0-1 101Oct 04 Presbyterian College* W 3-0 109Oct 06 at Campbell* L 1-2 276Oct 13 Coastal Carolina* L 0-1 123Oct 15 Charleston Southern* W 5-0 137Oct 20 at Gardner-Webb* L OT 3-4 148Oct 22 at Winthrop* L 1-3 365Oct 27 High Point* L 0-4 137Oct 29 Liberty* L 0-3 178Nov 03 Radford* T OT3 1-1
|-GOAL AVERAGE-| |-SAVES-|## GOALTENDERS GP Minutes GA Avg Sv Pct W L T Sho 0 MULLER, Heather 20-20 1840:00 53 2.59 120 .694 3 15 1 2 TM TEAM 0-0 0:00 0 0.00 2 1.000 0 0 0 0 Total 20 1840:00 53 2.59 122 .697 3 15 1 2 Opponents 20 1840:00 26 1.27 105 .802 15 3 1 9
GOALS BY PERIOD 1st 2nd OT OT2 OT3 TotalUNC Asheville 12 14 0 0 0 26 Opponents 25 27 1 0 0 53
SHOTS BY PERIOD 1st 2nd OT OT2 OT3 TotalUNC Asheville 143 140 3 2 0 288 Opponents 136 166 3 3 0 308
SAVES BY PERIOD 1st 2nd OT OT2 OT3 TotalUNC Asheville 52 67 2 1 0 122 Opponents 61 41 2 1 0 105
CORNERS BY PRD 1st 2nd OT OT2 OT3 TotalUNC Asheville 28 40 0 0 0 68 Opponents 41 53 0 1 0 95
FOULS BY PERIOD 1st 2nd OT OT2 OT3 Total UNC Asheville 52 68 0 2 0 122 Opponents 66 73 4 0 0 143
/// UNC ASHEVILLE BULLDOGS ///
27/// F E A R T H E D O G ///
BIG SOUTH OVERALLTeam W L T Pts Pct W L T Pct Home Road Neu L10 Streakxy-Radford 8 2 0 24 .800 15 6 1 .705 8-2-0 5-4-0 2-0-1 7-2-1 L1x-Winthrop 8 2 0 24 .800 12 7 1 .625 8-1-0 4-5-0 0-1-1 7-2-1 L1Campbell 7 1 2 23 .800 15 5 2 .727 7-1-0 5-2-2 3-2-0 6-2-2 L1 High Point 6 2 2 20 .700 8 10 3 .452 4-2-2 4-7-1 0-1-0 5-3-2 L2Liberty 5 4 1 16 .550 9 8 3 .525 4-3-2 4-4-1 1-1-0 5-4-1 L1Gardner-Webb 4 4 2 14 .500 6 8 5 .447 4-2-3 2-5-2 0-1-0 4-4-2 L1Charleston Southern 4 5 1 13 .450 9 8 2 .526 6-3-0 3-5-1 0-1-0 4-4-2 L2UNC Asheville 3 7 0 9 .300 4 15 1 .225 3-6-0 1-9-0 0-0-1 3-6-1 T1Presbyterian College ** 2 6 2 8 .300 4 13 2 .263 3-6-1 1-6-1 0-1-0 2-6-2 W1Coastal Carolina 2 7 1 7 .250 2 15 2 .158 1-4-2 1-6-0 0-5-0 2-7-1 L3VMI 0 9 1 1 .050 3 13 2 .222 3-6-1 0-7-0 0-0-1 0-9-1 L8x - Big South regular-season co-champion y - Big South Tournament champion ** - Presbyterian is not eligible for the postseason tournament
2011 BIG SOUTH STANDINGS
FIRST TEAM ALL-CONFERENCECourtney Durbin F Sr. WinthropKrystyna Freda F Fr. WinthropAshley Clark F Fr. Campbell
Pirjo Leppikangas F Sr. CampbellKelli Joline MF So. High Point
Kirsty Meyer MF R-Jr. CampbellLeilani Halkiotis MF Sr. Asheville
Allie VandeWater MF Jr. WinthropTyler Drake * D So. Radford
Janay Whittaker D Jr. High PointTaylor Brown D Jr. Campbell
Casey Bolduc D Sr. Charleston SouthernChe’ Brown GK So. Radford
SECOND-TEAM ALL-CONFERENCESilvia Betancourt F Sr. Liberty
Dawn Rollyson F Sr. Gardner-WebbJulie Ruh’e F So. Radford
Toni Lashley F So. Charleston SouthernBecca Hemby MF So. High Point
Megan Curan MF Fr. Gardner-WebbKatie Taber MF Sr. High Point
Sarah Strand MF Sr. VMIMegan Pritts D So. Winthrop
Sammy Vercellino D So. High PointLauren Stell D Jr. Liberty
Alyssa Clark D So. Coastal CarolinaAndrea Ritchie GK Sr. High Point
ALL-FRESHMAN TEAMKrystyna Freda F WinthropAshley Clark F CampbellMaddie Boone MF LibertyJacky Kessler F High PointStephanie Herb D Radford
Ashley Herndon D WinthropStephanie Hand D Charleston Southern
Megan Curan MF Gardner-WebbKara Nay MF Radford
Kaitlyn Eckert F AshevilleGracie Boswell F Presbyterian College
ACADEMIC ALL-CONFERENCETaylor Brown Campbell
Allison Lewis Charleston SouthernJessie Benchley Coastal CarolinaMegan Tremblay Gardner-Webb
Brielle Spencer High PointKaren Blocker Liberty
Emily Boggus Presbyterian CollegeMegan Rhodes Radford
Hannah Jeske AshevilleSimone Jimenez VMI
Rachel Webster Winthrop
ATTACKING PLAYER OF THE YEARCourtney Durbin, F, Sr., Winthrop
DEFENSIVE PLAYER OF THE YEAR Tyler Drake, D, Soph., Radford
FRESHMAN OF THE YEARKrystyna Freda, F, Winthrop
COACH OF THE YEARBen Sohrabi, Radford
SCHOLAR-ATHLETE OF THE YEARBrielle Spencer, High Point
BIG SOUTH WOMEN’S SOCCER CHAMPIONSHIP
Thursday, Nov. 3 - Quarterfi nals#5 Liberty 2 .........................#4 High Point 1
(Overtime)#1 Radford 1 ...............#8 UNC Asheville 1
(OT2 - Radford advanced 3-2 on PK’s)#3 Campbell 3 ............#6 Gardner-Webb 1#2 Winthrop 0 .#7 Charleston Southern 0(OT2 - Winthrop advanced 5-3 on PK’s)
Friday, Nov. 5 - Semifi nals#1 Radford 4...............................#5 Liberty 1#3 Campbell 3 ......................#2 Winthrop 2
Sunday, Nov. 7 - Championship#1 Radford 1 .........................#3 Campbell 0
ALL-TOURNAMENT TEAM
SAHAR AFLAKI, F (MVP) ..............RadfordMARYELLEN DERENDA, MF .......RadfordSYDNEY GOLDEN, D ...................RadfordRACHEL CONWAY, MF/D ...........RadfordPIRJO LEPPIKANGAS, MF/F ...... CampbellANNABELLE GIBNEY, F ............ CampbellTAYLOR BROWN, D .................. CampbellCOURTNEY DURBIN, F ........... WinthropALLIE VANDEWATER, MF ........ WinthropHELENA PEREIRA, M .......................LibertyKELLY HENION, D/F .......................Liberty KELLI JOLINE, F ......................... High PointHEATHER MULLER, G ..... AshevilleMEGAN REIMER, MF/F .....Gardner-WebbSTEPHANIE HAND, D ........................CSU
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
28 /// F E A R T H E D O G ///
BIG SOUTH RECORDS
Big South tournament Record By Round
Win Loss Tie PctQuarterfi nals 5 6 3 .435Semifi nals 6 3 1 .650Finals 1 3 3 .357
Big South Tournament Record By Opponent
Win Loss Tie .PctBirmingham-Southern 1 0 0 1.000Charleston Southern 4 1 1 .750Elon 0 0 2 .500High Point 0 2 1 .200Liberty 0 2 2 .250Radford 0 5 0 .000South Alabama 0 1 0 .000UMBC 2 1 0 .667UNC Greensboro 1 0 1 .750Winthrop 4 0 0 1.000Totals 12 12 7 .500
Big South Tournament Results
Year Opponent Round Score W/L Site1992 UMBC Quarterfi nals 0-7 L Baltimore, Md1994 Radford Quarterfi nals 0-1 L Baltimore, Md.1995 UMBC Semifi nals 3-0 W Greensboro, N.C.1995 UNC Greensboro Finals 1-0 W Greensboro, N.C.1996 UMBC Semifi nals 3-0 W Greensboro, N.C.1996 UNC Greensboro Finals 1-1 (3-4, PK’s) L Greensboro, N.C.1997 Charleston Southern Quarterfi nals 3-0 W Radford, Va.1997 South Alabama Semifi nals 1-2 L Radford, Va.1998 Charleston Southern Semifi nals 2-1 (OT) W Lynchburg, Va.1998 Radford Finals 0-1 L Lynchburg, Va.1999 Elon Quarterfi nals 0-0 (4-5, PK’s) L Lynchburg, Va.2000 Liberty Quarterfi nals 1-3 L Radford, Va.2001 Charleston Southern Quarterfi nals 0-2 L Charleston, S.C.2002 Elon Quarterfi nals 1-1 (4-3, PK’s) W Charleston, S.C.2002 Liberty Semifi nals 1-1 (4-2, PK’s) W Charleston, S.C.2002 Radford Finals 0-2 L Charleston, S.C.2003 Winthrop Quarterfi nals 2-1 W High Point, N.C.2003 Charleston Southern Semifi nals 3-0 W High Point, N.C.2003 High Point Finals 0-0 (2-3, PK’s) L High Point, N.C.2004 Winthrop Quarterfi nals 1-0 W Charleston, S.C.2004 High Point Semifi nals 1-3 L Charleston, S.C.2005 Winthrop Quarterfi nals 1-0 W Rock Hill, S.C.2005 Charleston Southern Semifi nals 3-1 W Rock Hill, S.C.2005 Liberty Finals 0-3 L Rock Hill, S.C.2006 Birmingham-Southern Quarterfi nals 1-0 (2 OT) W Conway, S.C.2006 Winthrop Semifi nals 2-1 W Conway, S.C.2006 Liberty Finals 0-0 (4-2, PK’s) W Conway, S.C.2007 Charleston Southern Quarterfi nals 1-1 (4-2, PK’s) W Charleston, S.C.2007 High Point Semifi nals 0-1 L Charleston, S.C.2008 Radford Quarterfi nals 1-2 (OT) L High Point, N.C.2011 Radford Quarterfi nals 1-1 (3-2, PK’S) L Charleston, S.C.
Regular Season Championships
2004, 2005Tournament Championships
1995, 2006Tournament Runners-Up
1996, 1998, 2002, 2003, 2005
The 1995 UNC Asheville team won the Big South Conference championship and set a school record for wins with 16. The Bulldogs won the title by upsetting nationally-ranked UNC Greensboro, 1-0 in the championship match.
/// UNC ASHEVILLE BULLDOGS ///
29/// F E A R T H E D O G ///
When the 2006 season started for the UNC Asheville women’s soccer team, Michele Cornish’s club would not carry the role of favorite for the fi rst time in two seasons.
The Bulldogs were coming off back-to-back regular season championships in 2006. The 2004 and 2005 teams had been expected to be good and accomplished a great deal with their titles. Only one thing was missing from those teams and that was a Big South Conference tournament championship and a trip to the NCAA Tournament.
There wasn’t much hope that the Bulldogs would be able to get that tournament title and trip to the NCAA Tournament in 2006. UNC Asheville was a preseason pick to fi nish in fi fth place and had graduated the core of its championship teams. There were some key players returning but a lot of younger players were going to have to step up for the Bulldogs to have a winning season.
Asheville entered the Big South Conference Tournament as the fi fth seed and without the pressure of being the top seed from the previous two seasons. The Bulldogs were 8-6-2 and had a nice year considering they lost their starting goalkeeper early in the season and at times were struggling to score goals.
The fi rst game in the tournament would be a tough one as fourth-seeded Birmingham-Southern would be the opponent. The Panthers were in their fi nal year of Division I and wanted to go out a winner. They had beaten the Bulldogs, 1-0 early in the season at Greenwood Field.
A strong Asheville defense led by senior Sara Pahl and junior Kate Barrow kept the Panthers at bay. But the Panthers’ defense was tough as well and kept the Bulldogs off the scoreboard. The match moved into a second overtime period and it looked like penalty kicks would decide the match. However, Robyn Busha had other ideas. She took a pass from Juliana Duncan and headed the ball into the back of the goal in the 107th minute to send the Bulldogs to the semifi nals for the fi fth straight year.
The semifi nals would be a match with top-seeded Winthrop. The Lady Eagles were gunning for revenge against Asheville. The Bulldogs had ended Winthrop’s season the past three years and it had never beaten UNC Asheville. The regular-season champs scored early and began to dominate the match in the fi rst half before settling for a 1-0 lead.
But again Asheville’s defense would tighten up and keep Winthrop off the scoreboard. The Bulldogs began to play better and then got a big break to tie the game early in the second half. On a corner kick, the ball was knocked into the goal by an Eagle player to knot the match at 1-1.
The Bulldogs were then able to strike again late. Busha sent a perfect pass to Joy Haynes. The junior forward used her speed to get loose for a breakaway. She was able to push the ball into the back of the net and suddenly the Bulldogs led 2-1 with four minutes left. Asheville was able to hold off one more Winthrop charge and the Bulldogs were in the title game for the second straight year and fourth time in the last fi ve seasons.
The Big South Championship match had been a real source of frustration for Cornish and the Bulldog program. This was the sixth time Asheville had advanced to the title game and only had one victory to show. The Bulldogs would face Liberty once again for the title and once again Asheville’s defense was up to the task. The Flames would control play but could not get a shot past Lazar. The match would go through regulation tied at 0-0 before heading to overtime.
It would stay scoreless as each team’s defense would not allow a goal. The Bulldogs’ dream of a trip to the NCAA Tournament would come down to Penalty Kicks.
Lazar stopped two of the Flames tries, while Duncan, Carter and Busha gave Asheville a 3-2 lead. The freshman goalkeeper stopped one more Liberty attempt and now the Bulldogs were one made PK away from a championship. Freshman Meagan Bradham would be the Asheville player to take the kick. She buried it into the back of the goal for a 4-2 PK win and a trip to the NCAA Tournament.
The MVP of the tournament was midfi elder Ashleigh Carter. She was the heart and soul of the Bulldogs. Carter had a solid freshman year but had been sidelined for much of the next two years with injuries. She was never close to 100 percent during her senior season but played on and helped get the Bulldogs a championship.
Also making the all-tournament team were defenders Sara Pahl and Kate Barrow plus midfi elder Juliana Duncan. The Bulldogs’ defense allowed just one goal in 307 minutes of play in the tournament.
Asheville then wondered who it would play in its fi rst NCAA Tournament appearance. The Bulldogs found out the next day that they would take on eventual national champion and national power UNC Chapel Hill later in the week.
2006 BIG SOUTH CHAMPIONS
The 2006 Big South Conference Champions
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
30 /// F E A R T H E D O G ///
Game RecordsGoals: 4, Kristi Cummings vs. Charleston (1993) 4, Lynae King vs. UNC Wilmington (1995)Assists: 4, Megan Harris vs. SC State (2000) 4, Olivia Korman vs. The Citadel (2001)Points: 9, Kristi Cummings vs. Charleston (1993) 9, Lynae King vs. UNC Wilmington (1995)Shots: 10, Kristi Cummings vs. Charleston (1993)Saves: 20, Tracy Brainard vs. UMBC (1992)
Season RecordsGoals: 21, Hilary McKay (2001)GW Goals: 4, Emily Langill (2004)Assists: 8, Amanda Wilkinson (2000) 8, Megan Harris (2000) 8, Kelsey Dawson (2002)Points: 48, Hilary McKay (2003)Shots: 96, Hilary McKay (2005)Saves: 125, Tracy Brianard (1992)Shutouts: 12, Jill Young (1995)
Career RecordsGoals: 53, Hilary McKay (2002-05)GW Goals: 13, Hilary McKay (2002-05) Assists: 22, Hilary McKay (2002-05)Points: 128, Hilary McKay (2002-05)Shots: 302, Hilary McKay (2002-05)Saves: 297, Jill Young (1993-96)Shutouts: 25, Jill Young (1993-96)
Season Top 10Goals:1. Hilary McKay 21 20032. Hilary McKay 17 20053. Mackenzie Miller 13 19954. Robyn Busha 12 20055. Kristi Cummings 10 1993 Mackenzie Miller 10 19977. Mackenzie Miller 9 1998 Kelsey Dawson 9 2002 Hilary McKay 9 200210. Becky Frankwicz 8 1994 Alison Gehringer 8 1996 Kelsey Dawson 8 2000 Kelsey Dawson 8 2001 Ellen Sims 8 2001 Robyn Busha 8 2006
Assists:1. Amanda Wilkinson 8 2000 Megan Harris 8 2000 Kelsey Dawson 8 20022. Hilary McKay 7 2005 Robyn Busha 7 20055. Mackenzie Miller 6 1995 Lynae King 6 1995 Alison Gehringer 6 1996 Alison Gehringer 6 1997 Hilary McKay 6 2003 Kelsey Dawson 6 2003 Stephanie Feltis 6 2005
Points:1. Hilary McKay 48 20032. Hilary McKay 41 20053. Mackenzie Miller 32 19954. Robyn Busha 31 2005 5. Kelsey Dawson 26 20026. Mackenzie Miller 25 19977. Kristi Cummings 23 1993
8. Alison Gehringer 22 19969. Mackenzie Miller 21 1998 Robyn Busha 21 2006Saves:1. Tracy Brainard 125 19922. Heather Muller 120 20113. Caroline Jacobsen 119 20004. Christine Geske 113 19995. Jill Young 112 19946. Veronica Lazar 111 20087. Michelle Mattos 88 20028. Megan Dent 84 20109. Veronica Lazar 82 200610. Michelle Mattos 81 2004
Career Top 10Goals:1. Hilary McKay 53 2002-052. Mackenzie Miller 39 1995-983. Kelsey Dawson 36 2000-03 Kristi Cummings 36 1993-964. Robyn Busha 35 2005-085. Ashley Hart 20 1995-986. Lynae King 19 1993-96 Alison Gehringer 19 1995-977. Joy Haynes 16 2004-078. Ellen Sims 14 2001-029. Leilani Halkiotis 11 2008-1110. McKenna Stockhausen 10 2006-09
Assists:1. Hilary McKay 22 2002-052. Kelsey Dawson 18 2000-03 Lynae King 18 1993-963. Amanda Wilkinson 17 1997-2000 Alison Gehringer 17 1995-97 Mackenzie Miller 17 1995-984. Ashley Hart 13 1995-985. Robyn Busha 11 2005-086. McKenna Stockhausen 9 2006-09 Juliana Duncan 9 2005-087. Megan Harris 8 20008. Stephanie Feltis 7 2001-059. Katrin Casey 6 1995-9810. Amanda Knapp 6 2010-
Points:1. Hilary McKay 122 2002-052. Mackenzie Miller 95 1995-983. Kelsey Dawson 90 2000-034. Robyn Busha 85 2005-085. Kristi Cummings 83 1993-966. Lynae King 56 1993-967. Alison Gehringer 55 1995-978. Ashley Hart 53 1995-989. Joy Haynes 39 2004-0710. Ellen Sims 29 2001-02 McKenna Stockhausen 29 2006-09 Leilani Halkiotis 29 2008-11
Saves:1. Jill Young 297 1993-962. Michelle Matos 292 2002-053. Veronica Lazar 267 2006-094. Christine Geske 238 1996-995. Tracy Brainard 125 1992-936. Caroline Jacobsen 119 20007 Megan Dent 84 20108. Mary Scherger 59 2001-029. Dawn McDonald 49 199310. Shanna Brown 40 2005-07
RECORDS SECTION
/// UNC ASHEVILLE BULLDOGS ///
31/// F E A R T H E D O G ///
Shutouts:1. Jill Young 25 1993-962. Michelle Matos 20 2002-053. Christine Geske 16 1996-994. Veronica Lazar 10 2006-095. Rebecca Bostian 5 2001-04
GoalsGame: 11, vs. Lenior-Rhyne, Oct. 14, 1996Season: 60, 2010AssistsGame: 11, vs. Lenior-Rhyne, Oct. 14, 1996Season: 42, 1995PointsGame: 33, vs. Lenior-Rhyne, Oct. 14, 1996Season: 144, 1995ShotsGame: 36, vs. Lenior-Rhyne, Oct. 14, 1996WinsSeason: 16, 1995Consecutive: 6, 1996, 2005Conference: 6, 2004, 2005Consecutive: 5, 2005LossesSeason: 14, 2007Consecutive: 8, 1992Conference: 7, 1992Consecutive: 7, 1992Ties3, 1999, 2003, 2006Season Winning Percentage.762, (16-5) 1995Fewest Goals AllowedSeason: 16, 1995 and 1996Most Goals AllowedGame: 9, vs. Clemson, 1999Season: 52, 1992
Miscellaneous RecordsShutouts in a Season12, 1995Largest Margin of Victory11, vs. Lenior-Rhyne, Oct. 14, 1996Largest Margin of Defeat0-9, vs. Clemson, 1999Fastest Goal Scored:05, Kristi Cummings, vs. Furman, 1995 (Standing NCAA Record)Consecutive Shutout Minutes530, Michelle Mattos, 9/18- 10/9, 2004Longest Unbeaten Streak7, 1996, 2004Most Consecutive Home Wins9, 1995-97Most Consecutive Conference Wins4, 11/26-10/9, 2004
Most Consecutive Shutouts5, 1995 and 2004Most Improved Win-Loss Record7-10-2 in 1994 to 16-5-0 in 1995Best Goals Against Average0.75, 1995Most Overtime Games Played5, 1997, 1998, and 2008Most Overtime Wins4, 1998Most Overtime Losses2, 1997 and 2008Record in Penalty Kicks3 wins, 4 lossesLast Penalty Kick WinNov. 9, 2007 4-2 at Charleston Southern (BSC quarters)Last Penalty Kick LossNov. 8, 2003, 2-3, vs. High Point (BSC Final)
GoalKeeper RecordsSeasonMost Minutes: 1,840, Heather Muller, 2011Most Shots Faced: 308, Heather Muller, 2011Most Saves: 125, Traci Brainard, 1992Best Goals Against Avg.: 0.75, Jill Young, 1995Most Shutouts: 12, Jill Young, 1995CareerMost Minutes: 5,957, Michelle Mattos (2002-05)Most Shots Faced: 570, Jill Young (1993-96)Most Saves: 297, Jill Young (1993-96)Best Goals Against Avg.: 1.19, Michelle Mattos (2002-05)Most Shutouts: 25, Jill Young (1993-96)
Leilani Halkiotis was named to the 2011 Big South Conference’s All-Conference First Team, and is ninth in career goals and 10th in career points.
