Arabidopsis Gene Project GK-12 April Workshop Karolyn Giang and Dr. Mulligan

Preview:

Citation preview

Arabidopsis Gene Project

GK-12 April Workshop

Karolyn Giang and Dr. Mulligan

Reverse genetics

An approach used to determine the function of a gene from known DNA sequence

BLAST: Basic Local Alignment Search Tool

Gene project

You are working on an Arabidopsis gene discovery project, and your job is to sequence cDNAs and then learn all you can about the genes from all types of databases: DNA sequence, genome, and publication databases.

TCCTGCATTCAATGTGATCAATGGAGGCAGTCATGCTGGGAATAGTTTGGCTATGCAAGAGTTTATGATACTACCTGTAGGAGCTACCTCATTCTCGGAGGCCTTCCAGATGGGAAGTGAAGTTTATCATACATTGAAGGGGATAATCAAAACTAAGTATGGTCAAGATGCTTGTAATGTCGGAGATGAAGGAGGGTTTG

Query sequence:

NCBI homepage

1. What is the name of the gene that the

unknown cDNA sequence is derived from?

1. What is the name of the gene that the

unknown cDNA sequence is derived from?

1. What is the name of the gene that the unknown cDNA sequence is derived from?

1. What is the name of the gene that the

unknown cDNA sequence is derived from? 2. Identify the location of this gene by Arabidopsis thaliana chromosome and genome locus.

2. Identify the location of this gene by Arabidopsis thaliana chromosome and genome locus.

3. What is the function of this gene?

4. How many nucleotides are in the coding sequence of this gene?

4. How many nucleotides are in the

coding sequence of this gene?

1434 nucleotides

5. What sequence of amino acids is

encoded by your unknown cDNA sequence?

6.In the Arabidopsis genome, what other gene has

the most similar protein sequence to your gene?

6.In the Arabidopsis genome, what other gene has

the most similar protein sequence to your gene?

6.In the Arabidopsis genome, what other gene has

the most similar protein sequence to your gene?

7. In the human genome, what is the most

closely related gene to your Arabidopsis gene?

7. In the human genome, what is the most closely related gene to your Arabidopsis gene?

8. What T-DNA insertion for this gene

would be likely to knock out gene function?

8. What T-DNA insertion for this gene

would be likely to knock out gene function?

8. What T-DNA insertion for this gene

would be likely to knock out gene function?

8. What T-DNA insertion for this gene

would be likely to knock out gene function?

9.Give a literature citation to a research article that

studied a knock out of this gene in Arabidopsis.

9.Give a literature citation to a research article that

studied a knock out of this gene in Arabidopsis.