Citation preview
The rediscovery of Schaefer’s Spine-jawed Snake (Xenophidion
schaeferi Günther & Manthey, 1995) (Serpentes, Xenophidiidae)
from Peninsular Malaysia with notes on its variation and the first
record of the genus from Sumatra, IndonesiaZootaxa 4441 (2):
366–378
http://www.mapress.com/j/zt/ Article
Günther & Manthey, 1995) (Serpentes, Xenophidiidae) from
Peninsular Malay-
sia with notes on its variation and the first record of the genus
from Sumatra,
Indonesia
EVAN S.H. QUAH1,8, L. LEE GRISMER2, THOM JETTEN3, PERRY L. WOOD,
Jr.4, AURÉLIEN MIRALLES5,
SHAHRUL ANUAR MOHD SAH1, KURT H.P. GUEK6 & MATTHEW L.
BRADY7
1School of Biological Sciences, Universiti Sains Malaysia, 11800
Minden, Penang, Malaysia.
E-mails: evanquah@yahoo.com, evanquah@usm.my, sanuar@usm.my
2Herpetology Laboratory, Department of Biology, La Sierra
University, 4500 Riverwalk Parkway, Riverside, California 92515
USA.
E-mail: lgrismer@lasierra.edu, 3Biotic Eco-Tech, G-53, Plaza Ampang
Jaya, Jalan Mewah 3, 68000 Ampang, Kuala Lumpur, Malaysia.
E-mail: Biotic-ecoTech@outlook.com 4Department of Ecology and
Evolutionary Biology and Biodiversity Institute, University of
Kansas, Dyche Hall, 1345 Jayhawk Blvd,
Lawrence, Kansas 66045-7561, USA. E-mail: perry.wood@ku.edu
5Institut Systématique, Evolution, Biodiversité (ISYEB)—UMR 7205,
Muséum national d'Histoire naturelle, 25 rue Cuvier, CP 30,
75005 Paris, France. E-mail: miralles.skink@gmail.com 625, Jalan
22/38A, Taman Sri Sinar, 51200 Kuala Lumpur, Malaysia. E-mail:
orionmystery@gmail.com 7LSU Museum of Natural Science, 119 Foster
Hall, Louisiana State University, Baton Rouge, Louisiana 70803,
USA.
E-mail: mbrady3@lsu.edu 8Corresponding author
Abstract
The family Xenophidiidae is an extremely rare and little-known
family of snakes that contains only two species, Xeno-
phidion acanthognathus Günther & Manthey and X. schaeferi
Günther & Manthey that are each known only from their
holotypes. We report on the rediscovery of X. schaeferi from two
new locations in southern Peninsular Malaysia. The new
specimens differ markedly from the holotype of X. schaeferi in
colour pattern and are more akin to the patterning of X.
acanthognathus from Borneo. However, molecular analyses of one of
the new specimens reveal that it only differs from
the holotype of X. schaeferi by a minimum sequence divergence of
0.27%. An expanded description of the species based
on these specimens is provided and phenotypic variation within the
species is discussed. We also report the first record of
the genus Xenophidion from West Sumatra, Indonesia. These
sensational discoveries continue to underscore the fact that
southern Peninsular Malaysia and upland areas of Southeast Asia in
general still harbour unrealized herpetological diver-
sity and are still in need of field research-based taxonomic
studies.
Key words: Reptile, Squamata, Southeast Asia, Sundaland, endemic,
biodiversity, taxonomy
Introduction
The family Xenophidiidae contains two extremely rare species,
Xenophidion acanthognathus Günther & Manthey from Borneo and X.
schaeferi Günther & Manthey from Peninsular Malaysia, each
known only from their holotypes (Günther & Manthey 1995;
Stuebing et al. 2014). Very little is known about their ecology but
they are believed to be semi-fossorial snakes known to shelter
beneath layers of moss covering rocks. Both species occur in
lowland forests up to approximately 600 m in elevation (Günther
& Manthey 1995; Stuebing et al. 2014). They get their common
name, Spine-jawed Snakes from a large pair of spiny projections of
the palatine bones that diagnose the family. This, together with
the presence of the large tooth in the anterior portion of each
lower jaw, suggests they specialise in feeding on slippery prey or
those with smooth, hard scales (Günther & Manthey 1995;
Stuebing
366 Accepted by T. Nguyen: 16 May 2018; published: 27 Jun.
2018
et al. 2014). These snakes are of great interest to herpetologists
who have long worked to resolve the position of their family in
higher level snake phylogenies (Wallach & Günther 1998; Lawson
et al. 2004).
Two recently collected snake from southern Peninsular Malaysia at
Lata Kijang, Jelebu, in the state of Negeri Sembilan and Semenyih,
in the state of Selangor were determined to belonged to the genus
Xenophidion owing to them having a combination of character states
(Günther & Manthey 1995) including the absence of premaxillary
teeth; the presence of small, numerous, approximately equal-sized,
aglyphous, weakly recurved palatine, pterygoid, and maxillary
teeth; maxillae bearing a long, tapering palatine processes
(Processus praefrontales), and a broad, long and thin ectopterygoid
processes (Processus pterygoideus); ectopterygoids extending nearly
to the middle of the maxillae and almost completely adhering to
them; dentary with a bent anterior end and significantly enlarged
caniniform tooth; undivided nasals extending ventrally from the
midline of the rostrum to near the opening of the mouth;
internasals absent, probably fused with prefrontals or nasals;
prefrontals greatly enlarged, forming the largest scales on the top
of the head; all dorsal head shields extending to the three
bordering the prefrontals posteriorly approximately the same modest
size, the three bordering the prefrontals are enlarged and possibly
fused with the preoculars and the frontal (or parts of it);
numerous sensory papillae located on most head shields and
especially on the labial scales; loreals absent; suboculars absent;
dorsal scales keeled with rounded tips; ventrals narrow; anal plate
single; and subcaudals undivided. Initially, the identity of these
specimens were uncertain as they were similar in colour pattern to
X. acanthognathus and in squamation to X. schaeferi. A tissue
sample of the specimen from Lata Kijang was sequenced and included
in the dataset of Lawson et al. (2004) and subsequently identified
as X. schaeferi. We also identify the specimen from Semenyih as X.