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
32 /// F E A R T H E D O G ///
Year By Year LeadersYear Goals Assists Points Saves1992 Candi Enneking (2) Candi Enneking (4) Tracy Brainard (125)1993 Kristi Cummings (10) Kristi Cummings (3) Kristi Cummings (23) Dawn McDonald (49)1994 Becky Frankwicz (8) Jodi Winterton (4) Becky Franwicz (19) Jill Young (112)1995 Mackenzie Miller (13) Mackenzie Miller (6) Mackenzie Miller (32) Jill Young (77) Lynae King (6) 1996 Alison Gehringer (8) Alison Gehringer (6) Alison Gehringer (22) Jill Young (60)1997 Mackenzie Miller (10) Alison Gehringer (6) Mackenzie Miller (25) Christine Geske (58)1998 Mackenzie Miller (9) Kara Strehle (5) Mackenzie Miller (21) Christine Geske (61)1999 Joanna Stocking (5) Amanda Wilkinson (5) Joanna Stocking (10) Christine Geske (113)2000 Kelsey Dawson (8) Amanda Wilkinson (8) Kelsey Dawson (19) Caroline Jacobsen (119)2001 Kelsey Dawson (8) Olivia Korman (4) Kelsey Dawson (17) Mary Scherger (59) Ellen Sims (8) Ellen Sims (17) 2002 Kelsey Dawson (9) Kelsey Dawson (8) Kelsey Dawson (26) Mich Mattos (88) Hilary McKay (9)2003 Hilary McKay (21) Hilary McKay (6) Hilary McKay (48) Mich Mattos (48) Kelsey Dawson (6)2004 Hilary McKay (6) Hilary McKay (4) Hilary McKay (16) Mich Mattos (81) Emily Langill (6)2005 Hilary McKay (17) Hilary McKay (7) Hilary McKay (41) Mich Mattos (75) Robyn Busha (7)2006 Robyn Busha (8) Robyn Busha (5) Robyn Busha (21) Veronica Lazar (82)2007 Robyn Busha (8) Robyn Busha (3) Robyn Busha (19) Veronica Lazar (74)2008 Robyn Busha (8) Juliana Duncan (5) Robyn Busha (14) Vernoica Lazar (111) McKenna Stockhausen (5)2009 Chloe McCleary-Small (4) Meagan Bradham (2) Chloe McCleary-Small (9) Veronica Lazar (59)2010 Leilani Halkiotis (4) Leilani Halkiotis (3) Leilani Halkiotis (11) Megan Dent (84)2011 Amanda Knapp (6) Amanda Knapp (4) Amanda Knapp (16) Heather Muller (120) Kaitlyn Eckert (6)
Big South All-Conference PerformersFirst TeamKristi Cummings (1995, 1996)Kelsey Dawson (2000, 2001, 2002, 2003)Alison Gehringer (1995, 1996, 1997)Christine Geske (1998, 1999)Amanda Hutson (1997)Kirstin Kiphardt (1999)Mary Milligan (1994, 1996)Mackenzie Miller (1998)Joanna Stocking (1999)Jill Young (1994, 1995, 1996)Hilary McKay (2002, 2003, 2005)Robyn Busha (2005, 2008)Emily Langill (2005)Michelle Mattos (2005)Sara Pahl (2006)Ashleigh Carter (2006)Leilani Halkiotis (2011)
Second TeamKatrin Casey (1997, 1998)Kristi Cummings (1993, 1994)Sandi Dror (1993)Kerry Gaschler (1998)Christine Geske (1997)Megan Harris (2000)Ashley Hart (1995, 1998)Caroline Jacobsen (2000)Emily Langill (2002, 2003)Lynae King (1996)Dawn McDonald (1993)Mary Milligan (1993, 1995)
Mackenzie Miller (1996, 1997)Brita Nordgren (2003)Kelly Ratterman (1999)Sharon Sawdowski (1997)Jodi Winterton (1995)Joanna Stocking (1998)Sara Pahl (2005)Robyn Busha (2006, 2007)Veronica Lazar (2006)Kate Barrow (2007)McKenna Stockhausen (2008)Chloe McCleary-Small (2009)Mary Kate Tucker (2009)
All-Freshman (Big South)Veronica Lazar (2006)Keri Skelton (2006)Mary Kate Tucker (2008)Hannah Jeske (2009)Kaitlyn Eckert (2011)
All-Tournament (Big South)Kristi Cummings (1995)Jodi Winterton (1995)Jill Young (1995)Kerry Gaschler (1995, 1996, 1998)Alison Gehringer (1995, 1996, 1997)Mackenzie Miller (1995, 1996, 1997)Ashley Hart (1995)Mary Milligan (1995)Amanda Hutson (1998)Joanna Stocking (1998)Christine Geske (1999)
Keri Caneveri (2000)Mary Sparks (2001)Emily Langill (2002, 2003, 2005)Erin Trigonoplos (2002)Michelle Mattos (2002)Kate Barrow (2003, 2006, 2007)Hilary McKay (2003)Shoshana Fried (2005)Sara Pahl (2005, 2006)Ashleigh Carter (2006)Juliana Duncan (2006)Veronica Lazar (2007)Robyn Busha (2008)Heather Muller (2011)
Big South Scholar Athlete of the YearAlison Gehringer (1997)Mackenzie Miller (1998)
Big South Coach of the YearMichele Cornish (1995, 2005)
Big South Tournament MVPAlison Gehringer, Jill Young (1995)Ashleigh Carter (2006)
Big South Rookie of the YearHilary McKay (2002)
Big South Player of the YearEmily Langill (2004)Hilary McKay (2005)
/// UNC ASHEVILLE BULLDOGS ///
33/// F E A R T H E D O G ///
ALL-TIME LETTERWINNERSASally Averett, 2000
BKate Barrow, 2003-07Mary Beale, 2009-Christina Beam, 1993Katy Beeler, 2007-10Gina Beer, 2010-11Rebecca Bostian, 2001-04Cindi Bradford, 1992Lindsey Bragg, 2007-08Meagan Bradham, 2006-09Traci Brainard, 1992-94Shanna Brown, 2005-07Robyn Busha, 2005-08
CBecky Call, 2002-03Keri Caneveri, 2000Ashleigh Carter, 2003-06Katrin Casey, 1995-98Ceclia Chan, 1992Chesa Cofi ni, 1993-96Shannon Constello, 2000Dawn Cothran, 1993-94Natasha Creticos, 2002-05
DLauren Danielik 1997Amelia Davis, 2005-08Kelsey Dawson, 2000-03Megan Dent, 2009-10Jennifer Donish, 1994Sandi Dror, 1993-97Adriane Dufty, 2000-03Juliana Duncan, 2005-08
EEmily Elliot, 2009Evin Ellis, 1998-01Emily Elstrom, 2006-Candi Enneking, 1992-94
FStephanie Feltis, 2001-05Samia Fercha, 1998-01Susan Fletcher, 1994Kersten Flink, 1997Becky Frankwicz, 1993-94Shoshana Fried, 2004-07
GHeather Gallagher, 1998-99Kerry Gaschler, 1995-98Alison Gerhlinger, 1995-97Christine Geske, 1996-99Bridget Goss, 1999-2002Sharon Goss, 2002Erin Graham, 2005Ashley Gray, 2003Mary Guerrero, 1992Pamela Gutbier, 1993-96
HLeilani Halkiotis, 2008-11Kelly Hall, 2006-07Megan Harris, 2000Melissa Harris, 2009-10Ashley Hart, 1995-98Joy Haynes, 2004-07Sara Marie Holland, 2005-09Meredith Horne, 1994Amanda Hutson, 1995-98
JCaroline Jacobsen, 2000Hannah Jeske, 2009-Erin Jordan, 1997-98
KErin Kelly, 1992Elizabeth Keil, 2009-Lynae King, 1993-96Kirsin Kiphardt, 1996-99Amanda Knapp, 2010-Olivia Korman, 2001-04
LEmily Langill, 2002-05Jenny Larson, 1992Kristen Lawson, 2010-Veronica Lazar, 2006-09Hannah Lee, 1999-00Katie Lilley, 2006-08 Heather Lynch, 1993-94
MKim Maddox, 1993Christine Martin, 2000Tanell Martin, 1993Nicole Matters, 1995-96Michelle Mattos, 2002-05Chloe McCleary-Small, 2009Mary Ashley McCullough, 2004-07Dawn McDonald, 1993Hilary McKay, 2002-05Mackenzie Miller, 1995-98Meredith Miller, 1992Mary Milligan, 1993-96Kristini Montuori, 2006-09
NLaura Nagle, 1992Brita Nordgren, 2002-05OCarolyn O’Brien, 2008-11
PSara Pahl, 2003-06Emily Pifer, 1993
RKelly Ratterman, 1996-99Ferriss Roberts, 2009-Cecily Rogers, 2000-2002Erin Ryan, 2010-
SSharon Sawdowski, 1997Mary Elizabeth Scherger, 1999, 2001-02Tracy Schmidt, 1998-99Bailey Schultz, 2000-03Emma Sell-Goodhand, 2010-11Ellen Sims, 2001-2002Janet Singletary, 1992Keri Skelton, 2006-09Angelina Smith, 2006Amber Snipes, 1998Mary Sparks, 1999-2002Dana Sroka, 2007-10Francis Staelin, 2010-11Joann Stephenson, 2003McKenna Stockhausen, 2006Jessica Stocking, 1997Joanna Stocking, 1997-00Kara Strehle, 1995-98Jennifer Supko, 2003Allison Svenstrup, 2009
TTarrah Tate, 2010-11Bethany Teague, 2008-10Sara Thorp, 2001Mary Kate Tucker, 2008-11Lauren Turnburke, 2006-10Erin Trigonoplos, 2001-04
VSara Vank, 1995-98
WDiane Walton, 1992Emily Weld, 1998-01Carly West, 2006Amanda Wilkinson, 1997-00Lauren Wingo, 2003-06Jodi Winterton, 1993-96Elsa Wright, 1992
YJill Young, 1993-96
Current players in Bold
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
34 /// F E A R T H E D O G ///
YEAR-BY-YEAR RESULTS SINCE 19931993 • Overall: 6-12-0 Big South: 2-4-09/4 Charleston W 5-2 OT9/5 at Radford* L 1-2 OT9/7 Catawba L 0-29/10 at UMBC* L 0-49/11 at Towson State* L 0-49/14 at Lenoir-Rhyne L 0-29/18 at Campbell* L 1-59/21 at Virginia Tech W 2-19/24 at Tusculum W 4-09/26 Vanderbilt L 0-39/28 UNC Greensboro L 0-310/2 Charleston Sou.* W 2-110/5 Davidson L 0-410/9 at Mercer L 1-510/10 vs. Centenary L 0-210/14 Georgia Southern W 4-010/20 Liberty* W 2-1 OT10/23 Kentucky L 0-3*Big South Matches
1994 • Overall: 7-10-2 Big South: 2-4-09/3 at Louisville T 1-1 OT9/4 at Kentucky L 0-19/6 South Alabama L 1-2 OT9/10 St. Francis W 5-09/11 UNC Charlotte T 1-1 OT9/16 at Charleston Sou.* L 2-49/18 at UNC Wilmington W 6-09/20 at Furman W 4-19/24 Towson State* W 1-09/25 UMBC* W 1-09/28 at UNCG* L 0-410/1 at Davidson L 0-410/4 at Clemson L 0-510/11 at Charleston W 3-010/15 at Liberty* L 0-110/18 at Georgia Southern L 1-310/22 Appalachian State W 3-010/23 Radford* L 2-310/28 vs. Radford^ L 0-1*Big South Matches^Big South Tournament Match
1995 • Overall: 16-5-0 Big South: 4-1-0 • Big South Champions •9/2 UNC Wilmington W 5-09/3 Davidson W 2-19/7 Furman W 5-09/9 at Wake Forest L 0-29/12 Catawba W 1-09/15 at Lenoir-Rhyne W 9-09/19 Wofford W 3-09/23 Liberty* W 2-09/26 UNC Greensboro* L 2-39/29 at Radford* W 2-09/30 vs. Louisville W 3-010/7 Charleston Sou.* W 3-110/11 at Appalachian St. W 2-010/14 at UMBC* W 3-210/15 at American L 0-110/17 at Clemson L 0-510/20 at Wofford W 3-010/26 at UNC Charlotte L 0-310/28 Charleston W 3-111 vs. UMBC^ W 3-011 vs. UNCG^ W 1-0*Big South Matches^Big South Tournament Match
1996 • Overall: 10-3-1 Big South: 4-1-0 • Big South Runner-Up •9/1 at Clemson L 1-49/13 Radford* W 3-2 (OT)9/21 UMBC* W 1-09/24 at UNC Greensboro* L 2-49/29 Appalachian State W 5-010/5 at Charleston Sou.* W 2-1 (OT)10/9 at Tennessee L 1-210/12 at Liberty* W 2-010/14 Lenoir-Rhyne W 11-010/18 at Davidson W 2-110/26 Wofford W 3-110/29 Wake Forest W 2-011/8 vs. UMBC^ W 3-011/10 vs. UNCG^ T 1-1 (PK)*Big South Matches^Big South Tournament Match
1997 • Overall: 9-8-2 Big South: 2-3-0 • Big South Runner-Up •9/5 at South Carolina L 1-29/7 at Georgia Southern T 1-1 (OT)9/13 at Tennessee Tech W 4-09/16 East Tennessee St. W 5-09/20 at Richmond L 0-29/21 at East Carolina L 1-2 (OT)9/27 Liberty* W 2-09/28 Davidson L 0-210/3 at Appalachian State W 2-110/4 Middle Tennessee W 5-010/8 at Elon W 1-0 (OT)10/11 at UMBC* L 2-3 (OT)10/12 at Howard W 4-010/17 South Alabama* L 0-210/22 at Wofford T 1-1 (OT)10/25 Charleston Southern* W 6-111/1 at Radford* L 1-311/6 Charleston Sou.̂ W 3-011/7 South Alabama^ L 1-2*Big South Matches^Big South Tournament Match
1998 • Overall 11-7-1 Big South 3-1-1 • Big South Runner-Up •9/2 Appalachian State W 1-0 (OT)9/4 Mars Hill W 7-09/11 Tennessee Tech W 2-09/13 Howard* W 4-19/18 Tennessee L 1-89/22 Richmond L 0-29/26 Radford* W 1-010/3 at Charleston Sou.* T 1-1 (OT)10/4 at South Carolina L 1-610/8 at Wofford L 0-310/10 at Clemson L 0-510/17 Elon W 2-1 (OT)10/20 High Point W 3-110/24 at Liberty* W 3-010/27 at East Tennessee St. W 5-010/29 at Davidson W 2-1 (OT)11/1 at South Alabama* L 0-111/6 vs. Charleston Sou.̂ W 2-1 (OT)11/7 vs. Radford^ L 0-1*Big South Matches^Big South Tournament Match
1999 • Overall 5-10-3 Big South: 2-4-08/27 at Clemson L 0-99/1 Western Carolina W 3-09/4 Liberty* L 0-19/7 East Tennessee State W 1-09/11 Davidson L 0-29/13 Tusculum W 3-09/17 vs. Xavier L 0-59/22 Wofford L 2-39/25 at Elon* L 0-29/28 at Tennessee L 0-610/2 vs. VCU T 0-0 (OT)10/3 at Richmond L 0-410/9 at Radford* L 1-2 (OT)10/12 at High Point* W 1-010/16 at Charleston Sou.* W 2-110/27 at Appalachian State T 0-0 (OT)10/29 at Howard L 0-111/4 vs. Elon^ T 0-0 (PK)*Big South Matches^Big South Tournament Match
2000 • Overall: 4-12-1 Big South: 1-4-18/30 at Davidson L 2-79/2 Union W 4-29/8 High Point* T 0-0 (OT)9/10 at Tennessee L 0-79/14 at Western Carolina L 1-29/20 at East Tennessee St. L 1-49/22 at Clemson L 0-59/23 vs. N.C. State L 1-39/27 Radford* W 2-19/30 S.C. State W 8-010/3 at Mars Hill W 10-110/7 Elon* L 0-110/9 at Coastal Carolina* L 0-210/14 at Liberty* L 0-210/21 at Charleston Sou.* L 0-110/24 Appalachian State L 1-210/26 vs. Liberty^ L 1-3*Big South Matches^Big South Tournament Match
2001 • Overall: 5-11-0 Big South: 1-4-09/5 Western Carolina L 0-59/9 at Radford* L 2-49/18 at Appalachian State L 0-29/22 Liberty* L 1-29/25 East Tennessee State W 4-29/29 at Wofford W 3-110/3 Tennessee Tech W 2-1 (OT)10/6 at Elon* L 0-410/9 at Gardner-Webb L 0-110/12 Coastal Carolina* W 2-110/17 The Citadel W 10-210/20 Charleston Southern* L 0-210/24 at Clemson L 0-510/27 at Birmingham-Sou. L 0-211/3 at High Point* L 0-411/8 vs Charleston Sou.̂ L 0-2*Big South Matches^Big South Tournament Match
/// UNC ASHEVILLE BULLDOGS ///
35/// F E A R T H E D O G ///
