View
218
Download
0
Category
Preview:
Citation preview
Supporting online material
A link between mRNA turnover and RNA interference in Arabidopsis
Silvia Gazzani, Tom Lawrenson, Claire Woodward, Denis Headon and Robert Sablowski
Materials and methods
Arabidopsis growth and genetic analysis.
For plant growth, seeds were stratified at 4°C for 4 days before growth at 21°C with
16 h light / 8 h dark cycles, either on soil or on plates with GM medium (S1). For DEX
treatments, seedlings were grown on GM containing 1 µM dexamethasone (SIGMA).
For mutagenesis, 100 mg of homozygous STM-GR seeds (Landsberg-erecta
background, L-er) were treated overnight at room temperature with 0.3% ethyl methane
sulphonate (EMS) in 0.05% Tween 20, rinsed in saturated sodium thiosulphate, germinated
on GM medium and transferred to soil after one week. Progeny from 2000 individual plants
were germinated on separate GM plates containing 1 µM dexamethasone (SIGMA) and
screened for wild-type growth. The xrn4-1 and xrn4-2 mutants were isolated in this screen.
The xrn4-3 allele originated from the Salk Institute collection of T-DNA insertions
(http://signal.salk.edu/cgi-bin/tdnaexpress), strain SALK_014209, obtained via the
Nottingham Arabidopsis Stock Centre (http://nasc.life.nott.ac.uk/)
The STM-GR strain has been described (S2), and an independent STM-GR line was
generated using the same methods. The AG-GR strain was made in L-er background using
the same vector and methods as for STM-GR, except that the STM coding sequence was
replaced with the complete AGAMOUS coding sequence fused in-frame with GR. The
WUS-GR strain (L-er) was a gift from Michael Lenhard (University of Freiburg, Germany)
and has been described (S3). sde1-1(S4) and the corresponding wild-type control (C-24
background) were provided by Alan Herr (Sainsbury Laboratory, Norwich, UK).
For crosses, plants were grown on soil to maturity and four to five flowers were
hand-pollinated two days after their immature stamens had been removed. Genotypes were
confirmed using dCAPS markers. For xrn4-1, genomic DNA was amplified with primers:
5'GACCGATACCCGAAGTCAAT3' and
5'CTAACCAAACATTTCTGAGCTACAACAGA3'. For sde1-1, primers were
5'GGGAGCCTGTGTCAGATCAT3' and
5'GAGATGCTTGAGAGAAGCTATATTGAGATC3'. In both cases, amplification was
initiated by adding Taq polymerase at 94°C, followed by 35 cycles of 94°C for 30 sec, 52°C
for 60 sec and 72° C for 90 sec. The 204 bp XRN4 product was cut to 173 bp by BglII if
amplified from xrn4-1; for SDE1, BglII cut the 183 bp product to 153 bp if amplified from
sde1-1.
RNA extraction and analysis
Total RNA was isolated from the aerial part (leaves, cotyledons and hypocotyl) of
11 days-old seedlings grown on GM medium. For extraction of high molecular weight
RNA, the tissues were frozen and ground in liquid nitrogen and RNA was extracted with
the TRIzol Reagent (Life Technologies) according to manufacturer’s instructions. For
Northern blots, ~10 µg of total RNA was fractionated on 1.2 % formaldehyde-agarose gel
and blotted onto Hybond-NX nylon filter. cDNA probes were labelled by random
priming with [α-32P]dCTP. Equal loading was verified by stripping in boiling 0.5% SDS
and hybridizing with a β–tubulin probe.