schaeferi based on its similarities in pholidosis and colour
pattern to the specimen from Lata Kijang. Here we expand the
description of this rare species based on these additional material
and discuss its variation and natural history.
Another Xenophidion was recently photographed at Mount Talakmau,
West Sumatra, Indonesia and determined here to belong to the genus
Xenophidion based on having undivided nasals; no internasals;
greatly enlarged prefrontals forming the largest scales on the top
of the head; other dorsal head scales up to the three bordering the
prefrontals posteriorly approximately the same modest size, the
latter, which are enlarged and possibly fused with the preoculars
and the frontal (or parts of it); no loreal or suboculars; dorsal
scales with rounded tips; narrow ventrals; anal plate single; and
subcaudals undivided (Fig. 4). This is the first record of the
genus from Sumatra and the biogeographic significance of this
discovery is discussed.
Material and methods
Material examined. Adult male (LSUHC 13481) obtained by Thom Jetten
from native collectors that found it on 22 August 2017 near Lata
Kijang, Jelebu, Negeri Sembilan, Peninsular Malaysia (N 3.200581, E
101.986279; approximately 800 m in elevation); Adult male (USMHC
2389) found by Kurt Hock Ping Guek on 20 April 2018 at Semenyih,
Selangor, Peninsular Malaysia (N 3.058051, E 101.872747;
approximately 87 m in elevation); Specimen of unknown sex (LSUDPC
10755–58) that was photographed by Matthew L. Brady and Oscar
Johnson on 17 March 2018 at Mount Talakmau, West Pasaman Regency,
West Sumatra Province, Indonesia (N 0.0973, E 99.9480;
approximately 1075 m in elevation).
Morphological analysis. Morphological and colour pattern data were
taken and compared with data reported for the holotypes of X.
acanthognathus and X. schaeferi (Günther & Manthey 1995: Table
1). Scale counts and scale nomenclature follow Günther &
Manthey (1995). All body measurements were made to the nearest
millimeter. The number of ventral scales were counted according to
Dowling (1951). The terminal scute (cloacal plate) was not included
in the number of ventrals. Dorsal scale row counts are given at one
head length behind the head, at mid-body (i.e., at the level of the
ventral scale corresponding to one-half of the total number of
ventrals), and at one head length anterior to the vent. We
considered infralabials as those scales that had more than one-half
their length below a supralabial. The values for paired head scales
are listed in left/right order. Character abbreviations are adapted
from Grismer et al. (2014a) and Günther & Manthey (1995) and
include SVL–Snout- vent length (mm), TaL–tail length (mm), TL–total
length (mm), ADSR–dorsal scale rows at neck, MDSR–dorsal scale rows
at mid-body, PDSR–dorsal scale rows before vent, VEN–number of
ventral plates, SubC–number of subcaudal scales, cloacal plate
single or divided, L–presence of loreal scales, SL–number of
supralabials, SL/Eye– numbers of supralabials entering the orbit,
Larg SL–largest supralabial, IL–number of infralabials, IL/1st chin
shield–number of infralabials in contact with the anterior chin
shield, PreOc–number of preoculars, PostOc–
Zootaxa 4441 (2) © 2018 Magnolia Press · 367XENOPHIDION SCHAEFERI
AND FIRST RECORD OF THE GENUS FROM SUMATRA
number of postoculars, SuprOc–number of supraoculars. The museum
abbreviations LSUHC refers to La Sierra University Herpetological
Collection, La Sierra University, Riverside, California, USA; USMHC
refers to Universiti Sains Malaysia Herpetological Collection; and
LSUDPC refers to La Sierra University Digital Photographic
Collection.
TABLE 1. Comparison of the scalation and colour pattern in the
holotypes of X. acanthognathus, X. schaeferi and the
newly collected X. schaeferi specimens (LSUHC 13481 and USMHC 2389)
*data obtained from Günther & Manthey
1995, – no data available. Abbreviations are listed in the
Materials and Methods.
Molecular analysis. Sequence data from a 1116 base pair fragment of
the cytochrome b gene (cyt b) was obtained from Xenophidion
schaeferi (LSUHC 13481). The new sequence used in this study is
deposited in GenBank (Accession number MH172020).