2002 • Overall 7-8-3 Big South: 2-4-0 • Big South Runner-Up •9/2 at East Tennessee St. L 1-29/7 Campbell W 4-29/11 at Tennessee Tech L 0-79/20 at Coastal Carolina* L 0-29/22 at UNC Wilmington L 0-29/25 S.C. State W 5-19/28 High Point* W 2-010/2 Appalachian State W 3-210/5 Elon* L 1-210/9 Gardner-Webb W 2-110/12 at Liberty* L 1-210/23 at Charleston Sou.* W 3-2 (OT)10/26 Radford* L 0-111/2 Birmingham-Sou. W 5-311/4 at Western Carolina T 1-1 (OT)11/7 vs. Elon^ T 1-1 (PK)11/8 vs. Liberty^ T 1-1 (PK)11/9 vs. Radford^ L 0-2*Big South Matches^Big South Tournament Match
2003 • Overall: 11-6-3 Big South: 4-3-1 • Big South Runner-Up •8/31 Davidson L 1-29/2 at VCU L 0-79/6 at Gardner-Webb W 5-29/10 South Carolina State W 4-09/13 at Campbell W 3-29/15 East Tennessee State W 2-19/19 UNC Wilmington W 2-09/26 Coastal Carolina* L 1-310/1 at Appalachian State L 1-210/6 Western Carolina T 2-2 (OT)10/11 at Radford* T 2-2 (OT)10/12 at VMI* W 4-010/15 at High Point* W 2-010/20 Charleston Southern* W 3-010/24 Winthrop* W 3-010/27 Liberty* L 0-111/1 at Birmingham-Sou.* L 2-311/6 vs. Winthrop^ W 2-111/7 vs. Charleston Sou.̂ W 3-011/8 vs. High Point^ T 0-0 (PK)*Big South Matches^Big South Tournament Match
2004 • Overall: 11-6-2 Big South: 6-0-2 • Big South Regular Season Champs •8/27 vs. Kennesaw State L 0-28/29 at Tennessee Tech L 0-29/3 at Western Carolina W 3-09/6 at East Tennessee St. L 0-19/14 Gardner-Webb L 0-29/18 at Coastal Carolina* T 1-1 (OT)9/22 Appalachian State W 1-09/26 Birmingham-Sou.* W 1-09/29 at Davidson W 1-010/2 High Point* W 1-010/6 at Winthrop* W 1-010/9 at Charleston Sou.* W 3-110/12 at Clemson L 0-710/15 Radford* T 2-2 (OT)10/23 at Liberty* W 1-010/26 at S.C. State W 4-010/20 VMI* W 4-011/4 vs. Winthrop^ W 1-011/5 vs. High Point^ L 1-3*Big South Matches^Big South Tournament Match
2005 • Overall: 13-6-0 Big South: 6-2-0 • Big South Regular Season Champs •8/26 East Tennessee St. W 3-09/2 Tennessee Tech W 4-0
9/10 South Carolina State W 6-09/13 Western Carolina L 0-29/18 Coastal Carolina* W 4-09/20 at Appalachian State L 0-29/24 Charleston Southern* L 1-2 (OT)9/30 at Birmingham-Sou.* W 1-010/4 Winthrop* W 1-010/10 Liberty* W 4-110/15 at Radford* W 3-010/18 at Francis Marion W 3-110/22 at VMI* W 3-2 (OT)10/23 at Longwood L 1-310/26 at High Point* W 0-210/29 Campbell W 4-111/3 at Winthrop^ W 1-011/4 vs. Charleston Sou.̂ W 3-111/6 vs. Liberty^ L 0-3*Big South Matches^Big South Tournament Match
2006 • Overall: 10-7-3 Big South: 4-2-2 • Big South Champions •9/3 Austin Peay W 3-09/8 at Tennessee Tech L 0-29/14 Appalachian State W 2-19/16 Radford* W 2-09/20 at Winthrop* T 1-1 (OT)9/23 Longwood L 0-29/26 at Western Carolina L 0-39/30 at Liberty* T 0-0 (OT)10/2 Birmingham-Southern* L 0-110/6 High Point* W 1-010/15 VMI* W 4-010/18 at Furman L 1-310/21 at Coastal Carolina* L 0-110/25 at East Tennessee State W 2-110/28 at Charleston Southern* W 2-110/30 at Campbell W 2-011/2 vs. Birmingham-Sou.̂ W 1-0 (OT)11/3 vs. Winthrop^ W 2-111/5 vs. Liberty^ T 0-0 (PK)11/10 at North Carolina# L 0-7*Big South Matches^Big South Tournament Match#NCAA College Cup Matach
2007 • Overall: 3-14-1 Big South: 1-6-09/2 Tennessee Tech W 1-0 (OT)9/5 Western Carolina L 1-29/7 ar Gardner-Webb L 1-59/9 vs. Birmingham-Sou. L 1-39/11 at Appalachian State L 0-29/16 at Austin Peay L 0-29/20 Furman L 1-59/23 Chattanooga W 6-19/26 Francis Marion L 0-210/6 Coastal Carolina* L 0-210/13 at Radford* L 2-310/17 Winthrop* L 0-110/20 Charleston Southern* L 0-110/24 at High Point* L 0-210/28 at VMI* W 5-010/31 Liberty* L 1-211/9 vs. Charleston Sou.̂ T 1-1 (PK)11/10 vs. High Point^ L 0-1*Big South Matches^Big South Tournament Match
2008 • Overall: 5-13-1 Big South: 3-6-08/24 East Tennessee State L 0-18/31 at Clemson L 0-89/5 at Murray State L 0-39/7 vs. UT-Martin T 0-0 (OT)9/10 at Furman L 1-2 (OT)9/12 vs. Georgia State L 1-59/14 at Jacksonville W 3-2 (OT)9/17 Presbyterian* W 4-1
9/21 at Tennessee Tech W 2-19/23 Appalachian State L 0-29/27 at Winthrop* W 1-0 (OT)10/1 High Point* L 0-110/4 at Gardner-Webb* W 3-010/7 at Coastal Carolina* L 2-310/11 at Liberty* L 1-310/21 VMI* L 0-110/25 at Charleston Southern* L 0-311/1 Radford* L 2-311/6 vs. Radford^ L 1-2 (OT)*Big South Matches^Big South Tournament Match
2009 • Overall: 5-10-1 Big South: 2-7-08/30 at Appalachian State L 0-19/3 at Wofford W 1-09/6 at East Tennessee State W 1-09/9 Furman L 1-29/13 Tennessee Tech W 2-19/18 vs. Elon L 1-29?20 at Western Carolina T 0-0 (OT)10/2 at Radford* L 0-110/4 at VMI* L 0-210/10 Presbyterian* W 3-010/16 Charleston Southern* L 0-110/18 Coastal Carolina* L 0-210/23 at Winthrop* L 1-210/25 at Gardner-Webb* L 0-110/30 Liberty* L 0-111/1 High Point* W 1-0*Big South Matches^Big South Tournament Match
2010 • Overall: 1-16-0 Big South: 0-9-08/20 ETSU L 1-4 8/26 Western Carolina L 0-4 9/5 at Tennessee Tech L 1-3 9/09 at Elon L 0-3 9/10 Wofford College L 2-3 9/15 at Furman L 1-4 9/19 Francis Marion W 2-1 9/27 at South Carolina State L 1-3 10/1 Radford* L 0-2 10/3 VMI* L 2-3 10/9 at Presbyterian College* L 0-3 10/15 at Charleston Southern* L 0-8 10/18 at Coastal Carolina* L 1-4 10/22 Winthrop* L 0-4 10/24 Gardner-Webb* L 0-3 10/27 at Liberty* L 3-6 10/29 at High Point* L 1-2 (OT) *Big South Matches^Big South Tournament Match
2011 • Overall: 1-16-0 Big South: 0-9-08/20 at Davidson L 1-8 8/28 Tennessee Tech L 1-4 9/02 Eastern Kentucky L 0-4 9/04 at Wofford L 0-5 9/09 at Western Carolina L 0-4 9/11 at Appalachian State L 0-1 9/16 Georgia State L 2-3 9/18 South Carolina State W 5-1 9/25 at ETSU L 0-3 9/29 at VMI* W 3-1 10/01 at Radford* L 0-1 10/04 Presbyterian College* W 3-0 10/06 at Campbell* L 1-2 10/13 Coastal Carolina* L 0-1 10/15 Charleston Southern* W 5-0 10/20 at Gardner-Webb* L OT 3-4 10/22 at Winthrop* L 1-3 10/27 High Point* L 0-4 10/29 Liberty* L 0-3 11/03 Radford* T OT3 1-1*Big South Matches^Big South Tournament Match
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
36 /// F E A R T H E D O G ///
ALL-TIME RESULTS SINCE 1993Team W L T Last Meeting ScoreAmerican 0 1 0 Oct. 15, 1995 AU 1, ASHEVILLE 0Appalachian State 6 8 1 Sept. 11, 2011 ASU 1, ASHEVILLE 0Austin Peay 1 1 0 Sept. 16, 2007 APSU 2, ASHEVILLE 0Birmingham-Southern 4 4 0 Sept. 9, 2007 BSC 3, ASHEVILLE 1Campbell 4 3 0 Oct. 6, 2011 CU 2, ASHEVILLE 1Catawba 1 1 0 Sept. 12, 1995 ASHEVILLE 1, CC 0Centenary 0 1 0 Oct. 10, 1993 CC 2, ASHEVILLE 0Charleston, College of 2 0 0 Oct. 11, 1994 ASHEVILLE 2, CofC 0Charleston Southern 14 9 2 Oct. 15, 2011 ASHEVILLE 5, CSU 0Charlotte 0 1 1 Oct. 26, 1995 UNCC 3, ASHEVILLE 0Chattanooga 1 0 0 Sept. 23, 2007 ASHEVILLE 6, UTC 1 Citadel 1 0 0 Oct. 17, 2001 ASHEVILLE 10, CIT 2Clemson 0 4 0 Oct. 12, 2004 CU 7, ASHEVILLE 0Coastal Carolina 2 9 1 Oct. 13, 2011 CCU 1, ASHEVILLE 0Davidson 4 7 0 Aug. 20, 2011 ASHEVILLE 1, DC 8East Carolina 0 1 0 Sept. 21, 1997 ECU 2, ASHEVILLE 1East Tennessee State 8 6 0 Sept. 25, 2011 ETSU 3, ASHEVILLE 0Eastern Kentucky 0 1 0 Sept. 2, 2011 EKU 4, ASHEVILLE 0Elon 2 6 1 Sept. 9, 2010 ELON 3, ASHEVILLE 0Francis Marion 2 1 0 Sept. 19, 2010 ASHEVILLE 2, FMU 1Furman 2 5 0 Sept. 15, 2010 FUR 4, ASHEVILLE 1 Gardner-Webb 3 6 0 Oct. 20, 2011 GWU 4, ASHEVILLE 3 (OT)Georgia Southern 1 1 1 Sept. 7, 1997 ASHEVILLE 1, GSU 1Georgia State 0 2 0 Sept. 16, 2011 GSU 3, ASHEVILLE 2High Point 7 7 2 Oct. 27, 2011 HPU 4, ASHEVILLE 0 Howard University 2 1 0 Oct. 29, 1999 HU 1, ASHEVILLE 0Jacksonville 1 0 0 Sept. 14, 2008 ASHEVILLE 3, JU 2 (OT)Kennesaw State 0 1 0 Aug. 27, 2004 KSU 2, ASHEVILLE 0Kentucky 0 2 0 Sept. 4, 1994 UK 1, ASHEVILLE 0Lenior-Rhyne 2 1 0 Oct. 14, 1996 ASHEVILLE 11, LRC 0Liberty 7 13 3 Oct. 29, 2011 LU 3, ASHEVILLE 0Longwood 0 2 0 Sept. 23, 2006 LU 2, ASHEVILLE 0 Louisville 1 0 1 Sept. 30, 1995 ASHEVILLE 3, UL 0Mars Hill 2 0 0 Oct. 3, 2000 ASHEVILLE 10, MHC 1Mercer 0 1 0 Oct. 9, 1993 MU 5, ASHEVILLE 1Middle Tennessee 1 0 0 Oct. 4, 1997 ASHEVILLE 5, MTSU 0Murray State 0 1 0 Sept. 5, 2008 MSU 3, ASHEVILLE 0North Carolina State 0 1 0 Sept. 23, 2000 NCSU 3, ASHEVILLE 1Presbyterian College 3 1 0 Oct. 4, 2011 ASHEVILLE 3, PC 0Radford 6 15 3 Nov. 3, 2011 RU 1, ASHEVILLE 1 (2OT)Richmond 0 3 0 Oct. 3, 1999 UR 4, ASHEVILLE 0Saint Francis 1 0 0 Sept. 10, 1994 ASHEVILLE 5, SFC 0South Alabama 0 4 0 Nov. 1, 1998 USA 1, ASHEVILLE 0South Carolina 0 2 0 Oct. 4, 1998 USC 6, ASHEVILLE 1South Carolina State 6 1 0 Sept. 18, 2011 ASHEVILLE 5, SCSU 1Tennessee 0 4 0 Sept. 10, 2000 UT 7, ASHEVILLE 0Tennessee-Martin 0 0 1 Sept. 7, 2008 ASHEVILLE 0, UTM 0 (2OT)Tennessee Tech 7 5 0 Aug. 28, 2011 TTU 4, ASHEVILLE 1 Towson State 1 1 0 Sept. 24, 1994 ASHEVILLE 1, TSU 0Tusculum 2 0 0 Sept. 13, 1999 ASHEVILLE 3, TC 0UMBC 5 2 0 Oct. 11, 1997 UMBC 3, ASHEVILLE 2UNC Greensboro 1 4 1 Nov. 10, 1996 ASHEVILLE 1, UNCG 1UNC Wilmington 3 1 0 Sept. 19, 2003 ASHEVILLE 2, UNCW 0Union College 1 0 0 Sept. 2, 2000 ASHEVILLE 4, UC 2Vanderbilt 0 2 0 Sept. 26, 1993 VU 3, ASHEVILLE 0Virginia Commonwealth 0 1 1 Sept. 2, 2003 VCU 7, ASHEVILLE 0Virginia Tech 1 0 0 Sept. 21, 1993 ASHEVILLE 2, VT 1VMI 6 3 0 Sept. 29, 2011 ASHEVILLE 3, VMI 1Wake Forest 1 1 0 Oct. 29, 1996 ASHEVILLE 2, WFU 0Western Carolina 2 7 3 Sept 9, 2011 WCU 4, ASHEVILLE 0 Winthrop 8 4 1 Oct. 22, 2011 WU 3, ASHEVILLE 1Wofford 5 4 1 Sept. 4, 2011 WC 5, ASHEVILLE 0Xavier 0 1 0 Sept. 17, 1999 XU 5, ASHEVILLE 0
Bold indicates 2011 Opponents
/// UNC ASHEVILLE BULLDOGS ///
37/// F E A R T H E D O G ///
UNC Asheville’s Athletics Hall of Fame was established in 2003 and has had fi ve classes inducted. A total of 33 athletes and administrators have been enshrined. Of those 33 inductees, two are former women’s soccer players: Jill Booth Young and Mackenzie McCoy
Jill Young Booth (1993-96)Inducted in 2007
Jill Young Booth was a three-time fi rst team all-conference goalkeeper for the Bulldog women’s soccer program. She was the Co-MVP of the 1995 Big South Conference Tournament and is the holder of most career shutouts at UNC Asheville with 25.
Mackenzie McCoy (1995-98)Inducted in 2011
Mackenzie McCoy played for UNC Asheville from 1995 through 1998. She is the second leading goal scorer in school history with 39 and second in career points with 86. Mackenzie led the Bulldogs in goals and scoring in three of her four seasons. She helped lead UNC Asheville to the Big South Conference championship game three times in her career. In 1995, Mackenzie led the Bulldogs to the Big South Conference championship with a 1-0 upset victory over nationally-ranked UNC Greensboro. She was a fi rst team all-conference performer three different times in her career. In 1998, Mackenzie was named Big South Scholar Athlete of the Year and was nominated as an Academic All-American three times.
UNC Asheville Hall of Fame Herb Coman, Football Coach/ADBob Hartman, MBB CoachJim McElhaney, Men’s BasketballSheila Ford Duncan, WBB BasketballIlona Fekete Thimmer, VolleyballEd Harris, Men’s Basketball CoachJerry Green, Men’s Basketball CoachKim Duncan, Women’s BasketballBrian Shehan, BaseballTom Hunnicutt, Athletics DirectorJenee Cross Daniely, Women’s TennisUlrich Dietrich, Men’s SoccerMickey Gibson, Men’s BasketballMike Grace, Men’s BasketballPatrick Britz, Men’s SoccerDanielle Meyer Harrison, VolleyballJill Young Booth , Women’s SoccerPaul Allen, Men’s BasketballDave Hart, ContributorElissa Mount, VolleyballRebecca Gallaher, Track and FieldBamford Jones, Men’s BasketballTrish Wyatt, Women’s BasketballAytekin Yildiz, Men’s SoccerMarc Rosenbalm, BaseballJosh Pittman, Men’s BasketballLorelee Smith, VolleyballHelen Carroll, Women’s BasketballGeorge Gilbert, Men’s BasketballMackenzie McCoy, Women’s SoccerTy Wiggington, BaseballLisa Rhodes, VolleyballTony Bumphus, Men’s Basketball
UNC ASHEVILLE HALL OF FAME
A
A
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
38 /// F E A R T H E D O G ///
Since its founding in 1983, the Big South Conference has matured into a competitive leader in college athletics, actively pursuing excellence on the fi eld of play and in the classroom. The League’s growing presence as an NCAA Division I athletic conference is evident by athletic accomplishments on the national stage, innovative marketing and media partnerships, increased television packages, and quality athletic competition while intentionally fostering the academic, personal, social, athletic and leadership development of each student-athlete. This has evolved into the Conference’s mission of “Developing Leaders Through Athletics.”
