View
217
Download
2
Category
Preview:
Citation preview
UNIVERSIDAD POLITÉCNICA DE MADRID
Escuela Técnica Superior de Ingenieros Agrónomos
Ecotoxicology of pesticides on natural
enemies of olive groves.
Potential of ecdysone agonists for controlling
Bactrocera oleae (Rossi) (Diptera: Tephritidae)
TESIS DOCTORAL
Paloma Bengochea Budia
Ingeniera Agrónoma
2012
DEPARTAMENTO DE PRODUCCIÓN VEGETAL:
BOTÁNICA Y PROTECCIÓN VEGETAL
Escuela Técnica Superior de Ingenieros Agrónomos
Ecotoxicology of pesticides on natural
enemies of olive groves.
Potential of ecdysone agonists for controlling
Bactrocera oleae (Rossi) (Diptera: Tephritidae)
TESIS DOCTORAL
Paloma Bengochea Budia
Ingeniera Agrónoma
Directora: Mª del Pilar Medina Vélez
Dra. Ingeniera Agrónoma
Madrid, 2012
Tribunal nombrado por e Magfco. Y Excmo. Sr rector de la Universidad Politécnica de
Madrid, el día de de 2012.
Presidente D.
Vocal D.
Vocal D.
Vocal D.
Secretario D.
Suplente D.
Suplente D.
Realizada la lectura y defensa de la Tesis el día de de 2012
en Madrid, en la Escuela Técnica Superior de Ingenieros Agrónomos.
Calificación:
El Presidente Los Vocales
El Secretario
A mis padres,
a mi hermano
y a mis abuelas
Gracias….
A todos aquellos que me habéis apoyado y/o ayudado durante antes y durante la
elaboración de esta Tesis…espero no olvidarme de ninguno…
A la Universidad Politécnica de Madrid, porque sin la beca que me concedieron no hubiese
realizado esta Tesis, y sobre todo…
A todo el personal de la Unidad de Protección de Cultivos, sin cuyo apoyo y ayuda no hubiese
podido realizar este trabajo ni sobrevivir a todos los “problemillas” surgidos durante estos
años. Por todas esas comidas terapéuticas en las que arreglamos el mundo, nos reímos y nos
desahogamos. Por vuestra amistad. Gracias…
A mi tutora, Pilar Medina, por su apoyo incondicional y su ánimo en todos estos años. Por
estar siempre dispuesta a ayudarme y aclarar todas mis dudas existenciales. Por animarme a
escribir esta Tesis en inglés, que ha sido un reto. Por dejarme hacer millones de cursos y
llevarme a tantos Congresos. Por escucharme cuando lo he necesitado.
A Flor, Ángeles, Elisa y Pedro, por transmitirnos a todos vuestro entusiasmo por la
entomología, vuestras sugerencias y aportaciones.
A Luis, por tener siempre a punto a mis “pobres” Psyttalias para los ensayos.
A mis compañeros de laboratorio: los siguieron otros caminos: Sara, Guille, Edu, Raquel,
Cherre (tu consejo para las larvas de la Ceratitis no tiene precio) y con los que sigo codo con
codo compartiendo horas de laboratorio y se han convertido en buenos amigos: al
incondicional equipo desayuno con los que empezar el día es otra cosa, y a los que se unen de
vez en cuando: Mar, Yara, Nacho, Andrea, Jader, Agus y Rosa. A Fermín, que además es un
gran apoyo y un grandísimo amigo; porque siempre está dispuesto a echarme una mano y a
escucharme; por todos los momentos en que en el laboratorio nos hemos reído a más no
poder (la fuga de las chrysopas, el pobre piticli…)
A Román Zurita, el “guardián de los campos”, por resolver todos los problemas tecnológicos
que nos surgen y por habernos ayudado a transformar la enfermería del águila en el
invernadero en que mis olivos se han refugiado durante estos años.
A Ángela Alonso y Ezequiel Cabrera, que me ayudaron a identificar los hongos que aparecía en
la dieta de las pobres Bactroceras.
Al equipo INIA, especialmente a Manuel por resolver las dudas que me surgían sobre el olivar y
a Ismael, por ayudarme con todas mis dudas estadísticas.
A Jose Luis Porcuna y Mamen Alaurín, por permitirme visitar en insectario de Silla y darme las
primeras calabazas para comenzar mi cría de Aspidiotus.
A Manuel Ruiz-Torres y Bárbara Castellanos, que me mandaron aceitunas desde Jaén y Cáceres
para poder hacer mis ensayos.
A Andrew Jessup, de la sede de la FAO/IAEA de Seibersdorf, por dejarme visitar las
instalaciones para aprender cómo criar la mosca y enviarnos material siempre que
necesitábamos… y aun así la mosca se resistió…
A Carmen Calleja por resolver las dudas moleculares.
A Ian, Mª José, Olivier, Pieter y a todos aquellos que han contribuido a que esta Tesis tenga
unas pocas menos de faltas de ortografía…
A Josep Jacas y Alberto Urbaneja por aceptarme dos meses en el IVIA. A todas las personas que
conocí allí y que me acogieron como una más: Laura, Francesc, Sara, Alejandro, Óscar, Óscar,
Pablo, Joel, Elena, María, Paco, Miquel, Consuelo… (mil perdones si me olvido de alguien). A
Tati, que me introdujo en el mundo de los ácaros y además fue un gran apoyo el tiempo que
estuve allí. A Pili, Poli, César y Helga que me adoptaron para ir a San Sebastián. Moltes gracies
a tots!
A Guy Smagghe por acogerme por dos veces en la Universidad de Gante y permitirme
introducirme en el “mundo molecular”. A todos aquellos que me ayudaron en el laboratorio el
primer año, el segundo o los dos y que con paciencia me traducían las conversaciones en
dutch: Marteen, Rick, Didier, Patrick, Luck, Peter, Dorin, Ivan, Hanneke, Jisheng, Ruben,
Moises, Astrid, Sara… (y alguno más de los que espero me perdonen pero se me ha olvidado el
nombre…). A Jochem, el “spanishsitter”, que además intentó ayudarme a distinguir los
Chilocorus de las Chilocoras (aunque no tuviésemos mucho éxito), a Pieter, por los buenos
momentos, y sobre todo a Olivier: sin tu ayuda (y vigilancia) quién sabe qué habría salido de
las PCR, que al llegar a Gante me parecían máquinas dificilísimas de entender. Gracias por
enseñarnos Flandes y compartir tantos ratos buenos con nosotros. Dankjewel!
A Marta y de nuevo a Fermín, el resto del “spanish team”, porque sin vosotros las estancias en
Gante hubiesen sido muy diferentes y probablemente menos divertidas. Por haberme hecho
poner cada mañana al mal tiempo buena cara (en el sentido más literal de la frase).
A todos los jolgorianos, con quienes paso tan buenos momentos sea donde sea
A Eva, Marta, Juli, Jesús, Eva, Isa e Irene, por una amistad que viene de lejos.
A mis frijos, Cris y Ángeles, porque son un apoyo incondicional pese a la distancia.
A Ana, Bea y Marta, que me animaron tanto a seguir con esta beca. A Yuse, Sergio, Bea, Eva,
Sergio y demás agrónomos.
A Sara, Susi, Berta y Gema, mis compis agronómicas desde el primer día de carrera.
A Miguel, Cris, Alberto, Elena, Inés, Irene, Yoli, Mariano, Javi y demás ruteros con los que
siempre parece que he quedado ayer aunque pueda haber pasado un año. A Ceci, Freya, Vero
y Vera, las amigas al otro lado del charco.
A mis padres y mi hermano. Por haberme animado a realizar el doctorado cuando yo no tenía
las cosas muy claras, pero sobre todo por su gran apoyo diario y su cariño. A mis abuelas, que
son todo un ejemplo, y al resto de mi familia.
La paciencia es la madre de la ciencia…
Index
i
Index
INDEX i
RESUMEN vii
SUMMARY ix
1. INTRODUCTION 1
1.1 The olive tree 1
1.1.2 The origin of the crop 2
1.1.3 Geographical distribution 3
1.1.4 Importance of the crop 3
1.1.4.1 Economic importance 4
1.1.4.2 Social importance 4
1.1.4.3 Environmental importance 5
1.1.5 Olive growing in Spain 5
1.1.6 Pests and diseases: characteristics of the most important
pests and diseases of olive groves 6
1.1.6.1 The olive fruit fly (Bactrocera oleae) 10
1.1.6.2 The olive moth (Prays oleae) 14
1.1.6.3 The black scale (Saissetia oleae) 15
1.1.6.4 The olive leaf spot (Spilocaea oleagina) 16
1.2 Control of pests and diseases 17
1.2.1 Integrated Pest Management 18
1.2.2 Organic farming 21
1.2.3 Integrated Protection in olive groves 23
1.2.4 Organic olive farming 28
1.3 Side-effects of pesticides on non-target organisms 28
1.4 Natural enemies used in the experiments 30
1.4.1 Psyttalia concolor 30
1.4.2 Chilocorus nigritus 35
Index
ii
2. OBJECTIVES 41
3. GENERAL MATERIALS AND METHODS 43
3.1 Environmental conditions of insect rearing and laboratory
experiments 43
3.2 Insect rearing 44
3.2.1 Psyttalia concolor 44
3.2.1.1 Mass-rearing of Ceratitis capitata 45
3.2.1.1.1 Adults’ cage 45
3.2.1.1.2 Eggs handling 45
3.2.1.1.3 Larvae rearing 46
3.2.1.2 Mass-rearing of Psyttalia concolor 47
3.2.1.2.1 Parasitization 47
3.2.2 Chilocorus nigritus 48
3.2.2.1 Mass-rearing of scales 49
3.2.3 Bactrocera oleae 51
3.3 Common characteristics of the experiments 52
3.4 Parameters evaluated 54
3.4.1 Mortality 54
3.4.2 Life span 54
3.4.3 Effects on reproductive parameters 54
3.5 Statistical analysis 56
Index
iii
4. LETHAL AND SUBLETHAL EFFECTS OF KAOLIN PARTICLE FILMS AND COPPER-BASED COMPOUNDS ON THE NATURAL ENEMIES PSYTTALIA CONCOLOR AND CHILOCORUS NIGRITUS 59
4.1 Introduction and objectives 59
4.2 Material and methods 60
4.2.1 Chemicals 60
4.2.1.1 Kaolin 62
4.2.1.2 Copper 64
4.2.2 Laboratory tests 65
4.2.2.1 Residual contact on glass surfaces 65
4.2.2.2 Oral toxicity 67
4.2.2.3 Treatment of parasitized pupae 68
4.2.2.4 Treatment of the parasitization surface 69
4.2.3 Extended-laboratory experiments 71
4.2.3.1 Treatment of olive tree leaves 71
4.2.3.2 Treatment of the parasitization surface and olive
tree leaves 72
4.2.4 Semi-field experiment 73
4.2.5 Dual choice and no-choice experiments 75
4.2.5.1 Psyttalia concolor 75
4.2.5.2 Chilocorus nigritus 76
4.3 Results 79
4.3.1 Direct mortality 79
4.3.2 Life span 80
4.3.3 Emergence 84
4.3.4 Beneficial capacity 85
4.3.5 Dual choice and no choice experiments 88
4.3.5.1 Psyttalia concolor 88
4.3.5.2 Chilocorus nigritus 92
Index
iv
4.4 Discussion 95
4.4.1 Lethal and sublethal effects of kaolin, Bordeaux
mixture and copper oxychloride 96
4.4.2 Effects of kaolin treated surfaces in dual choice and no-
choice experiments 102
4.5 Appendix (tables of results) 104
5. ECDYSONE AGONISTS: EFFICACY AND ECOTOXICOLOGY ON BACTROCERA OLEAE AND PSYTTALIA CONCOLOR. INSECT TOXICITY BIOASSAYS AND MOLECULAR DOCKING APPROACHES 111
5.1 Introduction 111
5.1.1 The ecdysone receptor 112
5.2 Objectives and procedures 113
5.3 Materials and methods 114
5.3.1 Insect bioassays 114
5.3.2 EcR-LBD sequence 116
5.3.3 Confirmation of expression of EcR in the ovaries 122
5.3.4 Modeling of PcEcR-LBD and docking studies 123
5.4 Results 124
5.4.1 Efficacy and toxicological effects of methoxyfenozide,
tebufenozide and RH-5849 124
5.4.2 BoEcR-LBD sequence 127
5.4.3 PcEcR-LBD sequence, phylogenetic tree and expression in
the ovaries 130
5.4.4 Modeling of BoEcR-LBD and PCEcR-LBD and docking studies 135
5.5 Discussion 142
5.5.1 Effciacy and toxicology of insect gorwth regulators
on Bactrocera oleae and Psyttalia concolor,
respectively 143
5.5.2 Molecular docking studies 148
5.6 Appendix (tables of results) 151
6. CONCLUSIONS 155
Index
v
7. REFERENCES 157
APPENDIX 183
Index of figures 183
Index of tables 189
Acronyms 191
Index
vi
Resumen /Summary
vii
RESUMEN
Los tratamientos fitosanitarios en el olivar siguen siendo hoy en día uno de los
métodos de control más empleados en la lucha contra las principales plagas y
enfermedades que afectan a este cultivo: la mosca del olivo, Bactrocera oleae (Rossi),
el prays, Prays oleae (Bernard), la cochinilla del olivo, Saissetia oleae (Olivier), y el
repilo, provocado por el hongo Spilocaea oleagina Fries. Sin embargo, y como la nueva
legislación en materia fitosanitaria se dirige hacia una gestión integrada de las plagas y
enfermedades, continúa siendo importante evaluar y conocer los efectos que los
pesticidas tienen sobre los enemigos naturales presentes en los diferentes
agrosistemas.
Una parte de este trabajo ha consistido en el estudio de los efectos directos e
indirectos del caolín y dos formulados a base de cobre (caldo bordelés y oxicloruro de
cobre), mediante diferentes ensayos de laboratorio, laboratorio extendido y
semicampo en los enemigos naturales Psyttalia concolor (Szèpligeti)., parasitoide de la
mosca del olivo, y Chilocorus nigritus (F.), depredador de diaspídidos. Este depredador
se ha utilizado en lugar de C. bipustulatus (L.), que es la especie que se encuentra en
los olivares. El caolín actúa fundamentalmente como repelente de los insectos y/o
disuade la oviposición. En el olivar se emplea para el control de la mosca y el prays. El
cobre se emplea en el control de enfermedades fúngicas y bacterianas, como el repilo
y otras enfermedades del olivar. En ninguno de los ensayos realizados se encontraron
diferencias estadísticamente significativas con respecto a los controles, excepto
cuando se evaluó la toxicidad oral de los productos en las hembras de P. concolor. En
este caso, el caolín y el oxicloruro de cobre causaron una mortalidad mayor de las
hembras a las 72 horas del tratamiento, y tanto el caolín como las dos formulaciones
de cobre redujeron la supervivencia. Los parámetros reproductivos sólo se vieron
Resumen /Summary
viii
afectados negativamente por la ingesta de caolín. Además de los ensayos anteriores,
en el caso del caolín, por su particular modo de acción, se plantearon un ensayo de
elección y otro de no elección. Tanto las hembras de P. concolor como los adultos de C.
nigritus mostraron una clara preferencia por las superficies no tratadas con el
producto cuando se les ofrecía la posibilidad de elegir entre una superficie tratada y
otra sin tratar. Cuando esa posibilidad no existía, no se detectaron diferencias
estadísticamente significativas entre los tratamientos y los controles.
Además se ha comprobado también la eficacia y la selectividad de tres insecticidas
reguladores del crecimiento (metoxifenocida, tebufenocida y RH-5849) sobre B. oleae
y P. concolor, respectivamente. Además de estudios para evaluar la toxicidad en
laboratorio de los insecticidas, se extrajo RNA de los insectos y con el cDNA obtenido
se secuenció y clonó el dominio de unión a ligando (LBD) del receptor de ecdisona de
ambos insectos. Posteriormente, se obtuvo la configuración en tres dimensiones del
LBD de ambas proteínas y se estudió el acoplamiento de las moléculas de los tres
insecticidas en la cavidad que forman las 12 α-hélices que constituyen el LBD de cada
una de las proteínas. Tanto los ensayos de toxicidad como las técnicas moleculares han
demostrado que metoxifenocida y tebufenocida no tienen ningún efecto nocivo ni en
B. oleae ni en P. concolor. RH-5849, sin embargo, resultó inocuo para el parasitoide
pero redujo notablemente la supervivencia de los adultos de la mosca, especialmente
cuando entraron en contacto con el residuo fresco. El estudio del acoplamiento de la
molécula de este insecticida ha mostrado que podría más o menos encajar en la
cavidad que forman las hélices del LBD de la proteína de B. oleae, por lo que la
búsqueda de nuevos insecticidas para el control de la mosca del olivo podría realizarse
tomando como modelo la molécula de RH-5849.
Resumen /Summary
ix
SUMMARY
Pesticide applications are still one of the most common control methods against the
main olive grove pests and diseases: the olive fruit fly, Bactrocera oleae (Rossi), the
olive moth, Prays oleae (Bernard), the black scale, Saissetia oleae (Olivier), and the
olive leaf spot, caused by the fungus Spilocaea oleagina Fries. However, and because
the new pesticide legislation is aimed at an integrated pest and disease management,
it is still important to evaluate and to know the ecotoxicology of pesticides on the
natural enemies of the different agrosystems.
A part of this work has been focusses on evaluating the direct and indirect effects of
kaolin particle films and two copper-based products (Bordeaux mixture and copper
oxychloride) through different laboratory, extended laboratory and semi-field
experiments. Two natural enemies have been chosen: Psyttalia concolor (Szèpligeti), a
parasitoid of the olive fruit fly, and Chilocorus nigritus (F.), predator of Diaspididae.
This predator has been used instead of C. bipustulatus (L.), which is the species found
in olive orchards. Kaolin mainly acts as a repellent of insects and/or as an oviposition
deterrent. It is used in olive groves to control the olive fruit fly and the olive moth.
Copper is applied against fungal and bacterial diseases. In olive groves it is used against
the olive leaf spot and other diseases. No statistical differences were found in any of
the experiments performed, compared to the controls, except when the oral toxicity of
the products was evaluated on P. concolor females. In this case, kaolin and copper
oxychloride caused a higher mortality 72 hours after the treatments, and both kaolin
and the two copper formulations decreased females’ life span. Reproductive
parameters were only negatively affected when kaolin was ingested. Apart from these
experiments, due to the uncommon mode of action of kaolin, two extra experiments
were carried out: a dual choice and a no-choice experiment. In this case, both P.
Resumen /Summary
x
concolor females and C. nigritus adults showed a clear preference for the untreated
surfaces when they had the possibility of choosing between a treated surface and an
untreated one. When there was no choice, no statistical differences were found
between the treatments and the controls.
Furthermore, the efficacy and the selectivity of three insect growth regulators
(methoxyfenozide, tebufenozide and RH-5849) on B. oleae and P. concolor,
respectively, have also been evaluated. In addition to laboratory experiments to
evaluate the toxicity of the insecticides, also molecular approaches were used. RNA of
both insects was isolated. cDNA was subsequently synthesized and the complete
sequences of the ligand biding domain (LBD) of the ecdysone receptor of each insect
were then determined. Afterwards the three dimensional structures of both LBDs were
constructed. Finally, the docking of the insecticide molecules in the cavity delineated
by the 12 α-helix that composed the LBD was performed. Both toxicity assays and
molecular docking approaches showed that either methoxyfenozide or tebufenozide
had no negative effects nor on B. oleae nor on P. concolor. In contrast, RH-5849 had no
deleterious effect to the parasitoid but decreased olive fruit fly adults’ life span,
especially when they were in contact with the fresh residue of the insecticide applied
on a glass surface. The docking study of RH-5849 molecule has shown a very light
hindrance with the wall of the LBD pocket. This means that this molecule could more
or less adjust in the cavity. Thus, searching of new insecticides for controlling the olive
fruit fly could be based on the basic lead structure of RH-5849 molecule.
Introduction
1
Chapter 1
INTRODUCTION
1.1 The olive tree
The olive tree, Olea europaea L.,
is a treelike species of the Oleaceae
family, within cultivated olive trees,
belonging to the sativa subspecies,
and wild olive trees, subspecies
sylvestris, are included. Plants of this
family are mainly trees and bushes
and some of them produce essential
oils in their flowers or fruits; only olive tree fruits are edible (Lombardo, 2003;
Rapoport, 2008).
Its taxonomical classification is: class Angiosperms, subclass Ranunculidae,
superorder Lamianae, order Lamiales, familiy Oleaceae, subfamily Oleoideae, genus
Olea, species O. europaea L. (Devesa, 2005).
It is a long‐cycle crop, as it takes a long time to begin to produce olives, to reach its
peak yield and to start its decline (Civantos, 2008). Its irregular production depends on
climatic conditions, pests, diseases and the alternate bearing (named “vecería” in
Spanish) (Orenga and Giner, 1998). According to Cirio (1997), olive growing is
described as a considerable environmental‐variability depending crop, which is highly
influenced by climatic, soil, biologic, agronomic, socioeconomic and cultural
conditions.
Figure 1: An olive grove in Castile‐La Mancha
Introduction
2
The genetic homogeneity of every cultivar is high because of the vegetative
propagation techniques that have traditionally been used. On one hand, first olive
farmers from every region used to select, among the wild olive trees, those which
were the most productive, had the biggest fruits and the highest oil‐content, allowing
the conservation of the characteristics of those original cultivars. On the other hand,
the spreading of these first local cultivars allowed its hybridization with other from
different regions, achieving the stability of the selected individuals through vegetative
reproduction techniques (Barranco, 2008).
1.1.2 The origin of the crop
The olive crop was one of the first fruit trees cultivated by man. It has been claimed
that its cultivation dated back to 4,000‐3,000 years BC in the area of Palestine. After
that, it spread out to all the countries of the Mediterranean region. As a consequence
of Columbus’s, Magellan’s and Elcano’s voyages, it started to be cultivated in the New
World. Nowadays it is also grown in North America, South Africa, China, Japan and
Australia (Lombardo, 2003; Civantos, 2008), although it is considered that around 98%
of olive oil world heritage is located in the Mediterranean area (Civantos, 2008).