Mitochondrial DNA was isolated from liver tissue stored in 95%
ethanol and extracted using using the Maxwell® RSC Tissue DNA kit
on a Promega Maxwell® RSC extraction robot. The cyt b gene was
amplified using a double stranded Polymerase Chain Reaction (PCR)
under the following conditions: 1.0 µl genomic DNA (concentration
10–30 µg of DNA), 1.0 µl light strand primer (concentration 10 µM)
HI4910 5’– GACCTGTGATMTGAAAAACCAYC–3’ (Burbrink 2000), 1.0 µl heavy
strand primer (concentration 10 µM) H15720
5’–TCTGGTTTAATGTGTTGTGGT–3’ (Burbrink 2000), 1.0 μl deoxynucleotide
pairs (1.5 μM), 2.0 μl 5x buffer (1.5 μM), 1.0 MgCl 10x buffer (1.5
μM), 0.1 μl Promega Taq polymerase (5u/μl), and 7.4 μl H2O. PCR
reactions were completed using a Bio-Rad gradient thermocycler
under the following conditions: initial denaturation at 95°C for 2
min, second denaturation at 95°C for 35 s, annealing at 49°C for 35
s followed by an extension cycle at 72°C for 95 s + 4 s per cycle
for 34 cycles. PCR products were visualized using gel
electrophoresis using a 1.0% agarose gel. PCR products that had a
distinct band with the correct molecular weight
Characteristics Xenophidion
ADSR 19 – 20 21
PDSR 19 – 18 20
Nasal Undivided Undivided Undivided Undivided
Internasals Absent Absent Absent Absent
SL 8/8 8/8 8/9 8/8
Larg SL 1 & 2/ 1 & 2 1 & 2/ 1 & 2 3/2 2/2
SL/Eye 3–4/3–4 3–4/3–4 3–4/3–5 3–4/3–4
IL 8 or 9 8/8 9/9 8/8
IL/1st chin shield 2/2 2/2 2/2 2/2
PreOc (no.) Present (1/1) Present (1/1) Present (1/1) Present
(1/1)
PostOc (no.) Present (2/2) Present (2/2) Present (2/2) Present
(2/2)
SuprOc (no.) Present (1/1) Present (1/1) Present (1/1) Present
(1/1)
SVL 276 mm 218 mm 239 mm 211 mm
TaL 61 mm 45 mm 51 mm 44mm
TL 337 mm 263 mm 290 mm 255 mm
SVL/TaL 4.52 4.84 4.69 4.79
Yellowish-white
QUAH ET AL. 368 · Zootaxa 4441 (2) © 2018 Magnolia Press
based on the standardized ladder were submitted to GENEWIZ® for PCR
purification, cycle sequencing, sequencing clean up, and
sequencing. Sequences were analysed from both the 3’ and 5’ ends
independently to ensure congruence between the sequences. Both the
forward and the reverse sequences were assembled and edited
in GeneiousTM version v6.1.8 (Kearse et al. 2012). We used the
BLASTn suite from BLAST® version 2.7.1 (Zhang et al. 2000; Morgulis
et al. 2008) to query the nucleotide database to infer what species
LSUHC 13481 was genetically related. PAUP* (version 4.0a build 159)
was used to calculate uncorrected p-distances.
Results
The results of the nucleotide blast demonstrate that the new sample
LSUHC 13481 has an E-value of 0.0 and 99% sequence identity with X.
schaeferi (ZMB 50534, AY574279) indicating its conspecificity with
ZMB 50534. Molecular analyses also indicate that specimen LSUHC
13481 is conspecific with X. schaeferi with BPP and ML bootstrap
values of 1.0 and 100 respectively. In addition, it only differs
from the holotype of X. schaeferi by an uncorrected pairwise
sequence divergence of 0.27%. The most recently collected specimen,
USMHC 2389 is similar in pholidosis and colour pattern with LSUHC
13481 and is considered conspecific (Table 1; Fig. 1). Both new
records represent range extensions for the species in Peninsular
Malaysia of approximately 40 km to the south and southeast of the
type locality. A description of the new specimens is presented
below.
The specimen photographed in Sumatra was also determined to belong
to the genus Xenophidion based on its combination of characters and
we refer to it here as Xenophidian sp. until morphological and
molecular examinations can take place.
Description of LSUHC 13481 (Figs. 1 & 2). Head small relative
to body, distinct from neck, wedge-shaped in lateral profile with
concavity between the eye; eyes small, dorsolaterally oriented,
pupils round; snout short and rounded in dorsal profile, rostrum
tapers downwards; rostral scale triangular, broader than tall,
visible from above; nasals undivided, extending from middle of
snout above to nearly the mouth opening below, nares in the distal
corners; internasal absent (probably fused with prefrontals or
nasals); loreal absent; preocular 1/1, large, extending
dorsally on each side contacting prefrontal, frontal, supraocular,
one head scale, 2nd & 3rd supralabial and eye; supraocular 1/1,
small; postoculars 2/2, upper smaller than lower; prefrontals two,
very large, longer than wide, in broad contact with each other,
frontal, preoculars, posterior tip of nasals, and supralabials 1
and 2/1–3; frontal hexagonal, small, less than 0.5 times size of
preoculars and less than 0.25 times size of prefrontals;
supralabials 8/ 9, largest supralabials 3/2, supralabial entering
orbit 3 and 4/3–5; mental groove present; infralabials 9/9, first
two in contact with anterior pair of chin shields; body laterally
compressed, gradually increasing in circumference from behind neck,
reaching its maximum circumference at midbody; dorsal scales
keeled, imbricate, 20 ADSR, 21 MDSR, 18 PDSR; 176 ventrals; cloacal
plate undivided; and 45 unpaired subcaudal scales. Body long,
slender; tail short, tapered; SVL 239 mm; TaL 51mm; TL 290mm.
Colouration in life. LSUHC 13481 (Fig 1A & B): The top of the
head is uniform dark-brown with lighter, orange-brown speckling and
spots on the rostral, nasal, prefrontals, frontal, preoculars,
supraoculars, postoculars, supralabials and other dorsal scales
covering the head and neck. Some of the small, light-brown speckles
merge to form a faint postocular stripe. The iris is orange.