The Big South Conference was formed on August 21, 1983, when Charleston Southern (then Baptist College) Athletic Director Howard Bagwell and Augusta President George Christenberry began recruiting members into the Big South, receiving initial commitments from Augusta, Charleston Southern, Campbell, Coastal Carolina and Winthrop. One month later, Dr. Edward M. Singleton was selected as the League’s fi rst Commissioner and continued to solicit new members. His efforts led to the additions of Armstrong State, Radford and UNC Asheville, giving the Big South more than the required six members to constitute an offi cial conference. The Big South’s fi rst year of competition was in the Fall of 1984, and in September 1986, the Big South Conference was granted full-fl edged NCAA Division I status.
During its infancy and prior to securing automatic bids to NCAA Championships, the Big South made early strides in earning at-large berths in several national postseason events, including volleyball, women’s basketball and women’s golf. In 1989, George F. “Buddy” Sasser replaced the retiring Dr. Singleton as Commissioner, and in 1990, the League received its fi rst automatic bid -- receiving an automatic qualifi er to the NCAA Baseball Championship. Under Sasser’s seven years of leadership, the Conference implemented its public relations and compliance programs, and introduced its fi rst-ever men’s basketball television package, featuring the Big South competing among some of the fi nest teams in the nation.
In August 1996, Kyle B. Kallander replaced Sasser as the League’s third Commissioner, and in his 15 years at the helm of the Big South, Kallander has been instrumental in aggressively promoting the Conference to new heights. The Conference has enjoyed record levels in marketing revenue during the past several years, he has brought television coverage to Big South women’s basketball, baseball and softball for the fi rst time in Conference history, as well as increased national television exposure to the League as a whole through aggressive and unique television packages.
Under Kallander’s leadership, the Big South developed and initiated its fi rst long-range strategic plan, re-affi rming the League’s vision as a distinctive athletic Conference committed to the quality of institutional life through athletic competition. He also spearheaded the efforts to add football as a championship sport, which came to fruition in 2002, and oversaw the additions of men’s and women’s indoor track & fi eld in 1997. The Conference’s 19th championship sport -- women’s lacrosse, will begin play in 2012-13 with seven members. At the same time, Kallander has solidifi ed Conference membership, as an all-time high 11 member institutions comprise the 28-year League in 2011-12. Recent additions include High Point, Gardner-Webb and Presbyterian College, plus the return of charter member Campbell University this year. Kallander’s long range vision has also included technological advancements, as the Conference introduced its fi rst live event video streaming in 2005 and has since expanded its video offerings to more than 700 events annually through a partnership with the member institutions, as well as the creation of several online and social media platforms.
In the last 15 years alone, the Big South Conference has experienced monumental growth and success in nearly every sport. During this time, the Conference has had an individual National Champion six times, more than 240 All-Americans, has reached the “Sweet 16” in men’s soccer, women’s basketball and baseball, has received national Top 25 rankings in football, men’s soccer, men’s basketball, women’s basketball, baseball, men’s outdoor track & fi eld, and men’s golf, had an individual selected to play in the NCAA Singles Championship six times in addition to the fi rst men’s tennis doubles at-large selection, had the fi rst women’s golf program advance to the national fi nals, had the No. 1 ranked men’s golfer in the country, has had the nation’s top scoring men’s basketball team fi ve consecutive years as well as the national men’s basketball scoring leader twice, received an at-large playoff berth in the Football Championship Subdivision in 2006, has had four NFL Draft picks, and had an institution fi nish fi fth in the NCAA Men’s Golf Championships - the Conference’s highest-ever team fi nish in an NCAA event.
In 2006-07, the Big South was the only Conference nationwide to have an at-large participant in the football playoffs (Coastal Carolina), a team in the Second Round of the NCAA Men’s Basketball Tournament (Winthrop) and a No. 1 seed in the NCAA Baseball Regionals (Coastal Carolina). In fact, Coastal Carolina’s baseball program has been a No. 1 seed four out of the last seven years - including a national seed for the fi rst time in 2010, while the Chanticleers’ FCS playoff berth in 2006 came in just the fi fth-year of the Big South’s football existence. The 2009-10 season saw Liberty’s Sam Chelanga win two NCAA National Championships (cross country, 10,000-meter run), Coastal Carolina’s baseball team reach the Super Regionals for the second time in three years as well as being ranked No. 1 in the national RPI and as high as No. 3 in the national polls; and three women’s basketball teams reach the postseason for the fi rst time in Conference history. Last season, Chelanga won two more NCAA National Championships (cross country, outdoor 5,000-meter run), the Big South had its fi rst automatic bid recipient in football (Coastal Carolina), UNC Asheville reached the Second Round of the NCAA Men’s Basketball Tournament, Coastal Carolina’s women’s golf team was the fi rst in Conference history to advance to the NCAA Championship out of Regional play, and a League-record 18 baseball players were drafted in the 2011 MLB First-Year Player Draft.
Several former Big South student-athletes have also reached national prominence in recent years. Coastal Carolina’s Amber Campbell made the 2008 U.S. Olympic Team - one of fi ve former Big South athletes to compete in the Games; VMI’s Reggie Williams reached the NBA with the Golden State Warriors in 2010, UNC Asheville’s Ty Wigginton was named an American League All-Star in 2010, and Coastal Carolina’s Dustin Johnson has won four PGA Tour events since departing the Big South Conference in 2007 and tied for runner-up at the 2011 Open Championship.
The Conference’s tagline, “Developing Leaders Through Athletics” was unveiled in 2008-09 in conjunction with the Conference’s 25th Anniversary. The League also honored its heritage with the Top 25 “Best of the Best” moments in League history from 1983-2008, with Liberty University’s 10-year women’s basketball championship run from 1996-2007 being crowned the No. 1 moment in the Big South’s fi rst 25 years. The Conference’s on-fi eld accomplishments have been duplicated in the classroom. Annually, more than 40 percent of Conference student-athletes are named to the Big South’s Presidential Honor Roll for maintaining a cumulative 3.0 grade-point average, and the League has had more than 95 Academic All-Americans in its 27 years of existence. Furthermore, the Big South has a record number of NCAA Public Recognition Awards for APR progress the last two years.
THE BIG SOUTH CONFERENCE
/// UNC ASHEVILLE BULLDOGS ///
39/// F E A R T H E D O G ///
BIG SOUTH CONFERENCE7233 Pineville-Matthews Road, Suite 100
Charlotte, NC 28226Phone: (704) 341-7990
Fax: (704) 341-7991www.BigSouthSports.com
Founded 1983
PresidentPenelope W. Kyle, Radford University
Vice PresidentDr. Frank Bonner, Gardner-Webb University
SecretaryDr. Anne Ponder, UNC Asheville
CommissionerKyle B. Kallander
Associate CommissionerJames Companion
Associate CommissionerDawn Turner
Assistant Commissioner - Public RelationsMark Simpson
Assistant Commissioner - MarketingChad Cook
Director of Multimedia DevelopmentMark Bryant
Offi ce ManagerTerri Ballard
Assistant Director of MarketingMatt VanSandt
Assistant Director of Public RelationsNic Bowman
Assistant Director of ComplianceSherika McLean
Marketing AssistantMelissa Estepp
Public Relations AssistantBriana Mayes
Administration/Multimedia AssistantEarl Laing
Coordinator of Football Offi cialsDoug Rhoads
Coordinator of Men’s Basketball Offi cialsJoe Forte
Coordinator of Women’s Basketball Offi cialsCharlene Curtis
Coordinator of Baseball UmpiresTony Thompson
Coordinator of Softball UmpiresBetsy Kidd
Coordinator of Men’s Soccer Offi cialsPaul James
Coordinator of Volleyball Offi cialsDaniel Leake
Member Institutions (12): Campbell University, Charleston Southern University, Coastal Carolina University, Gardner-Webb University, High Point University, Liberty University, Longwood University, Presbyterian College, Radford University, UNC Asheville, Virginia Military Institute, Winthrop University
Geographical Breakdown (3 states): North Carolina (4) – Campbell University, Gardner-Webb University, High Point University, UNC Asheville; South Carolina (4) – Charleston Southern University, Coastal Carolina University, Presbyterian College, Winthrop University; Virginia (4) – Liberty University, Longwood University, Radford University, Virginia Military Institute
Associate Members: Stony Brook University (football), Davidson College (women’s lacrosse)
Championship Sports (19): Baseball, Men’s Basketball, Women’s Basketball, Men’s Cross Country, Women’s Cross Country, Football, Men’s Golf, Women’s Golf, Women’s Lacrosse, Men’s Soccer, Women’s Soccer, Softball, Men’s Tennis, Women’s Tennis, Men’s Indoor and Outdoor Track & Field, Women’s Indoor and Outdoor Track & Field, Volleyball
Council of Chief Executive Offi cers: Jerry Wallace, Campbell; Jairy C. Hunter, Jr., Charleston Southern; David DeCenzo, Coastal Carolina; Frank Bonner, Gardner-Webb; Nido Qubein, High Point; Jerry L. Falwell, Jr., Liberty; Marge Connelly, Longwood; Dr. Claude Lilly, Presbyterian; Penelope W. Kyle, Radford; Anne Ponder, UNC Asheville; J.H. Binford Peay III, VMI; Anthony J. DiGiorgio, Winthrop
BIG SOUTH QUICK FACTS
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
40 /// F E A R T H E D O G ///
/// UNC ASHEVILLE BULLDOGS ///
41/// F E A R T H E D O G ///
ABOUT THE UNIVERSITY As the University of North Carolina at Asheville celebrates eighty years of excellence in higher education, the campus community welcomes new challenges and greater successes as one of the nation’s leading liberal arts colleges. From its beginnings as Buncombe County Junior College, where 86 students enrolled in 1927 to further their educations beyond high school, the University has valued liberal arts ideals and community engagement. Its special commitment to student learning and undergraduate education was reaffi rmed when it joined the University of North Carolina system in 1969 as the University of North Carolina at Asheville. The University maintains its liberal arts imperative, as the designated undergraduate liberal arts University of the 17-campus University of North Carolina system.
Vision
UNC Asheville students, within a diverse and inclusive community, experience liberal arts education at its best.
Mission
UNC Asheville is distinctive in the UNC system as its designated liberal arts university. Our practice of the liberal arts emphasizes the centrality of learning and discovery through exemplary teaching, innovative scholarship, creative expression, co-curricular activities, undergraduate research, engaged service, and practical experience. Primarily undergraduate, UNC Asheville offers a liberal arts education characterized by high quality faculty-student interaction. We offer this challenging educational experience to all promising students who are committed to liberal learning and personal growth.
Our liberal arts educational approach emphasizes life skills including critical thinking, clear and thoughtful expression, and honest open inquiry. Students undertake concentrated study in one area while simultaneously developing an understanding of the connections among disciplines. We encourage students to clarify, develop and live their own values while respecting the views and beliefs of others. In addition, we cultivate an understanding of the dimensions of human diversity while recognizing the common humanity of all. We believe a quality liberal arts education enables our graduates to be lifelong learners and to lead successful, fl ourishing lives as leaders and contributors to their communities.
At UNC Asheville, we respond to the conditions and concerns of the contemporary world both as individuals and as a university. We incorporate economic, social and environmental sustainability into our institutional practices and curriculum. With a range of associated centers, partnerships, and initiatives, we fulfi ll our public responsibility to address the needs of our community through a continuum of learning. We develop a commitment to continuing service characterized by an informed, responsible, and creative engagement with the Asheville area, the southern Appalachian region, the state of North Carolina, and a diverse and increasingly connected world.
Alma Mater
In 2000 the university community set about the task of writing a new Alma Mater—the offi cial anthem of UNC Asheville, sung at all ceremonial events—to replace the one from the 1960s. In Latin, alma mater means “nourishing mother,” and it also refers to the school one attended.
Hail Our Alma Mater, Hail UNCA.
Learning be your watchword,Greatness be your way.
High upon the mountains,In the Land of Sky,
Stands our Alma Mater,Lift your voices high.
Noble Alma Mater,Hear our words of praise.
May we love and honor you,Until the end of days.
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
42 /// F E A R T H E D O G ///
WWWWWiWWiWiWiWWWWWiWiWiWiWW hhhhththththh a a a aaabobobobobobbbobboboboboboobobobooututututuu 3 333,7,7,700000 sstututudededeeeennntntntntttnts s ss sss frfrfrfrf omomomomomm 4 4 4 44 4422 2 2 2 ststststatatatatatesesese aaaa aaandndndndndndndndndndndndndndndnddndndndndnddndndndnn 11 9 9 cocococoooooococoocooooooooooooc uuunununuunuuuuunnnuunttrtrtttrtrt iieieies,s, UU UUUUNCNCNCNCNCNCCCCCCNCNCCNCCCCCNNCCCCCCCCCCCCCCCCCCC AAA A AA AAA AAAA A AAAA AAAAAAAAAAAAAAAAAAAAAAshshshshhshshshshshsshshhhsheveveveveeveveeveeeeeeeeve ilililililillillli leeleeeeee is ononoonnne off tthhhehe nnnnnnnatatiiooo ’n’n’n’’n’nn ss s s ssssssssstototototototototototottottotoooopp ppppppp p pp p p p pp ppp pp pupupupupupppupupupupuuupppppppppp blblbblicicicic l l llibibibibibbbbbbibbbbiberererererererereererererereerralalalalalaaaaaaa a artrttsss s unununununu ivivvivererererrsisisisisis titititititiesesee a aandndnddnd o oooneneneee o o o offfff f ffffffff ththtthththththe ee ee 171717717 iiinsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnn ttititittttttttitututt titions in t t t ttttttttt ttttttttttheheheheheheheheheheheheheheheheheeehehheeeheeh U UU UU U UUUUUUU UUUUUUUUUUUUUUUUUUUUnininininnnininininininininininnnininnnininn vvevevevevevevevvevevevvevvvvvevvevvversrsrsrsrsrsrsrsrssssssssittitititttty y yyyyyyyy yyyyyyyyyyyyyyyyyy ofofff NN NN NNN NNNNNNNNNorrrthhthhthtt CCCCCCCCCCCCCarrrrrrrrrrrolina a a a a syssysysysyssssyystttttttttsttttstsssteememmmmmmm. . UNUNUNUUNUNUUNUNUNUNUUUNUNUNUNUNUUNUNUNUNUUUNUUUUUUUUUUUUNC C C C CCCCCCCCCC AsAsAshehehevviviviviviviviviviivviviilllllllllllllllllllllllle ee eeee ee ofofofofoffefefefeersrsrsrsrs m mmmororororre e ththhhhhananann 333 3 3 333 33333330 00000000000 0000 mmmmmmmamm jooojojojorsrsrsrsrsrsrs l l ll l lllleaeaeaeaeae dddididididdidididiiidddiidididid nnnnngnggnnnnnnnnnnnnnngggggg t to o ththe babababababababababababbabbabbbbbbachchchchchchchelelelelelllelelelelellelelelllle ororoorooororororororororororooroorrororrororrorr oooo oo oooooooooooooofffff f ff ff ff ff fffff f f fffff f f arararararararararararararararrrarrarrarararaarrartststststststststststststststssssssss, , , , , , , ,, bababababaabababababbbababaabababbbbbabbachchchchchchchchchchhchchhchchchchchchchchcchchhchhcchhcchchhcccchhheleeeeeeeeeee or ooooooooooof ff ff fffffffffffffffffffff scscscscscscsssscssccieieeieieieieieiii ncnce e eaaanananaand d d d mamamamaaaasttstststststtereeeeereeeeeeeeeeeeee ooooo of fffff ffffffffffff lilililililililillililiiiiiiiiiiibebebebbebebebbebebebebebeeebebbebbbebbbbbbbb rararararararrrr l l lllll l ararartstststststststsstss dd ddd egegegegegrereeesesssss.....