It is not clear when olive cultivation started in Spain, but the most accepted
hypothesis pointed to Phoenicians and Greeks as its introducers. During the Roman
period, Hispania olive oil trade spread out all over the western Roman Empire
(Pajarón, 2007), which resulted in the expanse of the crop in the Betis Valley
(nowadays known as Guadalquivir area), getting up to Sierra Morena. The railway‐
building during the 19th Century favoured olive cultivation in the interior areas of the
country and filled out the Spanish olive crop map (AAO, 2011).
At the beginning of the second half of the last century, the olive growing system
changed from a traditional into a modern one, due to the increase of labour salaries.
This fact caused the replacement of the labor by machinery and the introduction of
monoculture crops. However, concerning olive groves, these changes were not as big
Introduction
3
as in other crops because of the longevity of the trees, mostly affecting cultural work,
while the structure of the plantation and the variety of the trees were maintained
(Pajarón, 2007).
1.1.3 Geographical distribution
The olive tree habitat is located between 30º and 45º, both in the north and in the
south, in regions with a Mediterranean climate (characterized by hot and dry
summers), and up to 1,000 metres above sea level. In the southern hemisphere it is
also founded in more tropical latitudes whose climate is modified by altitude (Cirio,
1997; Rotundo and De Cristofaro, 2003; Civantos, 2008).
Optimal climatic conditions are those whose minimum temperatures are not lower
than ‐5ºC, the average precipitation is no more than 500‐550 mm and the soil has a
balanced composition, is rich in organic matter and its pH is neutral or slightly basic.
Thanks to its huge adaptation capacity, it is able to grow also in very poor soils and dry
locations (<250mm yearly) (Cirio, 1997).
1.1.4 Importance of the crop
The olive tree is the iconic tree of the Mediterranean area where, along with vines
and cereals, it helps define the most striking features of the agricultural landscape
(Duarte et al., 2008). Apart from its economic, social and cultural importance, its
environmental value must also be taken into account, because of the high level of
biodiversity and low rates of soil erosion found in this agrosystem (Pajarón, 2007).
Introduction
4
1.1. 4. 1 Economic importance
World olive growing is estimated at around 1,000 million of olive trees, occupying a
surface of 10 million hectares. 98% is located in the Mediterranean basin, 1.2% in
America, 0.4% in Asia and the other 0.4% in Oceania. Average world olive fruit
production is estimated in 16 million tons, of which 90% goes to olive oil production
and the other 10% to table olives (Civantos, 2008).
The main olive oil producing countries in the world are Spain (39%), Italy (22%),
Greece (16%), Tunisia (6%), Turkey (5%), Syria (4%), Morocco (2%), Portugal (2%),
Algeria (1%) and Jordanian (1%) (Civantos, 2008).
According to the data of the “International Olive Council” (IOC), the world olive oil
production during the 2009/2010 campaign was 3,024,000 t, and the provisional figure
for 2011, 2,948,000 t (IOOC, 2011).
1.1.4.2 Social importance
Traditional olive growing has a significant socio‐economical role, as it provides an
important source of income and employment, particularly in marginal regions, strongly
dependent upon agricultural activities (Duarte et al., 2008). As olive‐growing areas,
many villages are trying to offer different activities for rural tourism, in order to earn
money not only by selling their olives. In Spain, different initiatives are being
encouraged, such as the opening of the “Museo de la Cultura del Olivo” (Olive Tree
Culture Museum) in Baeza (Jaén) or the recognition of labels granted to some
“guarantee of origin and quality” of some varieties. The promotion of the oleo‐tourism
allows people to know more about the crop, the villages and their inhabitants, the
properties of olive oil and its culinary uses (Anonymous, 2009a,b).
Some studies have been carried out about the olive oil benefits on human health.
This product has been not only the basis of the Mediterranean diet for ages, but of
Introduction
5
plenty more besides: it is used to make cosmetics, in religious rituals, in medicine and
it also has an important role in mythology. Furthermore, during the last few decades it
has been shown that diet is the most important environmental factor affecting the
quality of life, and olive oil is necessary in order to reach a healthy old age and to
prevent the most important causes of mortality all over the world (CIAS, 2008).
1.1.4.3 Environmental importance
Olive trees are essential in the Mediterranean ecosystem because their fruits are
important foodstuffs for the fauna related to it. Moreover, because trees do not loose
their leaves, and thanks to the shelter that foliage provides, a special microclimate is
created within the olive canopy during the winter. This makes it warmer and more
attractive than the outside (exposed to the wind and to low temperatures). Indigenous
and wild flora, which includes around one thousand of herbaceous and woody species
(Cirio, 1997), benefit from these special conditions as well (Saavedra, 1998).
1.1.5 Olive growing in Spain
Spain is the first olive oil and table olive producer and exporting country in the
world (Civantos, 2008), having the longest olive grove surface (2,580,577 ha) and the
largest number of olive trees (282,696,000) (AAO, 2011; MARM, 2011a). Because of its
wider territorial spreading and its economical, social, environmental and health
importance, the olive growing is one of the main sectors of the Spanish agricultural
system. Olive trees can be found all over Spain, except in Galicia, Asturias and
Cantabria (Civantos, 2008; AAO, 2011).
According to the data published by the Ministry of the Environmental and Rural and
Marine Environs (Ministerio de Medio Ambiente y Medio Rural y Marino); from
December 2011, Ministerio de Agricultura, Alimentación y Medio Ambiente), Spanish
olive oil production in 2011 was estimated at 1,357,400 t and 485,300 t of table olives
(MARM, 2011b).
Introduction
6
During the last years, the Spanish olive grove system has undergone an updating of
techniques which are increasing its productivity. In the 60’s and the 70’s, old trees or
trees planted in marginal areas were pulled out and replaced with other crops which
were more suitable or more profitable. Simultaneously, the Spanish administration
established the “Plan of the restructuring of productivity and conversion of olive
groves” (Plan de Reestructuración Productiva y de Reconversión del Olivar) in which
proceedings to improve or increase the olive grove productivity figured. As a
consequence, areas well adapted to this crop increased the surface dedicated to them
and their production, while the less adapted ones cut down on it (Civantos, 2008).
There are also other changes concerning this crop, such as the increase of irrigated
olive groves, the use of higher denseness plantation (2,000 – 3,000 trees per hectare),
the choosing of the trees whose trunks are better adapted for mechanical harvesting
and the development of a nursery industry dedicated to obtain plants with just one
trunk and an early fruiting. Furthermore, farmers are nowadays aware of the
importance of using the suitable growing and oil‐making techniques that guarantee a
better quality of the olive oil produced (Rallo, 1998).
1.1.6 Pests and diseases: characteristics of the most
important pests and diseases of olive groves
From a phytosanitary approach, olive groves can be considered as simple
agricultural systems. This is due to their environmental stability, the orientation of its
production, the small number of really harmful parasitic, the tolerance to produced
damages, and the abundance of natural enemies (Cirio, 1997). Because of these facts,
the number of chemical treatments remains still low compared to other crops
(Alvarado et al., 2008). However, the olive tree grows closely related to several biotic
and abiotic factors which not only establish the specificity of the present organisms,
but also determine their population changes. A single change in one of them affects
the whole agrosystem balance (Iannotta, 2003; Alvarado et al., 2008). For example,
although more than 225 potential damage organisms have been cited since olive tree
cultivation started (Haniotakis, 2005), the most important pests affecting this crop are
the olive fruit fly and the olive moth. However, from the 1960’s up to nowadays, as a
Introduction
7
consequence of the abuse in the use of pesticides to fight against these two pests,
another one, the black scale, has increased its population, causing different damage.
Troubles brought on by other pests, like other scales, mites, etc., have also risen up
due to this traditional pest management system (Alvarado et al., 2008).
Losses caused by pests, diseases and weeds are estimated to reach 30% of the crop,
of which 15% are due to the action of insects. Amongst them, 10% are attributed to
the main olive grove pests (Haniotakis, 2005).
According to this author, four pest categories have been established in the
Mediterranean area:
‐ Key or major pests: they are the most damage‐causing ones. An annual
monitoring of them is required. The olive fruit fly, Bactrocera oleae (Rossi)
(Diptera, Tephritidae), is the only one considered in this category.
‐ Secondary important pests: their losses have an occasional or local importance.
The olive moth Prays oleae (Bernard) (Lepidoptera, Yponomeutidae) and the
black scale Saissetia oleae (Olivier) (Homoptera, Coccidae) are included in this
category.
‐ Pests of a limited economic or localized importance: pests that change over
time and cause locally and/or occasionally economic losses.
‐ Pests without much economic importance: they rarely cause damage or losses.
The main olive grove phytophagous and pathogens are included in Tables 1 and 2.
Introduction
8
Table 1: Main olive grove phytophagous and their eating habits1,2
Key pests and secondary important pests
Olive fruit fly (mosca del olivo): Bactrocera oleae (Rossi) Monophagous
Olive moth (polilla, prays): Prays oleae (Bernard) Olygophagous
Black scale (cochinilla de la tizne, caparreta): Saisseta oleae (Olivier) Polyphagous
Pests of economically moderate importance
Olive bark beetle (barrenillo, palomita): Phloeotribus scarabaeoides (Bernard)
Olygophagous
Olive bark borer (barrenillo negro): Hylesinus oleiperda (F.) Olygophagous
Olive pyralid, jazmines moth, olive leaf moth (polilla del jazmín, glifodes): Palpita unionalis (Hübner)
Olygophagous
Olive pyralid moth (abichado): Euzophera pingüis (Haworth) Olygophagous
Olive gall mite (sarna, erinosis o acariosis del olivo): Aceria oleae (Nalepa) Monophagous
Secondary pests with local or temporary importance
Apple mussel scale, oystershell scale (serpeta o coma del manzano): Lepidosaphes ulmi (L.)
Polyphagous
Olive parlatoria scale, (parlatoria, piojo violeta): Parlatoria oleae (Colvee) Polyphagous
Olive psyllid (algodón, tramilla): Euphyllura olivina (Costa) Monophagous
Olive weevil, oziorrinco (otiorrinco): Otiorhynchus cribricollis (Gyllenhal) Polyphagous
White grubs, European cockchafer (gusanos blancos): Melolontha papposa Illiger, Ceramida cobosi (Bagena)
Polyphagous
Olive thrips (arañuelo): Liothrips oleae (Costa) Monophagous
Olive midge (mosquito de la corteza): Resseliella oleisuga (Targioni‐Tozzetti)
Olygophagous
Cicada (cigarra): Cicada barbara (Stal) Polyphagous
Leopard moth (zeuzera o taladro amarillo): Zeuzera pyrina (L.) Polyphagous
Birds, rodents, rabbits and hares (Oryctolagus cuniculus (L.) and Lepus europaeus Pallas)
Polyphagous
1Phytophagous have been arranged in groups, according to their economic importance and their diet habits (monophagous, olygophagous or polyphagous). 2The Spanish name of the pests is indicated in brackets. Sources: (Iannotta, 2003; Alvarado et al., 2008).
Introduction
9
Table 2: Olive grove pathogenic agents and abiotic diseases. Significance of the damage caused by them1,2
Bacteria
Olive knot disease, tuberculosis of olive tree (tuberculosis del olivo): Pseudomonas savastanoi pv. savastanoi
Moderate‐High
Foliar diseases‐Fungus
Olive leaf spot (repilo): Spilocaea oleagina Fries (= Cyclonium oleaginum Cast.) High
Anthracnose (antracnosis, aceituna jabonosa): Colletotrichum gloeosporioides Penz. (= Gloeosporium olivarum Alm.)
Moderate
Dalmatian disease (escudete de la aceituna): Camarosporium dalmaticum (= Sphaeropsis dalmatita Thüm.)
Low
Cercosporosis or leaf spot disease on olive (emplomado de la aceituna): Pseudocercospora cladosporioides (= Cercospora cladosporioides Sacc.)
Moderate
Coin canker (lepra): Phlyctema vagabunda Desm.(= Gloeosporium olivae Petri) Low
Sooty mould, fumagina (fumagina, negrilla): Capnodium elaeophilum Prill. Low
Other fruit rots (otras podredumbres del fruto): Fusarium, Alternaria, Cladiosporium…
Low
Other foliar fungal (otras micosis foliares): Stictis, Leveillula, Phylactina Not
important
Trunk decay (caries del tronco): Fonus, Phellinus, Polyporus, Stereum Low
Chancre (chancro) Low
Root fungus
Verticillium wilt, soil borne fungus (verticilosis): Verticillum dahliae High
Thick root rot fungus (podredumbre de raíces gruesas): Armillaria, Rosellinia, Omphalotus
Low
Thin root rot fungus (podredumbre de raicillas): Phytophtora, Cylindrocarpon, Fusarium
Moderate‐ Low
Virus
Malformation, yellowish (malformaciones, amarilleo): unidentified virus Not important Latent infections, yellowish (infecciones latentes, amarilleo): Nepovirus, Cucumovirus, Oleavirus
Not important
Nematode
Root lesions: nodes, galls (nódulos, agallas): Meloidogyne, Pratylenchus… Not important
Phanerogam
Mistletoe, Jopo, Cuscuta Not important
Abiotic diseases
Lack of essential nutrients : boron, iron, potassium Moderate‐ Low
Other damages: frost, drought, flooding… High ‐ Low 1The table has been organised according to the different pathogen agents or the causes of abiotic diseases. Their economic importance, according to the damage caused, has also been pointed out as high, moderate, low or unimportant. 2The Spanish name of the pests is indicated in brackets.
Sources: Iannotta, 2003; Trapero and Blanco, 2008; Trapero et al., 2009
Introduction
10
In intensive farming systems, the high‐density plantations and the continuous
presence of fresh shoots during the whole vegetative cycle allow phytophagous
species to have a constant availability of food. Apart from traditional damaging
organisms, others which had never caused significant damage on the crop could be
now categorized as potential pests or disease‐causing agents (Torrell and Celada,
1998).
11.6. 1 The olive fruit fly (Bactrocera oleae )
Bactrocera oleae distribution is primarily
limited to the regions where cultivated and
wild olive trees are found. Today, the olive
fruit fly is reported throughout the
Mediterranean basin, Africa and from Middle
East to India (Guerrero, 2003; Alvarado et al.,
2008). It is also found in all the countries
where olive crop has been introduced during
recent years, as USA, China, but it has not been observed in South America and
Australia (Civantos, 1999; Iannotta, 2003; Rotundo and De Cristofaro, 2003; Daane and
Johnson, 2010).
It was recorded attacking olives in biblical times and has long been a major pest in
the Mediterranean basin. Larvae are monophagous on olive fruits in the genus Olea,
including O. europaea (cultivated and wild), O. verrucosa and O. chrysophylla (Daane
and Johnson, 2010). However, it has also been reared in laboratory on Ligustrum and
Jasminum berries (Civantos, 1999; Alvarado et al., 2008) and on tomatoes (Navrozidis
and Tzanakakis, 2005).
As soon as adults emerge, they look for the sweetened and nitrogenous substances
they need as nutritional requirements. They feed on a variety of organic sources
including insect honeydews (for example, black scale honeydew), plant nectar, plant
Figure 2: Female of B. oleae (Anonymous, 2009c)
Introduction
11
pollens and fruits exudates (De Andrés, 1991), and also bird dung, bacteria and yeasts.
Females lay their eggs in ripening but also in green fruits, in which the newly hatched
larvae feed upon the pulp. They pupate inside the olive or exit to do it on the ground
(Daane and Johnson, 2010). Larval development is largely temperature dependent. It
has been reported that the lower temperature threshold is 6ºC and the upper one is
35ºC, while the optimal temperature ranges from 20º to 25ºC. Relative humidity is
only important if its value is low and temperatures are high during a long period (De
Andrés, 1991; Civantos, 1999; Rotundo and De Cristofaro, 2003; Alvarado et al., 2008).
The number of annual generations depends not only on the temperature, but also
on the relative humidity, on the microclimate within the olive canopy and on the
availability and quality of olive fruits. This results in variation in the reported number
of generations per season within the fly’s endemic range, which encompasses a variety
of climatic regions. Two to three generations have been reported in continental
climate areas, while three generations are always common in coastal regions
(Civantos, 1999), or even four (De Andrés, 1999; Alvarado et al., 2008). Some authors
have also reported up to six or seven generations (De Andrés, 1991).
Several studies have shown that olive cultivars vary in their susceptibility to the
olive fruit fly. Some of the factors that possibly play a role include fruit size and weight,
colour, fruit epicarp hardness, surface covering (mainly aliphatic waxes), phenological
stage of the crop, and chemical factors (Daane and Johnson, 2010). Oil destined
cultivars are less susceptible to olive fly attack than table olive cultivars (Civantos,
1999; Rotundo and De Cristofaro, 2003; Alvarado et al., 2008). It has also been
demonstrated that the most susceptible fruits in a tree are the biggest and those
which are in the outer part of the tree’s crown (Alvarado et al., 2008).
The relative importance of the economic damage provoked depends either on the
olive fly population density or on the period of the year considered (De Andrés, 1991;
Civantos, 1999; Alvarado et al., 2008; Daane and Johnson, 2010). In areas of the world
where the olive fruit fly is established, it has been reported as responsible for losses of
up to 80% of oil value and 100% of some table cultivars. It has been estimated to
Introduction
12
damage 5% of total olive production, resulting in economic losses of approximately
USD 800 million per year (Haniotakis, 2005; Daane and Johnson, 2010). In table olives
damage is more important because
oviposition stings on fruits totally reduce their
value (Alvarado et al., 2008). Therefore, the
tolerable infestation level is near zero larvae
per fruit (Daane and Johnson, 2010).
Economic damage can be classified as direct
and indirect:
Direct damage: premature fruit dropping or loosing of fruit weight resulting
from larvae feeding the pulp. The production rates can decrease between 5
and 10 %
Indirect damage: they are referred to the lowered quality and value of
pressed oil due to increased acidity as a result of microorganism growth
inside olive tree fruits (bacteria, yeasts and mould).
In the Mediterranean area, it seems that none of the olive fruit fly’s predators or
parasitoids is able to totally control the pest (González‐Núñez, 2008). According to the
earlier surveys, it appeared that sub‐Saharan Africa might provide a rich source of
natural enemies of B. oleae. The most recent surveys suggest that a smaller group best
represents the primary parasitoids attacking olive fruit fly in its native range. Most of
these wasps are synovigenic, koinobiont, larval‐pupal or larval‐prepupal parasitoids in
the Opiinae subfamily. The exception is the idiobiont larval ectoparasitoid Bracon celer
Szépligeti. (Hymenoptera, Braconidae). Some chalcid parasitoids have also been reared
from olive fruit fly, although many of the species are polyphagous parasitoids that may
opportunistically attack the olive fruit fly (Daane and Johnson, 2010). In the
Mediterranean basin the most common parasitoids found are the Hymenoptera
Eupelmus urozonus Dalman (Eupelmidae), Pnigalio mediterraneus (Ferriere and
Delucchi) (Eulophidae), Eurytoma martellii Domenichini (Eurytomidae), Psyttalia
concolor (Szèpligeti) (Braconidae) and Cyrtoptyx latipes (Rondani) (Pteromalidae)
Figure 3: Detail of a B. oleae larva in an olivefruit. Microorganism growth can be observed inthe feeding gallery
Introduction
13
(Iannotta, 2003; Rotundo and De Cristofaro, 2003). The most commonly found are E.
urozonus and P. mediterraneus, but they are not effective enough to control B. oleae
populations (Civantos, 1999). Neonate larvae of the olive fruit midge, Lasioptera
berlesiana Paoli (Diptera, Cecydomiidae), feed on the eggs of B. oleae. The problem is
that females, at the time of egg‐laying, also introduce the fungus S. dalmatica (C.
dalmaticum), which causes Dalmatian disease in olive fruits. There seems to be a large
number of B. oleae larvae and pupae predators too. Predators attack B. oleae when
third instar larvae drop to the ground to pupate beneath the trees. This group of
predators includes ants, Carabidae, Staphyllinidae, spiders and earwigs (González‐
Núñez, 2008; Daane and Johnson, 2010). Some authors also take into account the role
of insectivorous birds and birds which feed on olive fruits because they can decrease B.
oleae populations of wild, overgrown and ornamental olive trees (González‐Núñez,
2008).
Over the last four decades B. oleae management has been based on the use of
different insecticides (such as organophosphates, pyrethroids and spinosad). However,
the fly has already evolved resistance to dimethoate (Daane and Johnson, 2010) and
spinosad (Kakani et al. 2010). Furthermore, the continued use of such products has
been questioned in recent years, especially by environmentalists. For example, in the
case of dimethoate, which is used to control both B. oleae and the anthophagus
generation of the olive moth, a strong and dramatic effect on the abundance of
different trophic groups has been reported (Santos et al., 2010). In addition, residues
of pesticides have been detected both in olive oil and in the environment where olives
are grown. These facts have caused concern in most olive growing countries and have
lead to a concerted effort to reduce the amount of pesticides used in this crop
(Montiel‐Bueno and Jones, 2002).
Introduction
14
1.1.6.2 The olive moth (Prays oleae )
Prays oleae (Bernard) (Lepidoptera:
Yponomeutidae) is considered the second
important pest in olive groves. It is found
throughout the Mediterranean basin. Although
its main host plant is the olive tree, it can also
feed on other Oleaceae species (Rotundo and De
Cristofaro, 2003; Alvarado et al., 2008).
It has three generations per year, synchronized with the olive tree phenology. The
first one infests the leaves (phyllophagous), the second one the flowers (antophagous)
and the third one the fruits (carpophagous). The most harmful is the third one
(Iannotta, 2003) because feeding damage causes premature fruit dropping. Chemical
treatments against the first or the second generation are only justified when trees are
young or when moth population is high and the number of flowers is low (Rotundo and
De Cristofaro, 2003; Alvarado et al., 2008).
Climatic conditions are very important to the olive moth development and
determine its presence in the different geographical regions (Civantos, 1998a). Cold
weather during the winter (<10ºC) or hot weather (>30ºC) and a high relative humidity
percentage (> 70%) during the summer control the populations. A relative humidity
percentage below 50% makes survival difficult for the eggs (Alvarado et al., 2008;
Civantos, 1998a; Rotundo and De Cristofaro, 2003).
Parasitism rate is high and varies among generations, years and geographical areas.