For small RNA detection, total RNA was extracted from 11 days-old seedlings as
described (S5). 80 µg of total RNA were analyzed as in (S6), except that a 17%
polyacrylamide gel was used. The gel was soaked in 10 mM phosphate buffer pH 7.2,
followed by 10 min in 20 X SSC and standard Southern transfer (S7) onto Hybond-NX
nylon filter. The filter was probed with STM or GR [α-32P]UTP-labelled riboprobes,
which were hydrolized for 1 hour in 200 µl of 100 mM carbonate buffer (40 mM
NaHCO3, 60 mM Na2CO3, pH 10.2). To probe for miRNAs 157 or 167
(http://cgrb.orst.edu/smallRNA), the filters were stripped in boiling 0.5% SDS and
probed with [γ-32P]ATP-labelled oligonucleotides (5' GTGCTCTCTATCTTCTGTCAA3'
for miRNA157 and 5'TAGATCATGCTGGCAGCTTCA3' for miRNA167) . All blots
were exposed to a Storage Phosphor Screen (Molecular Dynamics) and the images
analyzed with ImageQuant 5.1 (Molecular Dynamics).
RACE-PCR
Detection of RNA 5' ends was performed using the GeneRacer™ Kit (Invitrogen),
without the initial de-capping reaction (S8). After isolation of polyA RNA (PolyATtract
mRNA Isolation System IV - Promega) the GeneRacer™ RNA oligonucleotide (5’-
CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA-3’) was
ligated to exposed 5’ ends and reverse transcription reaction (RT) carried out using an
oligo-dT primer [5’-GCTGTCAACGATACGCTACGTAACGGCATGACAGTG(T)18].
A 10-cycle hot-start polymerase chain reaction (PCR) was performed (94°C/4 min
followed by 10 cycles of 94°C/30 sec and 72°C/90 sec), using a primer specific for the
GeneRacer™ RNA oligonucleotide (GeneRacer™ 5’ Primer: 5’-
CGACTGGAGCACGAGGACACTGA-3’) and STM-specific primer (STMrev1: 5’-
TGTCCTCCGACGGCTTCCAATGC-3’). The PCR products were purified with the
QIAquick PCR purification kit (QIAGEN) and used as templates for a second 40-cycle
hot-start PCR (94°C/4 min then 40 cycles of 94°C/30 sec and 72°C/90 sec) with nested
primers (GeneRacer™ 5’ Nested Primer, 5’-
GGACACTGACATGGACTGAAGGAGTA-3’, and STMrev2, 5’-
CCGACGGCTTCCAATGCCGTTTC-3’). These PCR products were separated on a 1%
agarose gel and transferred to Hybond-NX nylon filter by Southern blotting (S7). The
filter was probed with the full-length STM cDNA, labelled by random priming with [α-
32P]dCTP. Cloning and sequencing of the most prominent PCR product (approx. 1 Kb)
confirmed that it corresponded to full-length cDNA, in which the sequence immediately
following the RNA adaptor sequence was 5' ACGGGATCCATG…3' (plant
transformation vector sequences italicized, transcriptional start from the 35S promoter in
boldface, and STM start codon underlined). Similar results (amplification of the full-
length STM-GR cDNA, with no detectable cleavage products) were obtained using the
GeneRacer™ 5’ primer and a primer directed to the NOS terminator sequence at the 3’
end of STM-GR (NOSrev: 5’ATCATCGCAAGACCGGCAACAGG3’).
For quantitative analysis, the standard was the PCR product obtained with the
GeneRacer™ 5’ Nested Primer and STMrev2, purified with the QIAquick kit (QIAGEN)
and quantified by absorbance at 260 nm. Serial dilutions of the standard and of the
products of the initial 10-cycle PCR of the RACE procedure were used as templates for
hot start PCR (94°C/5 min followed by thirty cycles of 94°C/30 sec, 60°C/60 sec and
72°C/90 sec), using the GeneRacer™ 5’ Nested Primer and primer STMrev3: 5'
CCTGTTGGCCCCATAGATGC 3' (this primer combination allowed more sensitive
amplification with fewer non-specific products). After electrophoresis through 1.2 %
agarose, the ethidium bromide-stained gel was scanned using a Typhoon 8600 scanner
(Molecular Dynamics), with the laser set to 532 nm and emission filter to 610 nm. Band
intensities were measured using ImageQuant 5.1 (Molecular Dynamics).