Beginning just posterior to the nape is a light, elongate, yellow-
white patch on approximately dorsal scale rows 4–18, approximately
five times longer than the head. Within the light-coloured, neck
patch are dark speckles along the midline that are more prominent
anteriorly. The base colouration of rest the dorsum is grey and is
darker along the vertebral scale rows, fading to a lighter
silver-grey along the flanks. An irregular, dark-grey, zig-zag
stripe runs along the vertebral column starting from the posterior
end of the yellow-white neck patch to the tail and it breaks into
blotches along the posterior end of the body and tail. Along the
upper section of the flanks is a row of large more-or-less
rectangular shaped dark-grey markings forming the lower borders of
the nape patch and extends to midway down the tail. The bottom
edges of some of these markings coalesce to form a series of
confluent blotches. Together with the dark, zig-zag, vertebral
stripe, these rectangular blotches form two light-coloured,
irregularly shaped zig-zag stripes that extend along the length of
the body to the tail that are formed by the constriction of the
lighter base colour of the dorsum. On the lower flanks, is a row of
smaller blotches that tend to alternate with the larger rectangular
shaped blotches above and form a chequered pattern along the lower
flanks. The infralabials, chin and throat are grey, the ventrals
are whitish and marked or chequered with dark-grey, squarish
blotches that are either alternate with each other laterally or are
confluent to form a single series of ventral markings. Each dark
blotch or band is 2–6 ventral scales wide and
Zootaxa 4441 (2) © 2018 Magnolia Press · 369XENOPHIDION SCHAEFERI
AND FIRST RECORD OF THE GENUS FROM SUMATRA
separated from each other by another 1–4 ventral scales. The dark
ventral markings also extend on to the first row of dorsal scales
and may merge with the lower row of small blotches on the lower
flanks.
LSUDPC 10755–58 (Fig. 4): The top of the head is uniform dark-grey
with lighter, whitish speckling and spots on the rostral, nasal,
prefrontals, frontal, preoculars, supraoculars, postoculars,
supralabials and other dorsal scales covering the head and neck.
Some of the small, light speckles merge to form a faint postocular
stripe. The iris is grey. The base colouration of the dorsum is
dark-grey and is darker along the vertebral scale rows, fading to a
lighter grey along the flanks. An irregular, broad, whitish,
zig-zag stripe runs along the vertebral column starting from the
nape to the tail and it breaks into blotches along the posterior
end of the tail. In the middle of the whitish zig-zag stripe runs a
dark-grey zig-zag stripe that breaks up into more-or-less
rhomboidal markings along the back. Along the upper section of the
flanks is a row of large more-or-less rectangular shaped dark-grey
markings starting from the neck to the tail. On the lower flanks,
is a row of smaller dark-grey blotches that tend to alternate with
the larger rectangular shaped blotches above and form a chequered
pattern along the lower flanks. The ventral are whitish and marked
with dark-grey, squarish blotches that are either alternate with
each other laterally to form a chequered pattern or are confluent
to form bands across the venter. A series of dark spots on the
middle of each ventral scale form a broken stripe down the middle
of the venter and most ventrals are speckled with a few smaller
spots along the edges. The dark ventral markings may also extend on
to the first row of dorsal scales and merge with the lower row of
small blotches on the lower flanks. The infralabials, chin and
throat are grey.
Natural history. The Peninsular Malaysian specimens LSUHC 13481 and
USMHC 2389 were found at approximately 2100 hours and 2045 hours
respectively. Both specimens were found crawling on the ground
between the leaf litter in the forest. It had just rained for
approximately 30 mins prior to specimen USMHC 2389 being found and
conditions were similarly very wet where LSUHC 13481 was found from
rain the days before. In addition, USMHC 2389 was found
approximately 15 m from a stream and the snake sprung forward
repeatedly to try and escape when found, similar to the behaviour
observed in Pseudorabdion longiceps (Kurt H.P. Guek pers. obs.;
Baker & Lim 2008). The Sumatran specimen was observed at 2045
hours crawling on the ground (Fig. 4A) in slightly disturbed,
primary rainforest approximately 15–20 m from a rocky, flowing
stream (Matthew L. Brady pers. obs.).
Variation and comparison (Figs. 1–4). Specimen USMHC 2389 closely
resembles LSUHC 13481 in overall external morphology, colouration,
and patterning (Table 1; Fig. 1). It differs from LSUHC 13481 only
by its higher number of anterior (21 vs. 20), mid-body (23 vs. 21)
and posterior (20 vs. 18) dorsal rows, lower number of infralabials
(8 vs. 9) and a smaller yellowish-white neck patch (3X head length
vs. 5X head length).
The most notable difference in the new X. schaeferi specimens
(LSUHC 13481 and USMHC 2389) compared to the holotype is their
colour pattern. The holotype of X. schaeferi was reported as having
a brown base colouration with a solid, dark-brown vertebral stripe
beginning on the nape to the posterior end of the body that breaks
up into spots on the tail. The vertebral stripe is bordered by
wide, yellowish white stripes with wavy borders. Along the flanks
are dark-brown lateral markings with triangular points derived from
a basal stripe while the ventrals are dark-brown, and at a regular
interval series of one to four successive ventrals, their borders
display white spots (Günther & Manthey 1995; Fig. 2C). The new
specimens LSUHC 13481 and USMHC 2389 have an elongate, yellow-white
patch on the neck; an irregular, discontinuous, dark-grey, zig-zag
stripe running along the vertebral column starting behind the
light-coloured neck patch and extending to the tail; a row of
rectangular dark- grey blotches along the flanks; and the ventrals
are chequered (see detailed description in section on colouration
in life). In addition to colour pattern, LSUHC 13481 differs from
the holotype of X. schaeferi by having a lower number of mid-body
dorsal scale rows (21 vs. 23), lower number of ventrals (176 vs.