It is responsible for between 10 and 50% of moth population mortalities. Amongst
their parasitoids, the Hymenoptera Ageniaspis fuscicollis var. praynsicola (Silvestri)
(Encyrtidae), Chelonus eleaphilus Silvestri (Braconidae) (both of them specific to prays),
Diadegma armillata (Gravenhorst) (Ichneumonidae), Apanteles xanthostigmus
(Haliday) (Braconidae), the Eulophidae Pnigalio mediterraneus (Ferriere and Delucchi)
Figure 4: Adult of P. oleae (Anonymous, 2009d)
Introduction
15
and P. pectenicornis (L.), and other Trichogrammatidae species stand out. They
parasitize larvae, pupae or eggs (Civantos, 1998a; González‐Núñez, 2008). Among their
predators, the chrysopids Chrysoperla carnea (Stephens) and Dichochrysa flavifrons
(Brauer) (Neuroptera, Chrysopidae) are very important (González‐Núñez, 2008). They
feed on the eggs (BOJA, 2002; Iannotta, 2003; Rotundo and De Cristofaro, 2003;
Alvarado et al, 2008), although they can also feed on larvae of the phyllophagous and
the anthophagous generations (González‐Núñez, 2008). Also different spider species,
especially mites which feed on eggs and larvae (Civantos, 1998a), ants, Heteroptera
and Coleoptera are important predators of the olive moth (González‐Núñez, 2008).
Bacteria, fungi, protozoa and virus can also affect the pest, but they are not usually
efficient enough (Civantos, 1998a).
1.1.6.3 The black scale (Saissetia oleae )
The black scale, Saisettia oleae (Olivier)
(Homoptera, Coccidae), is spread all over the world,
but mainly in the Mediterranean basin. It is found in
olive groves and citrus, but also in some other trees
and bushes. It prefers shady areas and humid
environments (Rotundo and De Cristofaro, 2003;
Alvarado et al., 2008).
They feed on the trees by piercing of host tissues and sucking the sap. Although
direct damage is not really significant, the black fungi developing on the honeydew
they deposit on trees (sooty mould) are responsible for reducing photosynthesis and
can be referred to as contamination, often rendering plants or fruits unmarketable
(Iannotta, 2003; Alvarado et al., 2008). Furthermore, honeydew is one the of B. oleae
adults’ favourite sweet foodstuff, so it can also attract them (Guerrero, 2003).
Saissetia oleae holds a high number of natural enemies which parasitize different
nymphal stages and even preovipositional females. They are mainly Hymenoptera
Figure 5: S. oleae adult females
Introduction
16
parasitoids of the genus Metaphycus (M. helvolus (Compere) and M. lounsburyi
(Howard); Encyrtidae) and other native Aphelinidae, such as Coccophagus lycimnia
(Walker), C. semicircularis (Föster) and C. scutellaris (Dalman), which also parasitize
other Coccidae species (González‐Núñez, 2008). Among predators, the most important
are the Hymenoptera Scutellista cyanea (=S. caerulea) (Mostchulsky) (Pteromalidae),
whose larvae feed on the eggs under the female scale, and some Coleoptera
Coccinellidae, such as Chilocorus bipustulatus (L.) (Iannotta, 2003; Rotundo and De
Cristofaro, 2003; Alvarado et al., 2008), Brumus quadripustulatus (L.), Rhyzobius spp.,
Scymnus spp. The Lepidoptera Eublemma scitula Rambur (Noctuidae) and the
Neuroptera Coniopteryx spp. (Coniopterygidae) are important as well (González‐
Núñez, 2008).
1.1.6.4 The olive leaf spot (Spilocaea oleagina )
The olive leaf spot, caused by the
fungus Spilocaea oleagina Cast., is the
most common disease in Spanish olive
orchards (Trapero et al., 2009). Its
importance is due both because of the
extensive areas where it can be found
and because of the damage caused when
development conditions are in its favour (rainy years, high density and poorly aerated
plantations and olive groves irrigated or close to wet areas) (Guerrero, 2003; Pajarón,
2007; Trapero and Blanco, 2008). Despite the fact that the fungus is only pathogenic
on olive trees, morphologically similar fungus have been described as disease‐causing
on Ligustrum, Phillyrea and Quercus species (Trapero et al., 2009).
Typical symptoms of the disease are the black circular spots on the adaxial surface
of the leaves, often surrounded by a yellowish hallow. Leaves fall prematurely and
death of twigs may ensue. Conidia are spread out mainly by the rain. Once they are on
the susceptible tissues of the plant, they germinate only if there is water available or
Figure 6: Olive leaf spot
Introduction
17
the relative humidity is higher than 98% and temperature swung by around 0º and
27ºC, being 15ºC the optimum. Consequently, cultural practices helping aeration of
the trees are very important (Trapero et al., 2009). Premature defoliation has serious
consequences on the plant vegetative activity and yield. It could reduce either the
differentiation rate of auxiliary buds into flower‐bearing shoots or the productivity of
the trees. Sometimes, it can also infect fruit peduncles and provoke their premature
fall, which decreases their quality and fatty yield. Olive oil quality from these fruits,
however, remains unaffected (Guerrero, 2003; Pajarón, 2007; Trapero and Blanco,
2008).
1.2 Control of pests and diseases
The use of different substances with insecticide properties dates from Roman and
Greek times. During the 19th Century, artificial fertilizers were developed. They were
cheap, powerful and easy to transport in bulk. Similarly, it also occurred in the 1940’s
with chemical pesticides, leading to the decade being referred to as the “Pesticide era”
(MARM, 2006). Indeed, the synthesis of the DDT in 1939 seemed to have solved all
pest problems (Dent, 1991; Casida and Quistad, 1998).
Traditional agricultural systems are based on the use of different chemical products,
without taking into account the possible negative impacts caused by their widely and
uncontrolled use and abuse. For example, environmental contamination, intoxications
or the appearance of resistances to insecticides among the pests have already been
reported in different crops, including olive groves (Cirio, 1997; De Ricke, 1998;
Chamorro and Sánchez, 2003; Iannotta, 2003; Alvarado et al., 2008).
In contrast to these chemical‐based traditional pest management practices, once
farmers and researchers realized it was necessary to rationalise the use of pesticides,
the concept of “Integrated Pest Management” (IPM) appeared. Furthermore, as a
reaction to agriculture growing reliance on synthetic fertilizers, the organic movement
had already started between 1930 and 1940 (MARM, 2006).
Introduction
18
1.2.1 Integrated Pest Management
In 1967, the FAO (Food and Agriculture Organization of the United Nations) defined
IPM as “the careful consideration of all available pest control techniques and
subsequent integration of appropriate measures that discourage the development of
pest populations and keep pesticides and other interventions to levels that are
economically justified and reduce or minimize risks to human health and the
environment. IPM emphasizes the growth of a healthy crop with the least possible
disruption to agro‐ecosystems and encourages natural pest control mechanisms”
(FAO, 2011a).
Later on, in 1976, the International Organisation for Biological and Integrated
Control of Noxious Animals and Plants (IOBC) defined Integrated Production:
“Integrated Production is a concept of sustainable agriculture based on the use of
natural resources and regulating mechanisms to replace potentially polluting inputs.
The agronomic preventive measures and biological/physical/chemical methods are
carefully selected and balanced taking into account the protection of health of both
farmers and consumers and of the environment”. The aim of the IOBC is the
promotion of biological and integrated methods to fight against pest, diseases and
weeds (IOBC, 2011).
Integrated Protection (IP) fits among the different Integrated Production measures.
The aims of IP are both to protect the environment and to be profitable for farmers,
although both situations are not always compatible. IP is based on three practices
(Cirio, 1997):
‐ Crop monitoring: that is, a routinely checking process against defined
objectives and targets. It takes place periodically and evaluates and verifies
standards across a range of plantation activities. It is a rigorously documented
process that will normally result in a programme of improvements.
Introduction
19
‐ Application of the Economic Injury Level (EIL), which is the point when
economic damage that occurs from insect injury equals the cost of managing
insect populations; it is the breakeven point (Alvarado et al., 2008). Damage
that occurs below that point is not worth the cost of preventing it. Because
these insect or injury levels are not wanted to be reached, a point that is set
well below the EIL is used, usually meaning when an insecticide can be applied.
This “take action” level is known as the Economic Threshold (ET).
‐ Evaluation of the proper control methods both for effectiveness and risk. Good
practices related to crop protection include those that use resistant cultivars
and varieties, crop sequences, associations, and cultural practices that
maximize biological prevention of pests and diseases; maintaining regular and
quantitative assessment of the balance status between pests and diseases and
beneficial organisms of all crops; adopt organic control practices where and
when applicable; applying pest and disease forecasting techniques where
available; determining interventions following consideration of all possible
methods and their short‐ and long‐term effects on farm productivity and
environmental implications in order to minimize the use of agrochemicals
(FAO, 2011b).
Biological control will always try to exploit agrosystem trophic food chains
(Urbaneja and Jacas, 2008). Therefore, all the measures which protect auxiliars should
be favoured. Special attention should be paid to cultural practices and pesticide
applications, which can control pests but also have a negative impact on natural
enemies (Jiménez et al., 2002). For that reason, it is very important to know the
biological and phenological cycles of auxiliary fauna, their role in pest control and the
side effects of pesticides on them (Civantos, 1998b). Furthermore, regional regulations
of integrated production have established at least two natural enemies whose
protection and increase are important (González‐Núñez, 2008).
Pesticides should only be applied as a last resort when there are no adequate non‐
chemical alternatives and their use is economically justified. They should be as specific
as possible for the target and have the least side effects on human health, non‐target
Introduction
20
organisms and the environment. Their use should be kept at minimum levels, e.g., by
partial applications (Civantos, 1998b; Hassan, 1998; BOJA, 2002; Malavolta et al., 2002;
FAO, 2011a).
In 2009, the European Parliament approved the new legislation about the
sustainable use of pesticides and their trade (Regulation EC 1107/2009 of the
European Parliament and the Council of 21 October 2009 concerning the placing of
plant protection products on the market. It repeals the Council Directives 97/117/EEC
and 91/414/EEC and the Directive 2009/128/EC of the European Parliament. It
establishes a framework for Community action to achieve the sustainable use of
pesticides). The compromise deal on the proposed regulation will put in place a system
where a positive list of approved active substances in pesticides will be drawn up.
Pesticides will then be licensed at the national level based on this list. The deal allows
exemptions for banned active ingredients to be used in pesticides for up to five years,
if they are proven essential for crop survival. Certain types of banned active
ingredients (candidates for substitution) have to be replaced within three years, if
safer alternatives exist. The compromise deal on the framework Directive requires
Member States to adopt National Action Plans with quantitative targets, measures and
timetables. The deal prohibits pesticide use, or at least requires it to be kept to a
minimum, in specific areas used by the general public or by vulnerable groups (IEEP,
2009; OJEU, 2009a,b; Palomar, 2009; Ruiz‐Torres, 2009).
In Spain, IP practices are carried out under the supervision of public regulated
organisms, the ATRIAS (“Agricultural Integrated Treatment Groups”: “Agrupaciones de
Tratamientos Integrados en Agricultura”, in Spanish), since 1979. They control the
crops and decide the proper treatments according to the methodology tuned up by
Plant Health Services (Chamorro and Sánchez, 2003).
Introduction
21
There is a national logo which identifies products produced under IP techniques, as
well as some other different Autonomous Communities’ logos (BOE, 2004; MARM,
2004a,b).
1.2.2 Organic farming
Despite having started at the beginning of the XXth century, organic farming was not
recognized as a feasible agricultural method until the beginning of the seventies
(MARM, 2006).
There is a worldwide umbrella organization for the organic movement which unites
more than 750 member organizations in 116 countries, the International Federation of
Organic Agriculture Movement (IFOAM). It actively participates in international
agricultural and environmental negotiations with the United Nations and multilateral
institutions to further the interests of the organic agricultural movement worldwide.
According to IFOAM, organic agriculture can be defined as “A production system that
sustains the health of soils, ecosystems and people. It relies on ecological processes,
biodiversity and cycles adapted to local conditions, rather than the use of inputs with
adverse effects. Organic agriculture combines tradition, innovation and science to
Figure 7: National and Autonomous Integrated Protection logos (BOE, 2004; MARM, 2004b)
Introduction
22
benefit shared environment and promote fair relationships and good quality of life for
all involved” (IFOAM, 2011).
Just as in IPM, plant health should be achieved through the maintenance of
preventive measures. For example, the choice of appropriate species and varieties
resistant to pest and diseases, suitable crop rotations, mechanical and physical
methods and the protection of natural enemies. In case of needing a treatment to a
crop, plant protection products may only be used if they have been authorised for its
use in organic production (there is a restricted list of products and substances that can
be used). All products and substances should have plant, animal, microbial or mineral
origin, except if products are not available in sufficient quantities or if alternatives are
not possible. If they are not identical to their natural form, they may only be
authorised whether their conditions for use preclude any direct contact with the edible
part of the crop. Each European Union Member State regulates the use of these
products within their territory (OJEU, 2007).
The council Regulation (CE) 834/2007 regulates on organic production and labelling
of organic products. It repeals the previous Regulation (EEC) 2092/91. In order to
ensure that organic products are produced in accordance with requirements laid down
under the Community legal framework of organic production, activities performed by
operators at all stages of production, preparation and distribution of organic products
should be submitted to a control system set up and managed on official controls
(OJEU, 2007). In Spain, the MARM has a specific program whose main aims are to
promote organic farming, to improve the trade, the consumption and the knowledge
about organic products, as well as to get better collaboration among institutions and
farmers. Autonomous Communities are directly responsible for regulations (MARM,
2007; OJEU, 2007).
Introduction
23
There is a European Union logo, a national one and some others from some
Autonomous Communities. There is
also a logo which certifies Spanish
organic products for export (OJEU,
2007; Anonymous, 2008; MARM,
2011c).
1.2.3 Integrated Protection in olive groves
Integrated Olive Production in Spain has specific regulations in six Autonomous
Communities (Andalusia, Balearic Islands, Catalonia, Extremadura, Murcia and
Valencian Community). The number of hectares growing under this production system
is 290,505 ha, which accounts for11% of the total olive crop hectares in our country
(MARM, 2011e,f).
Within the IOBC, there is a specific Working Group (WG) focus on olive crops, the
“Integrated Protection of Olive Crops”, which was initiated in 1991. The main goal of
the group is to promote collaboration in multidisciplinary research on the
development, evaluation and implementation of integrated control strategies for olive
pests and diseases. An important priority is the exchange of knowledge and the main
ultimate targets are to minimize the impacts of olive crop protection on the
environment, to increase sustainability and also to support the production of higher
quality products (IOBC, 2011). IOBC has also published specific guidelines for
Figure 8: Spanish, Autonomous Communities and European Union logos. Certification for European organic products (ECO CERT, SHC) (Anonymous 2008, MARM, 2011c)
Introduction
24
integration production of olives. The purpose of these guidelines is to define the basic
requirements of integrated production in olives in such a generalised way that these
rules can be applied in all geographical regions (Malavolta et al., 2002).
Table 3 summarizes some of the specific integrated production practices of olive
groves.
Table 3: Integrated pest management in olive crops
Sources: (Cirio, 1997; Civantos, 1998b; Civantos, 1999; BOJA, 2002; Chamorro and Sánchez, 2003; Iannotta, 2003; Rotundo and De Cristofaro, 2003; Romero et al., 2006; Moretti et al., 2007; Pajarón, 2007; Alvarado et al., 2008; González‐Núñez, 2008; Trapero and Blanco, 2008; IAEA, 2009; Trapero et al., 2009; Bento et al., 2010; Delrio, 2010).
Crop monitoring
As olive grove areas tend to be big, in order to simplify pest and diseases monitoring they
are divided into homogeneous smaller areas. Control plots, as more representative of the
whole area as possible, are then the monitoring units. Different traps are placed in the
control plot and vegetative parts of the trees or fruits, depending on the phenological
stage and the pest or the disease evaluated, are periodically sampled
Economic threshold levels
Tolerable thresholds are somewhat debatable because several factors influence them (the
region, the variety, the destination of the harvest, etc.). That is the reason why the
specific pest or disease, their secondary effects and the particular conditions of each farm
should be taken into consideration when evaluating. Data from similar areas can be
extrapolated
Introduction
25
Table 3: Integrated pest management in olive crops (continuation)
Sources: (Cirio, 1997; Civantos, 1998b; Civantos, 1999; BOJA, 2002; Chamorro and Sánchez, 2003; Iannotta, 2003; Rotundo and De Cristofaro, 2003; Romero et al., 2006; Moretti et al., 2007; Pajarón, 2007; Alvarado et al., 2008; González‐Núñez, 2008; Trapero and Blanco, 2008; IAEA, 2009; Trapero et al., 2009; Bento et al., 2010; Delrio, 2010).
Control methods
Agricultural practice Pest or disease controlled
New plantations
Selecting best varieties for local growing conditions
Tuberculosis, verticillium wilt, olive leaf spot, anthracnose, black scale, olive fruit fly and olive moth
Verifying that both the soil and the new plants are pathogen‐free
Verticillium wilt
Planting trees in a density that provides a good aeration
Olive leaf spot, anthracnose
Cultural techniques
Avoiding nitrogen over‐fertilisation Verticillium wilt, black scale, olive leaf spot
Limiting heavy tillage practices Fruit fly and olive moth pupae could be destroyed by tillage; however, limiting tillage practices increases populations of beneficials.
Herbicide applications Olive fly populations increase while beneficial populations decrease
Maintaining permanent soil covering It avoids nitrogen run off and increases biodiversity
Limiting water inputs in irrigated plantations
Verticillium wilt, root fungus, white grubs, black scale, olive leaf spot
Olive pruning
Achieving a good aeration Black scale, bark beetles, Euzophera pingüis, tuberculosis, fungal diseases
Disinfecting pruning tools and ensuring that there are not damage
Olive knot disease
Removing the pruned branches and destroyed them
Zeuzera pyrina and Cossus cossus larvae and Phloeotribus scarabaeoides adults
Pruning during the dormant season Different pests
Harvesting
Early harvest B. oleae
Do not mixing fruits collected from olive trees with those lying on the ground
B. oleae
Introduction
26
Table 3: Integrated pest management in olive crops (continuation)
Sources: (Cirio, 1997; Civantos, 1998b; Civantos, 1999; BOJA, 2002; Chamorro and Sánchez, 2003; Iannotta, 2003; Rotundo and De Cristofaro, 2003; Romero et al., 2006; Moretti et al., 2007; Pajarón, 2007; Alvarado et al., 2008; González‐Núñez, 2008; Trapero and Blanco, 2008; IAEA, 2009; Trapero et al., 2009; Bento et al., 2010; Delrio, 2010).
Control methods
Agricultural practice Pest or disease controlled
Biological control
Releases of the Hymenoptera Psyttalia concolor, Fopius arisanus, P. lounsburyi, Eupelmus urozonus
B. oleae
Releases of the parasitoids Methaphycus swirskii, Diversinervus elegans, M. barletti, M. helvolus, M. lounsburyi and the predators Rhyzobius forestieri, Brumus quadripustulatus
S. oleae
Releases of the fungus Bauveria bassiana Balsamo and Metarhizium anisopliae Metchnikoff
B. oleae
Releases of different nematode species Z. pyrina
Applications of the fungus Talaromyces flavus Klöcker
Verticillium wilt
Inoculative releases of the fungus Fomes spp. and Agrobacterium tumefaciens
Vegetable parasites
Releases of the parasitoid Trichogramma spp., the predator Chrysoperla carnea and the parasporal crystals of the bacterium Bacillus thuringiensis var. kurstaki
P. oleae
Releases of the parasporal crystals of the bacterium Bacillus thuringiensis var. kurstaki
Palpita unionalis
Management of the agroecosystem to maximize the effect of native or introduced biological control agents (conservative or natural control): sowing plants that attract natural enemies, offering honey or other sugar sources…
Different olive pests
Biotechnical methods
Mass trapping (traps baited with pheromones) Z. pyrina, C. cossus
Mass trapping (traps baited with food lures); “Attract and kill” (integrating the sexual pheromone and ammonium bicarbonate as lures), sexual confusion and releases of sterile males (Sterile Insect Technique)
B. oleae
Introduction
27
Fruit flies, such as B. oleae, are not attractive targets for classical biological control.
This is partly because of several features in their life histories which make conditions
very difficult for parasitoids. Adults of many fruit fly species disperse widely when they
emerge and leave their parasitoids behind. This also happens when fruits disappear
from crops and fruit flies disperse widely to other areas. Some examples of failures and
successes in efforts to establish parasitoids in countries have been demonstrated by
many years of extensive biological control programs conducted in the Pacific region
and other countries outside it (Peters, 1996).
Conservative biological control programs are effective against some olive grove
pests. For example, a study carried out by Boccaccio and Petacchi (2009) showed that
landscape structure and natural or semi‐natural woodland play a role in enhancing B.
oleae parasitoid activity. Some other experiments have studied the effect of different
attractive sources (sugars, yeasts, etc.) on the abundance of olive pests predatory
arthropods and the possible enhancement of their activity (Bento et al., 2004), or the
effect of the establishment of vegetation patches which produce flowers (Jorge et al.,
2005).
Pesticide applications in olive crops are sometimes necessary against B. oleae, P.
oleae, olive leaf spot and anthracnose, less frequently with S. oleae and rarely with the
rest of the pests (Iannotta, 2003). The most used products in these agrosystems are
syntheticc insecticides, like organophosphates and pyrethroids against pests, and
copper‐based compounds against diseases (MARM, 2011c). However, it should be
pointed out that their use is lower compared to other crop systems (Cirio, 1997).
Spanish regulation has established the predator C. carnea as one of the two natural
enemies whose protection and increase is important in olive groves. The other natural
enemy should be chosen among the most important natural enemies in each region
(González‐Núñez, 2008).
Introduction
28
1.2.4 Organic olive farming
Organic olive groves occupy a surface of 126,328.26 ha (4.9% of the total), chiefly in
Cordoba (Andalusia), where a 53.30% of organic crop is located (according to the
MARM, in 2010 there were 1,650,866 ha of organic farming in Spain) (MARM, 2011d).
Agricultural practices to fight against olive pests and diseases are similar to those
previously described for IP systems. However, in organic olive systems there is a lack of
a wide range of effective products to control some of them, as it occurs with B. oleae.
In this case, the interest on using repellent and antiovipositional products, as well as
products able to kill both their larvae and eggs, has increased in the last years (Caleca
and Rizzo, 2006; Caleca et al., 2008).
1.3 Side-effects of pesticides on non-target organisms
The effects of chemical pesticides on predators and parasites are much less known
than on herbivorous. However, literature on natural enemy/pesticide research has
increased at an exponential rate since the late 1950s.