HHHeHeHeHHerererere a aa arerere a a a f f fewewewe m m mororore eeeee ee e fafafactctctssssss s ssssss aaanananaaaaaa d dd fi fi gugureeeeeereress.s.ss.s.s.s.s.s.s.s
AcAcAcAcAcAAcAcAcAcAcAAcAcAcA adadaddddadaaaaaaaaa ememememmmememmmmmicicicicicii sssssAAvAvAverereeeragagaaagge e ClClClCCClCClClCllCllasasasasaaaaaaaaaaa s s s s SiSiSiSizezezeeeezezee::: ::::: 2020202020202020
MoMoMoM ststst P Popoppuulululaaaarararaaa M M MMaaaaaajaaaajajorororss sss s bbbbybybybybb E E EEEEEEEEEEEEEnrnrrrrrrrrroloollmlmenent:t: P PPPPPPPPPPPPPPPPsysyssysyyyysyyyyyyysyychchhhhhhchc oooololoololooolooololololooolololooo ogogogogooggogoogoogggogyyy,y,y,y,yy,yy L L L LLLLititititittererererereere atatataturururureeee,e,ee,e, EEEEEEEEEEEEEnvnvnvnvnvvnvvvvvvvvvvnvvvviririrrrrrrononononnnnnnnonononnnnnonnnnnnnnnnno mmmemememeeeeeememeememeeeem ntntntntntnntntntnntnntnnnnnnntnntnn alalalalalallalalalalaallllalallallalalaaaaa SSSSS SSSSSSSSSSSSSS S S S Stututututututututututtuutuutututututututtututututututtuuutuuuudididdidididididdidddididdididdididididddddidid esesesesesesessesesesesssesessseseesssessessseeseessssseesss, , , ,, ,,,,,,, HeHeHeHeHeealthth &&&& &&&& W W WWWWWWWWWWWWWWWWele lnnesess ssPrPrromomommotottoto ioioioionn,n, aaandndndd A A A AAAAAAAAAAAAAAAAAAAAAAArtrtrttttrtrtrtrtrtrttrtrtrrrtrtrtrtrtrttrrtrtt
FuFuFuF llbllbblbblblbbbbbbblllllblbllbbl riririgghgghghghghhhhghghhgggghhgghgghhgg t t AAAAAwAwwwwwAwAAwAAAA arararardsdsdssssssssssssdssss: : :: :: : :::: 37373737373737773773773737377773737373737373737373377 s s tttutututut ddddeeeeeeeeeeeeeed ntntntntntntntntnnnn s s hhavev reeeeeececececceceieiiiiieieieiieivvvveveved ddddddd ddd ddd ththththhhhhhhhhe e prprprprprprprrprpprrrprprrp eseseseseseseseseesesesseseseeesttitititttttttttt gigigigiououououous s s s awaaawawawawawawawwawawawawawawawawawawawwawaraaaarrrrrarraararaararaarara ddd
UnUnUnUnUnUUnnnnnUnnnUnddddedededddddededdergrgrgrgrggrgrgggrggrgrgrgrggrggggraraaaaaaaaaaaaddduduuududduatatatatatatataaate eeeeee e ReReReRReReReRR seseseseseeararararchchchhc :: ::::::: MoMooooreree tt thahahan hhhahahahaahahhhh lfffflfflffff oo oof f fffffff ststsstststtstsstuuududdudududdu eeeeneeneneneeneee tststsststss ccc c c ccc c cccccccccccc cccccomomomomplpplplpp eteetetetettetettetettette eeeeeeeee eeeee eeeeeeee orooororrorrrorrororororrrrrroooo igigggginininininininininininiinii aaaaaaaalalaaaaaaa r rrrrrrrrrrrrrrreeeseeseesessssseseesseeesseeeaeeaeaeaeaeaeaeaaae rcrrcrrrcrcrcrcrcrcrcr hhhhhhhhh h hh hhhhhhhhhhhhhh iniinninininnnininininniininiinnniiinnninniinnninnnn t ttt ttttt tttttttttttttttttttttthhhhhhehehehhhehhhehheh iriririrrr fi fi fi fififififi e ee e e eeeldldlddld o oooof f f fffffff stststststttudududududududduddy y y yyy yy y ythththrorougugh hh thththhhthhthhhthhheeeeeeeee e UnUnUnUnUnUnUnUnUnUUnUUnnivivivivivivivviviviiverererererererereerersisisisisss tytytyyyyyyyyyyyy’s’s’s’s nnnnnnnnn nnaaaatataatioioionananallllllyy y rrrrrerererr cooooococcoooogngngnnnngnngngngggggg izizziziiizizzizizi edededdedededededddeddedddd U U UUUUU UU UUUUU UUUUUUUUUUUUUndndndndndndndnndndndnddnndndnddndndnddndndndddddderereeereererererereeeeerereeereeeerereeerereee grgrgrgrrgrgrgggggggg dadadadadadduuauuuauauauauauuuauaaaauaaaateteteteteteeeteteteeeteeeetetetttttttttteee R R Reeeseseseseseseseseseseesesseeseeseeseseeseesseeseeseseseesseeeeeeaeaeaaeeeaeaeeeeeeeeaeeeae rrrcrcrcrcrcrcrcrccrccrcrcrrrrccrcrccchhhh hh hhhhhhhhhhhhh hhhhhh hhhhhhhhhhhhh PrPrPrPrrrrrrPrPrPPPPrrrP ogooogogogogogogogogogogooogoooggogoogoogogggoogogogogooggoo rararaaarararararararaaararararararaaraaraarraaraaarararaaaar mm.mmm.m.mm.m.mmmmmmmmmm.mmmmmm.mmmmmmmmm UUUU NCNCCCC AAAA A AAAAshshshshhhhhevevevvvililillilillleleleleleleleeffofoooooooof unundeeeeeeeeed d ttththhthhhheeee e NaNaNaNaNaNNNaNaNaNaaaaaaaaatitititititit onononononnonoono lalllalalllla CC CCCCCCCCCCCCCCCononononnonononooo fefefefeferrerer ncnce e e onoo UUUUUUUUndndndndnndndndndnnnn errrrererrrrggrgrgggg aadadaadadadddadaa uauauuuauauaaaauauuaauaaaauaaauaauatttttteteteteettttetttttt R RRR RRRRR RRRRReseseeeesesesesesessssesesseseseseeseeeeee eaeaeaeaeaeeaeaeaeaeaeaeaeaeaeaeaeaeaeearcrcrccccrcrcrrcrcr hhhhhhhhhhhhh h h hhhhh mmomore thahan n 25222222225255555252252522225225255255555222 yy yyyeaeeeaeaeaeeaeaeeaeeaeeeeeaeeeeeeaearsrrrsrsrsrsrssrsrssrsrsrssrrrrsrsrssrrrsrssrssssss aaaaaaaa aaaaaaaaaaaaaa gogggggggogogogogoggogogggogogogoggogogggggggggggg .
StStStStSStStStStS udddududududddduuduudududyy yyyyyy yy yyyyyy yyy AbAbAAA roorooooooooooaaaaaadddda a aaaaaaaaaaaaaaaaaaaaandndndndddndddddddndndndndndndndnndnnndnnddndn SSS SSSSSS SSSSSSSSSSSttutuututututututututttt dddydydyddyddydddydyyddydyy A AA A AAAAwawwaww y:y: 1 17 77 pepepeeeeeercrrr eeeeeenenneenee t t tt oofofffooooooo s sssssssssstutututuuuuuuuudddddddddededdddedddddddddddddddd ntnnnnnnntntnnnnnnnnnnnnnntn sssss ssssssss tatatatatataaaatataataaaaaaaaaaakekekekkekekekekekekekekekekeke a aaa aa aaadddddddvdvdvvvvvdddvvdvvvvvanananannanannnnnnanananananannanaa tatatatatatatatatataaaaaaaaaagegegegegegegegegegegegegegegegegeegegegeee o oooo oo o o o o oo oooooff ff ff f ff f fff f ff leleleleleeelelellelelellleeeleeeleeleeeleleeararararararararaararaaa ninininininininnininnininnnnniniiin ngngngnnngngngngngngnnnngngnngngngnnngnnnngnnnngnnnnnnnnggnnggggngg ooooooo oooooooooooopppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppororooooooooooooooo tututututtttutuutuuutttutttttutututuutuutuuuuutuututuunininininininn titititttt esessssss i i in nnn n n nototoototottototoototo heheheheheeheheeheeh r r rrrrr ststststststtststtsttatatatatatttatatatttteseseseeseseeseseeeee aaaanndndddddddddndddddddddddd ccccc cccccccccccccccccccoououoooooo ntntnnntntnttntntntntnttrrriririrrrrirrriirirriir esesess w whihihilele e enrnrnrololollllllllelelelellleeeleell ddd ddddddddddddd atatataatatattat UUUU UUUUU UU UUNCNCNNCNCNCNCCCCNCNCNCNNCNCNCNCC A A AAAAAA AAAAAAAA AAAAAAAAAAA Ashshshshhshshhhhshhshshshhhshshhhhhshhsshs evevevevevevevevevvevevevvvevevvveveveeveve ililililillllliillililiiililleleleleleleleleeleleleelee... .
StStS ududenenenenenenttt ttttt AAAtAtAAtAtAthlhlhlhlhlhlhlh eteeetteettte e eee GGGrGrrGGGrrG adadadadadadaaduauuauauauauauaaaaaatititititititiititittitit ononononoono RRRRR R RR Ratatattttttattattatatattttattteeeeee::ee:eeeee:ee:ee UUUUU U UNCNNCNNCNNCNCNCNCNC AAAAA AA Ashshsshshshshevevevevevevvililililili lellellelele s sssss stututudeddentnnnntnnntnnnnnnnnnnnnn -a-aaththtththhthththhhthhthhhhlleleleleeeelelelelleeleletetetetetetetetetetetetettteteeeeteteeteteteetessssssssssssssssss s sss hahahahahahahhahahahahahahhahaahahahahhahahhhhahahaahhh vevevevevevevvevvevveveveveveveevev o oo ooooonenennn o of f hththe e hihighghg esest t grgrrgrgrgrgrgrrgrrradadadadadaadaaaada uauauuatitittiononononrararrarrraatetetetetet ss s sss iiniiininininnin tt t t ttthhhehehehehe NNNNN NN NCACACACACACACACAA.A.A.A.A.A.A.AAA O O OOOOurururururururu ssssss sstutututututudedededededentntntntntntnn aa-a-a-athththtttthleleleteteetes s sss ononononon a a a aaththleleetitiitititicc c scscscscscscscchohohoohohoohohooooooholalalalllallalalalalaarrsrsrsrsrsrsrshihhihihhhhihihhhihih pspsps wwhoho p plalay yy alalalaa ll fofofooofourururrurururrururrurrurur yyyyy yyy yyyeaeaeearsrs aaattt UNUNCC C AsAsAsAsAsA hehehhevivivilllllle e hahahahavevevve a aaa 9 9 9 99 9 9 pepepepepeep rcrcrcrcrcrcenenenene tt ttt grgrgradadadadaaduauauauauatiitititioonon rrratatate.e..
FaFaFaFaFaFaFaFaFFFFFFFaFacuccucucuucuc ltltltltlltl y:y:y:y:yyyyyyy 222222 2 210101001000010101010 fffff ffulululluluullll-l-l-l--l-l-ll titititititit memememememememeeeeee ff fffffffffacacacacacacaaaacululllulullululultytytytytytytytyyyyyy mm m m m mmmmmmmemememememememmememeeee bebbebebebbebbebeersrsrsrrsrsrssrsr , , , ,, 84848484484848484848484%%%%%%%% % % wiwiwiwithththtththhht ttt tttttereeerererererrrmimimimimimmimimiminanaaal l l dedededededeedegrgrggrgrgggrgrggg eeeeeeeeeeeeees s
COCOPLAC: UNUNC C AsAshehevivilllle isiis t thhehe hh heaeadqddquauauartrtereers s s fofor the e CCoununcicil l of PPububblilicc c Liberal l Artsts C Coolleges, aa2727-mmemembeber r orgagaaninizazazattition of state-supppporteed libebeberalll arts collegegeges that rrrececogogninizeze tt theee immpmportancncncee e ofoff liberal l arartsts a andnd s sccicieneenceccess ededucucatiion for succesee s ss innn aa comom lplexex g gloloobabab l sosocicietetety.
CCCCaCaCaCaCaCCCCCaCCCCaCaCampmpmpmpmpmpmpmpmpmpmpmpmpppppus LifeRRReReReReReReReResisisisisisiiisiidededededededeedeeencncncccccncccnccncncncnnce e eeeeeeeeee Haalllls:s: AAboboutut oonene-t-thihirdrd o of f ststududenentsts l livive e onon c camampupus,s, w whiiiileleleeeeeeeeeleleleeleelelee a a a a aaa a aa aaaa aaaaaaannonononnnononononnooonoononnoonnnononnnonnn thththththththththththththththththththththththhhththhherererererererererererererererererererereeerrerrrr t t t tt tt t t t tt t ttt t ttttt tt ttt tthihihhihihihihihihihihihihihihihihihhhhhhhihhihiih rdrdrdrdrdrdrdrdrdrdrdrdrdrrdrdrdrdrdrdrdrdrdrdrdrddr ll l ll l ll ll l lll l ll l lliviviviviiiivivivivivivivivivivive withthini aa one-mile rarararaaadididididddiddd usususususus o o o ooffff ff ff cacacacacacaaaaaaccaaacccc mpmpmmmmmmmmmm usus.
AtAtAtAAAAAthlhlhlhlhlhlletetetee icicicics:s:s:ss:s:: 1 115 5 5 5 NCNNNCNCNCNCNCNCNCCCCCCCCCCCCCNCAAAAAAAAAA D Divviision 1 1 tetetetetetetetetetetetetetetttttteteteteamamamamamamammamamamamamamamaaaaaaaaaaaa s s s
StStStStStStSttStStStStududududdududududududeneneneneeneneneneenenene ttttttttttt t GrGrGrGGrGrGGrGrGrGrGrouououououououououououpspspspspsppps:: :: MoMoMoMoMooMoMoMoMoMoooM rerererrererereeererereererrerererrerrererererr t t t t t tttthahahahahahahahahahaaahahahahahaahaaan n n nnnnnnnn 60606060606060600000 c ccccccccccccccccccccclululululululululululuulululuuuululululullubsbsbsbsbsssbsbssssbssbsbsbsbsbsbsbssbsbsbsb a a aa a a a aa aa a aaaaaaaanddndndndndndndndndndnddddddndndddnd ooo oooooo oo o oo oooooo ooooooorgrgrgrgrgrgrgrgrgrgrgrrgrgrgrrgrgrgrgggananizzata ioionss, raaaaaaaangngngngngngngngngngnggngngnngngnngnggngngngininininininininininininninininininiiininiiniinnggg g ggg ggg g g gggggggg ggg g gggggggggggg g frfrfrfrfrfrfrfrrfrfrfrfrfrfrrfrfrffrfrrfrffrfrrrrromomomoomomomomomomomomomomomoomomommommomoooomoommomomomomo hh hhh h hh hhononononononoroorororororo s s s s ssococococococieieieieietititititiesesesess ttttttttttto o o oo oo iniinininnninintrtrtttrtrtrrtrrrrrttrrrtrrrrrrrrramamamamamamamamaaaamamaaamaaaaa urururururuuururururruruururururururrrrruralalalalalaaallalalalalalalalalalaaaa spspspspspspspsporororororroortstststst
Innnnnntttteteeercrculululuuullultutututuutututturararaaaararal CeCeCeCeCeCCeCeCeCeCentntnttntttttttttterererererererererererererererere & & &&&&&&&&&&&&&&&&& O OO OOOOO O OOOOOOOOffiffiffiffififfiffiffiffiffiffifffifffiffi cccccc cc e e eee ofooofofofofoooo M MMMMMMululululuullultititittitititicucuucucucucuucultltltltlttlttttururururururururururalalalalalaalalal S SS S SS S SSS S SStutututututututututtuudededededededededededeeeedentntntntntntntntntntnnntntntt P PPPPPPPPPP P Prororororoororoororoororogrgrgrgrgrgrggrgrgrggrgrggrrgrrrg amamamamamamamamaamams:ss Thee Inttttererererererererccucucucuuuucucuultltltltll uuururrurrrrrurrralalalalalalalalalalaal C C CC C C C enenenenteteteteteteteteteterr r r rrrrrrr hhohohohohohohohohohoh uuusususususususususususususussussuusuuseseesesesesesesesesesesesesseesseseseessssssesssseessssesessss cocococooococoococococooccococc fmfmfmfmfmfmfmfmfffmfmfmfmfm ororrrororororororororororortttatatatataattaablblbbblblbblblbb e eee spspspspsppaaaaaacccca esesesesesesesessesessesesses ff f f fff f f f f f ffffff ororororororororororororororororor mm mmmmmmmmmmmmm m mmmeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeetitititititititititititit ngngngngngngngggggngggngngngngn s,s,s,s,s,s,s,s,s,ss,s,ss,s s s s s ssssooco ial evevevenenenene tstststt a aa aaaannddndndnddnd p p p p ppp ppp pppror grgrrgrgrrrramamamamamsss sss ininininvovovovovooooovoovovvov lvlvlvll ininnininingggggg g susususususususususususususuuuuchchchchchchchchchchchcchchcc d ddd d dd d dd ddivivivvivvvvvi ererererereeerrsssssesessssssee groupppppsss sss asasasasasasasasasasas A AA AA A AA AAAA Alllllllliaiaaaaai nnnncncncnccccccncncncncncnncncncnncnncnccccccnnnce,e,e,e,e,ee,e,e,e,e,e,e,e,e,ee,,e,ee,eee,eee,eeeeeeee,,ee,,, BBBBlllBBBBBlB aacacacacacaacaaaa k k k k StSStttttSttttttudududududuududeneneneneennenennentstststststssssss A A AA A AAAAAAAsssssssssssssssococococococococococococococococociaiaiaiaiaiaaiaiaiaiaiaiaiaiaiaiatitittititittititititititititittitiononononononononononononononon, ,, ,,,, ,, , , , InInInInInInInInInIInInnnInntetetetetetetetetetetttetteteternrnrnrnrnnrnnrrrrnrr aattaaaaaaaaaaa ioionanaaaaal l l ll SSStStStStStStSStStSS ududududududduddduudeneneenennenennenne ttt t tt t tttt AAAsAsAsAsAsAsAAAAsAsA sososossosososssssociiciciciciiciiiiatatatatataatatatatattatiioioioiooioioooioiooiioionn,n,nnn,, A A AAAAAAsisisisssisisisis anannanananananananannnnaa SSSSS S Stut deddddedeeeeeeeeeeeenntntnttnttttttntntntttnn ssss s ininnnnnnn A AAAAAAshss eveveveevevevevevevevevevilille, , HHeHeHeHeHHeHHHHeHeHHHHH rmrmrrmanananananan@s@@@s@s@s@s@s@s@s@s@s@s@@s@s@s@@s@s@s@s@s@s@s@s@s@s@s@s@s@s@s@@s@s@@@s@@@s@ss@ss@@@s@@OOrOrOOOrOrOOrOOrOOOrgugugugugugulllllll ooooooosososos@@@@@ssss@@@@@ eeeeeen n n n nn LaLaLaLaLaLas s s ssssssssssss s AmAmAmAmAmAmAmAmAAmAmAmAmAmAAmAmAmererererererererererererereereerrericicicicicccicicicicicicicicicicasasasasasasasasasasasasasas (( ( (( (( ( ((( ( ( ( ( ((HOHOHOHOHOHOHOHOHOHOHOHOOHOHOHOHOHOH LALALLLALAALALALAL ))))))) anannanananananananand d ddddd d d dd d d HiHiHiHHHiHiiHiHiHiHiHHiHiHH llllllllllllllllllllllllll elelellleeeleee . .
