Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species

Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species.

Greg MoyerU.S. Fish and Wildlife Service - Warm Springs, GA

Brian KreiserUniversity of Southern Mississippi

OR

Where Are You From

&

Who’s Your Daddy?

A Brief Introduction

Kreiser & Colleagues

Kevin Feldheim - The Field Museum

Wilfredo Matamoros - USM

Jake Schaefer - USM

Moyer & Colleagues

Brian Sloss – USGS

Josh Rousey – Valdosta State

Justin Sipiorski - SIU

Samples in Hand

MS Gulf Coast Fishing Rodeo (2002+) - Dennis Riecke (MDWFP)

St. Catherine Creek NWR - Ricky Campbell (UWFWS)

Vicksburg - Jan Hoover (Army Corp)

Oklahoma - Kerry Graves (USFWS)

Louisiana - Allyse Ferrara (Nichols State U.)

Texas - Mark Malfa (bowfishing guide)

Choctawhatchee - Frank Parauka (USFWS)

Other gar species (spotted, longnose, shortnose, Florida)

Overview

1. Background on conservation genetics, molecular tools and microsatellites

2. Summary of work to date

3. Future directions - your input

Conservation GeneticsFields of - Ecology, Population Genetics & SystematicsTools of - Molecular Biology & Mathematical Modeling

Overlapping Questions

What is genetic variation and why is it important?

• All the variation due to differences in alleles and genes in an individual, population, or species

• Raw material for adaptive evolutionary change– Genetic diversity is required for populations to evolve in response

to environmental changes1

– Heterozygosity levels are linked directly to reduced population fitness via inbreeding depression2

1McNeely et al. 1990; 2Reed and Frankam 2003

What is genetic variation and why is it important?

• Conservation plans– maintain self sustaining populations– . . . long-term viable populations

• What does viability and self-sustaining actually mean?

• A viable population must be large enough to maintain sufficient genetic variation for adaptation to environmental changes

The Molecular Markers

Mitochondrial DNA

Microsatellites

Species Boundaries

Population Structure

Within Populations

Screening for Genetic Variation

Microsatellite gel run

Not Really That Complicated

Kreiser Lab Not the Kreiser Lab

Why Mitochondria?

“Powerhouse of the cell”; with its own genome

Small, circular genomeHigh mutation rateVariation for population studies

ClonalMaternal inheritance

Microsatellites - DNA Fingerprinting

Many loci in genome

Highly polymorphic

Example:- (CA) repeat- 6 alleles

#2 Genotype = 148 bp / 146 bp - one repeat unit difference

#8 Genotype = 144 bp / 156 bp - six repeat units difference

Microsatellites - DNA Fingerprinting

#5 Genotype = same

Multilocus genotype = the DNA fingerprint

Microsatellites - DNA Fingerprinting

Individual Locus 1 Locus 2 Locus 3 Locus 4 #2 148/146 160/156 220/212 138/130 #5 148/146 158/156 218/210 140/136 #8 144/156 160/158 224/220 142/132

Microsatellite Marker Development

• Collaborative effort among agencies, universities and laboratories

• Goal – Develop a suite of 12-16 markers for estimating

population genetic parameters

Microsatellites - Isolating Loci

(GCC)(AT)

(GATA)

DNAExtraction

Enrichment Clone

SequenceClones

SelectLoci Bearing

Clones

Microsatellites - Isolating Loci

TATTCCAAGGTGCAGCTGTAAGAATGCCATACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAACTCACTCTTCTGAGCTAAAATTCTGTGCTGTCTGTTTTGGGTGAAAACTAGGGAGTTTGCAGAACTCTTTGAGAGTTTTTTTAAGGTGCACATAAAAACTTCATCAGGATCTGAAACACCGTCACTGTGCTGGCTTCCCATTAACCAATATCTGTTTCCTC

Atsp 84 - primer design

16 alleles

Atsp 1594 alleles

Atsp 121 allele

Results

• Moyer lab (lots of work and nothing to show for it!)

– Two libraries constructed (enriched for di and tri repeats)

– 24 primers sets developed and optimized– 14 of 24 loci -- successful and consistent amplification of alligator gar

DNA– Limited variation

• 5 loci limited to 1 allele• 7 loci had 2 alleles• 2 loci had 3 alleles

– Cross species amplification with L. osseus, oculatus, platostomus, tropicus, and platyrhincus

• Similar results

Results

Kreiser lab - Alligator gar

19 individuals - MS Gulf Coast fishing rodeo

30 loci tested14 - not resolved

16 - amplified5 - monomorphic (one allele)11 - polymorphic (no deviation from HWE or LD)

Loci TestingLocus # Alleles Ho He

Atsp 7 4 0.263 0.238

Atsp 35 3 0.750 0.627

Atsp 40 4 0.684 0.620

Atsp 54 4 0.316 0.614

Atsp 57 2 0.053 0.051

Atsp 66 4 0.842 0.658

Atsp 84 16 0.947 0.898

Atsp 95 3 0.444 0.545

Atsp 122 3 0.389 0.329

Atsp 159 4 0.526 0.597

Atsp 341 3 0.688 0.506

Average 4.5 0.537 0.517

Loci Testing

Other gar

L. oculatus (n=14) & L. osseus (n=13) - Pascagoula

30 loci tested12-13 - not resolved

7-8 - amplified2-4 - monomorphic4-5 - polymorphic (no deviation from HWE or LD)

Loci Testing

# Alleles # Alleles

Locus L. oculatus L. osseus

Atsp 12* 3 2

Atsp 40 1 3

Atsp 54 1 1

Atsp 57 6 7

Atsp 66 13 10

Atsp 95 8 8

Atsp 324* 1 NR

Atsp 339* 1 1

Where do we go from here?

Restoration Goals• Ecological

– Supplement existing populations– Establish new populations– Ecological functions

• Genetic– Maintain/restore adaptive diversity and evolutionary

processes to promote population persistence.• Adaptive genetic variation within populations• Genetic structure among populations

• Historical– Restore the past?– Ensure the future?

Strategies for ecological restoration• Wait and see • Restore habitat

– Goal is simply to enhance natural recruitment

– No intended or unintentional genetic impact

• Hatchery-based enhancement– Goal is to increase numbers

– No intentional genetic impacts

– Unintentional impacts depending on the source of brood stock, how it’s managed, and the natural genetic structure

• Genetic Rehabilitation– Goal is to “improve” the genetics of populations

• Manipulate gene flow

• Selectively bred or genetically engineered brood stock

Conservation Genetics & Hatchery Propagation

• Best choice is local brood stock

• Non local– Risk – outbreeding depression (relative fitness of hybrids and

back crosses < natural population)

– Does genetic similarity = adaptive similarity?

– Can have high gene flow but local adaptation

• Recommendation– Avoid non-local brood stock

– Test for adaptive vs. neutral genetic variation

Conservation Genetics & Hatchery Propagation• Local brood stock

– Genetic diversity • Hatchery ≈ natural• Risk: inbreeding depression

– Lower relative fitness of hatchery stock• Recommendation – Genetic baseline data

– Large number of unrelated founders – number depends on generation time of organism

– Spawn unrelated– Avoid spawning brood stock more than once– Use brood held in captivity < 1 generation1

– Equalize parent contributions

– Rearing conditions • Hatchery ≈ natural• Risk: artificial selection

– Lower relative fitness of hatchery stock• Recommendation

– Equalize parent contributions1Araki et al. 2007 Science

Questions/Suggestions?