178), higher number of subcaudals (45 vs. 43), higher number of
infralabials (9 vs. 8) and the largest supralabials being the 2nd
& 3rd vs. 1st
& 2nd. From X. acanthognathus which it resembles in colour
pattern, LSUHC 13481 differs in its lower number of mid-body dorsal
scale rows (21 vs. 23), lower number of ventrals (176 vs. 181),
lower number of subcaudals (45 vs. 51), the largest supralabials
being the 2nd & 3rd versus the 1st & 2nd and a larger
yellowish-white neck patch (5X head length vs. 3X head length)
(Günther & Manthey 1995). USMHC 2389 is more similar in
pholidosis with the holotype of X. schaeferi than LSUHC 13481 and
only differs from it in having a lower number of ventrals (176 vs.
178) and higher number of subcaudals (45 vs. 43). From X.
acanthognathus which it resembles in colour pattern, USMHC 2389
differs by its lower number of ventrals (176 vs. 181), lower number
of subcaudals (45 vs. 51) and the higher number of anterior (21 vs.
19) and posterior (20 vs. 19) dorsal scale rows (Günther &
Manthey 1995). Other distinguishing characters between LSUHC 13481,
USMHC 2389 and the holotypes of X. acanthognathus
and X. schaeferi are presented in Table 1.
QUAH ET AL. 370 · Zootaxa 4441 (2) © 2018 Magnolia Press
FIGURE 1. (A) Dorsum of Xenophidion schaeferi (LSUHC 13481) from
Lata Kijang, Negeri Sembilan. (B) Venter of X.
schaeferi (LSUHC 13481) from Lata Kijang, Negeri Sembilan.
Photographs by Evan Quah. (C) Dorsum of X. schaeferi
(USMHC 2389) from Semenyih, Selangor. Photograph by Kurt H.P.
Guek.
Zootaxa 4441 (2) © 2018 Magnolia Press · 371XENOPHIDION SCHAEFERI
AND FIRST RECORD OF THE GENUS FROM SUMATRA
FIGURE 2. (A & B) Number of supralabials and other head scales
on X. schaeferi (LSUHC 13481), A: The right side of the
head. B: The left side of the head. F = frontal; IL = infralabial;
N = nasal; PF = prefrontal; PO = postocular; PrO = preocular;
R
= rostral; SL = supralabial; SO = supraocular. Photographs by Evan
Quah. (C) Holotype of X. schaeferi (ZMB 50534) from
near Templer’s Park, Selangor. Photograph courtesy of Wolfgang
Grossmann.
QUAH ET AL. 372 · Zootaxa 4441 (2) © 2018 Magnolia Press
FIGURE 3. (A) Xenophidion acanthognathus found in-situ crawling
across a fallen log at night at Lambir Hills National Park,
Sarawak. (B) Full body shot of the Xenophidion acanthognathus. (C)
Close-up of the head of Xenophidion acanthognathus. All
photographs courtesy of Neil Rowntree.
Zootaxa 4441 (2) © 2018 Magnolia Press · 373XENOPHIDION SCHAEFERI
AND FIRST RECORD OF THE GENUS FROM SUMATRA
FIGURE 4. (A) Dorsum of Xenophidion sp. from Mount Talakmau, West
Sumatra. Photograph by Matthew L. Brady. (B)
Close-up of the head and (C) Venter of Xenophidion sp. from Mount
Talakmau, West Sumatra. Photographs courtesy of Oscar
Johnson.
Based solely off colour pattern, the Sumatran specimen appears
somewhat similar to LSUHC 13481, USMHC 2389 and X. acanthognathus
minus the white or yellow patch on the neck. It differs from the
holotype of X.
schaeferi by its dorsal pattern (more-or-less chequered vs.
striped) and ventral pattern (chequered or banded vs. dark-brown
with white spots on their borders) (Günther & Manthey 1995).
However, as noted in this study, the colour pattern can be very
variable in X. schaeferi despite the specimens being genetically
similar. Thus, we reiterate that pending the acquisition of a
voucher material for detailed examination and molecular comparison,
we refer to the Sumatran population as Xenophidian sp..
Discussion
Xenophidion species are extremely rare and have only been observed
three times prior to this and the Bornean X.
acanthognathus has only recently been photographed alive (Fig. 3)
(Rowntree et al. 2017). Thus, the rediscovery of X. schaeferi and
the first record of the genus from Sumatra is especially exciting.
The new localities of these X.
schaeferi specimens from Lata Kijang, Jelebu, Negeri Sembilan and
Semenyih, Selangor extends the range of this species by
approximately 40 km to the southeast and south respectively from
the type locality at Templer’s Park,
QUAH ET AL. 374 · Zootaxa 4441 (2) © 2018 Magnolia Press
Selangor which is now reportedly destroyed (Günther & Manthey
1995). In addition, the specimen collected at Lata Kijang from
approximately 800 m in elevation significantly extends the
elevational range for the species that was previously only known
from the lowlands. It also highlights the underestimated diversity
remaining in upland regions of southern Peninsular Malaysia and
underscores the fact that there is still much left to be discovered
(Chan & Norhayati 2009; Grismer & Pan 2008; Grismer et al.