It is necessary to test the possible negative effects of pesticides on non‐target
arthropods, not only for regulatory requirements before a product is able to be
registered, but also for knowing whether a plant protection product is suitable for
using in IPM programs. In Europe, according to the Council Regulation (EC 1107/2009),
the objective of protecting human and animal health and the environment should take
priority over the objective of improving plant production. Therefore, it should be
demonstrated, before plant protection products are placed on the market, that they
present a clear benefit for plant production and do not have any harmful effect on
human or animal health, including that of vulnerable groups, or any unacceptable
effects on the environment. Regarding the effects on the environment, the following
requirements have to be considered: the fate and distribution of the products in the
Introduction
29
environment, their impact on non‐target species, including the ongoing behaviour of
those species, and their impact on biodiversity and the ecosystem (OJEU, 2009a). With
the aim of developing and validating test methods to assess the side‐effects of plant
protection products to non‐target arthropods, the IOBC, the BART (Beneficial
Arthropod Testing Group) and the EPPO (European and Mediterranean Plant
Protection Organisation) in collaboration with the Council of Europe), decided in 1994
to set up a Joint Initiative (JI) (Barret et al., 1994). JI activities started in 1995 and
different reports and conferences resulted in the publication of a guidance document
for regulatory testing and interpretation of semi‐field and field studies with non‐target
arthropods. They describe test systems, treatments, validity criteria of the studies,
information on test organisms, test procedures, test conditions, biological
observations, data analyses and reporting for selected terrestrial non‐target
arthropods (Candolfi et al., 2000).
In 1974, the working group of the OILB/SROP, “Pesticides and Beneficial Organisms”
was founded. Their main objective was to coordinate the developing of standard
methodologies to evaluate side‐effects on the most important natural enemies and to
choose selective pesticides to be used in IPM programs (Hassan, 1998). Pesticides are
selected according to a sequential process which assumes that harmless pesticides in
laboratory tests will be also harmless in semi‐field and field, and they do not need
additional studies. Since 1980, standard guidelines to test side‐effects of pesticides on
natural enemies; rearing methods for beneficial arthropods; comparison of results of
laboratory, semi‐field, field experiments, and results of the joint programs to test the
side‐effects of pesticides on beneficial organisms have been published (IOBC, 2011).
The measurement of the acute toxicity of pesticides to beneficial arthropods has
traditionally relied on the determination of an acute median lethal dose or
concentration. However, these tests can only be a partial measure of their deleterious
effects. In addition to direct mortality induced by pesticides, their sublethal effects on
arthropod physiology and behaviour must be considered for a complete analysis of
their impact (Desneux et al., 2007). In extended laboratory and semi‐field experiments,
treated vegetal material is used. In the case of extended laboratory assays, plants are
Introduction
30
treated and carried to the laboratory, where experiments are performed. When fresh
residues of the pesticides caused negative effects, possible effects due to the
persistence of the products on the plants are also evaluated. Treated plants are
maintained in greenhouses or outdoors up to the desired‐age residue is available.
Then, they are carried to the laboratory to continue the experiment. Semi‐field tests
are carried out with fresh applied products or residues on the plants, under similar
field conditions, i.e. in greenhouses. Whether field studies are necessary, they are
designed taking into account the habitat of the natural enemy and the good
agricultural practices procedure, which involves respecting both the number of
applications of a product and the minimum time period between treatments.
1.4 Natural enemies used in the experiments
1.4.1 Psyttalia concolor
Psyttalia (Opius) concolor (Szèpligeti)
(Hymenoptera, Braconidae) is a koinobiont
parasitoid of second‐ and third‐instar larvae of
tephritids. Its host records are available for
about 24 species. Originally described from
material reared from olive fruit fly (B. oleae)
infested olives in Tunisia (Szèpligueti, 1911), it
has also been reared in Kenya from olive fly
collected from Olea europaea var. cuspidata and from medfly (Ceratitis capitata
(Wiedemann); Diptera, Tephritidae) in arabica coffee also in Kenya and in argan trees
(Sapotaceae) in Morocco (Kimani‐Njogu et al,. 2001; Anonymous, 2011).
It belongs to the P. concolor species complex, which also includes P. humilis and P.
perproximus (which have been treated as synonyms of one another), amongst others
(Kimani‐Njogu et al., 2001; Rugman‐Jones et al., 2009). These species have been
Figure 9: P. concolor female
Introduction
31
distinguished by subtle differences in the length of the ovipositor and the size of the
eye (Billah et al., 2008).
The adult body colour varies between light brown and yellowish, and measures in
the region of 3.5 cm. Antennae are darker than the body. The female is able to
parasitize different host’s larval instars although it prefers the third one, when larvae
are close to pupation and are located nearer the surface of the fruits (Arambourg,
1986; Jiménez et al., 2002; Canale and Loni, 2006; Sime et al., 2006). The relative short
ovipositor of females makes them unable to reach larvae that have burrowed deep
into the olive, as commonly happens with second instars, which feed near the pit (Sime
et al., 2006). Under laboratory conditions, the relative failure of P. concolor to locate
the second larval stage it is likely to be related to the fewer vibrations produced by
second instar hosts during feeding and/or movement (Canale and Loni, 2006).
Sometimes there is superparasitism and more than one egg is laid inside the same
larva (normally by different females). It is quite likely that the female paralyses its
hosts to oviposit successfully, but by definition this paralysis must disappear fairly
rapidly in order to allow the host to continue to fend for it and pupate. Parasitoid
larvae have four instars (Cals‐Usciati, 1972) during which they consume the host up to
its own pupation. The development of the parasitoid occurs in the range between 15ºC
and 30ºC. Males’ development is shorter compared to females’ (Loni, 1997). Under
laboratory conditions (25 ± 2ºC and 75 ± 5%HR), male developmental time is 17‐18
days and female’s is 21‐22 days. In the field, they overwinter as adults or immature
stages inside the pupae of B. oleae found in soil of olive groves. Their survival is
conditioned on winter temperatures, which can reduce populations or even make
them disappear (Jiménez et al., 2002; Liaropoulos et al., 2005).
Members of P. concolor complex have been extensively used in both classical and
augmentative biological control programs directed against tephritid pests. In fact,
shortly after being described in Tunisia, it was introduced to olive‐growing regions of
Italy (1914 and 1917‐1918) and France (1919 and 1931) (Rugman‐Jones et al., 2009)
for controlling both B. oleae and C. capitata. In 1912 it was introduced in Hawaii from
South Africa with the aim of controlling C. capitata (Daane and Johnson, 2010).
Introduction
32
However, despite the high percentage of parasitation reached at the beginning, this
species was finally replaced by Diachasmimorpha tryoni Cameron (Hymenoptera,
Braconidae) (Peters, 1996). P. concolor was the only olive fruit fly parasitoid found in
Morocco and the Canary Island. However, few olive fruit flies were collected and
parasitism rates were limited to 14.6 and 2.3% respectively. Similarly, less than 7% of
the parasitism was recorded in the Republic of South Africa. On the contrary, it was the
dominant parasitoid in Namibia (18 to 35% parasitism rates) (Daane and Johnson,
2010). Parasitism rates of P. concolor between 22.4% and 23.4% have also been
detected in Spain in organic orchards in the Balearic Islands (Miranda et al., 2008).
After the development of its efficient mass‐rearing method using medfly in artificial
diet in the 1950s, most European programs for olive fruit fly focused on P. concolor
(Jiménez et al., 1990; Daane and Johnson, 2010; Anonymous, 2011). It has been
routinely used in the Mediterranean Region (Spain, France, Italy, Greece, Portugal and
former Yugoslavia) (EPPO, 2011a) for augmentative releases against B. oleae (Kimani‐
Njogu et al., 2001; Jiménez et al., 2002; Rugman‐Jones et al., 2009). To date, it has
been the only imported species widely released and established in olive‐growing
regions (Daane and Johnson, 2010).
Over the years, different releases of the parasitoid have been made in olive groves
in order to evaluate the parasitism rates, their adaptation to the environment and the
survival capacity either of the released individuals or their progeny. Most experiments
have shown that releases should be made when fruit fly population levels are low, at
the beginning of the summer, to control the first fruit fly generations. Otherwise, when
B. oleae populations are high the parasitoid is not able to maintain them under the
economic threshold levels (Jiménez et al., 1990; Civantos, 1999):
‐ In Italy, it is recommended to release twice a year: one inoculative release in
spring, to control the first generation of the pest (which is inside the olive fruits from
last year or as pupae in the soil), and a second inundative one to control summer‐
autumn generations (Delrio, 1995; Rotundo and De Cristofaro, 2003). P. concolor
releases are only recommended when olive grove yield is high and as a part of an
Introduction
33
integrated pest management program, being combined with other methods (Delrio et
al., 2005). In Sardinia, parasitism rates between 60% and 100% were reached even if a
low amount of parasitoids released. However, if climatic conditions are not suitable,
there is not parasitism despite releasing a high amount of individuals (Delrio et al.,
2005).
‐In Spain, Jiménez et al. (1990) carried out some experiments in Jaén, where
parasitoids were released inundatively in order to test whether they were able to
hibernate there or not. They demonstrated that progeny of P. concolor could be
obtained from parasitized B. oleae the year after releases were done, however, the
number of parasitoids collected was low compared to the number of them released.
Other experiments carried out between 1997 and 1999 evaluated the parasitic activity
of P. concolor in some different regions, demonstrating the efficacy of the parasitoid
when is released during the summer (Jiménez et al., 2002).
‐In Corfu, Greece, P. concolor and P. concolor var. siculus Mon. were released during
spring to determine whether they could be used to control olive fly infestations at that
period. At an initial density of 300‐400 parasites per tree, the mean parasitism rates of
3rd stage larvae ranged from 30% to 50% in the first week following the release,
indicating that P. concolor could work well in the spring in tall trees with large numbers
of ripe and heavily infested fruits (Kapatos et al., 1977).
‐In California, where olive fruit fly arrived in 1998 and it is considered an invasive
pest (Yokoyama et al., 2008), a classical biological control program was initiated in
2002 (Sime et al., 2006). Results from several experiments suggest that high summer
temperatures limit olive fly abundance in California’s Central Valley (Wang et al., 2009)
and it seems that nowadays biological control is effective enough to control pest
populations (Yokoyama et al., 2008).
Parasitism rate differences among experiments can be due to the low quality of
laboratory mass‐rearing parasitoids, climatic conditions and the abundance of fruit
flies at the beginning of the summer or the olive grove yield (Delrio et al., 1995). Adult
foodstuff availability and the possibility that parasitoids attack other non‐target fruit
flies could also cause those different results (Yokoyama et al., 2008). Furthermore,
mass‐reared parasitoid’s flight ability has been demonstrated to be lower than that of
Introduction
34
wild parasitoids. This can be caused either by the mass‐rearing technique employed or
by the genetic population composition (Delrio et al., 1995). Because mass‐rearing
conditions can have an influence on host localization and parasitic capacity of some
braconids used in biological control programmes, it could be interesting to periodically
renew laboratory populations with wild individuals (Loni and Canale, 2005/2006; Estes
et al., 2012). Psyttalia species are known to have specific host fruit and/or host fly
preferences and despite the fact that they can successfully produce viable offspring in
the laboratory, it is not known whether this populations/species interbreed in the
field. When releasing these species, potential effects of interbreeding must be taken
into account, especially in environments where other closed related species are
presented or in situations where multiple introductions are intended. (Billah et al.,
2008).
In Spain, the company Econex marketed P. concolor up to 2006 (De Liñán, 2007).
They recommended releases of 100 to 500 adults per olive tree, choosing the most
appropriate time depending on the state of development of the pest: in spring, against
the first generation; from the end of June up to the end of August, against the summer
generations; and during September and October against the overwintering generation,
which will become the fruit fly adults of the next spring.
Introduction
35
1.4.2 Chilocorus nigritus
Amongst predaceous ladybeetles (Coleoptera, Coccinellidae), species of the genus
Chilocorus (65 known species) are important scale‐predators, capable of removing
heavy infestations and thereby increasing crop yields (Hattingh and Samways, 1994;
Omkar and Pervez, 2003).
In olive groves, one of the most common species within the Coccinellid community
is C. bipustulatus (Santos et al., 2010), which is indigenous to the Mediterranean
region (Smith, 1915). It is a polyphagous predator of scale insects, such as the
California red scale (Aonidiella aurantii (Maskell) (Homoptera, Diaspididae), the
Egyptian black scale (Florida red scale), Chrysophalmus aonidium L. (Homoptera,
Diaspididae), the Florida wax scale, Ceroplastes floridensis Comstock (Homoptera,
Coccidae), and the black scale, S. oleae (Nadel and Biron, 1964). However, due to the
difficulties to have enough individuals to carry on laboratory experiments, the
coccinellid C.nigritus F., which is sold by different European companies, has been used
as representative species of it in this thesis.
C. nigritus is native to the Indian
subcontinent (Samways and Tate, 1984;
1986; Hattingh and Samways, 1994; Omkar
and Pervez, 2003) and South‐east Asia
(Ponsonby and Copland, 1998; 2000). After
its establishment in South Africa it soon
spread naturally or was artificially
introduced in other regions. Evidence
suggests that once established in an area,
the beetle becomes a permanent member of the local fauna. Amongst other
Chilocorus species, it is maybe one of the most tolerant to extreme temperatures,
although their theoretical lower thermal development threshold is 16.6ºC (Samways
and Tate, 1984; Ponsoby and Copland, 1998; Omkar and Pervez, 2003). This adaptive
Figure 10: C. nigritus adults
Introduction
36
strategy has probably helped it in its establishment in the tropical and sub‐tropical
regions. It prefers hot and humid summers and cold dry winters (Omkar and Pervez,
2003), although is well adapted to the drier savannah areas too (Greathead and Pope,
1977). It has not yet established in high altitudes (Samways and Tate, 1986). Because
of its tolerance to a wide range of temperature and humidity, it is suggested that
perhaps the reasons for the failure to the species in apparently favourable climates
may be due to other factors. For example, prey suitability and/or the presence of
natural enemies or pathogens to which the species has no resistance (Ponsonby and
Copland, 1998), although it seems to be rarely attacked by natural enemies (Samways
and Tate, 1986; Ponsonby, 2009). It is an active predator of many insect species, such
as different aphid species or the spiralling whitefly Aleurodicus disperses Russel
(Hemiptera, Aleyrodidae). However, it prefers scales, especially Diaspididae, such as A.
aurantii Maskell, Asterolecanium miliaris Boisduval or Aspidiotus nerii Bouché
(Greathead and Pope, 1977; Samways, 1984; Samways and Tate, 1984; 1986;
Ponsonby and Copland, 2000; Omkar and Pervez, 2003), when they are on citrus, sugar
cane, coconut and other tropical and subtropical crops (Ponsonby and Copland, 1996).
It feed on all sessile stages of the scales and it is the most important predator of gravid
adult females (Samways, 1984; Samways and Tate, 1986). It is more efficient in
removing medium and medium‐high densities of scale (15.8‐23.5 scales/cm2) than at
very high ones (60 scales/cm2) (Omkar and Pervez, 2003).
Adults are easily recognizable due to their almost
semi‐spherical shape, with sizes ranging from 3 to 5.5
mm. Their elytra are shiny black with sparse simple
punctures. They have dull orange areas between the
eyes and on the antero‐lateral tips of the pronotum.
Females lay bright yellow spindle‐shaped eggs
individually on the substrata, to which they are attached
by one of their ends (in the shields of death scales, on
the silk of spider webs or any other substrata composed
of loose fibres, and on scale‐infested leaves). Early first instars hatch out and they
usually moult thrice to undergo four larval instars. Greyish yellow larvae have the
Figure 11: C. nigritus larva
Introduction
37
dorsal surface covered with spiny hairs. They also have characteristic dark patches on
the second, the third and from the seventh to the ninth segments, which impart a
banded appearance. Mature larvae congregate inside the concavity of crumpled leaves
to pupate (Samways, 1984; Omkar and Pervez, 2003). First instars chewed through the
newly formed scale cover and sucked out the body juices, leaving the cuticle behind.
The other three instars completely removed the scale cover and sucked out the body
contents, leaving the cuticle behind or partially eaten (insects are rarely completely
eaten). Piercings or puncturings on the scales lead to their rapid dehydration
(Ponsonby and Copland, 2000; Omkar and Pervez, 2003). Larvae and adults are
positively phototactic and negatively geotactic. They use the prominent features of the
plant, such as leaf veins and margins, to guide their searching behaviour. Since prey
species shows similar photo‐ and geotaxis and feed largely from the veins, such
behaviour tends to concentrate predators at sites of high prey density (Ponsonby and
Copland, 1995). Temperature varies developmental times, the pre‐oviposition period
and the oviposition rate (Samways and Tate, 1984; Ponsonby and Copland, 1998;
Omakar and Pervez, 2003). At 26ºC, mean development period days are 6.6 ± 0.6 for
the eggs, 7.5 ± 0.8 for the first instar, 5.2 ± 0.6 for the second one, 5.4 ± 2.5 for the
third one, 9.9 ± 1.6 for the forth one and 6.1 ± 0.2 for the pupa. This means 34.0 ± 3.7
days from egg to adult (Ponsonby and Copland, 1996). The influence of biotic and
abiotic factors of prey development can reduce predator fitness, i.e., their immature
development and adult reproduction. Immature stages are always more affected than
adults (Hattingh and Samways, 1994). The reproductive activity of the females can also
be inhibited, delaying oviposition for several days (Omkar and Pervez, 2003).
It has been successfully utilized as a natural enemy in many biological control
programs, and classically introduced in scale prevalent regions time and again
(Samways, 1984; Omkar and Pervez, 2003; Ponsonby, 2009). Success of C. nigritus and
other coccidophagous beetles has been attributed to their high searching efficiency
and quick response to the changes in prey density (Omkar and Pervez, 2003).
According to the data available on the EPPO website, both C. nigritus and C.
bipustulatus are commercially used as biological control agents (EPPO, 2011b). There
have been many experiences in releasing C. nigritus over the years:
Introduction
38
‐ In the EPPO countries, data of first use of C. nigritus is 1985 and it is currently
used in Belgium, Denmark, France, Germany, the Netherlands and United
Kingdom. It is used indoors, mainly against Diaspididae and Asterolecaniidae,
but it has not been successfully established in this area (EPPO, 2011b).
‐ In South Africa and Swaziland, it has been reared in several insectaries primarily
against California red scale, (Samways and Tate, 1984), which became resistant
to organophosphate insecticides (Samways, 1984). The predator has been
found to be the most effective natural enemy, along with Aphytis spp.
(Hymenoptera, Aphelinidae), against A. aurantii (Uygun and Elekçioglu, 1998).
‐ In the coconuts industries of the Seychelles and Mauritius it has been used
against A. aurantii and other scales on various plants, including citrus.
‐ In India, it has been released to control Coccus viridis Green (Homoptera,
Coccidae) on coffee (Samways, 1984).
‐ In Pakistan, against the diaspidids Aspidiotus destructor Signoret (coconut
scale), Aspidiotus orientalis Newstead, Pinnaspis strachani Cooley and
Quadraspidiotus perniciosus Comstock (Samways, 1984).
‐ In the New Hebrides, against the coconut scale (Samways, 1984).
‐ In UK glasshouses it has been considered as a potential natural enemy of
different scales (Ponsonby and Copland, 1996).
Chilocorus nigritus (F.) mass rearing can be done using several diaspids and/or
certain artificial diets (Omkar and Pervez, 2003). Nutritional requirements of
coccinellids, similarly to other predatory groups, are very specific. Thus, artificial diets
that support normal rates of coccinellid egg production are not commercially available.
Honeybee products or brood have been used for semi‐artificial diets (Obrycki and
Kring, 1998). However, artificial diets are still inferior to natural prey and not adequate
as the sole food source for rearing consecutive generations. They are just valuable as
substitute food in the insectary during shortages of natural prey (Hattingh and
Samways, 1993). Cannibalism by larvae and adults is another persistent problem in
mass rearing of many coccinellid species (Obrycki and Kring, 1998).
Introduction
39
According to some authors, the introduction of predator eggs in the scale‐infested
areas is not advisable, since most of the hatched larvae starve when scale population is
composed mostly of adult females (Omkar and Pervez, 2003). Therefore, adult releases
are better, followed by older larvae (Hattingh and Samways, 1991). However,
successful experiences in South Africa to control A. aurantii were done distributing
predator eggs in polyester fibre pads (Samways and Tate, 1984; Obrycki and Kring,
1998). It enabled far more material to be introduced into the field, encouraged
establishment of the species throughout larvae developing in situ (Samways and Tate,
1986), and it also partially overcome the problem of dispersal away from specific
release sites (Samways, 1984).
Coccinellidae activity in suppressing pest populations is significant. However, it is
poorly documented in many pest management programs that expect preserving
natural enemies. They are often less susceptible than their prey to treatments, but
they are highly affected by several insecticides. Toxicities vary widely among and
within classes of insecticides and coccinellid species. Coccinellids efficacy in natural or
managed systems is difficult to determine given their mobility and typically
polyphagous nature. Adults may disperse from treated areas in response to severe
prey reductions or because of insecticide repellence (Obrycki and Kring, 1998).
Introduction
40
Objectives
41
Chapter 2
OBJECTIVES
Chemical control is still the most common strategy applied against B. oleae.
However, there is a shortage of a wide range of effective products to control it,
especially in organic olive systems.
The objective of chapter number four of this thesis is to study the ecotoxicology of
kaolin and two copper‐based products (Bordeaux mixture and copper oxychloride) on
the two natural enemies P. concolor and C. nigritus. The use of kaolin and copper is
allowed both in integrated management systems in organic farming. They act as
deterrents of oviposition (kaolin) or bactericidal (coppers), rather than having
insecticidal activity. Hence, seven different experiments both at laboratory and semi‐
field level using different routes of uptake have been designed to be able to better
understand their activity. Several studies have demonstrated some negative effects of
kaolin on auxiliary fauna at field level, which cannot be explained through classical
laboratory assays. Therefore, specific experiments to study kaolin effects on the
behaviour of insects, rather than the direct effects of the product on them, have also
been designed.
In the fifth chapter of this thesis, the potential of three different insect growth
regulators for controlling B. oleae is studied. The ecdysone agonists, methoxyfenozide,
tebufenozide and RH‐5849 have been chosen. Furthermore, the ecotoxicology of the
three products on P. concolor females is also considered. For both insects, the pest and
the beneficial, not only of biological assays are performed, but also molecular and
docking experiments.