Map-based cloning and complementation
Homozygous xrn4-1, STM-GR (L-er) was crossed to the Columbia (Col-0)
accession. xrn4-1, STM-GR homozygous mutants were selected in the F2 generation,
based on wild-type growth on medium containing Kanamycin 50 µg/mL and
dexamethasone 1 µM. We initially mapped the mutation to chromosome 1 between
markers pSSLP3 (19.32 Mb) and nga280 (20.15 Mb). One thousand xrn4-1, STM-GR F2
seedlings were then used for fine-mapping, with primers designed using information from
the CEREON collection (http://www.arabidopsis.org/) and dCAPS Finder 2.0
(http://helix.wustl.edu/dcaps/dcaps.html) (S9). The interval was narrowed to an interval
of 100 kb, spanning genes At1g54430 to At1g54710 (http://www.arabidopsis.org/).
Sequencing of candidate genes identified the xrn4-1 and xrn4-2 mutations.
Complementation of xrn4-1 was performed with a genomic fragment amplified by
PCR with primers 5'ATTTTGGAGCTCCTGAATTCAACAATGACGTACTT3' and
5'TTGGAGATGTCCTACTTGTGGAGCTCCTCAGA3'. The PCR product was cloned
as a SacI fragment and the sequence was verified. The fragment was then subcloned into
pPZP222 (S10) and transformed into homozygous xrn4-1, STM-GR plants, using the
floral dip method (S11). Complementation was seen in five independent transformed
lines, based on return of the STM-GR phenotype in xrn4-1, STM-GR seedlings grown on
medium containing kanamycin 50 µg/mL, gentamycin 100 µg/mL and dexamethasone 1
µM.
In situ RNA hybridization
Tissue fixation, sectioning and in situ hybridization were performed as described
(S12). Riboprobes were labelled with digoxigenin (Roche Molecular Biochemicals) and
alkaline phosphatase activity was detected with 5-bromo-4-chloro-3-indolyl phosphate
toluidine salt (BCIP) and nitro blue tetrazolium chloride (NBT) (Roche Molecular
Biochemicals) according to the manufacturer's instructions.
Supporting figures
Fig. S1: Small RNA blots comparing plants with STM-GR present (+) or absent (-) and
wild-type (+) or mutant (-) for XRN4 and SDE1.
(A) Blot hybridized with GR probe, showing siRNAs in STM-GR, xrn4-1 seedlings, but
not in STM-GR, xrn4-1, sde1-1. (B) Same blot, probed for miRNA167 as a loading
control and size marker.
Fig. S2: xrn4-1 suppressed a STM-GR transgene different from the one used in the mutant
screen. The same construct present in the original STM-GR line was transformed
independently into Arabidopsis L-er and crossed to xrn4-1 that had been segregated from
the original transgene. When grown on medium containing DEX, the new transgenic line
showed the typical STM-GR phenotype (A), which was suppressed in xrn4-1 background
(B). Bar: 1 mm.
Fig. S3: xrn4 mutations and complementation.
(A) Structure of XRN4, with mutations indicated. Three independent xrn4 alleles caused
similar suppression of STM-GR. xrn4-1 had a G to A mutation in the first nucleotide of
the first intron. RT-PCR amplification of the mutant cDNA showed two aberrantly
spliced products, with the last 14 or 35 nucleotides of the first exon deleted, causing
frame shifts and premature termination (asterisks) 36 or 44 amino acids after the start
codon. In xrn4-2, the first nucleotide of the sixth exon is changed from G to A, causing
a non-conservative change (N to D) at amino acid 234, which is highly conserved in the
exonuclease domain (Interpro IPR004859). xrn4-3 had a T-DNA insertion in the 16th
intron, but in this case the consequences for the transcript were not analyzed. The
inverted, duplicated T-DNA insertion in xrn4-3 is not drawn to scale; LB and RB are left
and right borders, respectively.