2011). In recent years, other new discoveries made from the state
of Negeri Sembilan and other regions of southern Peninsular
Malaysia are the new frog, Gastrophrynoides
immaculatus representing the first record of that genus for
Peninsular Malaysia (Chan et al. 2009) as well as Ansonia
endauensis, Ingerophrynus gollum, Cyrtodactylus majulah, C.
pantiensis, C. semenanjungensis,
Dendrelaphis kopsteini, Rhacophorus norhayatii, Microhyla mantheyi,
and Kalophrynus limbooliati (Chan & Grismer 2010; Das et al.
2007; Grismer 2006, 2007; Grismer & Leong 2005; Grismer et al.
2008, 2012; Matsui et
al. 2012; Vogel & van Rooijen 2008). Another notable discovery
was the genetic similarity between the new X. schaeferi specimen
(LUSHC 13481)
and the holotype despite looking very different. This finding
demonstrates that the colour pattern in X. schaeferi is variable,
and this phenomenon has been observed in other Malaysian snakes,
such as Ahaetulla prasina, Boiga
cynodon, B. drapiezii, Chrysopelea paradisi, Dryocalamus
subannulatus, Gonyosoma oxycephalum, Oligodon
purpurascens and Naja sumatrana (Baker & Lim 2008; Cox et al.
1998; Grismer 2011; Stuebing et al. 2014; van Rooijen et al. 2011;
Wüster & Thorpe 1989). The phenotype of the new specimens is
also similar to that of X.
acanthognathus (Fig. 3). This phenotypically similar colour pattern
of the new X. schaeferi specimens with that of X. acanthognathus
and the very minimal differences in scale counts between them might
suggest that these species may possibly be conspecific. Other
studies have demonstrated the genetic similarity between
populations of certain taxa between Borneo and Peninsular Malaysia
especially at the more southerly locations (Chan et al. 2014; Quah
et
al. 2017; Wostl et al. 2016, 2017). The relationship of the two
species can be tested in the future with the acquisition of genetic
material for X. acanthognathus.
FIGURE 5. Distribution map of Xenophidion species. Stars indicate
type locality. Circle indicates reported localities.
Also of significance is the discovery of the first specimen of the
genus Xenophidion from Sumatra, Indonesia, which is in accord given
the past multiple connections between Sumatra, Peninsular Malaysia,
and Borneo from the Pliocene onward (Inger & Voris 2001; Voris
2000; Sathiamurthy & Voris 2006; Woodruff 2010). The finding
of
Zootaxa 4441 (2) © 2018 Magnolia Press · 375XENOPHIDION SCHAEFERI
AND FIRST RECORD OF THE GENUS FROM SUMATRA
Xenophidion sp. from Gunung Talakmau in West Sumatra echoes other
recent discoveries of Sundaland amphibian and reptile taxa
previously unrecorded from Sumatra such as the frogs of the genus
Gastrophrynoides (Matsui et al. 2017) and the gekkonid genus
Cnemaspis (Amarasinghe et al. 2015).
The rarity of these snakes still leaves much of their natural
history unknown and only anecdotal evidence can be gathered from
chance observations. The holotypes of X. acanthognathus and X.
schaeferi as well as USMHC 2389 and the Sumatran specimen have been
found in the proximity of streams (Günther & Manthey 1995)
indicating they may also be semiaquatic. Observations on the
movements of LSUHC 13481 and USMHC 2389 on land and in water, lead
us to consider that the laterally compressed body of this snake may
be an adaptation for swimming. In addition, the flattened shape of
the snake’s head and the absence specialised burrowing structures
such as reduction of head scales, the inordinately thin neck, and
relatively long tail suggests it not a burrower (Inger & Marx
1965). The recent night time sighting of X. acanthognathus crawling
on the side of a log in the forest (Fig. 3A) suggests this species
may be semi-scansorial, moving through low vegetation and rocks
(Rowntree et al. 2017). The food habits of this genus are still
completely unknown. Details of the skeletal structure of the skull
and internal anatomy of LSUHC 13481 will be treated in a separate
paper along with a multilocus phylogeny (Miralles et al. in
prep).
Acknowledgements
Our team is grateful to the Department of Wildlife and National
Parks, Peninsular Malaysia for issuing us permits P-00074-15-18 and
B-00741/13/16 to conduct research. Research work in Malaysia by LLG
was supported in part by a grant from the College of Arts and
Sciences, La Sierra University, Riverside, California and from a
National Geographic Society Explorers Grant, while research by
Shahrul Anuar was supported by a Universiti Sains Malaysia Grants
(811311 and 870039). Evan Quah would like to thank Tom Charlton for
bringing to his attention the discovery of one of new X. schaeferi
specimens and his research is partially supported by the USM
Postdoctoral scheme. Matthew L. Brady would like to thank Subir
Shakya and Prof. Fred Sheldon of LSU for organising and obtaining
the funding for the expedition in Sumatra, Indonesian colleagues
Andri Saputra and Tri Haryoko of LIPI for help in the field and
Yingyod Lapwong who helped with identification on inaturalist. We
are also grateful to Neil Rowntree, Oscar Johnson and Wolfgang
Grossmann for generously contributing their photographs and to
Ulrich Manthey and another anonymous reviewer for the feedback that
helped improve the manuscript.
References
Amarasinghe, A.A.T., Harvey, M. B., Riyanto, A. & Smith, E. N.