Objectives
42
General material and methods
43
Chapter 3
GENERAL MATERIAL AND METHODS
In the current chapter, general material and methods of the experiments on side‐
effects and efficacy carried out in this study are explained. The following items can be
found:
‐ Environmental conditions of the different insect rearing and laboratory
experiments.
‐ Insect rearing.
‐ Common characteristics of the experiments.
‐ Parameters evaluated.
‐ Statistical analysis.
3.1 Environmental conditions of insect rearing and laboratory experiments
Both insect rearing and laboratory experiments, unless otherwise specified, were
performed in a controlled environmental cabinet (4.25 x 2 x 2.5 m3) in the laboratory
of “Protección Vegetal” (Polytechnic University of Madrid) with the following
conditions:
‐ Temperature: 25 ± 2º C
‐ Relative humidity: 75 ± 5 %
‐ Photoperiod: 16 : 8 (L : D)
In order to keep the adequate temperature, there is an air‐conditioner‐heat pump
(Interclisa®, CUCVO26M3 + CXE 26M3), regulated by a thermostat (Sunvic®).
Relative humidity percentage is controlled with a humidistat connected to a
humidifier (Defensor®, model 505).
General material and methods
44
To control either temperature or humidity regulation systems, there are a thermo‐
hygrograph (model Salmoiraghi® 1750) and a digital thermo‐hygrometer with memory
for maximum and minimum absolute values.
Photoperiod is achieved with two strip lighting (Sylvanya Gro‐Lux®) placed above
each shelf, which give a luminance in the region of 2.500 lux at 20 cm distance.
Switching on and off of lights is controlled with a switch clock (Orbis®).
3.2 Insect rearing
3.2.1 Psyttalia concolor
The parasitoid P. concolor is reared in the laboratory on the alternative host C.
capitata (medfly) following the methodology proposed by González‐Núñez (1998),
which is slightly modified from the one described by Jacas and Viñuela (1994). Neither
C. capitata nor P. concolor have ever been exposed to insecticides and both rearings
have been renewed from time to time with field individuals.
Psyttalia concolor population in our laboratory comes from the original one that the
“Instituto Nacional de Investigaciones Agrarias” had in “El Encín”, a researching centre
which was located en Alcalá de Henares, Madrid.
General material and methods
45
3.2.1.1 Mass rearing of Ceratitis capitata
3.2.1.1.1 Adults’ cage
Medflies are reared in methacrylate
cages (40 x 30 x 30 cm) with around 3,000
flies per cage. The front side of the cages is
covered with mesh, which is used for
females to oviposite. Mesh also allows
aeration inside cages. Eggs are laid through
the mesh after a pre‐oviposition period of
4‐5 days and they fall into a plastic tray
containing water, from which they are collected daily by filtering.
Cages have two round holes (8 cm diameter) on the upper side covered with mesh.
The diet, a mixture of hydrolyzed protein and sugar (1:4; MP Biomedicals Inc:
Azucarera Ebro S.A.), is offered through the holes. Water is supplied ad libitum in a
plastic pot with a piece of Spontex® wiper, placed inside the cage.
Adults are usually used for obtaining eggs during a week, although they can survive
longer.
3.2.1.1.2 Eggs handling
Eggs (less than 1 day old) are collected daily from the plastic trays (39.5 x 30.5 x 4.5
cm) with water in which they have been conserved since they were laid. A thin mesh
(for example, tights) fixed to a funnel is used to filter the eggs. About 2,000 eggs are
placed on each larval diet tray (25 x 15 x 4 cm; 3 eggs/g diet). They should be
previously mixed with a small amount of water to be able to scatter them evenly.
Figure 12: Cage of C. capitata adults’ rearing
General material and methods
46
3.2.1.1.3 Larvae rearing
Larvae are reared in plastic trays containing a specific diet consisted of:
Wheat bran (Harinas Polo S.A.) 400 g
Sugar (Azucarera Ebro S.A.) 112 g
Brewer’s yeast (Vigor®, Santiveri S.A.) 58 g
Methylparaben (Nipagin®, Central Ibérica de Drogas S.A.) 4.5 g
Propylparaben (Nipasol®, Central Ibérica de Drogas S.A.) 4.5 g
Benzoic acid (Panreac ®, Montplet & Esteban S.A.) 4 g
Water 900 ml
All ingredients, except water and benzoic acid, are mixed in a two‐liter container
with a mechanical mixer (Turbula®, WAB) during an hour to ensure a homogenous
mixture.
Water is heated up and when it boils, benzoic acid is added and dissolved with the
help of a magnetic mixer. Then, they cool down up to 40ºC and they are mixed in a
tray with the rest of the ingredients, using a spatula. Diet is then distributed into two
plastic trays (25 x 15 x 4 cm; 750 g diet/tray). It is squashed and covered with
aluminium foil. It can be conserved in the fridge up to two weeks, being careful to let it
get warmer up to room temperature before placing eggs on it.
Trays with the diet are placed inside a methacrylate cage. Eggs hatch two days after
placing them on the diet. 8‐9 days later, third instar larvae (already fully developed)
search for a dry place to pupate. Thus, larvae jump out from the diet and pupate on
the floor of the cages. Once pupated, pupae are collected and stored in small plastic
cages (12 cm diameter, 5 cm high).
Some days before adult emergence, new adult cages are built up. Pupae are placed
inside them and mass‐rearing continues.
General material and methods
47
3.2.1.2 Mass-rearing of Psyttalia concolor
Psyttalia concolor adults are kept in methacrylate cages (40 x 30 x 30 cm) containing
around 500 wasps per cage. Lids of the
cages consist of a mesh which provides
both ventilation and the physical
support for the parasitization process.
Water is supplied ad libitum in a glass
pot with a piece of Spontex® cloth
protruding out of it. Food, consisted of
a milled mixture of brewer’s yeast and
icing sugar (1:4), is also provided ad
libitum in a plastic stopper. Cages are
renewed weekly.
3.2.1.2.1 Parasitization
About 500 fully grown larvae of C. capitata are offered to P. concolor adults by
sandwiching them between two pieces of mesh hold together with a wooden frame
(14 cm diameter). Frame is placed on the roof of the parasitoid rearing cage and
females sting medfly larvae through the mesh. A bag with sand is put on top of the
frame to prevent larvae from jumping (otherwise females are not able to parasitize
them). After one hour of exposure, larvae are transferred to a plastic cage (12 cm
diameter, 5 cm high).
Adult flies emerge from the non parasitized pupae after 7‐8 days. Parasitoid males
do it after 17‐18 days approximately and females after 21‐22 days, at 25±2 ºC.
Parasitoid adults are collected and transferred to the rearing cages for renewing the
population or are used in the experiments.
Figure 13: P. concolor adults’ cage
General material and methods
48
3.2.2 Chilocorus nigritus
The availability of C. nigritus adults and
larvae was limited. Only a few companies
in Europe sell them. Adults used in the
current experiments were normally
supplied by the company Entocare
Biological Crop Protection (Wageningen,
The Netherlands). When it was possible,
adults were reared in the laboratory, but
their number was usually too low to
perform assays.
A mass rearing of the predator was tried to be established in the laboratory.
Hattingh and Samways (1993) screened promising diets for C. nigritus based on
different artificial diets for other entomophagous insects. Two suitable diets, one for
adults and one for larvae, were obtained. However, they were still inferior to natural
prey and not adequate as the sole food source for rearing consecutive generations
(Ponsoby, 2009). Other coccinellid mass rearing experiences had also demonstrated
that predators acquired significantly higher survival and faster development when
feeding on live prey, as it occurred with Menochilus sexmaculatus (F.) (Coleoptera,
Coccinellidae) when compared the parameters above after feeding on Myzus persicae
(Sulz.) (Homoptera, Aphidae) or artificial diets (Khan and Khan, 2002). Females also
showed more preference for laying eggs on scale‐infested butternuts than on an
artificial substrate (Murali‐Baskaran and Suresh, 2007).
In order to have an available source of live prey for C. nigritus, a mass‐rearing of
scales was established in the laboratory. In absence of living prey, C. nigritus adults
were fed with eggs of Ephestia kuehniella Zeller (Lepidoptera, Pyralidae). Distilled
water was also provided ad libitum in glass vials similar to those described for P.
concolor.
Figure 14: Temptative C. nigritus rearing established inthe laboratory
General material and methods
49
3.2.2.1 Mass-rearing of scales
The literature on host relations of C. nigritus is extremely ambiguous and appears to
suggest the presence of different ecotypes and/or biotypes. For example, first instar
larvae of South Africa origin were only capable of feeding on first instar A. nerii, while
larvae of a similar stage from Pakistan were able to feed on first and second instar
Aspidiotus cyanophylli Signoret (Homoptera, Diaspididae). However, prey species may
not be as important as prey population structure. Indeed, highest levels of beetle
reproduction occur when there are high densities of overlapping generations of scale
that include all stages of development (Ponsoby, 2009).
Best survival rates and adult
fecundity appeared to be from beetles
cultured on biparental A. nerii reared on
potato tubers (Solanum tuberosum L.).
Butternuts (Cucurbita moschata Duch.
ex Lam.) have also demonstrated to be a
good alternative (Samways and Tate,
1986; Hattingh and Samways, 1993;
Ponsoby, 2009). Thus, both butternuts
and potatoes were used in A. nerii
rearing.
Butternuts are more convenient to handle and provide a large surface area on
which beetles can feed. In contrast, potatoes are used principally as mother stocks.
They are able to support heavier scale infestations than butternuts and crawlers can
also readily leave potatoes to move onto new material rather than settling on an open
area, as they are inclined to do on butternuts. Scale‐infested vegetal should be
removed from the culture from time to time because fungal contamination of the
butternuts occurred.
Figure 15: A. nerii rearing. Infested and uninfested butternuts and potatoes are placed on wire baskets
General material and methods
50
Both fresh butternuts and potatoes were bought in the supermarket, because
picking them direct from the field was not available. They were carefully washed in a
0.025% solution of sodium hypochlorite and dried before offering to scales.
Rearing of scales was started with A. nerii‐infested butternuts from a public
insectary in Silla, Valencia (Spain). It was carried out slightly modifying the
methodologies proposed by Samways and Tate (1986) and the public insectary
mentioned above.
The culture of the scales was maintained in plastic cages (500 x 400 x 250 mm) in
the previously described climatic chamber. Vegetal material was placed on wire
baskets to improve aeration and avoid fungal contamination. Cages had two holes on
both sides and one on the front part (30 x 10 cm) covered with mesh to allow aeration
and to prevent crawlers from escaping. Cages were painted black colour. Because
crawlers are attracted upwards to the light (Samways and Tate, 1986), they were
supposed to walk up to the front part of the cages, so it would be easier to collect
them. This mass‐rearing procedure was followed in the insectary of Silla, where scales
were reared in big dark chambers with a light point in the middle. However, the
methodology did not work in the laboratory and infestation of new butternuts by
crawlers was decided to be by contact. Thus, uninfested potatoes and butternuts were
placed among the infested ones. Within the hours, crawlers infested the new material.
This made it easier to get homogeneously infested vegetal material because crawlers
did not need to walk long distances to find non infested surfaces. There was not a
strict routine to this procedure.
When scales on butternuts had developed up to a level in which they formed a
white layer on the surface of the vegetable, they were then ready to be transferred to
beetle cages or used in the experiments. However, despite the efforts to rear the
scales, their development was not fast enough, as it could take several months to have
butternuts with an appropriate scale‐infestation level. Infested material could only be
used in the dual choice and no‐choice experiments (explained later in Chapter 4).
General material and methods
51
3.2.3 Bactrocera oleae
Mass‐rearing of B. oleae on an artificial diet has difficulties and the procedure still
needs different improvements. Issues include: the desing of the cages and oviposition
substrated, the cost and quality of artificial diets, the maintenance of endosymbiotic
microbiota, the control of pathogenic microbes, the collection of pupae and the fitness
of adults (Estes et al., 2012).
Although we attempted to rear B. oleae in our laboratory with individuals sent from
the FAO/IAEA (International Atomic Energy Agency) Agriculture and Biotechnology
Laboratory in Seibersdorf (Austria), different problems forced us to use wild olive fruit
flies for the experiments
We were able to obtain eggs using a paraffined gauze
as artificial substrate, but fungal contamination on the
artificial diets prevented the larvae from developing. This
fungal contamination affected either some of the
ingredients used in the diet or the laboratory installations,
and it was not possible to decontaminate none of them.
Bactrocera oleae adults were
finally obtained from infested
olive fruits collected from
different olive orchards in Spain:
Villarejo de Salvanés in Madrid (cv.
Manzanilla and Cornicabra); Jaén
and Alcalá la Real in Jaén (cv.
Picual); Alía and Guadalupe in
Cáceres (cv. Verdial, Manzanilla
cacereña and Cornicabra).
Infested fruits were taken to the
Figure 17: Methacrylate cages where third‐instar larvae of B. oleae were collected when they jumped from the olive fruits
Figure 16: Fungal contamination of B. oleae artificial diet
General material and methods
52
laboratory and placed on plastic grilles situated on the top of methacrylate cages.
When larvae were close to pupate, they jumped out from the fruits into the cages and
pupae were collected. Adults emerged from these pupae were used in the
experiments. They were fed with a mixture of icing sugar: hydrolyzed protein
(Azucarera Ebro S.A.: MP Biomedicals Inc; 4:1). Distilled water was provided ad libitum
as previously described.
3.3 Common characteristics of the experiments
Unless otherwise specified, in the case of P. concolor ten individuals per replicate
were used to perform the different experiments. Eight or nine adults per replicate in
the case of C. nigritus were used, depending on their availability. Five replicates per
treatments were always used if possible.
Unfed, mated females, less than 48‐h old of P. concolor, were always used. Females
were used instead of males because they live longer. Furthermore, females, which only
need mating once, are the ones which control pest populations (Ragusa, 1974). Newly
emerged individuals were used because they use to be the most sensitive to pesticides
(Croft, 1990). They were not fed because it has been demonstrated that pesticide
sensitivity of some insect is modified when they are fed (Viñuela and Arroyo, 1983).
In the case of C. nigritus, adults (unknown age or sex) were always used in the
experiments. Experiments with larvae were not performed because it was not possible
to achieve a homogeneous‐age population of larvae.
In the case of B. oleae, ten less than 48‐h old adults were used.
General material and methods
53
Unless otherwise specified, individuals were placed in ventilated round plastic cages
(12 cm in diameter by 5 cm, with a 5.5 cm‐diameter ventilation hole covered with
mesh on the top). Distilled water was provided ad libitum in small glass vials (30 x 35
mm) covered with Parafilm® and a piece of Spontex® wiper leaking out of it. No water
was offered to C. nigritus. Diet was supplied in small plastic stoppers (24 x 6 mm) (diets
for each insect were the same as the diets described for their mass rearing: brewer’s
yeast and icing sugar (1:4) for P. concolor, E. khueniella eggs for C. nigritus and sugar
and hydrolysed protein (4:1) for B. oleae).
Both the glass vials and the plastic stoppers were fixed to the floor with Plasticine®.
Water and diet were renewed when necessary.
Figure 18: Round plastic cages used in the experiments
General material and methods
54
3.4 Parameters evaluated
3.4.1 Mortality
Mortality was always scored at 24, 48 and 72 hours. Depending on the test, a longer
period could also be evaluated. Normally, 72h after the treatments, survivors were
moved to non‐treated cages to study the effects of the products on reproduction or
life span.
3.4.2 Life span
Life span was measured as the average of days that each insect survived in each
replicate after the treatments. It was evaluated daily (or twice a week when more than
two months had been lasted since the experiment started) using similar cages and
conditions than the ones described above.
3.4.3 Effects on reproductive parameters
Reproductive parameters in the case of parasitoids
are also known as “beneficial capacity”. It is measured
as the percentage of attacked hosts (percentage of
puparia without medfly emergence) and the percentage
of progeny size (percentage of parasitoids emerged
from parasitized puparia). To evaluate these two
parameters on P. concolor, 72h after the treatments
five females per replicate, when possible, were
transferred from the plastic cages described above to a
parasitization cage.
Figure 19: Cages used to evaluate beneficial capacity of P. concolor
General material and methods
55
Parasitization cages consist on untreated round cages similar to those described
above but with a hole (5.5 cm‐diameter) covered with mesh on the bottom, through
which females parasitized C. capitata larvae. Distilled water and diet are provided ad
libitum as described above. When possible, five replicates per treatment were also
performed to evaluate beneficial capacity.
During the following five days, 30 fully‐grown C. capitata larvae are offered to
females in each cage replicate. The larvae of the medfly are previously collected from
their diet and placed in water before offering
them to female wasps to avoid pupation. Larvae
are immobilized by sandwiching them between
the mesh of the cage’s floor and a piece of
Parafilm® placed on the bottom of a glass pot,
all held together with a rubber band. After one
hour of exposure, C. capitata larvae are
transferred to Petri dishes to allow them
pupate (effects of the products on beneficial
capacity can approximately be evaluated one
month after parasitization).
Data from the first day of parasitization are rejected because previous experiments
had shown that females needed one day before getting used to parasitizing in their
new cages.
Effects on reproductive parameters were only possible to be measured in the case
of P. concolor. In the case of C. nigritus, the difficulty of determining the number of
eggs laid by females on the butternut surface, together with the difficulty of sexing
individuals to make pairs, made it not possible to determine fecundity and fertility
rates during the experiments using butternuts as oviposition substrata. Surgical gauzes
were provided as artificial substrata, as it was demonstrated that it was highly suitable
as substrate for oviposition and thus for augmentative releases in glasshouses
environments (Ponsoby, 2009). Synthetic cotton was also provided as oviposition
Figure 20: C. capitata larvae transferred into Petri dishes after 1hour of exposure to P.
concolor females
General material and methods
56
substrata, but a low amount of eggs were laid on them and the larvae hatched died
always before pupating. Furthermore, C. nigritus preferably needs prey to reproduce
and our scale mass‐rearing was not big enough to continuously provide A. nerii.
These parameters were not evaluated in the case of B. oleae either because we did
not have enough non damaged olive fruits to offer to females to oviposit.
3.5 Statistical analysis
The data were subjected to a one‐way analysis of variance (ANOVA). Fisher’s least
significant difference (LSD) test was used to compare the responses to the insecticides.
All statistical analyses were performed using Statgraphics® version 5.1 (STSC 1987). If
necessary, the data were transformed using arcsin (x/100) for percentages and log
(x+1) otherwise. The untransformed data (mean values and standard errors (S.E.))
were shown in the tables. If any of the assumptions of the analysis of variance were
violated after appropriate transformations, the non‐parametric Kruskal‐Wallis test was
applied. When P < 0.05, the idea that the differences are all a coincidence can be
rejected. This doesn´t mean that every group differs from every other group, only that
at least one group differs from one of the others. In this case, the Dunn’s post‐test was
applied. This test compares the difference in the sum of ranks between two columns
with the expected average difference (based on the number of groups and their size).
Median values are considered significantly different if the 95% confidence intervals of
the medians did not overlap.
The mean values of each parameter studied were corrected using the Schneider‐
Orelli formula [M (%) = [(Mtreated ‐ Mcontrol)/ (100 ‐ Mcontrol)] x 100] for mortality or the
Abbot formula [P (%) = [1‐ (Ptreated/ Pcontrol)] x 100] for reproductive parameters and life
span. These corrected values were used to rank the products according to the IOBC.
Pesticides were classified into the following four toxicity categories: for laboratory
experiments the categories are: 1, harmless (<30%); 2, slightly harmful (30‐79%); 3,
moderately harmful (80‐99%); 4, harmful (>99%). For extended laboratory and semi‐
General material and methods
57
field tests the categories are: 1, harmless (<25%); 2, slightly harmful (25‐50%); 3,
moderately harmful (51‐75%); 4, toxic (>75%) (Hassan 1998).
In the dual choice and no‐choice assays different statistical analyses were done.
For P. concolor, significant differences between treatment means were detected
using the two sample t‐tests. If any of the assumptions of the analysis are violated, the
non‐parametric Mann‐Whitney U test is applied.
For C. nigritus, data were analysed by multifactorial ANOVA because more than one
factor was taken into account (A. nerii infestation and treatment).
Different models were used to fit survival of C. nigritus with regard to treatments in
the two experiments performed with kaolin and coppers. Survivorship curves are a
graophical expression of the probability of surviving to age t as a function of t
(Southwood, 1976). Survivorship data can be effectively summarized and compared
using the shape and the scale parameters of the Weibull frequency distribution (Pinder
et al., 1978). TableCurve 2D (Jandel Scientific, 1994) was used to models fitting and
parameter estimation.
F (t) = 1 –exp [‐(t/b)c]
t,c,b > 0
in which b and c are respectively the scale and shape of the Weibull frequency
distribution. The c parameter controls the rate of change of the age‐specific mortality
rate and, therefore, the general form of the survivroship curve (Southwood, 1976).This
function shows four basic types of curve (Slobodkin, 1962; Southwood, 1976); in type I
mortality acts most heavily on the old individuals, in type II a constant number die per
unit of time; in type III the mortality rate is constant and in type IV mortality acts most
heavily on the young stages. In the Weibull frequency distribution, high values of c
determine a type I curve, while low values determine type IV values (Pinder et al.,
1978).
General material and methods
58
Kaolin and copper-based products
59
Chapter 4
LETHAL AND SUBLETHAL EFFECTS OF KAOLIN PARTICLE FILMS AND COPPER-BASED COMPOUNDS ON THE NATURAL ENEMIES PSYTTALIA CONCOLOR AND CHILOCORUS NIGRITUS1
4.1 Introduction and objectives
As previously mentioned in the introduction, B. oleae has been proved to be able to
develop resistance to some of the products commonly applied against it. Therefore, a
suitable pest management program should include different control measures that
prevent resistance development. In this context, kaolin particle films and copper‐based
compounds might be considered as an alternative. Furthermore, both products could
be also applied in organic olive groves.
Up to nowadays, side‐effects of kaolin and copper‐based products on natural
enemies found in olive orchards have been mainly tested at field level. Most of these
studies showed results concerning the presence/absence or mortality of the non‐
target organisms after the application of the products. However, much less is known
about which the causes of those results are. Whether a minor number of insects are
due to a direct mortality of them after the treatments or due to other sublethal effects
is what the current study will try to evaluate.