TTTTTThThThThThThThThThTThTTTTTTThThThThe eee eeeee SShShShShShShShShShShSShShShererererererererererrririiiriririririirilllllllllllll C CCC CCCCCCenenenenenenenene teteteteeeteteeteteeer:r:r:r:r:r:r:r:r:rr:rr WiWiWiWiWiWWWiWiWiWiWiWiWiWiWiWillllmlmlmlmlmmlmlmlmlmlma a aaaaaaa aaaa a MM.M.MMM.MMMMM.MMMMM S SSSSSSSSSSShehheheheeehheheheehehheheheherrrrrrrrrrrrrrrrrrrrrrrrrrililiiliilililililillllll CCCeCeC ntntntntereree i iis ththhththt eeeeeeee e unuuununununununuuuunnunnniviviviviviiiviiivviviverrerererererrererer isisisiisisisisiisisisisisisisisisisityttytytytytytytytyytytyttytytyttytytytytyttytyy’s’s’s’s’’s’s’s’s’s’s’s’s’s’sssssss n nn n n nn nnnn nnn nnnnnnneweweweweweweweweweweweewewwweweeewwwesesesesesesesseseseseseeeseesessessttt tt tttt ttt aaaanaaannannd d d lalaargrgrgrgr esesessssssssessssst tt t t tttt fffafafafaaaaaafaaaf cccccciiciccccccccccccciliiiitytytyty, , , oofffffffffffffffffffefefffffeeeeeffeffffefefferiirrr ngnngngngngnngngngngnggngngngngngngngngnggnggnggnggggg a a rarangngnggge e e ofoff a a acacacadededeeemimiimimimimic c c c c c ananananannnndd d d d d dd ouououoououtrtrtrtrtrtreaeaeaeaeaeaeachchcchchchchchhhh p p prrorogrgramams s fofocucusesed d ononononnn hhh hh h h hh heaeaeeeaaaeaeaaaaltltltltltttthyhyhyhyhyhyhyhhyhhhyhyyy lllll l l ll liviviviiviviviivvivvinininininiiinngg g gg g ggg ananananananananananananand ddddd dddd d dd weweweweweweeeweewwweww lllllllllllllllllllneneneneneneneneneneneneneessssssssssssssssssssssssssssssss pppp p p ppppp pp pppp p prororrrororororoororrrororororroroooomomomomommmmmmm titititionnnnnnnnnnnnnnnnnnnnnoo .. . ... ThThhhhhhhhhhhhhhhhhhhhhhheeeee e ee eeeeeeeeeeeeeeeecececececeececccccc nntntntn ererere i i iiis s s hohohomemmmemee tt ttooooo o thththhhththeeeeee e acaacacaacaca adadadadaddada ememememmemiciciciciciccic DDDDDDDepeepppararara tmttmeeeneent t fof HHHHHHH HHeaeaeaeaaltltttthh hhhh ananana d d WeWeWeWWWWWWeWWWWWeWWWW lllllllllllllll nenennesss, withhhhhhhhhth cclalalassssroroomomommms,ss, dddd dddededededeeedediciccciccciiicatatatttttedededddededededed ssssss s ss spapapapapapapapapapapapacececececececececececcecececceccececcececeeeece ffofoff r r unundedergrgr rar duate researchh, a hiighghghghghg -tech tttet acachingngngnngng/ddeemmmonoonstststtrararar titiononnn kkitittttchchchchchchhchhchhhchchc eneeeenennnnnenennnnnn, , ,, , , , , ,, ,,,, ananand ddd rereeeseseseseseeeeararararararararaaaarraraaaarararraararaa chchchchhhhhhhhcch aaaaa aa aaaaandndndndndnndn lleaearnnininnng gg g gglalalalallal bsb .Theee S SSherrrrrriliiiiii l CeCeCeeeeeenter includededededeeeeeeeeeeeeeeessss sssssss ss sss ananna ee expxpxpxxx ananansisisiveve fifififi fifi t ttnenenessssss c ccenenenennneeennnttttetetetetetetetteteeerrrrr,rrrrrrr,rrr,rrrr aaa a a a b b bbioioioioiooiooioiooooioioffefefeffefefefefffffefefeeeededededededededdededeededdde bababababababababbababababbabaaaackckcckckckckkcckckkckcckkckkckckcckckcck ll l l ll l ababbababababaabababbbb a a a a a aa nnndndd mmmmmmmmmmmmmmedededdedddededdddddddddeddddititititttitittiitttitttatatatatata ioioiooion nn rrrrrrrororrrrrrorrrrror omoomomomommomomomoomommomoooooomooooooo , , , anaananaa d tththththththhtththht eee eeeee WWWWWeWeWeWWWWWW lllllll neneneeeeessssssssssssss CCCCCCCCCCCCCCCCCCCCCCCafafafafaaafé.éééééé
KiKiKKiKK mmmmmmmmmmmmmmelelelelelelelel A A AA A AAA A AAAArererereerrrenananananana: : : : : ThThThThThThe e e ee neneneneneew w w w w KiKiKKKK mmmmmmmmmmmmmmmmmmmmmeleleeleleleleleelee A A AAA A AAAAAAArerereenanana, , wwwhich isssi p pararara tttt t ofofofofofofofofofofooff t t t ttttt tthehehhehehhheh SSS hheherrrrrrr iiililll CeCeCeCeCeeCeeCentntntntnttntntntntnterererereeererr, ,, , , caccccacacacacaccccann n nnn n seseseseseesess atataatatatatataaaatat uu uuu u u upp p p ppp tottotooooooooo 3 3 33,8,8,8,8,8888,8,88888, 00000000000000000000000 peopoppppppopopppleeeleelellellelle f f f ff f ffffforororororororoor cccccc conononononncececececertrtrtrtrtr s,s,ss,s, ccc cccomomomomomommmememmmmencncncncncncnccncnccemeeememememememeemememenenenenennenennennentstststs, , , cocooc nnvvocatttioioiooonsnnn , , , leleleectctctctctttttctttctururururururururu eeseseses,, ,, , ,, iinininiiii teteetercrcrcr oloolleeelelegigiggiiig ataatatatatatatataaaattaa e e e eeee e ee e mememememmememeememenn’n’n’n’nnnnnn s ss s sss ananananananannndd dd d ddd wowowowowwowwww mememmememeeeen’n’n’n’nnn’nn s s ss ss babababbabababababababbbaabaassss-----s-sss-ssketbbbbbbbbbbalalalalaalalallaa l lll l l l ll gagagagagagagagagagggagamememmememeemmmes,s,s,s,sss h h hh h heaeaeaeaeaealtltltltltlth h h hh h fafafafafaf iriririririrs,s,sss,s a aa andndddddddd c c c c c c cc cc cccccomomomoomomomomomomomomo mmmmumumumummmmm nininityyytty eeeeventtts..s.AsAAshehehevvvvviviiiilllllllllle e eee ee e e e cocooocoooocococooommmmmmmmmmmmmm unu ity.
/// UNC ASHEVILLE BULLDOGS ///
43/// F E A R T H E D O G ///
KKuKuKuKKKKuKKuKuKuKKKuKuKKuKuKuKKuKuKuKuKuKKKuKuKKuKuKuKuuKudodododododododododododododododdodododdddoododdddododododossssssssssssssUUNUNUNUNUNUNUNUNUUNUUUNUNUUNNUNNNNUNUUU C CC CCCCCCCCCCCC AsAsAsAAAAAAAsAsAsAAAsAAsAAssssheheheheheheheheehehehheeeeeheheheeeeeevivivvvivivivivivivivivvivivviv lllllllllllllllle ee eee e eeee ofofofofofofofooooffffo fefefefefefefefeffeeeeeeeeeeeeeeeefersrsrrrrrsrsrssrsrssrrrrsrssrssrssrsr a a a a aaaaaaaaaaaaaa ““““““““““ ““ttotototototttotottooooot p-p-p-p-p-p-p-p-pppp nononononononnonoononononooonotctctctttctctttttccttcctt hhh h hhhhhhhh hh acacacacaccacacacacacaacaaaa adadadadaddadadadaddadadaddadddda ememememememememeememememeemeememememmmmicicicicicicccicicccccicici e e e ee ee xpxpxpxpxpxpxpxpxpxxxppxxpxxpxppxppeerereeeereerereereeeerrre ieieieieieeeeiei ncncnnccccccncncnccnn eee,e,e,e,eeeeeee,,,, ”” ””” ””””” anananananananananananananana d,ddd,d,d,dddddd,ddddd,d,d,d,d,d,d,dddddd b bbb b b bbbb bbbasaasasasasasaaaa edededededededededededeeeeddeeedee o oooooo oo ooon nnnnnn n nnn nnnnn sstststststststststsststsssssttudududududududududdududuuuuuuuddenenenenenenenneneeneneeennnnennennnnnntttt t t ttttt tttttt t ttt ssususususussssss rvrvrr eyeyyyeyyyyyyyyyyyyyy r rrrrrrrrrrrrreseseeseseeseeeee popopopopopoppppppp nsnsnssn esesesesesesssesssssss, , , , , ,,,,,,AsAsAsAsAAsAsAsAsAAsAsAsAsAsAAsAsAssssAshehehehheheheheeeehehheehehehehevivivivivivivivvivivivivvvivvvvillllllllllllllllllllleeeee eee eeeeeee e isisisisiisisisississss rr r r rrrrrrr rananannanananannanaaananaanaanaaaankekekekekekekekekekekekekeekekekekeekeeedddddddd dddd dddd d d d 111111111111111111111111111111thtthththththththtththththththhththttttttttt i ii ii iiii nnnnnnnnnnnnn nnn n ththththththththththththhththhthththt eeeeeee ee nanaaaatitititttiititittitiitititt onn o on n ththee “c“colollelegege c citty y gegetss hhigighh mamarkrks” lisst. - TThehe PPrir ncncetetonon R Re-e-viviviviv ewewewewewwewwwwwwwwwwwwwwww’s’ss’ssssss’sssssss ““““““ “ “ ThThThThThThThTThee ee eeee e BeBeBBeBeBeeeeBeBeBeBBeeeBBBeB ststststststttsststststststtstststttstssts 3 33 3 3 3 333 333333337777777777777777777777777777777777777777 C C C CC C C C CC CC CCColololololooolollooololoooololollelelelegegegegegggggggggggg ss s - 2022020201313131333 E EE E dididititititittiononononn”” (A(A(A(AA(((((((((((( ugugugguguggggggggggggusususussu ttt tt tt 20202020202201212121222)))))))))))))
UNUNUNUNUNUNNNUNUNUNUUNUNU C CC CCCCCCC AsAsAsAsAsAsAAsAsAsAsAsAsAsAAssshehehehhheehehheeeheheeheviviviviviviivivivvvvvv lllllllllllllllleee e e eeee e rarararararararrrarrrarar knknknknknknknkkknknknkknknkkknnkkkkedededededededddeee 2 2 222222 2 222221st in the nnnaataa ion n as aaa “BeBB sts Buy C C Colololololleeeegegegegeg ,” based on n quququalalitty y ofofo teaeaching, carareeeerr prprprprprprrrprprrpppppp osososososospepepepepepeeeeepp ctctcttttctcccccccccccccc ss,s,s,s,s,ssss,ss, g g ggg ggggg ggrararrararaaaaaarraarrar duddududududududududududududududduuuuataatatatatattaatataaaaaaa iiiioioioiooiiioioi n n n nn nnn rrrraaaararaaaaatett s,s and sstututudedededed ntn debebe t leveel..Off theeehe e e igigiggghththhththhh uniiveerssititieies s inin N NNoororthth C CCararolo inina a a aa a aa ththhththththththththththtththatataatttataatattatatattat mmamamamamamamamamamaammamaamm dededededeededeedededdd ttttttttttttt ttthehhhehheeeeeheheheehehehhheeheehehhee ll llllll llllisissssssssississsissssisssst,t,t,t,t,t,t,ttt,tt,t,tt,t,tt,ttt o o o o o ooooooonlnnnlnlnlnlnnlnlnlnlnlnlnlllllln yyyy yyy y y yyyyy y yyy y yy yyy UNUNUNUNUNUNNUNNUUNUNUNUNNUNNCCCCCCCC-C-CCCCC-ChChChapapappelll H Hilll,l, aat 13313133tht , , raraaaaanknknknknkeded higiggheher r thhthhananaa U UUNCNCNNN AAshheveve ilillele. . RaRaRanknkininngsgsgs p prerereeeeepapapapapapapapapapaaap rerererererreerererererrrred d d dddd d ddd dd dddd bybybybybybybybybybybybbybybybybybyy thththththththhthhttt eeee e eee CeCeCeCeCeCeCeCeCeCeCeeeeeCeeeeeeentnntntntntntnnnnnnnnnnnterererrrrrerrrrr fff fffffff fffff oroorooorororrrrororroroorororoooo CCCCCCCCCC CCCCCCCCCCCCoooolololololooloooo leeeeeleleeleegegegeggegeegege AAAAAAAAAffffffffffffffffffffffffororororororororororororrorrrdadadadadadadadadadadadaddadadadaabibibibibibibiiibiiilililililillllllllll tytytytyttytytytytytytytytytyttyy a a a a a a a aaaaaandndndddndndndndndnddnndndndn PPP PP PPPPP PPPPPPPPPPrororororororororororoorooooorodudududududududdududududududududduuuuctctctctctctctccctcttcttttcc iviviviviviviviviivivivivivvvi itittttttty.y.y.y.y.y.y.y.y.y.yyyy.yyyyy. - --- - - F FF Forororororoororororororroorroro bebebebebebebebebebebebebebebbbeb s ss s ssss s s ss MaMaMaMaMaMaMaMaaMaMMaMaMaaMaMaMaaM gagaagagagagagagagagagagagagaggagaggaaazizizizziineneneneneneneneenenenee ( ( ( ((( ( ( ((AuAuAAuAuAuAuAAuAuAuuuuAAuuAA guguguguuguguguuguguguuguguustststsstststssss 22 2 2 22222222010101000100000000 2)2)2222222222222
“U“U“U““U“U“U“U“U“U“U“U“U““U“U““U“UU“U“U“U“U“UUUUNNNCNNCCNCNNNCNNNNCNCNNCCCNNCNCNNN A AA AAAAAAA A AAAAAshshshshshshsshsshshshsshshs evevevevevvvvvvveveeevvvvvviiilililililililililiiiillllii leleleleleeeeeeeleleeee aa a aaaaaaaaaaa aaaaandndndndndndndndndndndndndnndndndndnnndn ttttt tttttttthehhheheheheeeeehhehhheehee c cccccccititititittitity yyyyyyy ofofofofofffofoofoffoff A AAA AAAAAAAAAA Ashshshhshshhhhhhhshshhheveveveeeeveevevevevee ililililillililllillelelelelelelleeele aaaaa a arererererreererere sssss s steteeteteeeeteeteteeeepepepepeepepepepepepeppeppe ededddededededeededdedd iiiii i innnnn n nn whwhw ititewewwatata ererer c ccululultututurerer m mororore ee ththanan a anynyyywhwhwhwhwhwhwhwhwhwhwhwwhwhwhwhwhw eerererererereereee e e e eeeeeeeeeee elelelelelelleleleleleele sesesese ininininininnnnninnninninnnn tt t t ttttttheheheheheheheheheheheheheheehhheeeeheh www ww w worororororororo ldlldldlddddddlldldldlldldlddddddldddlddd.................. . AsAAsAsAsAsAsAsAAsAAAsAAAsAAss didididdidididididdididdddididdiddiddiii e eeeeeee fffrfrffrfrfffffrfrfrffffrffffff ooooooomomomomomoooo t theeheirir l llonononoong g g g lilil ststttt oof f fi rsrst t dedeeeescscs enentsts a andddndnd r racace ee iiiwiwiwiw nsnsnsss, , UNUNUNUNUNUUNNCCCCCC C AAsAsAsAAAsAAsAAshehehehhhehehehevivivvvvvvv lll e e alalalalalallalalalalaalalla umummummumummumummu s ss s ssssss ss sss anananananananannndddddd d dddprprpppprprprppp ofoffesesee sosorsrs a aaaaaaaaaaaaaaaaaalslslslslsslslsooooo o ooooooooo giggiigigivevvevvvvevevevvvv b baaaaaccacacaccccccaaack kk k toto ttttheheh p padadddldldldlininii g ggg cocommmmmmmm ununititty.yyy.”-”---”- “““ ““HHHoH nnonon r r RoRollll: : ThThhe e BeBeeB stst O Oututu dododooror S Schchoooooooooooolslslslslslslsllsslsl i ii ii i i ii i i iiiiinnnnnnnn n n n n nnnn ththththththththththhhththhe ee ee e e eeeeeeeeeBlBlueueueueueeue RRididgege,”,”””””””””””””” B B B B Blllluullllllll e e RiRidgdgggggee eeeeeeeeeeee e OuOuOuOuOOOOOOuOOuOOOOOO tdtdtdtdtdttdttdooooooooooorsrsr ( ( (((((((AuAuA gugugugggggggggggg stst 2 2 222010100112)2)
UNUNUUUU C C AsA hehevvvvivviviviviiivvvivvvivvvvvv lllllllllllllleeeeee eeeeeeeeeeeee isisisisisissisisiisisisssissiissssssss “““““““““““““ ononononnonoooononooonnnnnnnnonoonoo eeeeeee ee e ofofofofofofofofofofofooffoofofoofoooo tttttttttttt t ttthehehehehehhehehehehhehehhehheeheehhe bbbb b bbbbbbbb eseeseseseseseesesessseseseesssessssttt t t t ttt t tt t edededededeeedeeee ucucucucatatioiooonanan ll babargrgaiainsns i inn ththe e cocoununtrtry.y.” ” FoForr nininene c cononononoooononononononoonooononnnnnno seseessesesesecucucucucucuccuutiiitiiiititititititiiit veveveveveveveee y yyyy y yyeaeaeaaaeearsrssssrsrsrsrs,, ,UNUNC C AsAshehevivillllllllllllllllllllllleeeee’e’e’’e’eee’eeee’eeeeeeee s s sssss ss ss EnEnEnEnEEnnEnvivivivivivviviviv roroorororooonmnmmnmnmnnmn enenenennentatataatatallll StStSStStttStStudududuuduuuduuuu ieieieieeees s s s ss ss s PPrPrPrPrPrPPPrrP ogogogogogogoggrarararararararaaam mm mmmmmmmm hhhahhhahhhhahahhhhhahahaas s s ssssss bebebeebebebebebebebeeebebebeebebebeeeenenenneeneneneneeenene nnnnnnnnnnn nnnn nnnnnnnamamammamamamamamaamamammmmmamamamammeddedededededeedededeeededededded ttttttttt tt tttt ttooo ooo oo o ooo o oo ththththththththththththththththhthheeeee eeee eeeeeeeeeeeee lililillliistststststststststttttttttt ooo oo o o oo of ff ff prprppppp e-e-prprofofofoffofofffffofffffffffffffo eeseseseseseseseesseeeeeee sisisisisisisiiononononoononnno alalaalaalaall ppp p ppprorororrororrororo--ggrgramams s wiwithth u unuuuunususususssusususususususuususuuualalallaaalalaalallalalalalaala ssssss ssstrrtrtrtrtrtrtrttrtrtrtrtrtrtrtrtrrrrreneenenennnenenenennnnnenenenne gtgtgtgtgggtgtgtggttgtgthhhhhhhhhhhhhhhhh h ininninininiiinininininninnnnnn p ppp p pppppp p p p prerererererererereeereeeeeepapapapapapapapapapapapapapapapapap ririririririririririririrrririrrringngngngngngngnggngngngngnnggngngngnnnggn sssssssssss s ssss sstutututututtututtuutututuutututuututudedededeededeeedededededeeeeedeentntntntntnnttntntnttntntnnntnn sssssssssss s ss fofofofofoffofofoofofff r r rrr rr cacacacacaaccaccaarererererererereererererereerrs.s.sss. - -- - T TTTT TTThehehehehhehehh F F FFFFFFFFFFisisisisisisisssskekekekekkekkkekeke G GGGGuiuuiuuu dedddedeededeee t t tttt ttt to o oooo CCoCoCCCCCoCoCoCCoolllllllllllllllll egegegegegegeggegeegegeggesesesessseseseessesseses, 202020202020200202020001313333 EdEditioi n n (J(Jululy y 20012122)))
UNNC C AsAshevillee is listed amamong AmA erica’s “green” ccollllegeges andnd uuniniversrsittiees.s - TThehe PPririncncettonon RRevevieiew’w’ss ““G“Guide to 3222 Grreeenn Colllegegese for 2012” (April 2020112))
UUNC Asheevivillllee is among jjusu t 75 iinsn titutions nationwiw dee nnoteded aas s a a “B“Beest VaV lue”e” ppubublic coollegge. - TThee PPrinceton Reevieww’s’s “20011 BBest Value CoC lleges” (Februuarry y 22012)
UUNC Asheevville e isis o onene o of f ththe e nanatitionon’s’s 5 0 bebest values inn ppppppp bubububbblililic cccc coollllegggggess, , iwithth t thehe fi fif fththhhh l lowowowowowesestt tototatall cost of f faattendinnnnnnnngg gg g g gggg pepepepepepepepp rrr rrr yeyeyeyeyyeyy arararararara , , ,,,,, annananananddddd d thththththe ee eeee eieieighghghgg ththth l l lowowowesesest t t t avavavavererereragagagagaggggee e e e dededededd btbttbttbt a aa a amomomomooomomomomonnngngnngngnggg g gg ggrrarar duduatatatatateses. . - Kiplppppp inininnii gegeer’’s ss s PePP rsrsrssr onalalalal F Financee MMagazinene ( ( (((((((JaJaJJaJaanunuuuunun arararararra yyyy y y yyy 2022020202022202020121222212122212))))))
UNUNUNUNUNUUNUNNC C C CCCCCCCC AsAsAsAsAsAsAsAsAsAsAshehehehehehheeheh viviviviviv llllllllllee e e ee rarararaaaarararraanknknknknknkkkknkkkssssss s s eeeiiiieeieighghhghghhhhhhghghgg tththththththhhthth i i in nnn ththttthtththeeeee e ee nanananananananann titititititititittt ononoooonnooono a aaaa aaa aamomomomomomomoomm ngngngngng PPPPubububbblililil ccc c c LiLiLiLLLiLiLiLLL beebeebbeeeeebbbb raalll l AAArrrrtstststststststs C CCCCCCCCCC ooooololoololo lleeeeeleleegegegegegeeegeg s,s,s,s,s,s,s,s, aa nnndnnnndndnd i i issss ss ss tththhhhhhhe eeeeeee oononono lyyyyy N N NN NNorrth CaCaCaCaCaCaCaCaCaCaCaarororrororororororororor lililiililiililinananannanaaaanana ii iiiiinsnsnsnsnssnsnn tititttitiitttitittit tutututuuuuuutt titititittititionononnnnnononnnnnoonon lllll lll ll isisisiiisiisi tetetettteetttt ddd d ddd d ddd aaamamamamamaaamononononnnonnnnongg g gggg NaNaNaNNNNaNNNaNaN ttitititttiiiononononooo alalalla L L L LLibibibibbbibibbererererererererereraalalalaaaa AAAA AArtrtrtrttsss ssss CoCoCoCoCoCoCoCCoColllll egegegegeseeseseseeses whooooooooooseseseseesesesse sssssssstutututuuuututut denntttttttsss s s ggrrrrrgrrrrgg aaaaadddaddddduauauauauauauau tteteete wwwwwwittttti h hhh h ththththththttht e eeeeeeleleeeleleeeeeasasaaaaasaaasasasasastt ttt t t t ttt t tttt amamamamamamammmaaamamaamououououououountntnttntntnn ooooooof fff ff dedededededededdd btbtbbtbtbtbbtbtt. .. - - - U.U.U.UUUUUU S.S.S.S.SSSS. N NN NNNNewewewwws ss & &&&&&&&& & WoWWoWoWoWoWorlrlrlrrlrr d d dddddddd ReReReReReReReReReR popopopopopooorrrtrtrtrtrtttrtrr ’ssss’s’’s’’s’s’ “““AmAAmAmAmAmmmmAmmeeeeere ica’s Best Colleges” ((SeSeptpteemmmmmbebebbebebeb rrrr 2000000011111111111))))))))