(2015) A new species of Cnemaspis (Reptilia: Gekkonidae)
from Sumatra, Indonesia. Herpetologica, 71 (2), 160–167.
https://doi.org/10.1655/HERPETOLOGICA-D-14-00034
Baker, N. & Lim, K. (2008) Wild Animals of Singapore. A
Photographic Guide to Mammals, Reptiles, Amphibians and
Freshwater Fishes. Draco Publishing and Distribution Pte. Ltd. and
Nature Society, Singapore, 180 pp.
Cox, M.J., van Dijk, P.P., Nabhitabhata, J. & Thirakhupt, K.
(1998) A Photographic Guide to Snakes and Other Reptiles of
Peninsular Malaysia, Singapore and Thailand. New Holland Publishers
Ltd., London, 144 pp.
Chan, K.O. & Grismer, L.L. (2010) Re-assessment of the
Reinwardt’s Gliding Frog, Rhacophorus reinwardtii (Schlegel
1840)
(Anura: Rhacophoridae) in Southern Thailand and Peninsular Malaysia
and its re-description as a new species. Zootaxa,
2505, 40–50.
Chan, K.O., Grismer, L.L., Ahmad, N. & Belabut, D. (2009) A new
species of Gastrophrynoides (Anura: Microhylidae): an
addition to a previously monotypic genus and a new genus for
Peninsular Malaysia. Zootaxa, 2124 (1), 63–68.
Chan, K.O., Grismer, L.L. & Brown, R.M. (2014) Reappraisal of
the Javanese Bullfrog complex, Kaloula baleata (Müller,
1836) (Amphibia: Anura: Microhylidae), reveals a new species from
Peninsular Malaysia. Zootaxa, 3900 (4), 569–580.
https://doi.org/10.11646/zootaxa.3900.4.7
Chan, K.O. & Norhayati, A. (2009) Distribution and natural
history notes on some poorly known frogs and snakes from
Peninsular Malaysia. Herpetological Review, 40 (3), 294–301.
Das, I., Yaakob, N. & Sukumaran, J. (2007) A new species of
Microhyla (Anura: Microhylidae) from the Malay Peninsula.
Hamadryad, 31, 304–314.
Dowling, H.G. (1951) A proposed standard system of counting ventral
in snakes. Journal of Herpetology, 1, 97–99.
QUAH ET AL. 376 · Zootaxa 4441 (2) © 2018 Magnolia Press
Grismer, L.L. (2006) A new species of Ansonia Stoliczka, 1870
(Anura: Bufonidae) from a lowland rainforest in southern
Peninsular Malaysia. Herpetologica, 62, 466–475.
https://doi.org/10.1655/0018-0831(2006)62[466:ANSOAS]2.0.CO;2
Grismer, L.L. (2007) A new species of Ingerophrynus (Anura:
Bufonidae) from a lowland rain forest in southern Peninsular
Malaysia. Journal of Herpetology, 41, 225–230.
https://doi.org/10.1670/0022-1511(2007)41[225:ANSOIA]2.0.CO;2
Grismer, L.L. (2011) Field Guide to the Amphibians and Reptiles of
the Seribuat Archipelago, Peninsular Malaysia. Edition
Chimaira, Frankfurt am Main, 258 pp.
Grismer, L.L., Chan, K., Grismer, J., Wood Jr., P.L. & Belabut,
D. (2008) Three new species of Cyrtodactylus (Squamata:
Gekkonidae) from Peninsular Malaysia. Zootaxa, 1921, 1–23.
Grismer, L.L., Grismer, J.L., Wood Jr., P.L., Ngo, V.T. & Chan,
K.O. (2011) Herpetology on the fringes of the Sunda Shelf: a
discussion of discovery, taxonomy, and biogeography. Bonner
Zoologische Monographien, Bonn, 57, 57–97.
Grismer, L.L, & Leong, T.M. (2005) New Species of Cyrtodactylus
(Squamata: Gekkonidae) from Southern Peninsular
Malaysia. Journal of Herpetology, 39 (4), 584–591.
https://doi.org/10.1670/43-05A.1
Grismer, L.L. & Pan, K.A. (2008) Diversity, endemism, and
conservation of the amphibians and reptiles of southern
Peninsular
Malaysia and its offshore islands. Herpetological Review, 3,
270–281.
Grismer, L.L., Quah, E.S.H., Shahrul, A.M.S., Muin, M.A., Wood Jr.,
P.L. & Azizah, S.M.N. (2014a) A diminutive new species
of cave-dwelling Wolf Snake (Colubridae: Lycodon Boie, 1826) from
Peninsular Malaysia. Zootaxa, 3815 (1), 51–67.
https://doi.org/10.11646/zootaxa.3815.1.3
Grismer, L.L., Wood, P.L. Jr. & Lim, K.K.P. (2012)
Cyrtodactylus majulah, a new species of bent-toed gecko
(Reptilia:
Squamata: Gekkonidae) from Singapore and the Riau Archipelago. The
Raffles Bulletin of Zoology, 60 (2), 487–499.
Günther, R. & Manthey, U. (1995) Xenophidion, a new genus with
two new species of snakes from Malaysia (Serpentes,
Colubridae). Amphibia-Reptilia, 16 (3), 229–240.
https://doi.org/10.1163/156853895X00028
Inger, R.F. & Marx, H. (1965) The systematics and evolution of
the oriental colubrid snakes of the genus Calamaria.
Fieldiana:
Zoology, 49, 1–304.