1 BENGOCHEA P, HERNANDO S, SAELICES R, ADÁN A, BUDIA F, GONZÁLEZ‐NÚÑEZ M, VIÑUELA E, MEDINA P, 2010. Side effects of kaolin on natural enemies found on olive crops. IOBC/wprs Bull 55:61‐67. BENGOCHEA P, SAELICES R, AMOR A, ADÁN A, BUDIA F, MEDINA P, Effects of kaolin particle film and copper‐based compounds on the endoparasitoid Psyttalia concolor (Szépligetti) and the predator Chrysoperla carnea (Stephens) in olives. Sent to be published BENGOCHEA P, AMOR F, SAELICES R, HERNANDO S, BUDIA F, ADÁN A, MEDINA P, The lethal and sublethal effects of kaolin particle films and two copper‐based products on six natural enemies: laboratory assays. Sent to be published
Kaolin and copper-based products
60
Hence, the aim of the following experiments will be to better understand the
possible sublethal effects of these products on the two natural enemies chosen, P.
concolor and C. nigritus. The ecotoxicology of the products on P. concolor female
adults has been carried out throughout different laboratory, extended laboratory and
semi‐field experiments. In contrast, in the case of the predator, and due to the
difficulty of having enough C. nigritus adults available, only a residual contact
experiment and an extended laboratory assay have been carried out. When it was
possible, additional experiments to test behavioural changes when insects are in
contact with kaolin have also been performed.
4.2 Material and methods
All the experiments were carried out with P. concolor adult females or pupae, C.
capitata larvae and C. nigritus adults obtained as it was specified in chapter 3:
“General material and methods”. Unless otherwise specified, environmental
conditions were the same as mentioned in that chapter.
Diet and distilled water were supplied ad libitum as it was described in chapter 3,
although in the laboratory test in which insects were exposed to a treated inert
surface, glass vials were a little bit smaller (15 x 22 mm) because the bigger ones did
not fit inside the cages.
4.2.1 Chemicals
Active ingredients tested, their trade names and their formulations are listed in
Table 4. A systemic insecticide, dimethoate, was used as a commercial standard
because it is the most commonly applied insecticide in Spanish olive groves (Alvarado
et al., 2008), even in integrated production systems (Civantos, 1999). It is utilized
against the main olive pests in bait treatments either in terrestrial applications or in
aerial treatments, being the last ones more specific against the olive fruit fly (Ruiz‐
Kaolin and copper-based products
61
Torres and Montiel‐Bueno, 2007). Solutions of product were prepared freshly in
distilled water prior to the assays, based on their respective maximum field
recommended concentrations (MFRC) in accordance with the Spanish registration,
with a delivery rate of 1000 liter water ha‐1.
In the laboratory assays in which products were applied on an inert surface, the
amount of insecticide applied per hectare was corrected by using the following
formula: PIEC = (dose rate x fd)/100, where PIEC in the Predicted Initial Environmental
Concentration (formulated product in µg/cm2); dose rate (formulated product in g/ha);
and fd is the correction factor representing deposits under field conditions (0.4 for
foliage dwelling predators), according to Barret et al. (1994) (see Table 4).
Table 4: Chemicals evaluated in the experiments
1Formulated product (concentration) 2Used only in some laboratory tests, in which an inert surface is treated
Active ingredient (a.i.)
Trade name %a.i; form
Conc1 PIEC2
(µg/cm2) Trade Company
Kaolin Surround
WP® 95 WP 5,000 g/hl 200
BASF Española S.L., Barcelona (Spain)
Bordeaux mixture
Poltiglia 20 WP®
20 WP 1,000 g/hl 40 Manica SPA, Trento (Italy)
Copper oxychloride
ZZ‐Cuprocol® 70 SC 250 cc/hl 10 Syngenta Agro S.A., Madrid (Spain)
Dimethoate Danadim Progress®
40 EC 150 cc/hl 6 Cheminova Agro
S.A. Madrid (Spain)
Figure 21: Chemicals used in the experiments
Kaolin and copper-based products
62
4.2.1.1 Kaolin
Kaolin is a white, non‐abrasive, fine‐grained aluminosilicate [Al4Si4O10(OH)8] mineral
clay. Kaolin‐based particle film was originally employed in fruit production because of
its agronomical benefits. It reduces heat stress by reflecting sunlight with its bright
colour. It does not affect plant photosynthesis or productivity due to the porous nature
of the film (Glenn et al., 1999; Glenn and Puterka, 2005). Indeed, crop yield and flower
production can be increased by decreasing transpiration (Sisterson et al., 2003). It has
also been hypothesized to control fungal and bacterial plant pathogens by preventing
disease inoculum or water from directly contacting the leaf surface too (Glenn et al.,
1999).
When sprayed on crops, researchers observed that this protective barrier creates a
hostile environment for insects (Bürgel et al., 2005), making the host plant visually or
tactually unrecognizable for pests (Glenn et al., 1999; Showler, 2003; Saour and
Makee, 2004). Furthermore, it obstructs insect movements and feeding when particles
attach to the insect’s body (Showler, 2003; Daniel et al., 2005). Additionally, it prevents
egg‐laying (Bürgel et al., 2005) and it also
impedes insect’s ability to grasp the plant
(Markó et al., 2008), resulting effective against
a range of pest insects such as psyllas (Puterka
et al., 2000; Pasqualini et al., 2003; Vincent et
al., 2003; Daniel et al., 2005; Gobin et al.,
2005; Saour, 2005; Laffranque et al., 2009),
tephritids (Caleca et al., 2008; Mazor and Erez,
2004; Braham et al., 2007), the Hymenoptera
Ophelimus maskelli (Ashmead) (Eulophidae),
which is a pest of Eucaliptus spp (Lo Verde et
al., 2011), and some aphids, mites,
leafhoppers, scales, Lepidoptera and
Coleoptera species (Knigth et al. 2000; Puterka Figure 22: Kaolin‐coated olive tree
Kaolin and copper-based products
63
et al., 2000; Phillips and De la Roca, 2003; Showler and Sétamou, 2004; Bürgel et al.,
2005; Daniel et al., 2005; Glenn and Puterka, 2005; Kourdoumbalos et al., 2006; Markó
et al., 2006; Laffranque et al., 2009).
In the last few years it has been tested against olive pests with good results on B.
oleae (Phillips and De la Roca, 2003; Saour and Makee, 2004; Perri et al., 2007; Caleca
and Rizzo, 2006; Iannotta et al. 2006; Pennino et al., 2006; Romero et al., 2006; Caleca
and Rizzo, 2007; Iannotta et al., 2007b; Caleca et al., 2008; González‐Núñez et al., 2008;
Laffranque et al., 2009). Visual and chemical stimuli lead the female olive fruit fly to
oviposit into fruits, so the clay, especially white clays as kaolin, disrupts ovipositing
females (Saour and Makee, 2004; Caleca and Rizzo, 2006; Iannotta et al., 2008). De la
Roca (2003) also reported a good control of the carpophagous generation of P. oleae,
as well as a minor presence of S. oleae, the second and third important pests in olive
groves, respectively.
Other advantages of kaolin particle films are that they are not‐toxic to humans and
they are relatively safe to natural enemies. They have no phytotoxic effects either.
They last longer than most insecticides on the plants when it does not rain or there is
not excessive dew formation. Additionally, they are washable and form a suspension in
water, so they can be easily applied using conventional spray equipment. Furthermore
it seems that pests are unlikely to develop resistance, because they are not an
insecticide and, therefore, they do not have a specific target site (Peng et al., 2011).
However, possible changes of insects’ behavior after several kaolin applications should
be evaluated because they could get used to these coated surfaces.
However, the effectiveness of kaolin particle film as a control method is reduced by
two factors: the frequent rainfalls, which washed off the particles, and the reduction of
the number of predators and parasitoids (Markó et al., 2006). Beneficials can be
affected both due to a direct effect on them and because of a reduction on their prey
number, as it occurs with some coccinellid species (Pascual et al., 2010a). Nevertheless,
the specific mechanisms that produce the decrease in certain arthropod taxa at the
field level remain unclear. The reduction of some beneficials due to kaolin treatments
Kaolin and copper-based products
64
could have strong negative effects and provoke an indirect increase of the populations
of several pests, as it has been already reported for some apple pests and cotton
aphids (Markó et al., 2006; Showler and Sétamou, 2004; Ulmer et al., 2006; Showler
and Amstrong, 2007).
In Spain the use of kaolin is authorised in orange, clementine and pear orchards. In
olive groves it can be used to control B. oleae and P. oleae. It should be applied before
egg‐laying on fruits (MARM, 2011c)
4.2.1.2 Copper
Copper is nowadays the only fungicide allowed in organic agriculture, together with
sulphur. Although it has been widely used in olive crops against fungal diseases,
farmers noticed a positive effect on the control of B. oleae (Belcari and Bobbio, 1999),
increasing the interest in the possible
application of this product against
this pest (Belcari et al., 2005; Rosi et
al., 2007). It is known that copper
products can play an important role
as an oviposition deterrent, but
researches have more recently been
focused on its effectiveness as a
bactericide. The fitness of the olive fly
is greatly assisted by the presence of
associated bacteria living on the
phylloplane and in specialised parts of the gut. These microorganisms play an
important role as a proteinaceous source for the adults and as elicitors of protein
hydrolysis in the blind sac of the midgut of the larvae (Belcari et al, 2005; Estes et al.,
2012). The symbiotic bacterium, named “Candidatus Erwinia dacicola”, is always
associated to B. oleae and mothers, endowed with contractile perianal glands that
become filled with bacteria, transmit symbionts to their offspring (Capuzzo et al.,
Figure 23: Olive tree leaves and fruits covered by copper
Kaolin and copper-based products
65
2005). Whether the bacterium colonizes the egg via the micropyle, or the larva
consumes the bacterium during the eclosion, is unknown (Estes et al., 2012). Different
studies have shown a high percentage of mortality on young larvae of the fly (first and
second instar) in the absence of the bacteria (Belcari and Bobbio, 1999; Rosi et al.,
2007). It seems to be important for both adult and larval nutrition (Estes et al., 2012).
It is the decrease of fruit fly populations after copper applications that could also
favour the subsequent action of their natural enemies, which are only efficient when
B. oleae population levels are low (Belcari and Bobbio, 1999).
Two copper formulations, Bordeaux mixture (CuSO4 + CaOH) and copper
oxychloride have been tested in this study because the formulation of products can
influence their action. Both of them are authorised in Spain to control different
diseases in several crops. In olive orchards they can be applied to control olive knot
disease and olive leaf spot (MARM, 2011c).
4.2.2 Laboratory tests
4.2.2.1 Residual contact on glass surfaces A standard methodology to evaluate the residual contact activity of pesticides on
non target arthropods in laboratory experiments was developed by Jacas and Viñuela
(1994), according to the IOBC criteria.
Glass plates (12 x 12 x 0.5 cm in thickness) are treated with the chemicals under a
Potter Precision Spray Tower (Burkard Manufacturing Co., UK) with 1 ml of each test
solution at a pressure of 55 kPa to obtain a homogenous deposit of 1.5‐2 mg fluid per
cm‐2. This deposit is within the interval recommended by the IOBC’s validity criteria for
running ecotoxicological experiments on beneficial arthropods (Hassan, 1998).
Kaolin and copper-based products
66
Adults are exposed to dry residues of insecticides after spraying them on glass
surfaces, using the slightly modified test cages designed for P. concolor tests by Jacas
and Viñuela (1994). Test units consist of a round methacrylate frame (10‐cm diameter,
3‐cm high) and the two square glass plates described above. The plastic frame has six
holes: two small (0.5‐cm diameter) and four bigger than them (0.7‐cm diameter). The
smallest ones are covered by a mesh (for aeration), three of the biggest with tape (to
prevent in sects from escaping), and the last one hold a hypodermic needle connected
to a rubber tube which provides a continuous flow of air produced by an aquarium
pump (to assure forced ventilation). As soon as the plates are dry (about half an hour
after the application of the products, depending on the compound), adults are
introduced to each test unit, which are then mounted and holding together with two
crossed rubber bands.
The glass vials use in the glass cages are smaller than those described in Chapter 3
(15 x 22 mm) because the others do not fit in the cages.
Figure 24: Residual contact on glass surfaces test. Cages (which contain C. nigritus adults) are in the climatic chamber. The forced ventilation system is also observed
Kaolin and copper-based products
67
Psyttalia concolor experiment: each treatment consisted of five replicates and ten
females per replicate. Cumulative mortality was recorded 24, 48 and 72 h after
treatment. Subsequently, five females per replicate, when possible, were transferred
to non‐treated cages to measure beneficial capacity as described in chapter 3.
Chilocorus nigritus experiment: each treatment consisted of five replicates. 9 adults
per replicate were used. 72 h later, survivors were transferred to untreated round
plastic cages to measure effects on life span after exposure to pesticides.
4.2.2.2 Oral toxicity
To evaluate the oral toxicity of the pesticides, they are offered via the drinking
water. In this case, the experiment was done with P. concolor females and it consisted
of five replicates per treatment; fifteen females per replicate were used.
After three days of exposure, five females per replicate were transferred to
untreated parasitization cages and beneficial capacity was measured. Apart from the
effects of kaolin and copper on direct
mortality and beneficial capacity, their effects
on life span were also measured (the
experiment continued with the females that
were not used to evaluate beneficial
capacity). Pesticides were offered during the
whole experiment (also during beneficial
capacity measurement) until the last female
died. Pesticide solutions were prepared at
the beginning of the experiment in big
quantities. Thus, if it was necessary to refill
any of the glass‐vials, the “age” of the Figure 25: Pesticide solutions in the glass vials and
plastic stoppers with the diet
Kaolin and copper-based products
68
insecticide was similar to those in the other vials and we assured that no effects on
insects were caused by freshly‐prepared solutions.
4.2.2.3 Treatment of parasitized pupae
The purpose of this test is to analyse the possible side effects of the products on the
most protected stage of P. concolor. According to Jacas (1992), the eleventh day after
parasitization is considered the moment from which parasitoids are more protected.
The colour of pupae is used to distinguish the parasitized pupae from the non‐
parasitized. Although it was considered that the darkest pupae were the ones which
should be used in the experiments, we observed that P. concolor emergence from
them was not always as high as expected. In contrast, the pupae whose colour was
between light brown and dark brown were the ones which shown a higher parasitoid
emergence percentage. Thus, these pupae were chosen for the experiments. Light
colour pupae were considered as not parasitized, while the darkest ones were
probably superparasitized.
30 pupae per replicate (5 replicate per treatment) are first placed in Petri dishes
and then treated using hand sprayers. After that, they are transferred to new Petri
dishes, which have a filter paper on the bottom glass, to better absorb the excess of
insecticide. Once they are dried (1 hour later), they are transferred to the round plastic
cages described above.
Figure 26: Testing of the effects when products are ingested
Kaolin and copper-based products
69
One or two days before adult emergence (5‐6 days after the treatment), distilled
water in glass vials and diet are placed in the cages. Emergence is evaluated daily.
Immediately after emerging, adults are transferred to untreated cages to evaluate
mortality and life span. When no more adults are emerged, beneficial capacity is
evaluated, using five females per replicate. Females used for parasitization are
between 3 and 5 days old. As we decided to transfer newly emerged adults to the
same cage, we could not exactly know how old females were. Nevertheless, we made
sure they were more than 72‐h‐old and had previously been in contact with males.
4.2.2.4 Treatment of the parasitization surface
The aim of this experiment is to evaluate whether kaolin and copper salts may
modify beneficial capacity when P. concolor females parasitized through a treated
surface. This experiment is an attempt to simulate which occurs in the field, when olive
trees are treated and the surface of the fruits is covered with the products.
The bottom mesh of the parasitization cages (which is the mesh with which P.
concolor females are in contact to reach L3‐larvae of C. capitata) is treated with the
products using a hand sprayer. Five females per replicate and five replicates per
treatment were performed. Females are transferred to treated cages 24 h after the
Figure 27: Treatment of pupae using hand sprayers
Kaolin and copper-based products
70
treatment, when meshes are totally dried. However, the previous day they are placed
in untreated cages with the aim of getting them to parasitize. Beneficial capacity is
then measured during four more days as previously described in chapter 3. However,
because at least 30 days after the treatments are needed to obtain data of attacked
hosts and progeny size, it is not possible to know whether any deleterious effect on
this parameter might be caused by the products after the four days of parasitization.
Therefore, we decided to continue the experiment for three more days. Hence, it can
be evaluated whether females, in case of previous negative effects, could reach their
normal beneficial capacity rates when a non‐treated surface is offered. Thus, surviving
females are transferred to untreated parasitization cages and 72 hours later beneficial
capacity is measured again during four more days.
Figure 28: Treatment of the meshes through which P. concolor females parasitize
Kaolin and copper-based products
71
4.2.3 Extended-laboratory experiments
4.2.3.1 Treatment of olive tree leaves
Leaves were collected from small two‐year‐old olive trees (cv. Picual) grown in a
greenhouse in the Experimental Fields of the ETSI Agrónomos (Polytechnic University
of Madrid) and taken to the laboratory.
The products are applied using hand sprayers until the liquid ran off the leaves.
Once the leaves are dried (1 hour later, approximately), they are transferred in groups
of 18 (3 small branches with 6 leaves per branch) to the previously described plastic
cages (12‐cm in diameter and 5‐cm high). Drinking water is offered in the small glass
vials described in the residual contact activity assay.
Figure 29: Treatment of olive tree leaves
Kaolin and copper-based products
72
Psyttalia concolor experiment: each
treatment consists of five replicates and ten
females per replicate. Cumulative mortality
is recorded 24, 48 and 72 h after treatment.
Subsequently, five females per replicate,
when possible, are transferred to non‐
treated cages to measure beneficial
capacity as described in chapter 3.
Chilocorus nigritus assay: each treatment consists of 4 replicates and 8 adults per
replicate are used. 72 h later, survivors are transferred to untreated plastic cages to
measure effects on life span.
4.2.3.2 Treatment of the parasitization surface and olive tree
leaves
This experiment also aims to evaluate whether kaolin and copper salts could modify
beneficial capacity when P. concolor females parasitized through a treated surface.
However, it tries to more accurately simulate field
conditions than the previous one, in which only the
surface was treated. Therefore, olive tree leaves are
also treated and females are in contact with them
during the first part of the assay (the four first
parasitization days during which females parasitized
through the treated surfaces).
The methodology followed is similar to the
previously described. Both the parasitization surface
and the leaves are treated using had sprayers. 3
small branches (18 leaves) are introduced in each cage. Drinking water is offered in the
small glass vials described in the residual contact activity assay.
Figure 30: Detail of kaolin‐treated leaves in the plastic cages
Figure 31: Olive tree leaves and parasitization surface treated
Kaolin and copper-based products
73
Similarly, after four days of parasitization, females are transferred to untreated
parasitisation cages. No olive tree leaves are placed in untreated cages.
4.2.4 Semi-field experiment
Effects of kaolin and copper salts were evaluated under semifield conditions on P.
concolor females.
Small‐55‐cm cv. Picual olive trees were grown in a greenhouse in Madrid (in the
experimental fields of the ETSI Agrónomos). The average environmental conditions in
the greenhouse during the experiment were 14.06 ± 2ºC, 65 ± 10 % r.h.
Trees are treated with hand sprayers with the
corresponding compound at their maximum field
recommended concentration until the liquid ran
off. As soon as trees dried, they are covered with a
wooden cage with a slight modification of the
design by González‐Núñez (1998) to conduct
semifield assays with the parasitoid P. concolor.
Each cage consists of a wooden base and a
wooden, plastic and gauze frame. The wooden
square bases are 25 cm long and are painted in
white. In one side there is a rectangular hole (13
cm x 2 cm) for the trunk of the tree. To contain
insects in the cage, Plasticine® is used to seal the
space between the trunk and the floor. The frames
are 60 cm high. The top and three of the sides are
covered with mesh. The fourth side consists of a
methacrylate sheet to easily monitor the experiment. Each tree is considered an
experimental unit. Each cage contains two small glass vials to supply water, similar to
Figure 32: Olive tree in the woodencage. Glass vials the stoppers can alsobe observed
Kaolin and copper-based products
74
those already described. The diet is supplied using two plastic stoppers. Both water
and diet containers are hung with a wire to the branches.
A total of 30 P. concolor females (less
than 24 h old) were introduced per cage
and exposed to the insecticides for a week.
Three replicates per compound and control
were performed. The beneficial capacity
was measured directly in the greenhouse
to avoid carrying the females to the
laboratory; thus, measurements were
carried out in the treated cages. Because
the mortality was no high after the three
days of exposure to the compounds, with
the exception of dimethoate, the
measurement of the beneficial capacity
was made using six times more C. capitata larvae than in the other experiments.
Therefore, 180 larvae were offered to the females, using two mesh pieces hold
together with a wooden frame (15‐cm diameter). A bag with sand was placed on the
top of the frames to prevent larvae from jumping (otherwise, the females would not
be able to parasitize them, as it occurred in the mass rearing of the parasitoids). After
one hour, larvae were placed onto Petri dishes and transferred to the climatic chamber
in the laboratory to allow them pupate. Percentage of attacked host and progeny size
were recorded as previously described.
Figure 33: Semi field experiment in the greenhouse.In the top of the wooden frames, the sand bags usedto prevent C. capitata larvae from jumping when P.concolor females are parasitizing can be observed
Kaolin and copper-based products
75
4.2.5 Dual choice and no-choice experiments
4.2.5.1 Psyttalia concolor
This experiment was designed with the aim of
evaluating the possible behavioural effects of
kaolin when P. concolor females have the
possibility of choosing between parasitizing
through a treated surface and an untreated one.
Both a dual choice test and a no‐choice test were
carried out. In both cases, six replicates per
treatment performed. Five females per replicate
(72‐h‐old) were used. Every 15 minutes, during the
hour of parasitization, the number of females
searching for larvae or parasitizing both in the
upper mesh and the bottom mesh was counted.
Distilled water and diet were provided ad libitum
as previously described.
In this case, the two pieces of mesh of the parasitization cage are treated (the one
usually used for ventilation and the one used for parasitize in the previous
experiments, because it is not possible to treat only half of the parasitization mesh). 15
C. capitata larvae are offered on the top of the cages, and other 15 on the bottom.
Larvae placed on the top mesh are covered with piece of Parafilm® and a small plastic
stopper (4‐cm diameter) to prevent them from being mashed. Larvae of the bottom
side are immobilized by sandwiching them between the mesh of the cage’s floor and a
piece of Parafilm®. Parafilm® is placed on the floor of a glass pot put upside down. All
the structure (the cage, the plastic stopper and the glass pot) is held together with a
rubber band.