UNUNUNUNUNNNNNNNNC C C C C AsAsAsAsAsAsAsAsAssAsAsAsssAsA hehehhehehehheheheheehehheeeevivivivivvvivvivvivivivillllllllllllllllllle ee eee iiiiiiisisisisis o oo o onenenneneenenneeeee ooooo oo ooooffffff fff ff f AAAAAmAmAmAmAmAmAmAmAmAmAmerererererrerreriiiiiiciccic ’’’’’’’a’’a’aaa sss ss “1“1“1“1““1“1“1“1“1110000 000 0000 0000 BBBBeBeBeBeBeBeBeBeBeBeBe tststststststtstststss CCC C C CCCCCCCCCCCCC lllolololoololololoolololo lllleleleeeeleelelelleegegegegeggegegegegegegeegegges ss s fofoof r r hthhhthe e e MoMMoMooMMoMooMoonnneneeeeenen y.y.y.yyyyy.yyyyy”””” ” ---- - BaBaBaBaBaaaBaBaBaBaBBBaBaBaaBanknknknknkknknnnknknknnknknnkrarararararararr teteeeeteteteteeteee.cccccc.cc.ccc.c.c.comomomommmmommmmomm, a aaaaa lelelll adadadadadaddadadddddinininnnininggg gggg g g g gg g g gggg gg ooononononononoonnlilililililineeneneneenene sosososoosoososourururuururuuururururururrrrururrurrcecececcececececcecceccececececececececeececececcecee o oo oo o o o oo o offffff f f fff ff f fifififi fi fifi fifi fi fifififi fi fi fifififififinananananananananananannannanananannnanaaaancncncncnncncncncncncncnnncnnn iaiaiaiaaiaiaaiaiaaaaaaial ll ll ll llllllll ininninnnfofofooofooooooooooormrrmrmrmrmrmmmmrmrrmmmrmmmmmrr atatatattatataataaaatatattattataaa iooioioooiooooioioioooioiooooi nnnn nn nnn nnnnnnn (J(J((J(J(J((J(J(J(((J(J(J(J(Junununnnnunnuunununnnunnununneeee e eee e eeeee eeee 20202020202020202202020202002220222201111111111111111111111))))))))))))))))
AdAdAdAdAdAdAdAdAdAdAdAdmimimimimimimimmmmimmimimmimmiisssssssssssssssssssssssssss ioioioioioioioioioiiioioioiooioioooonsnsnsnsnnnsnnssnnsnnnssMiMiMiMiMiMiMiMiMiMiMMMiiddddddddddddddddddddddddddddd leleleelelleleleleeeeeeee 55555 55555555 555 550%0%0%0%0%0%%00%0%0%%0%0%0%0%0%0%%%%0%0%00%00%00000%0 o o ooooo ooooooooofffffffffffffff fffffffff ininininininiinnnninnnnnnnnncccococococococccccccococococcococcoocccccccccc mimimmimimiimimimmmimiiinnngnngngngngngggnnngnngnnnngnnggnggggg fff f fffff ffffrrereereererererererrererrererereererrrrr shshhshsshsssssshshhshhhshhhshsssss mmememememememememmememennnnnnnnnnnnnnn nnn n SASASASAASAASASASASASASASASASASAAASASASASASASASAAASSAAAATTTT TTTTTTTTTTTTTT TTTTTT TTTTTTT sssscscccscscss orororororrrrrrorrrrrorrrrrrrrrrrooree:e:ee:ee:ee:e:e:e:e:eeeee 1 1 111 111100900090909009090900900909099990-0-000-0-0-0-0-000-000-0-0-0-0-0-0-00000 121122212222221111221212121221221121250500505050500050500505000505050550050505555555050000 ( (((((( ( ((( (( ((( (((FFFFaFaaFFaFFFaFaFaFaaFaFaFaaFaFaaaaallllllllllllllllllllllllllllllllllllllllll 2222222222 2 2 22222 2 222222 010100101101010101010100110100010101010100101011010110110 1)1)1)111)1)))1)111))1))))111)1))1)1
AnAAAAAAAnAAnAAAnAnAnAnAnAAAAAAAAA nnnnnunuuunuunuuuuuuuuuaaalalalalaaaaaaaaaa II IIIIIIIn-n-n-nnn-nn-nnnnn StStStStStStStStttStttS atatatattatte eeeeee eee eeeeeee ee TuTTuTuTTuTuTuTuTuTuTTTuTuTuuitittititiii iioioioionnnnnn n nnn anannaaaaanaaaaaaaaa dddddddddddddd dddd FeFeFeFFeFFeFFeFeFeFeFeFeFeFeFeeeeseeeseseseseseseseeeseseeeese :::: : $5$5$5$55$ ,3,33,3,333333,333333333333393933939393939939939939999939999 (((((( ( ((((((( (((((202020202020202020202020202222222 11111111111111111111111--1111-1-1-1-1-1-1-1-- 2)2)2)2)22))))22)2)2))
AnAnAnnnAAnnnnnnAnnnnnnuununuununununnnunnuunn aala OOOOOOOOOOOOuuututututututuuutut-o-of-f-f-f-StStStSttStS atatttttatattttttteeeeeee e eee TuTuTTuTuTuuTuuTTuuTTuTuTTuuTuTTTuTTuuTTuTuuuT ititttiittititioioiooioioioion n n aaanaananananaaaaannnnnd d FeFeeeesesesesssesessseses:::::::: $1$1$1$$1$1$1$1$$1$1$$$$$$1$$$1$$$$$$1$1$1$1$$ 9999999999,9999999999,9,00020202022002002020020200020202020200020022000002222202202000020255555555555 5555 5 555555555 (((2(2(2(2(2(2(2(2(2001010111111-1-1-1-11-11-11 122212122222222222))))))))))))))))
AvAAAAAvererererererraaggggagagagagaaaagaggggee e eeee e AAnAnAnAnnununununnnnnn alalalalallllllllll HHHHHHHHH ououuusisisisiingngngng a aaaaaa anndnddddddndddddddnddndndnddd MMM MMMMMMMMMMMMMMM MM MMMMM Meaeaaaeaeaeaaeaaaeaeaeaaaeaeaeallllllll l llll PlPlPlPlPlPlPPPPPP ananan FFFFFFFFFFFFeeeeeeeeeeeeeeeeeeeees:s:s:s: $$$$ $$$$$$$$$$ $$ $$$$7,7,7,7,30330303 222 2 2 2 (2(2(222(22(222(2222(22222(( 0000001011010000 1-11111 1212121221222) )
FiFiFFFFFFFiFFiFiFFFiFiFiFinananananannanananannannncncncnccccccccccccnccciiiaiiiiiiiiaiall l AAiAiAiAiAiAiiAAiAAid:d:d:d:d:d:d:dd:ddd:d:dd MMMMMMM MMMMororee ththanan h hallllllllllla ffffffff f ofofofofofofofofoffo ss sss s sstutuuuttt dddddedededdeedd ntntntntttts s ss sss rerererererereeeeeeerer cccceceeeeeceeececceeeeecec iviviivivivvvvvvvivvivivvvivivivi eee eee eeeeeeeee fi fi fifi fi fi fifififififififififififi fi nnnnnanananann ncnciaial l aiaiiid,dd,d,d w w wwwwitiitititittittthhhhhhh hhhh hh h momomomomoomorerererererereeee t tthahahhahhhahahahahahahhhahh nn n 8555585858555 pp ppppppereerererereeee ccccececececccecececececeeentntntntntntntntntnnn ooo ooooffff fff stststttstudududududududududududududududdddudeneneneneeneneneeeneneneneneennnttttststststttststts’ ’’ fi fi finannn ncnccccccccciaaiaiaiaiaiai l ll neneeeneneneenenenen edededededededddded m m mmmmmmmmmmmmmmmmeteteteteet..
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
44 /// F E A R T H E D O G ///
Dr. Anne Ponder became the sixth Chancellor of the University of North Carolina at Asheville in October 2005. She began her tenure by leading a campuswide collaboration to create a dynamic and viable fi ve- to seven-year strategic plan and revised mission state-ment.
With this focus, UNC Asheville has made major strides as a national leader in the liberal arts and has become a one of the top choices for students seeking a rigorous and multi-faceted educational experience.
During her tenure, the university was chosen as the fi rst national headquarters for the Council of Public Liberal Arts Colleges and several majors in Religious Studies and Anthro-pology have been added to the curriculum. Dr. Ponder has encouraged innovative collabo-ration that resulted in a UNC-Chapel Hill satellite pharmacy education program. Building new partnerships with local governments, scientifi c agencies and non-profi t organizations have resulted in agreements with Mission Hospital Systems, the City of Asheville, the Re-naissance Computing Institute and others for enhanced learning and research opportuni-
ties for students and faculty. This emphasis on collaboration, one of Chancellor Ponder’s hallmark traits, also led to the cultivation, with other campus and community leaders, of some of the largest multi-million donations in the university’s history.
Chancellor Ponder oversaw the largest building projects in UNC Asheville’s history, including New Hall classroom building; Sam Millar Facilities Management Complex; Zeis Science and Multimedia Building; and the Wilma M. Sherrill Center, which houses the North Caro-lina Center for Health & Wellness and the Kimmel Arena. In each of these projects, environmental sustainability has been a key feature, as dictated by the university’s strategic plan. These green efforts – combined with count-less others across campus – have earned the university a host of awards, including repeated recognition as one of the lowest energy consuming agencies in the state.
A strong advocate for community service, Dr. Ponder is a member of the Mission Hospitals Audit Committee, the Asheville Community and Economic Development Alliance, the Children’s Welfare League and the WNC Community Foundation’s Women for Women. She also is a board member for the non-profi t Kendal Corporation.
Before becoming Chancellor at UNC Asheville, Dr. Ponder served for 10 years as president of Colby-Sawyer College, a private liberal arts col-lege in New Hampshire. Prior to that appointment, she held teaching and administrative posts at Elon College (now Elon University), Guilford Col-lege and Kenyon College.
Chancellor Ponder, who holds a doctorate in English from UNC-Cha-pel Hill, is a nationally known expert on institutional effectiveness, stra-tegic planning, and fundraising and resource development. She has been a frequent faculty member of Harvard University’s Institutes for Higher Education and wrote the chapter on strategic planning in the American Council on Education’s book “Leading America’s Branch Campuses.”
A native of Asheville, Chancellor Ponder is the daughter of the late Eleanor and Herschel Ponder, both of whom trace their Asheville family roots to the 1780s. She is married to award-winning writer and publisher Christopher Brookhouse.
DR. ANNE PONDERCHANCELLOR - UNC ASHEVILLE
/// UNC ASHEVILLE BULLDOGS ///
45/// F E A R T H E D O G ///
Janet R. Cone is in her ninth year as Director of Athletics at UNC Asheville. She also serves the school as Senior Administrator for University Enterprises. This past year was highlighted by the men’s basketball team’s winning the Big South Conference championship for the second year in a row. The Bulldogs set a school record for conference and overall wins. Asheville advanced to the NCAA Tournament where it nearly pulled off one of the greatest upsets in NCAA history when the 16th-seeded Bulldogs lost a close game to top-seeded Syracuse. In addition, the school successfully hosted the Big South Conference men’s basketball tournament with a national television audience and sellout crowd watching the championship game in the school’s brand-new Kimmel Arena. Cone oversaw the successful opening of the Wilma Sherrill Center which houses the Kimmel Arena. She worked to bring the top-ranked UNC Chapel Hill men’s basketball team to open Kimmel against the Bulldogs in a game that was nationally televised. That game was also sold out. The Sherrill Center had more than 100,000 visitors the past year as its hosted various events
from concerts to graduation.
Other successes included the men’s tennis team’s fi nishing in second place in the Big South Conference, its highest league fi nish ever, the volleyball team’s advancing to the semifi nals of the Big South Tournament for the eighth time in the last nine years, and the women’s tennis, men’s tennis and women’s track and fi eld teams being honored for their work in the classroom.
Cone guided the athletic department through a successful certifi cation process by the NCAA. In addition, she brought back women’s swimming as a varsity sport for the fi rst time in more than 35 years.
In the 2010-11 year, Cone saw the UNC Asheville men’s basketball team win the Big South Conference championship and advance to the second round of the NCAA Tournament. In addition, the Bulldog women’s indoor track and fi eld squad fi nished in third place, the highest fi nish in school history. Senior sprinter Natalie Pearson made her second appearance in the NCAA National Outdoor Track and Field meet.
Three years ago, Chancellor Anne Ponder appointed Cone to the position of Senior Administrator for University Enterprises. In this position, Cone oversees the Sherrill Center, manages specifi c community relationships and serves as a member of UNC Asheville’s major gifts team. She is a member of the Chancellor’s Senior Staff.
In 2009, Cone helped to create the Asheville Buncombe Regional Sports Commission to bring athletic events to the Asheville area. Her leadership helped secure the return of the Southern Conference men’s and women’s basketball tournament to Asheville in March 2012.
Student-Athletes have excelled in the classroom under Cone’s leadership. In 2004, she created the Athletic Director’s 3.0 + Club which recognizes student-athletes who make a 3.0 or better grade point average each semester. More than 900 student-athletes have made the club during Cone’s nine years, and in 2009-10, a record number of student-athletes earned that distinction.
During that same time period, more than 800 student-athletes have been named to the Big South Presidential Honor Roll, and in 2009-10 more than 60 percent of UNC Asheville’s student-athletes earned this impressive academic distinction.
Cone has overseen construction projects that have dramatically improved the facilities in which UNC Asheville’s Bulldog student-athletes compete and train. (1) The Wilma Sherrill Center/Kimmel Arena was completed in the spring of 2011. Funded partly through a $35 million state appropriation, Cone helped raise more than $ 7 million dollars in private funds to construct the Kimmel Arena, a major convocation space that will accommodate larger group events than the campus has been able to host before. Among other things, this will allow the university to host its own graduation, attract major speakers and performances, and have a new home for the men’s and women’s basketball teams. (2) Renovation and repairs to the Karl Straus Track began in the spring of 2009. Cone helped raised more than one million dollars in private funding for the track project. (3) Cone negotiated a partnership with Crowne Plaza Hotel and Resort for construction of a new Bulldog tennis facility which has indoor courts, composition courts and six hard courts that were completed in the fall of 2009. The facility has been the home of Bulldog men’s and women’s tennis for the past three seasons, and this past spring hosted the Big South Conference men’s and women’s tennis championships for the fi rst time in school history.
JANET R. CONEDIRECTOR OF ATHLETICS • SENIOR ADMINISTRATOR FOR UNIVERSITY ENTERPRISES
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
46 /// F E A R T H E D O G ///
Highlights of the 2007-08 year included the men’s basketball team being co-regular season champions of the Big South Conference and earning a bid to the National Invitational Tournament, making UNC Asheville the fi rst men’s basketball team in Big South history to receive a bid to the NIT. Cone helped the department successfully host the Big South Conference Men’s Basketball Tournament and Women’s Basketball Tournament in back-to-back weekends. In October of 2007, Cone was named the 2007 Division I-AAA Administrator of the Year by the National Association of Collegiate Women Athletic Administrators. Chancellor Anne Ponder was delighted to see Cone receive the award. “Janet Cone’s inspirational leadership has set a very high standard for our student-athletes and our coaches, all of whom continue to be winners both on and off the fi eld,” stated Ponder. “We are thrilled that she is being recognized in this way for her vision, her energy, and her tenacity, qualities our University benefi t from each and every day.”
In 2006-07, three different UNC Asheville teams won Big South Conference championships and advanced to the NCAA Tournament. In May 2006, the baseball team completed an amazing run with its fi rst ever championship and a trip to Clemson for the NCAA Regional. In the fall of 2006, the women’s soccer team became the fi rst women’s team in school history to qualify for the NCAA Tournament when the Bulldogs won the league title and earned a spot against topseed UNC Chapel Hill in the College Cup. In March 2007, the UNC Asheville women’s basketball team won its fi rst ever Big South Conference championship. Asheville advanced to the NCAA Tournament for the fi rst time where it took on Final Four-bound LSU.
The South Carolina native has promulgated a signifi cant increase in corporate sponsorships and Bulldog Athletic Association donations, critical to an organization that is not allowed to receive state funds of any kind. She has also overseen a new partnership with the Asheville City and Buncombe County Parks and Recreation Departments, an improved Athletics website, and the implementation of internet broadcasts and video-streaming for six different sports.