Inger, R.F. & Voris, H.K. (2001) The biogeographical relations
of the frogs and snakes of Sundaland. Journal of
Biogeography,
28, 863–891.
https://doi.org/10.1046/j.1365-2699.2001.00580.x
Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M.,
Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran,
C., Thierer, T., Ashton, B., Mentjes, P. & Drummond, A. (2012)
Geneious basic: an integrated and extendable desktop
software platform for the organization and analysis of sequence
data. Bioinformatics, 28 (12), 1647–1649.
https://doi.org/10.1093/bioinformatics/bts199
Lawson, R., Slowinski, J.B. & Burbrink, F.T. (2004) A molecular
approach to discerning the phylogenetic placement of the
enigmatic snake Xenophidion schaeferi among the Alethinophidia.
Journal of Zoology, 263 (3), 285–294.
https://doi.org/10.1017/S0952836904005278
Matsui, M., Nishikawa, K., Belabut, D., Norhayati, A. & Yong,
H. (2012) A new species of Kalophrynus (Amphibia, Anura,
Microhylidae) from Southern Peninsular Malaysia. Zootaxa, 3155,
38–46.
Matsui, M., Yeo, S.T., Nishikawa, K., Zainudin, R., Eto, K. &
Hamidy, A. (2017) Biological notes on an enigmatic
microhylid,
Gastrophrynoides borneensis (Anura, Microhylidae). Raffles Bulletin
of Zoology, 65, 466–473.
Morgulis, A., Coulouris, G., Raytselis, Y., Madden, T.L., Agarwala,
R. & Schäffer, A.A. (2008). Database indexing for
production MegaBLASTsearches. Bioinformatics, 24 (16),
1757–1764.
https://doi.org/10.1093/bioinformatics/btn322
Quah, E.S.H., Shahrul Anuar, M.S., Grismer, L.L., Wood Jr., P.L.,
Siti Azizah, M.N. & Muin, M.A. (2017) A new species of
frog of the genus Abavorana Oliver, Prendini, Kraus & Raxworthy
2015 (Anura: Ranidae) from Gunung Jerai, Kedah,
northwestern Peninsular Malaysia. Zootaxa, 4320 (2), 272–288.
https://doi.org/10.11646/zootaxa.4320.2.4
distribution. Herpetological Review, 48 (1), 132–133.
Sathiamurthy, E. & Voris, H.K. (2006) Maps of Holocene sea
level transgression and submerged lakes on the Sunda Shelf.
Natural History Journal of Chulalongkorn University, 2, 1–43.
Stuebing, R.B., Inger, R.F. & Lardner, B. (2014) A field guide
to the snakes of Borneo. 2nd Edtion. Natural History
Publications
(Borneo), Kota Kinabalu, 310 pp.
Swofford, D.L. (2002) Phylogenetic analysis using parsimony.
Sinauer Associates Inc, Sunderland, MA. [software]
van Rooijen, J., Wood Jr., P.L., Grismer, J.L., Grismer, L.L. &
Grossmann, W. (2011) Colour pattern dimorphism in the
colubrid snake Oligodon purpurascens (Schlegel, 1837) (Reptilia:
Squamata). Russian Journal of Herpetology, 18 (3),
215–220.
Vogel, G. & van Rooijen, (2007) A new species of Dendrelaphis
(Serpentes: Colubridae) from Southeast Asia. Zootaxa,
1394, 25–45.
https://doi.org/10.11646/zootaxa.1394.1.2
Zootaxa 4441 (2) © 2018 Magnolia Press · 377XENOPHIDION SCHAEFERI
AND FIRST RECORD OF THE GENUS FROM SUMATRA
Biogeography, 27, 1153–1167.
https://doi.org/10.1046/j.1365-2699.2000.00489.x
Wallach, V. & Günther, R. (1998) Visceral anatomy of the
Malaysian snake genus Xenophidion, including a cladistics
analysis
and allocation to a new family (Serpentes: Xenophidiidae).
Amphibia-Reptilia, 19, 385–404.
https://doi.org/10.1163/156853898X00052
Woodruff, D.S. (2010) Biogeography and conservation in Southeast
Asia: how 2.7 million years of repeated environmental
fluctuations affect today's patterns and the future of the
remaining refugial-phase biodiversity. Biodiversity and
Conservation, 19, 919–941.
https://doi.org/10.1007/s10531-010-9783-3
Wostl, E., Riyanto, A., Hamidy, A., Kurniawan, N., Smith, E.N.
& Harvey, M.B. (2017) A taxonomic revision of the
Philautus
(Anura: Rhacophoridae) of Sumatra with the description of four new
species. Herpetological Monographs, 31, 98–141.
https://doi.org/10.1655/HERPMONOGRAPHS-D-16-00007
Wostl, E., Sidik, I., Trilaksono, W., Shaney, K.J., Kurniawan, N.
& Smith, E.N. (2016) Taxonomic Status of the Sumatran
Pitviper Trimeresurus (Popeia) toba David, Petri, Vogel &
Doria, 2009 (Squamata: Viperidae) and Other Sunda Shelf
Species of the Subgenus Popeia. Journal of Herpetology, 50 (4),
633–641.
https://doi.org/10.1670/15-045
Wüster, W. & Thorpe, R.S. (1989) Population affinities of the
Asiatic cobra (Naja naja) species complex in south-east Asia:
reliability and random resampling. Biological Journal of the
Linnean Society, 36, 391–409.
https://doi.org/10.1111/j.1095-8312.1989.tb00503.x
Zhang, Z., Schwartz, S., Wagner, L. & Miller, W. (2000) A
greedy algorithm for aligning DNA sequences. Journal of
Computational Biology, 7 (1–2), 203–214.
https://doi.org/10.1089/10665270050081478
QUAH ET AL. 378 · Zootaxa 4441 (2) © 2018 Magnolia Press
Abstract
Introduction