Figure 34: Dual choice and no‐choiceexperiments. C. capitata larvae wereoffered either on the top and thefloor of the parasitization cages. Thesmall plastic stopper placed in the topof the cages to prevent larvae fromjumping and escaping is apparent
Kaolin and copper-based products
76
In the dual choice test, one of the meshes of the cages is sprayed with kaolin. To
avoid possible effects on parasitization when females sting through the upper or the
bottom mesh, two different treatments
should be performed. Thus, the upper
mesh of the cages is treated in 6 replicates,
and the bottom one in the other 6
replicates.
In the no‐choice test, both the top and
the bottom meshes are sprayed with
kaolin. Distilled water was used to spraying
the mesh in control units. 6 replicates for
the kaolin treatment and 6 for the controls
were done.
4.2.5.2 Chilocorus nigritus
The main objective of this experiment was to evaluate the possible repellence
caused by kaolin treated surfaces on C. nigritus adults. The assay was carried out
offering vegetal material to adults and observing whether they were found on the
treated material or, by contrast, they preferred untreated parts. The plant material
used was butternuts (C. moschata). Three replicates per treatment were done.
Both infested and uninfested butternuts were used in the experiment. Non infested
butternuts were washed according to the procedure described in Chapter 3 for
butternuts and potatoes. Infested butternuts were obtained from the vegetal material
used for A. nerii rearing (see Chapter 3). Hand sprayers were used to treat the
butternuts. When they dried, they were placed in the cages on an egg box to prevent
them rolling in the cage.
Figure 35: Detail of P. concolor females parasitizing through the bottom mesh of the cages
Kaolin and copper-based products
77
Each experimental unit consists of a plastic cage (40 x 30 x 21 cm) covered with a
piece of mesh to allow aeration. The mesh is held to the cage with a rubber band and
some binder clips to prevent adults from escaping. Each cage contained the following
materials: two butternuts, one infested with A. nerii and other one uninfested, placed
on egg cardboards; a glass vial with distilled water (similar to those previously
described); a plastic stopper with E. kuehniella eggs; and a piece of a semi‐solid diet
(34‐mm diameter, 1‐cm high). The semisolid diet is elaborated with 66.67 g of honey,
33.33 ml of distilled water and 0.5 g of agar. Water and honey are heated up and when
they boil, agar is carefully added and dissolved with the help of a magnetic mixer. They
have to boil all together for three or four more minutes. Then, the mixture is let
warmer up and store in the fridge until it is used.
In the dual choice experiment, just half of the butternut surface is covered with
kaolin. In the no‐choice test, the surface of treated butternuts is completely kaolin‐
covered.
Adults were previously sexed according to the methodology proposed by Samways
and Tate (1984). However, due to the difficulty of sexing the adults when they are
alive, they were sexed again by dissection under a stereoscopic microscope when the
experiment finished. Six pairs of adults were introduced in each cage with the help of a
brush. Because it was not easy to distinguish between males and females at a glance, it
was not possible to detect behavioural differences between sexes.
Figure 36: Experimental units: plastic cages covered with a piece of mesh held with a rubber band and binder clips
Kaolin and copper-based products
78
The experiment lasted four days. Cages were transferred to the laboratory for the
daily measurements. The rest of the time, they were maintained in the previously
described climatic chamber. During the four days, daily measurements were done
every half an hour during three hours. The number of adults on the butternuts or on
the cages was counted. Butternuts were gently turning and then placed again on the
egg cardboards. It was not possible to evaluate either fertility or fecundity because C.
nigritus eggs were not easily visible on the butternuts. Nevertheless, the experiment
was maintained 15 more days to observe the possible presence of larvae. Adults and
Figure 37: No‐choice experiment: controls. The non‐infested butternut is on the left of the picture and theinfested one is on the right. Butternuts are placed on egg boxes. In the middle of the cage there is a glass vialwith distilled water, a plastic stopper with E. kuehniellaeggs and a piece of the semi‐solid diet
Figure 38: No‐choice experiments: kaolinreplicates (non‐infested butternut on the leftand the infested one on the right).
Figure 39: Dual choice experiment (on the left, theinfested butternut; on the right the non‐infested one).Half of the butternut was treated with kaolin and theother half with distilled water
Figure 40: Detail of a kaolin‐treatedbutternut. C. nigritus adults can beobserved on the treated surface
Kaolin and copper-based products
79
unifested butternuts were removed from the cages. Because we observed that females
tend to oviposit under the scales, only the A. nerii‐infested material was maintained.
Both in the case of P. concolor and C. nigritus, when the dual choice and no‐choice
tests were finished every adult was observed under stereoscopic microscope, in order
to find out whether kaolin particles were attached to their bodies or not.
4.3 Results
Results of the experiments carried out are stated below. Instead of giving the
results of each experiment separately, they are grouped depending on the parameter
evaluated. Different figures have been built up with the results obtained.
As an appendix at the end of the chapter, mean data and standard errors of each
experiment are shown in different tables (Tables 6, 7, 8, 9 10 and 11). Furthermore, an
additional table with the classification of the products according to the IOBC criteria
for each parameter and has also been done (Table 12).
4.3.1 Direct mortality
Kaolin, Bordeaux mixture and copper oxychloride did not caused any deleterious
effect on the percentage of mortality 72 h after the treatments, either for P. concolor
or C. nigritus in most of the experiments performed (percentages of mortality < 10%).
The sole exception was the evaluation of the oral toxicity of these pesticides on P.
concolor females. In this case, when females ingested kaolin via their drinking water,
an increase in the percentage of mortality was observed (36.0% of mortality). None of
the two copper‐based products provoked a high mortality, compared to the controls.
In great contrast, dimethoate killed 100% of insects within the first 24 h of all the
treatments, except in the semifield experiment, in which 100% of P. concolor adults
were killed 4 days after the treatment (Figure 41; Tables 6, 7 and 8).
Kaolin and copper-based products
80
0
10
20
30
40
50
60
70
80
90
100
Residualcontact(glass)
Extendedlaboratory(olive treeleaves)
Semi field Oral toxicity Residualcontact(glass)
Extendedlaboratory(olive treeleaves)
Psyttalia concolor Chilocorus nigritus
* * * * * *% M
ortality
Different experiments: % mortality
Control
Kaolin
Bordeaux mixture
Copper oxychloride
Dimethoate
Figure 41: Percentage of P. concolor and C. nigritus mortality 72 hours after different treatments. Asterisks indicate statistical differences between the treatments and the control (P<0.05)
4.3.2 Life span
No deleterious effects on the life span of P. concolor females emerged from treated
pupae were found for none of the tested products, including dimethoate (F4,20 = 1.14,
P = 0.3678). However, although the average number of days females lived after the
pupae treatments was between 46.3 (dimethoate) and 55.3 (control), some females
died 20 days after emerging, while others survived for 91 days. In contrast, when
females ingested the products via their drinking water, statistical differences amongst
all the treatments were found (F4,20 = 78.01, P < 0.0001). After dimethoate ingestion,
the life span was reduced to less than 24 h. Furthermore, a clearly reduction of this
parameter was caused by kaolin. The average number of days females survived in this
experiment was lower than in the previous one. Females survived 53 days, as
maximum, in the case of the controls; between 15 and 20 days when they ingested
coppers, and less than 8 days if they ingested kaolin or dimethoate (Figure 42; Table 5).
Kaolin and copper-based products
81
0
10
20
30
40
50
60
Oral toxicity Treatment ofpupae
*
* *
*
No. d
ays
Psyttalia concolor life span (number of days)
Control
Kaolin
Bordeaux mixture
Copper oxychloride
Dimethoate
Figure 42: Life span (number of days) of P. concolor when oral toxicity and treatment of pupae were evaluated. Asterisks indicate statistical differences between the treatments and the control (P<0.05)
In the case of C. nigritus, either kaolin or copper salts did not provoke a reduction
on the life span, both in the residual contact activity and in the extended laboratory
experiments. When exposed to dimethoate, however, 100% of adults died after 24 h in
both experiments (F4,20 = 26.58, P < 0.0001 and F4,15 = 14.80, P < 0.0001, respectively).
Although the average number of days C. nigritus adults exposed to water, kaolin or
copper treated surfaces (glass or leaves) were able to survive around 120‐140 days,
some of them could survive longer (up to 357 days) (Figure 43; Table 8).
020406080
100120140160
Residual contact(glass)
Extendedlaboratory (olivetree leaves)
* *
No. d
ays
Chilocorus nigritus life span (number of days)
Control
Kaolin
Bordeaux mixture
Copper oxychloride
Dimethoate
Figure 43: C. nigritus life span (number of days) during the residual contact on a glass surface and the extended laboratory experiments. Asterisks indicate statistical differences between the treatments and the control (P<0.05)
Kaolin and copper-based products
82
The Weibull distribution fitted well the population survivorship data obtained for
the four treatments considered, with R2 values greater than 0.92 in most of the cases
(Table 5). Similar patterns were obtained for controls, kaolin and Bordeaux mixture
both in the residual contact on glass surfaces and the extended laboratory
experiments. For copper oxychloride, however, different patters compared to the rest
of the treatments were obtained (Figures 44 and 45). In the residual contact on glass
surfaces, the obtained curves correspond to a curve type I (taking into account the
different survivorship curve data described by Slobodkin (1962) for control, kaolin and
Bordeaux mixture (mortality acts most heavily on the old individuals) and type II‐III for
copper oxychloride (the mortality rate is more or less constant). In the extended
laboratory experiment, copper oxychloride curve correspond to a curve type II‐III,
while a curve type III‐IV fits better with the rest of the treatments (although the
mortality rate is more or less constant, it acts most heavily on the young stages).
Because no statistical differences were found on life span amongst the treatments, the
different curves mean that although the final effect of products id not different from
one to each other, copper oxychloride acts different than the rest of the treatments.
The differences on formulation between the two copper‐based products used in the
experiments could explain why Bordeaux mixture and copper oxychloride patterns are
different.
Table 5: Parameters estimated for the Weibull function describing the survivorship of C. nigritus adults at different treatments in two experiments: residual contact on glass surfaces and an extended laboratory experiments in which olive tree leaves were treated (mean data ± standard error)
b ±SEa c ± SEb R2c
Residual contact on glass surfaces
Control 155.9231 ± 0.8887 13.2611 ± 1.2251 0.6444 Kaolin 143.7869 ± 0.8641 5.3357 ± 0.2207 0.9498 Bordeaux mixture 153.9784 ± 1.1663 4.4493 ± 0.1963 0.9362 Copper oxychloride 142.3211 ± 1.4290 1.5776 ± 0.0386 0.9432
Extended laboratory
Control 120.8383 ± 1.5806 1.2885 ± 0.0347 0.9309 Kaolin 119.1735 ± 1.2598 1.3707 ± 0.0310 0.9531 Bordeaux mixture 147.0034 ± 1.8742 1.3683 ± 0.0392 0.9221 Copper oxychloride 144.7783 ± 2.0494 0.7818 ± 0.0189 0.9208 aScale of the Weibull distribution bShape of the Weibull distribution cCorrelation coefficient
Kaolin and copper-based products
83
Figure 44: Survival probability of C. nigritus adults (Series 1) and line of best fit by Weibull function (Series 2) at the different treatments on the residual contact on glass surfaces experiment
Figure 45: Survival probability of C. nigritus adults (Series 1) and line of best fit by Weibull function (Series 2) at the different treatments on the extended laboratory experiment
Kaolin and copper-based products
84
4.3.3 Emergence
When C. capitata pupae previously parasitized by P. concolor, were treated with
kaolin, copper formulations and dimethoate, statistical differences were found
between dimethoate and the rest of the treatments (F4,15 = 7.16, P = 0.0010). A
reduction of 32.9% emergence was found for dimethoate compared to the controls,
while no differences were found when results of kaolin and coppers were compared to
the controls (Figure 46; Table 7).
0
20
40
60
80
100
*
% Emergence
Treatment of pupae: % emergence
Control
Kaolin
Bordeaux mixture
Copper oxychloride
Dimethoate
Figure 46: Percentages of P. concolor emergence from treated pupae. Asterisks indicate statistical differences between the treatments and the control (P<0.05)
Kaolin and copper-based products
85
4.3.4 Beneficial capacity
Beneficial capacity (i.e. percentage of attacked hosts and progeny size) of P.
concolor females during or after the treatments remained unaffected in all the
experiments performed (P ≥ 0.05). Percentage of attacked hosts was higher than 95%
in most of the cases. When females ingested kaolin, however, statistical differences
were found (F = 5.99, P = 0.0098) and the percentage of attacked hosts was reduced
13.5 compared to the controls (Figure 47; Tables 6, 7 and 8).
0
10
20
30
40
50
60
70
80
90
100
Residualcontact(glass)
Extendedlaboratory(olive treeleaves)
Semi field Oraltoxicity
Treatmentof pupae
*
% Attacked hosts
Different experiments: % attacked hosts
Control
Kaolin
Bordeaux mixture
Copper oxychloride
Dimethoate
Figure 47: Percentage of P. concolor attacked host in different experiments. Asterisks indicate statistical differences between the treatments and the control (P<0.05)
Values of the percentage of progeny size were much more changeable. Depending
on the experiment, they ranked from the 30% up to the 77%, although the average
was around 45‐50%. However, no statistical differences were found among the
treatments in none of the experiments. Thus, differences could be related to the
specific characteristics and fitness of the females and the medfly larvae used in each
experiment (Figure 48; Tables 6, 7 and 8).
Kaolin and copper-based products
86
Beneficial capacity of females treated with dimethoate was not evaluated because
they did not survive long enough to do it, with the exception of the experiment in
which pupae were treated with the products. Reproductive parameters of females
emerged from dimethoate‐treated pupae did not present any statistical differences
when compared to controls (F4,15 = 1.51, P = 0.2479 for attacked hosts and F4,15 = 0.18,
P = 0.9429 for progeny size) (Figures 47 and 48).
0
10
20
30
40
50
60
70
80
90
100
Residualcontact(glass)
Extendedlaboratory(olive treeleaves)
Semi field Oraltoxicity
Treatmentof pupae
% Progeny size
Different experiments: % progeny size
Control
Kaolin
Bordeaux mixture
Copper oxychloride
Dimethoate
Figure 48: Percentage of P. concolor progeny size in different experiments
In the experiments in which the parasitization mesh was treated, a slight reduction
of the percentage of attacked host was found for kaolin (83%, compared to the values
higher than 99% for the control and coppers), although these differences disappeared
in the second part of the experiment, when parasitization meshes were not treated
(F3,12= 22.89, P < 0.0001 and F3,12= 1.52, P = 0.2654, respectively). In contrast, when
treated olive tree leaves were added, no statistical differences in this parameter were
observed during the whole experiment (F3,12= 2.82, P = 0.0840 for the first part of the
assay and F3,12= 1.77, P = 0.2070 for the second one). No statistical differences for
progeny size were found in any of the experiments (P ≥ 0.05) (Figures 49 and 50).
Kaolin and copper-based products
87
Figure 49: Percentage of P. concolor attacked hosts in the experiment in which females had to parasitize throughout a treated surface and in the experiment in which also treated olive tree leaves are placed into the parasitization cages. The differences between the beginning of the two experiments (treated materials) and the end (untreated meshes and no olive trees, in the second case) have also been compared. Asterisks indicate statistical differences between the treatments and the control (P<0.05)
Figure 50: Percentage of P. concolor progeny size in the experiment in which females had to parasitize throughout a treated surface and in the experiment in which also treated olive tree leaves are placed into the parasitization cages. The differences between the beginning of the two experiments (treated materials) and the end (untreated meshes and no olive trees, in the second case) have also been compared
0
10
20
30
40
50
60
70
80
90
100
Only mesh Mesh + olivetree leaves
Only mesh Mesh + olivetree leaves
Treated material After the treatment
*
% Attacked hosts
Treatment of the parasitization surface and olive tree leaves:
% attacked hosts
Control
Kaolin
Bordeaux mixture
Copper oxychloride
0
10
20
30
40
50
60
70
80
90
100
Only mesh Mesh + olivetree leaves
Only mesh Mesh + olivetree leaves
Treated material After the treatment
% Progeny size
Treatment of the parasitization surface and olive tree leaves:% progeny size
Control
Kaolin
Bordeaux mixture
Copper oxychloride
Kaolin and copper-based products
88
4.3.5 Dual choice and no-choice experiments
4.3.5.1 Psyttalia concolor
No statistical differences were found when compared kaolin with controls in the no‐
choice experiment (t = 2.13365, P = 0.076821 for the percentage of attacked hosts and
W = 9.0, P = 0.885229 for the percentage of progeny size). Slight statistical differences
were found, however, for the percentage of attacked hosts in the dual choice
experiment. This percentage was 81.7 for the controls, while it was 63.8 for the kaolin
replicates (W = 593.5, P = 0.03489). There were no differences for the percentage of
progeny size (t = 1.60231, P = 0.113129). In this dual choice assay, when the
percentages of attacked hosts and progeny size between kaolin and controls were
compared depending on which the treated mesh was, i.e., depending on the position
in which C. capitata larvae were offered to females, curious results were observed.
There were no statistical differences between kaolin and controls when the bottom
mesh was treated with kaolin (W = 15.0, P = 0.0590715 for attacked hosts and t = ‐
0.901544, P = 0.402037 for progeny size). In contrast, when the upper mesh was
treated, statistical differences were observed (W = 16.0, P = 0.0294009 for attacked
hosts and W= 16.0, P = 0.0303826 for progeny size). However, both in the dual choice
and the no‐choice experiments, the percentage of attacked hosts and progeny size
were always higher when females parasitized through the mesh in the bottom than
through the upper mesh, even if no statistical differences were observed (Figures 51,
52, 53 and 54).
Kaolin and copper-based products
89
0102030405060708090
100
Kaolin Water Kaolin Water
Upper mesh treated Bottom mesh treated
Dual choice
*
% Attacked hosts
Dual choice experiment: % attacked hosts
Figure 51: Percentage of P. concolor attacked hosts in the dual choice experiment. Asterisks indicate statistical differences between the kaolin and the control
0
20
40
60
80
100
Kaolin Water Kaolin Control
Dual choice No choice
*
% Attacked hosts
Dual choice and no‐choice experiments: % attacked hosts
Figure 52: Percentage of P. concolor attacked hosts in the dual choice and no‐choice experiments. With the aim of comparing experiments, in the dual choice assay all the kaolin treated and water treated surfaces have been grouped together. Asterisks indicate statistical differences between the kaolin and the control
Kaolin and copper-based products
90
0
20
40
60
80
100
Kaolin Water Kaolin Water
Upper mesh treated Bottom mesh treated
Dual choice
*
% Progeny size
Dual choice experiment: % progeny size
Figure 53: Percentage of P. concolor progeny size in the dual choice experiment. Asterisks indicate statistical differences between the kaolin and the control
0
20
40
60
80
100
Kaolin Water Kaolin Control
Dual choice No choice
% Progeny size
Dual choice and no‐choice experiments: % progeny size
Figure 54: Percentage of P. concolor progeny size in the dual choice and no‐choice experiments. With the aim of comparing experiments, in the dual choice assay all the kaolin treated and water treated surfaces have been grouped together
Although daily observations of females while they were parasitizing showed that
they were able to parasitize through both surfaces, a detail study of the percentage of
attacked hosts demonstrated that females were more likely to do it through the
bottom mesh. Figures 55 and 56 showed that both in the dual choice and no‐choice
Kaolin and copper-based products
91
experiments, the percentage of attacked hosts remained more or less constant during
the four days of the experiments when females parasitize through the bottom mesh. In
contrast, these percentages strongly fluctuate during the experiment when the
parasitisation in the upper mesh was evaluated.
Figure 55: Daily fluctuation in the percentage of P. concolor attacked hosts in the no‐choice experiment
Figure 56: Daily fluctuation in the percentage of P. concolor attacked hosts in the dual choice experiment
0
10
20
30
40
50
60
70
80
90
100
Day 1 Day 2 Day 3 Day 4
% Attacked hosts
Dual choice experiment: daily fluctuation of % attacked hosts
Kaolin top
Water bottom
Kaolin bottom
Water top
0
10
20
30
40
50
60
70
80
90
100
Day 1 Day 2 Day 3 Day 4
% Attacked hosts
No choice experiment: daily fluctuation of % attacked hosts
Control Upper
Control Bottom
Kaolin Upper
Kaolin Bottom
Kaolin and copper-based products
92
4.3.5.2 Chilocorus nigritus
Most of C. nigritus adults were found on the egg card boxes or other parts of the
cages, rather than on the butternuts in all the observations done during the four days
the experiment lasted (in the no‐choice experiment, 13.9 % of the adults were found
on the butternuts and 85.5% in different parts of the cages in the controls. Similar
percentages, 12.4% and 87.6%, respectively, were observed in the kaolin replicates). In
the dual choice assay, results were similar (12.1% of adults were on the butternuts,
mostly on the non‐treated infested butternuts, and 87.9% on other parts of the cages)
(Figures 57 and 58; Table 11).
In the no‐choice experiment, statistical differences were found when the level of A.
nerii infestation was compared, and more adults were found on the infested
butternuts than on the uninfested ones (F = 165.42, P < 0.0001). In contrast, no
differences were found when the treatment was compared (F = 1.24, P = 0.2668).
These results suggest than C. nigritus adults are more likely to be on the infested
butternuts, no matter whether they are treated or not.
In the dual choice assay, statistical differences were found either when the
treatment or the infestation level were compared (F = 87.78, P < 0.0001 and F = 14.72,
P = 0.0001, respectively). These results show that C. nigritus are found mainly on the
infested butternuts and that once on these infested surfaces, if they can choose
between being on a treated surface or not, they prefer to be on the untreated parts.
The results also suggested that there is an interaction among the two considered
parameters (i.e. infestation level and treatment) (P = 0.001).