Cone has been tapped by the NCAA and the Big South Conference to serve on several key committees. In the Big South, she is on the committees for Budget, Compliance, Ad Hoc Committee on Publicity and Promotions, Baseball, Men’s and Women’s Basketball and Men’s Soccer and Tennis. In the spring of 2006, Cone was named to the NCAA Women’s Basketball Issues Committee. In September of 2008, she began a four-year term on the NCAA Division I Leadership Council. In July 2006, the Summerville, S.C. native was one of just 14 female athletic administrators to be picked by the NCAA/NACWAA to attend The Institute of Athletics Executives in Denver. In September 2008, she began a four-year term on the NCAA Division I Leadership Council.
Other highlights of Cone’s tenure include the development of a new Athletics Logo and a partnership with the Asheville City and Buncombe County Parks and Recreation Departments.
In the spring of 2006, she was named as an Outstanding Executive Manager by the Asheville-Buncombe Excellence in Public Service.
Cone is extremely active in the community, and in the summer of the 2006, she helped lead a group of community leaders to bring the Big South Conference Women’s Basketball Tournament to UNC Asheville’s Justice Center in 2007 and 2008. Cone also initiated the “Our Turn to Play” women’s luncheon for local business, civic, and community leaders the past two years. In addition, Cone was recognized as one of 10 Women to Know in Western North Carolina.
Cone came to Asheville from Samford University where she served as the fi rst head women’s basketball coach beginning in 1996. She coached the Bulldogs for fi ve seasons and, in 1999-2000, the team posted a 19-10 record. Cone was named Assistant Athletics Director before being promoted to Associate Athletics Director in 2003.
Prior to Samford, Cone served as the fi rst full-time Assistant Athletics Director, and the head women’s basketball and volleyball coach at Saint Leo University in Florida. She also directed basketball programs at Western Carolina University and Mars Hill College. Cone began her career as a teacher and coach in Gilbert, South Carolina. She coached against UNC Asheville eight times in her career and had a 5-3 record against the Bulldogs.
Cone was born and raised in Summerville, S.C. She was a four-year letterwinner on the basketball team and was an all-conference performer at Summerville HS for two years. Cone was inducted into that school’s Hall of Fame in 2007. She graduated magna cum laude from Furman University in 1978 and was named Physical Education Student of the Year while lettering in basketball and fi eld hockey as an undergraduate. While earning her Master’s from the University of South Carolina in 1986, she completed her studies with a perfect 4.0 grade point average.
A life-long learner, Cone is a 2003 graduate of the NACWAA/HERS Institute of Administrative Advancement. She is a member of NACDA, NACWAA, NCAA Division I-AAA Athletics Directors Association, Women’s Sports Foundation, and the Fellowship of Christian Athletes.
/// UNC ASHEVILLE BULLDOGS ///
47/// F E A R T H E D O G ///
TERRI BRNEASSOCIATE DIRECTOR OF ATHLETICS OF INTERNAL AFFAIRS SENIOR WOMEN’S ADMINISTRATOR
Terri Brne is in her seventh year of service to the UNC Asheville Athletics Department. She serves as Associate Director of Athletics for Internal Affairs and as Director of Compliance and Sport Oversight. She joined the UNC Asheville Athletic Department in the fall of 2006. In the summer of 2011, Terri became the school’s Senior Woman Administrator. Brne is responsible for the interpretation of rules by the NCAA and Big South Conference and is the department’s liaison with Admissions, Financial Aid, Registrar and the Big South Conference. She educates UNC Asheville’s student-athletes and staff on all of the NCAA rules and regulations. Brne serves as the Game Administrator for men’s and women’s basketball. Terri also oversees men’s and women’s soccer plus baseball and assists with men’s and women’s basketball. In addition, she works with the Big South Conference whenever UNC Asheville hosts a league tournament. This past year saw Brne help the athletic department pass its NCAA certifi cation and host both the men’s basketball and men’s and women’s tennis Big South tournaments. The Illinois native was an assistant basketball coach at both South Dakota and St. Andrews Presbyterian College. While at St. Andrews, she assisted in NCAA Compliance for all sports. Brne earned a Bachelor of Science degree in physical education from Illinois State. She earned her masters’s degree at Tarleton State in Exercise and Sports Studies and is currently completing a doctorate in Sports Administration.
MIKE GOREASSOCIATE DIRECTOR OF ATHLETICS FOR EXTERNAL AFFAIRS
Mike Gore is in his 27th year of service to the UNC Asheville Athletics Department. He currently serves the school as an Associate Athletics Director for External Affairs. In his post, Gore is the liaison with the media, handling all media-related activities concerning the athletic department. He also assists with game management and sport oversight. In 2004, Gore served as the school’s Interim Athletics Director for six months prior to the hiring of Janet Cone. He is the chairman of the school’s Athletics Department Hall of Fame and the Big South Conference Hall of Fame committee. The Buffalo native has been a longtime contributor to the Asheville Citizen-Times , Hendersonville Times-News and has written for Blue Ribbon Basketball Magazine. For the past 13 years, Gore has been the offi cial scorer for the Class A Asheville Tourists baseball team. In 2005, Gore was honored with the fi rst ever Mike Gore Bulldog Service Award at UNC Asheville’s Athletics Banquet. Gore is a 1984 graduate of Appalachian State University with a bachelor’s degree in communications. His wife Lisa is an Assistant District Attorney for the 28th Judicial District.
UNC ASHEVILLE SUPPORT STAFF
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
48 /// F E A R T H E D O G ///
Judith BohanBusiness Manager
James WestfallAssistant
Athletic Trainer, ATC
Harmon TurnerTicket Manager
Tim WhiteHead
Athletic Trainer, ATC
Lydee BenoitAssistant Volleyball
Coach
Mary CaseyAssistant Women’s
Soccer Coach
Dr. Herman HoltFaculty AthleticsRepresentative
Rebecca Nelms-KeilDirector of Student
Athlete Affairs
Erin Punter-SpenceDirector of Marketing
and Promotions
Matt PellegrinDirector of Athletics
Media Communications
ASHEVILLE SUPPORT STAFF
Eric LinnellAssistant
Athletic Trainer, ATC
Brett CareyAssistant Men’s
Basketball Coach
Aaron SandersDirector of Sherrill
Center
Joe Burnette Assistant Men’sSoccer Coach
Tom HandAssistant
Tennis Coach
Janell CraytonAssistant Women’s Basketball Coach
Russ GardinerAssistant Women’sBasketball Coach
Nick McDevittAssistant Men’s
Basketball Coach
Joel WilliamsAssistant Track & Field
Coach
Adam PuettAssistant Cross Country Coach
Honey BrownAssistant Women’sBasketball Coach
Donna PeekAdministrative
Assistant
Brady BurreshDirector of Facilities
Jim WallaceAssistant
Athletic Trainer, ATC
Omar AhmadHead Strength &
Conditioning Coach
/// UNC ASHEVILLE BULLDOGS ///
49/// F E A R T H E D O G ///
Brenda Mock KirkpatrickWomen’s Basketball
1st year as head coach
Michele DemkoWomen’s Soccer
3rd year as head coach
Matt KernMen’s Soccer
3rd year as head coach
Tom SmithBaseball
4th year as head coach
Jesse NormanCross Country/Track
6th year as head coach
Elizabeth LykinsWomen’s Swimming
1st year as head coach
Lise GregoryTennis
6th year as head coach
Eddie BiedenbachMen’s Basketball
17th Year as head coach
Frederico SantosVolleyball
2nd year as head coach
UNC ASHEVILLE HEAD COACHES
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
50 /// F E A R T H E D O G ///
Since UNC Asheville fi rst fi elded athletics teams in the 1930s (then known as Biltmore College), the bulldog has been its mascot. Early students chose the bulldog for its fi erce and tenacious reputation. In the decades that have followed, the bulldog has become a beloved symbol of our University.
In 1948, “Puck,” arrived on campus and began a tradition of live bulldog mascots that lasted into the 1980s. Puck, named after the character in Shakespeare’s A Midsummer Night’s Dream, was followed by Puck II and in the 1960s by Chug-a-lug. In the 1980s the campus welcomed Winston, named after British Prime Minister Winston Churchill, both for his bulldogged resolve as well as his appearance. Winston appeared for only a year and the tradition of a live mascot fell out of use. In 2009 thanks to a group of student organizers, UNC Asheville welcomed a new bulldog mascot to the University community. “Rocky I” made his fi rst public appearance at halftime of UNC Asheville’s homecoming basketball game on Feb. 21, 2009. Alumni couple, Alexis Johnson (’97) and Ed Johnson (’96), also a member of the math faculty, are his keepers.
The name “Rocky” was suggested by staff member Nancy Williams during a naming contest sponsored by the Athletics Department in 1995. Though the rumor has often been that the name came from Sylvester Stallone’s famous character, Rocky Balboa, which is based on the American prize fi ghter Rocky Marciano, the name was chosen because it means steadfast, much like the mountains that surround campus. Ironically, the name “Rocky,” which is of English origin, is a derivation of the name “Roch” (also Rocco and Roque) after St. Roch, the Patron Saint of Dogs.
In addition to the live bulldogs, the UNC Asheville mascot has also been depicted by an army of costumed students. Since the 1960s, students dressed as the bulldog have rallied the fans at thousands of games in support of Bulldog Athletics. The present incarnation of Rocky was introduced during the 2006-2007 season and is the fi rst to accurately refl ect the logo image of the bulldog used on signs and in print publications. That image, introduced during the 2004-05 season is the fi fth offi cial incarnation of the UNC Asheville bulldog logo.
In the late 1990s, the image of the bulldog, or “Rocky,” was immortalized in aluminum through a gift by the Class of 1998. Sculpted by Matt West (‘00) and modeled after a canine friend of the University, Pete “Bubba” McGill, the statue of Rocky stands in front of the Justice Center as a sentinel over campus. Careful observers will note a chipped tooth and a torn ear, signs of his ferocity. Despite his tough outward appearance, the statue of Rocky is beloved by fans. Continuing a tradition begun by the Class of 1998, each year, during convocation and commencement, freshman and seniors rub his head for good luck before going to the ceremonies. Seniors are also often spotted getting their picture made riding Rocky in the days leading up to graduation.
UNC Asheville is proud of its bulldog heritage. Today, Rocky, in all of his forms serves as a rallying point for fans far and wide.
1990-2003
2004-Present
ROCKY
/// UNC ASHEVILLE BULLDOGS ///
51/// F E A R T H E D O G ///
Important NCAA Terms
A prospective student-athlete is a student who has started classes for the ninth grade. In addition, a student who has not started classes for the ninth grade be-comes a prospective student-athlete if the institution provides such an individual (or the individual’s relatives or friends) any fi nancial assistance or other benefi ts that the institution does not provide to prospective students generally. An indi-vidual remains a prospective student-athlete until one of the following occurs (whichever is earlier):
(a) The individual offi cially registers and enrolls in a minimum full-time program of studies and attends classes in any term of a four-year collegiate institution’s regular academic year (excluding summer); or(b) The individual participates in a regular squad practice or competition at a four-year collegiate institution that occurs before the beginning of any term; or (Revised: 1/11/89, 1/10/90)(c) The individual offi cially registers and enrolls and attends classes during the summer prior to initial enrollment. (Adopted: 4/28/05, Revised: 1/17/09)
Contact: A contact is any face-to-face encounter between a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians and an institutional staff member or athletics representative during which any dialogue occurs in excess of an exchange of a greeting. Any such face-to-face encounter that is prearranged (e.g., staff member positions himself or herself in a location where contact is possible) or that takes place on the grounds of the prospective student-athlete’s educational institution or at the site of organized competition or practice involving the prospective student-athlete or the prospective student-athlete’s high school, preparatory school, two-year college or all-star team shall be considered a contact, regardless of whether any conversation occurs. How-ever, an institutional staff member or athletics representative who is approached by a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians at any location shall not use a contact, provided the encounter was not prearranged and the staff member or athletics representative does not engage in any dialogue in excess of a greeting and takes appropriate steps to immediately terminate the encounter.
Contact Period: A contact period is that period of time when it is permissible for authorized athletics department staff members to make in-person, off-campus recruiting contacts and evaluations.
Evaluation: Evaluation is any off-campus activity designed to assess the academic qualifi ca-tions or athletics ability of a prospective student-athlete, including any visit to a prospective student-athlete’s educational institution (during which no contact occurs) or the observation of a prospective student-athlete participating in any practice or competition at any site.
Evaluation Period:An evaluation period is a period of time when it is permissible for authorized ath-letics department staff members to be involved in off-campus activities designed to assess the academic qualifi cations and playing ability of prospective student-athletes. No in-person, off-campus recruiting contacts shall be made with the prospective student-athlete during an evaluation period.
Quiet Period: A quiet period is a period of time when it is permissible to make in-person recruiting contacts only on the institution’s campus. No in-person, off-campus recruiting contacts or evaluations may be made during the quiet period.
Dead period: A dead period is a period of time when it is not permissible to make in-person recruiting contacts or evaluations on or off the institution’s campus or to per-mit offi cial or unoffi cial visits by prospective student-athletes to the institution’s campus. The provision of complimentary admissions to a prospective student-athlete during a dead period is prohibited, except as provided in Bylaw 13.7.2.5 for a prospective student-athlete who visits an institution as part of a group. During a dead period, a coaching staff member may not serve as a speaker at or attend a meeting or banquet at which prospective student-athletes are in at-tendance, except as provided in Bylaw 13.1.8.1, and may not visit a prospective student-athlete’s educational institution. It remains permissible, however, for an institutional staff member to write or telephone a prospective student-athlete during a dead period.
Initial Eligibility: A student-athlete who enrolls in a member institution as an entering freshman with no previous full-time college attendance shall meet specifi c NCAA academic requirements, as certifi ed by the NCAA Eligibility Center, as approved by the Executive Committee, and any applicable institutional and conference regulations, to be considered a qualifi er and thus be eligible for fi nancial aid, practice and competition during the fi rst academic year in residence. For further information please visit, www.eligibilitycenter.org.
Frequently Asked Questions
What is the National Letter of Intent (NLI)?The NLI is a contract between a prospect and an institution. By signing a NLI, a prospect agrees to attend UNC Asheville for at least one academic year. In exchange, UNC Asheville must provide athletic fi nancial aid for one academic year. The NLI early signing period for Basketball, Baseball, Tennis and Volleyball is November 10-17, 2010. The regular signing period for Basketball is April 13 - May 18, 2011. The regular signing period for Baseball, Tennis and Volleyball is April 13- August 1, 2011. The NLI signing period for Soccer and Track is February 2-August 1, 2011. The NLI regular signing period for all other sports is April 13-August 1 2011. For more information, visit the NLI website: http://www.ncaa.org/wps/wcm/connect/nli/nli.
What is the difference between an offi cial visit and unoffi cial visit?After opening day of classes of the prospect’s senior year, the prospect may take fi ve offi cial visits to different Division I or II schools. Before the visit, the prospect must present a high school transcript, proof of SAT, ACT, PACT, PSAT test to UNC Asheville, register with the NCAA Eligibility Center, and be placed on the Institution’s IRL. An offi cial visit may not occur if the prospect is not registered with the NCAA Eligibility Center. Offi cial visits are paid in part and extended by UNC Asheville coaches only. All visits must be comparable to normal student life.
Prospects may make unlimited number of unoffi cial visits and may visit UNC Asheville anytime except during a dead period. Prospects are solely responsible for all expenses of unoffi cial visits. However, prospects may receive three com-plimentary admissions to any home athletic contest, excluding Big South Confer-ence Post Season Tournaments.
What is the NCAA Eligibility Center?It is the agency that certifi es both a prospect’s academic and amateur eligibility for Division I and II. A prospect should register with the NCAA Eligibility Center at the beginning of their senior year in high school. Visit the NCAA Eligibility Center website for registration information.
This is a brief summary of regulations which outlines the basic recruiting rules to help prospective student-athletes and parents better understand the recruiting process. UNC Asheville is committed to recruiting and conducting its athletics program with the highest level of integrity. If you have any questions about NCAA rules, please contact Terri Brne, Associate Athletics Director, at 828-251-6930.
THE NCAA
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
52 /// F E A R T H E D O G ///
For over 30 years, the Bulldog Athletics Association has been the athletics scholarship fundraising arm of the UNC Asheville Athletics Department, but in its simplest terms, the Bulldog Athletics Club is YOU. Construction workers, doctors, teachers, lawyers, bankers, manufacturers, brokers, and technicians who are friends, fans, alumni, and countless combinations of others from Asheville, Weaverville, Arden, Hendersonville, …and places all over North Carolina, the United States, and the world. They all have one thing in common—a passion for Bulldog Athletics. While we have high expectations for conference and NCAA competition, we also have high expectations for outstanding graduation rates, personal growth, and community involvement. As a member of the Bulldog Athletics Association, you become a critical part of a successful athletics program with a tradition of developing a student-athlete. We must raise funds not only to increase the amount of scholarship money we can offer but also to offset the rising costs of a college education. The confi dence of knowing your investment will be maximized is one reason supporting UNC Asheville Bulldog Athletics is a great investment. UNC Asheville Athletics receives no state funding for scholarships, so 100 percent of your gift will enable UNC Asheville to recruit and retain student-athletes who will succeed in the classroom, athletics arena, and the community – following our motto:
Champions in Athletics, Leaders in Life.
For more information about the Bulldog Athletics Association, please contact us:UNC Asheville Athletics
Justice Center, CPO #2600One University Heights
Asheville, NC 28804Phone: (828) 251-6459
Fax: (828) 251-6386www.uncabulldogs.com
“UNC Asheville is a point of pride for this community, as an alumnus and business owner. We are proud to support the athletics department and student-athletes as they represent our community and bring attention to WNC.”
--Rich Davis ’93, Jan Davis Tire Store
“The athletics scholarship I received from UNC Asheville allowed me to focus solely on my academics and soccer, without being concerned about how to pay for school. I donate to the Bulldog Athletics Club now so that current and future student-athletes can enjoy the same experience I did. Being a student-athlete at UNC Asheville was one of the best experiences of my life and the values and lessons I learned have helped me in my professional career and my personal life. Go Bulldogs!”
--Pat Britz ’90; former men’s soccer player
BULLDOG ATHLETICS ASSOCIATION
2012 SCHEDULE2012 SCHEDULE Aug. 08 @ Charlotte 2 p.m. Aug. 17 @ Eastern Kentucky 5 p.m. Aug. 19 ETSU 1 p.m. Aug. 26 @ UNCG 2 p.m. Aug. 30 @ USC Upstate 7 p.m. Sept. 02 ALBANY Noon Sept. 06 @ Furman 7 p.m. Sept. 09 WOFFORD Noon Sept. 14 APPALACHIAN STATE 4 p.m. Sept. 20 @ Longwood* 7 p.m. Sept. 22 @ Liberty* 2 p.m. Sept. 27 VMI* 3 p.m. Sept. 29 RADFORD* 2:30 p.m. Oct. 04 @ Campbell* 7 p.m. Oct. 06 @ High Point* 1 p.m. Oct. 11 COASTAL CAROLINA* 3 p.m. Oct. 13 @ Charleston Southern* 11 a.m. Oct. 18 GARDNER-WEBB* 3 p.m. Oct. 20 WINTHROP* Noon Oct. 23 @ Presbyterian College 7 p.m. ALL CAPS - HOME GAMES * - BIG SOUTH CONFERENCE GAME ALL TIMES EASTERN
Recommended