(B,C) Complementation of xrn4-1. (B) Seedlings grown on medium with DEX 1 µM.
The seedlings were homozygous for xrn4-1 and STM-GR, and segregated a T-DNA
containing the wild-type XRN4 genomic sequence, which caused recovery of the wild-
type STM-GR phenotype (arrows). An individual, complemented xrn4-1, STM-GR
seedling is shown at higher magnification in (C).
Fig. S4: Quantitative PCR comparing RACE products corresponding to de-capped STM-
GR mRNA from sde1-1, STM-GR and sde1-1, xrn4-1,STM-GR seedlings.
(A) Standard curve. The standard template (see methods) was diluted to a concentration
range comparable to that of the RACE products. The number of PCR cycles was chosen
to yield clearly measurable products (569 bp, corresponding to the 5' end of STM-GR)
while maintaining a linear relationship between input template and PCR product.
(B) Linear relationship between the amount of template (in fg, x-axis) and the area of
fluorescence peaks corresponding to the bands shown in (A). The linear equation was
calculated using the least squares method (R2=0.957).
(C) PCR amplification of serial 2-fold dilutions (1: undiluted; 2, 4 and 8: 1/2, 1/4 and1/8
of original concentration, respectively) of RACE samples (see methods) prepared from
sde1-1 and sde1-1, xrn4-1 seedlings in three independent experiments (No.1-3). PCR and
analysis were done in parallel with the standards shown in (A) (i.e., same PCR
amplification, same gel).
(D) Peak areas measured for the bands shown in (A) and (C), corresponding estimates of
initial template DNA (calculated using the linear equation shown in (B) and ratio between
estimated initial template in sde1-1, xrn4-1 and sde1-1 samples in the three experiments.
The sample dilution indicated was the highest dilution that still gave clearly measurable
peaks for both samples.
Fig. S5: XRN4 expression detected by RNA in situ hybridization. XRN4 mRNA (purple
signal) was detected throughout the shoot, including the meristem and in the vasculature
and mesophyll of leaves.
(A,C) Longitudinal section through the meristem (m) and leaves (l) of a wild-type
seedling, hybridized with XRN4 antisense probe (A) or GR sense probe as a negative
control (C).
(B,D) Transversal section through a leaf lamina, hybridized with XRN4 antisense probe
(B) or GR sense probe as a negative control (D).
Bar: 100 µm.
Supporting References
S1. D. Valvekens, M. Vanmontagu, M. Vanlijsebettens, Proc. Natl. Acad. Sci. U. S.
A. 85, 5536 (1988).
S2. J. L. Gallois, C. Woodward, G. V. Reddy, R. Sablowski, Development 129, 3207
(2002).
S3. M. Lenhard, G. Jurgens, T. Laux, Development 129, 3195 (2002).
S4. T. Dalmay, A. Hamilton, S. Rudd, S. Angell, D. C. Baulcombe, Cell 101, 543
(2000).
S5. J. L. White, J. M. Kaper, J. Virol. Methods 23, 83 (1989).
S6. G. Szittya, A. Molnar, D. Silhavy, C. Hornyik, J. Burgyan, Plant Cell 14, 359
(2002).
S7. J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular Cloning - A Laboratory
Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, ed. 2nd.,
1989).
S8. C. Llave, Z. X. Xie, K. D. Kasschau, J. C. Carrington, Science 297, 2053 (2002).
S9. M. M. Neff, E. Turk, M. Kalishman, Trends Genet. 18, 613 (2002).
S10. P. Hajdukiewicz, Z. Svab, P. Maliga, Plant Mol.Biol. 25, 989 (1994).
S11. S. J. Clough, A. F. Bent, Plant J. 16, 735 (1998).
S12. P. R. Fobert, V. Gaudin, P. Lunness, E. S. Coen, J. H. Doonan, Plant Cell 8, 1465
(1996).
Recommended