Kaolin and copper-based products
93
0
10
20
30
40
50
60
70
80
90
100
Day 1 Day 2 Day 3 Day 4
% C. nigritusadults
Dual‐choice experiment: % Chilocorus nigritus adults on the butternuts or other different parts
Other
Non infested butternut‐ kaolin
Non infested butternut‐ water
Infested butternut‐ kaolin
Infested butternut‐ water
Figure 57: Dual choice experiment: percentages of C. nigritus adults placed in the infested butternuts, the non‐infested ones or other parts of the experimental cages. Percentages were recorded during 4 days. “Water” means the half of the butternut treated with distilled water and “Kaolin” the other half, treated with kaolin
0
20
40
60
80
100
Control
Kaolin
Control
Kaolin
Control
Kaolin
Control
Kaolin
Day 1 Day 2 Day 3 Day 4
% C. nigritus adults
No choice experiment: % Chilocorus nigritus adults on the butternuts or other different
parts
Other
Non infested butternut
Infested butternut
Figure 58: Percentages of C. nigritus adults placed in the infested butternuts, the non‐infested ones or other parts of the experimental cages in the no‐choice experiments. Percentages were recorded during 4 days. “Control” means the replicates in which both butternuts were treated with distilled water and “Kaolin” indicates the replicates in which both were treated with kaolin
Kaolin and copper-based products
94
Despite not evaluating fecundity and fertility, the presence/absence of C. nigritus
larvae was recorded at the end of the experiment. Larvae were found both in the
cages and on the butternuts, especially close to the places were first instar scales
(crawlers) were, as for example the butternuts (where most of the larvae were
observed) and the corners of the cages (maybe crawlers walked to the corners of the
cages because there was more light there than in other parts of the cages and they
were attracted to it). Although the number of larvae was very changeable: from 4 up
to 35, depending more on the replicate than on the treatment), in most of the cages
this number was related to the level of A. nerii infestation of the butternuts and the
abundance of A. nerii N1, which are the food of newly emerged predator’s larvae (they
were more abundant in the cages in which the number of scales, including first instars,
was higher). It should be also remarked that at the time of checking the presence of
larvae, a high percentage of them had already died, which could be due either to the
treatment with kaolin or a limited number of crawlers (Figure 59).
0
5
10
15
20
25
30
35
Cage1
Cage2
Cage3
Cage1
Cage2
Cage3
Cage1
Cage2
Cage3
Controls Kaolin Control + kaolin
No‐choice Dual choice
No. C. n
igrituslarvae
Number of C. nigritus larvae found at the end of the experiments
Death
Infested butternuts
Cage (egg box, walls, etc.)
Figure 59: Number of C. nigritus larvae found in the different replicates of each treatment. In the dual choice experiment, larvae on the butternuts were always observed on the non‐treated parts of the butternuts. It can be observed the high percentage of dead larvae, especially on the kaolin treated butternuts
Kaolin and copper-based products
95
4.4 Discussion
Based on the results obtained in the different experiments performed, both kaolin
and copper salts seem to be not toxic to the natural enemies tested. The sole
exception was the oral toxicity assay, in which a reduction of life span of P. concolor
females was observed for the three products. In the case of C. nigritus, although no
effects have been proved on the parameters studied, possible negative effects on
fecundity and fertility still remained unknown, and they should be determined.
According to the IOBC categories, kaolin and copper salts were classified as
harmless (1), or slightly toxic (2), depending on the parameter studied. Only when
kaolin was ingested by P. concolor females, it was classified as moderately toxic (3).
However, this product did not cause as high deleterious effect as in this case in a
similar experiment performed with kaolin solved into the drinking water or sprayed on
the females’ food (data non shown).
Dimethoate was classified as toxic, except when parasitized pupae were treated
with the product. In this last case, negative effects of this product were lower. This
result can be explained taking into account that the intrinsic toxicity of an insecticide is
determined by the rate of arrival at the site of action. Pupae are the most protected
stage both for C. capitata and P. concolor. When dimethoate was sprayed on
parasitized pupae, P. concolor individuals were at pupal stage. Thus, a lower amount of
the insecticide arrived to the target site; which explained the reduction of the
percentage of emergence. No negative effects were reported for emerged adults,
compared to the other treatments. Youssef et al. (2004) observed similar results when
Sitotroga cerealella (Olivier) eggs including mature pupae of Trichogramma spp. were
directly sprayed with dimethoate.
Kaolin and copper-based products
96
4.4.1 Lethal and sublethal effects of kaolin, Bordeaux mixture and copper oxychloride
At field level, results of the different studies performed all over the world, showed
contradictory results. This could be due to a variety of factors, such as the pest or
beneficial studied, the methodology of the experiment, the particular climatic
conditions during the assay, etc. Kaolin has been reported to have a strong effect on
the olive grove’s arthropod community at the canopy level, in which the abundance of
arthropods is usually reduced after the treatments. Similarly, in a study conducted in
an olive grove in Madrid (Spain), Pascual et al. (2010a) showed that kaolin reduced the
abundance and diversity of arthropods after three consecutive years of treatment (the
treatment covered the entire foliage, and two treatments were applied per year). The
most affected taxa were certain coccinellids, mirids, different species of Orius and the
families Philodromidae, Scelionidae, Pteromalidae, Chrysopidae and Aphelinidae. At
soil level, however, the abundance did not decrease but the structure of the
community was modified (i.e. the overall number of auxiliars remained unaffected, but
the relative number within the same taxa changed). This effect can be the result of the
interference between the kaolin particle film and the feeding strategies utilised by
pollinators, phytophagous insects and predators (Iannotta et al., 2007a; 2008). Studies
carried out in pear orchards also reported a reduction on the reproduction of the pear
psyllas predator Anthocoris nemoralis (F.) (Heteroptera, Antocoridae) (Pasqualini et al.,
2003; Gobin et al., 2005). Showler and Sétamou (2004) also observed a reduction on
dipterans, Orius spp. and wasps after kaolin sprayed in cotton, although no adverse
effects were reported for other arthropod populations, including different natural
enemies. In contrast, Porcel et al. (2011) did not find any difference in the abundance
of adult C. carnea after kaolin applications in olive orchards and Kourdoumbalos et al.
(2006) showed no adverse effects on coccinellid populations after kaolin applications
in pear orchards either.
Fewer references can be found about the effects of copper application on non‐
target arthropods. Studies of the application of copper to olive orchards apparently
showed that the product seemed to be harmless to the taxa at the canopy level,
Kaolin and copper-based products
97
whereas it had a stronger negative effect on the arthropod communities at the soil
level (Iannota et al., 2007a; Scalercio et al., 2009). This effect could be due to the lower
dispersal ability of above‐ground arthropods (primarily walkers) compared with
canopy arthropods (primarily fliers). However, a reduction of Chrysopids in olive
groves after copper applications was also observed by González‐Núñez et al. (2008).
Nevertheless, long term effects of copper salts should be also taken into account
because copper has a high persistence in the soil. Thus, copper residues can be
accumulated in the environment (Scalercio et al., 2009), which could explain the
results showed above.
To the best of my knowledge, few references are available on the effects of kaolin
and copper on beneficial insects of olive orchards in the laboratory.
No effects on mortality have been found on P. concolor and C. nigritus, except when
the products were ingested. Adán et al. (2007) also reported no effects of kaolin on P.
concolor mortality when females were exposed to kaolin‐treated vegetation. Similarly,
no effects on mortality were observed on the natural enemies C. carnea, Chelonus
inanitus L. (Hymenoptera, Braconidae) and Scutellysta cyanea Motschulsky (= S.
caerulea; Hymenoptera, Pteromalidae), in residual contact and extended laboratory
experiments (Bengochea et al., 2010 and Bengochea et al., 2012‐sent). Porcel et al.
(2011) reported no effects on the mortality of third‐ instar C. carnea sprayed directly
with kaolin. However, larvae coated with the product showed a slightly hampered
movement capacity and a preference for clean surfaces. The authors have also
observed that if younger larvae were sprayed with kaolin, they removed the particle
layer deposited on their cuticle when they moulted.
Boyce (1932) suggested that when adults of the fruit fly Rhagoletis completa
Cresson (Diptera, Tephritidae) ingested different undissolved dust particles, they died
because particles abraded their alimentary canal tissues. This could explained the
higher mortality rates observed when P. concolor females ingested kaolin solutions,
compared to the rest of the experiments carried out in this work. A higher mortality of
insect after kaolin ingestion was also observed on Rhagoletis indifferens Curran
Kaolin and copper-based products
98
(Diptera, Tephritidae) (Yee, 2007), and when larvae of Choristoneura rosaceana
(Harris) (Lepidoptera, Tortricidae) were fed on kaolin‐sprayed apple leaves (Sackett et
al., 2005). Similarly, when second instar larvae of Trichoplusia ni (Hübner)
(Lepidoptera, Noctuidae) were fed on cabbage leaves, a 60% of mortality was
registered (Díaz et al., 2002). It has been reported that Hymenopteran parasitoids are
especially sensitive to dust due to their specialized structures for removing dust
particles. Dust is trained from liquid food and placed in a “gnathal pouch” just beneath
the mouth. It can be observed a lack of coordination in their movements, and they
wallow helplessly too (Quarles, 1992). In the case of predators, examinations of the
digestive tracts of dusted beetles before or after death showed that most of the
beetles which succumbed to toxic substances on dusted foliage were killed by particles
which were removed from their body and apendages by the mandibles rather than by
particles ingested with the food. The excitation resulting from particles which have
fallen upon the bodies, or which adhere to the appendages of the beetles as they walk
over dusted plant surfaces, is so great that the process of removal and ingestion is
begun at once (Richardson and Glover, 1932). However, no kaolin particles were found
attached to P. concolor or C. nigritus bodies after the treatments.
Effects of copper salts on natural enemies have been reported in several previous
studies. Copper oxychloride did not affect the mortality of the predators Orius
laevigatus Fieber (Hemiptera, Anthocoridae) if fourth‐instar larvae and young adults
were exposed to the product by contact or by ingestion, respectively (Angeli et al.
2005). Silva et al. (2005) also reported no negative effects of this product when larvae
of C. carnea were directly sprayed using the Potter´s Tower. Similarly, Ventura et al.
(2009) found basic copper sulphate to be harmless when the product was sprayed on
pupae parasitised by Trichogramma cordubense Vargas & Cabello (Hymenoptera,
Trichogrammatidae). When first and third instar larvae of three species of ladybeetle
(Coleoptera, Coccinellidae: Curinus coeruleus Mulsant, Harmonia axyridis Pallas, and
Olla v‐nigrum Mulsant) were exposed during 24 h to field rates of copper sulphate in
combination with petroleum oil, all larvae of all three species survived to adulthood at
the same rate as control larvae, but larvae of O. v‐nigrum experienced a significant
increase in developmental time (Michaud and Grant, 2003). In contrast, a slightly
Kaolin and copper-based products
99
higher mortality 72 h after the treatments was reported for A. nemoralis after kaolin
and copper applications (Bengochea et al., 2010 and Bengochea et al., 2012‐sent).
Effects on longevity after exposure to lethal or sublethal doses of pesticides have
been described mostly for parasitoids species and to lesser extent for predators.
Depending on the study, reduced longevity may be considered a sublethal effect or
latent mortality. Extrapolation of these effects to the population level is difficult
because, depending on the biology of the particular natural enemy (proovigenic or
synovigenic, parasitod or predator), they may be more or less likely to reproduce
and/or kill pests before their premature death. From a practical perspective, it is the
resulting amount of feeding and reproduction that occurs between exposure and
death that is important (Desneux et al., 2007). Previous studies of the effects of kaolin
and copper on longevity have obtained different results, depending on the insect, the
product tested and the experiment performed. In this work, no effects of the three
tested products have been observed in any of the experiments (except oral toxicity). In
agreement, Ventura et al. (2009) did not found a reduction on the life span of the
parasitoid T. cordubensis after copper applications. In contrast to my results,
Villanueva‐Jiménez and Hoy (1998), observed a 39.2% reduction of the survival of the
parasitoid Ageniaspis citricola Logvinovskaya (Hymenoptera, Encyrtidae) after copper
hydroxide applications on grapefruit leaves. Bengochea et al. (2012‐sent) also reported
a reduction of S. cyanea and C. inanitus life span when adults were exposed to kaolin‐
and copper‐treated olive tree leaves. Similarly, Knight et al. (2000) observed a
reduction of C. rosaceana female’s longevity after their exposure to kaolin‐treated
apple leaves. The reduction of life span when kaolin is ingested could be explained
from autointoxication as a result of failure to eliminate excrement or starvation
(Boyce, 1932).
Reductions in the reproductive parameters associated with pesticides may be due
to both physiological and behavioral effects (Desneux et al., 2007). The effects of the
products on reproduction also depend on the insect tested. In the case of parasitoids,
the differences in host location strategies, as well as larval habits (degree of larvae
enclosure inside fruits, leaf miners or leaf folds), may affect the interactions between
Kaolin and copper-based products
100
kaolin and parasitism and explain why some parasitoids are not affected by treatments
(Sackett et al., 2005; 2007).
Kaolin had no effects on the beneficial capacity of P. concolor, in any of the
experiments performed. Similarly, Adán et al. (2007) found no effects of kaolin
exposure on the beneficial capacity of P. concolor. Porcel et al. (2011) observed no
sublethal deleterious effects on C. carnea adults emerged from treated larvae or on
the early survival of newly emerged first instars after spraying the eggs with kaolin. In
agreement, no effects of kaolin on the fecundity or fertility of the predator C. carnea
have been also reported by Bengochea et al. (sent to Journal of Economic
Entomology.). However, deleterious effects on these parameters after kaolin
treatments have been reported. A reduction of A. nemoralis fecundity was observed
when adults were in contact with kaolin‐treated olive tree leaves, although no effects
were detected on the fertility of the eggs laid (Bengochea et al., 2012‐sent). Kahn et al.
(2001) also reported negative effects on the reproductive parameters of the parasitoid
Pnigalio flavipes Erdos (Hymenoptera, Eulophidae). The females were not able to
recognise their hosts, the western tentiform leafminer, if they were covered by kaolin
particles. This was the same effect as Grafton‐Cardwell and Reagan (2003) reported on
the citrus Diaspididae parasitoids, Aphytis melinus DeBach (Hymenoptera, Aphelinidae)
and Comperiella bifasciata Howard (Hymenoptera: Encyrtidae). Laboratory and
greenhouse assays carried out by Sisterson et al. (2003) and Showler (2003) on
different pests are consistent with the results of this study. The two assays cited
showed that kaolin was a partial deterrent. The kaolin treatment reduced the number
of eggs laid by the pink bollworm, Pectinophora gossypiella (Saunders) (Lepidoptera,
Gelechiidae) and the beet armyworm, Spodoptera exigua (Hübner) (Lepidoptera,
Noctuidae) on cotton bolls or plants (Cadogan and Sabaranch 2005a,b). However,
Porcel et al. (2011) observed in a laboratory study that C. carnea females preferred to
oviposit on the treated surface rather than on the controls. The explanation for this
finding may be that the treated surface was more suitable for anchoring the eggs.
However, the particle film attraction effect on adults was not observed at field level.
Kaolin and copper-based products
101
Copper‐based products did not affect the reproductive parameters of P. concolor
either. In agreement with our results, Angeli et al. (2005) observed that the fertility
and fecundity of the predator O. laevigatus were unaffected when adults were
exposed to copper residues through contact or ingestion. Little or no adverse effects
on emergency rates, longevity or fecundity of T. cordubense have been reported either
after basic copper sulphate applications (Ventura et al., 2009). Bengochea et al.a,b (sent
to Journal of Economic Entomology and 2012‐sent) observed similar results in treated
C. carnea larvae. In contrast, laboratory experiments with adults of C. carnea showed a
decrease of fecundity in individuals exposed to Bordeaux mixture. No negative effects
on fertility were reported, however. Similar effects were observed in this study for A.
nemoralis, although in this case the effects of copper oxychloride were more severe
than the effects of Bordeaux mixture. Female adults of C. coeruleus and H. axyridis
receiving copper sulphate exposures as larvae did not differ from control adults in pre‐
reproductive period, fecundity or fertility over ten days of reproduction. Treated O. v‐
nigrum females, however, had significantly longer pre‐reproductive periods than
control females and laid significantly fewer eggs, although egg fertility was equivalent
(Michaud and Grant, 2003). Laboratory tests carried out by Ye et al. (2009) showed
that copper oxychloride could be transferred along food chains to secondary
consumers (parasitoids) in small amounts, resulting in negative effects on parasitoid
growth and development (body weight and developmental duration), as well as
fecundity (number of offspring per female). Copper exposure also inhibited
vitellogenesis of parasitoids from Cu‐contaminated host pupae. When the effect of
fresh copper hydroxide residue was tested on Phyllocnistis citrella Stainton
(Lepidoptera, Noctuidae) and its parasitoid A. citricola, it allowed high survival of leaf
miner adults, but reduced survival of A. citricola adults, and it was ranked as
moderately selective to the parasitoid (Villanueva‐Jiménez and Hoy, 1998).
Kaolin and copper-based products
102
4.4.2 Effects of kaolin treated surfaces in dual choice and no-choice experiments
Different laboratory dual choice experiments showed a reduction of oviposition or
feeding damage on kaolin treated surfaces in the case of several pests, such as B.
oleae, C. rosaceana, P. gossypiella, Lymantria dispar (L.) (Lepidoptera, Lymantriidae),
Choristoneura fumiferana (Clemens) (Lepidoptera, Tortricidae), Thrips tabaci Lindeman
(Thysanoptera, Thripidae), S. exigua or R. indifferens (Knight et al., 2000; Sisterson et
al., 2003; Showler, 2003; Cadogan and Sabaranch, 2005a,b; Yee, 2007; Larentzaki et al.,
2008; Pascual et al., 2010b; Yee, 2010). These results are in agreement with those
obtained in the experiment with C. nigritus and P. concolor. Adults of the predator
seemed to prefer non kaolin‐treated surfaces when they were able to choose between
a treated and an untreated one. Similarly, the percentage of attacked hosts by P.
concolor females was higher in the controls than in the kaolin. In an experiment carried
out with the potato psylla, Bactericera cockerelli (Sulc) (Homoptera, Psyllidae), the
number of adults on the leaves depended on the leaf surface treated: when kaolin was
applied on the upper surface of the leaves, adults were found in a higher number in
the controls. In contrast, when the lower or both surfaces were treated, there were
not differences between the number of adults found in the controls and in the kaolin‐
treated leaves. However, 72‐h after the treatments, the number of psyllids on the
controls was significantly greater. It was also observed that the adults landed on the
treated leaves, apparently tried to escape from them by moving around. They tested
the leaf surface because their mouthparts could penetrate through the kaolin particle
film barrier on the surface into leaf tissue. Even though potato psyllid adults could land
on the kaolin‐treated plants, when given a choice, the psyllids avoided plants treated
with kaolin particle film under laboratory and field conditions. When no choice was
given, a fewer number of eggs was observed (Peng et al., 2011). Liang and Liu (2002)
reported a similar effect for the adults of the silverleaf whitefly, Bemisia argentifolii
(Bellows & Perring) (Homoptera, Alerodidae). They also observed that whitefly adults
after landing on the treated leaves quickly move forward to the uncoated areas,
forming many clusters of adults and eggs on the green spots on the leaves. These
results are in agreement with the results obtained in the C. nigritus
Kaolin and copper-based products
103
In the no‐choice tests, when insects cannot choose between a kaolin‐coated surface
and a clean one, the product did not have the same deleterious effects as those
reported in the dual choice experiments. Although Pascual et al. (2010b), found that
both the percentage of attacked olives and the number of oviposition stings per olive
were reduced by kaolin treatment, the product did neither completely inhibited
oviposition nor did negatively influence the percentage of egg hatching or larval
feeding, in the case of C. fumiferana, L. dispar, R. indifferens (Cadogan and Scharbach,
2005a,b; Yee, 2007). In agreement with the last results, there were not differences
between the percentage of C. nigritus adults found on the treated and the untreated
butternuts, and no differences on beneficial capacity of P. concolor were detected
either.
Kaolin and copper-based products
104
4.5 Appendix (tables of results)
Table 6: Percentages of mortality 72 hours after exposure, attacked hosts and progeny size of P. concolor after kaolin, Bordeaux mixture, copper oxychloride and dimethoate applications on an inert surface, an extended laboratory and a semifield experiments (mean data ± standard error)
Data followed by the same letter are not significantly different (ANOVA, LSD; P≥0.05) 1Mortality corrected following the Schneider‐Orelli formula: M (%) = [(Mtreated – Mcontrol)/(100 – Mcontrol)]*100 2 Attacked hosts and progeny size corrected following the Abbot formula: P (%) = [1‐ (Ptreated/ Pcontrol)] x 100 3IOBC toxicity rating: Laboratory: 1 (harmless) < 30%; 2 (slightly harmful) 30‐79%; 3 (moderately harmful) 80‐99%; 4 (harmful) >99%; Extended laboratory and semifield: 1 <25%; 2 25‐50%; 3 51‐75%; 4 >75% 4Data analyzed using Kruskal‐Wallis test.
% Mortality 72h
Reduction1 (%) IOBC3
% Attacked hosts Reduction2 (%)
IOBC3 % Progeny size
Reduction2 (%) IOBC3
Residual contact on glass surfaces
Control 0.0a ± 0.0 ‐ 83.0a ± 6,6 ‐ 54.8a ± 7.2 ‐ Kaolin 0.0a ± 0.0 0/1 97.7a ± 1.3 ‐17.6/1 65.0a ± 3.9 ‐18.6/1 Bordeaux mixture 0.0a ± 0.0 0/1 91.8a ± 3.7 ‐10.5/1 60.2a ± 4.8 ‐9.9/1 Copper oxychloride 0.0a ± 0.0 0/1 92.2a ± 5.8 ‐11.0/1 52.1a ± 4.4 4.8/1 Dimethoate 100.0b ± 0.0 100/4 ‐ ‐ ‐ ‐
K=24.04 F3,12=1.57 F3,12=1.21 P<0.0001 P=0.2484 P=0.3497
Extended laboratory
Control 3.8a ± 2.3 ‐ 96.3a ± 1.6 ‐ 54.8a ± 10.4Kaolin 0.0a ± 0.0 ‐4.0/1 97.4a ± 0.6 ‐1.2/1 65.1a ± 9.5 ‐18.7/1Bordeaux mixture 1.8a ± 1.8 ‐2.1/1 95.8a ± 1.7 0.5/1 77.4a ± 4.4 ‐41.2/1Copper oxychloride 5.3a ± 3.4 1.6/1 96.9a ± 1.7 ‐0.7/1 64.3a ± 12.1 ‐17.2/1Dimethoate 100.0b ± 0.0 100/4 ‐ ‐ ‐ ‐
F4,20= 460.75 F3,12=0.24 F3,12= 0.94 P<0.0001 P=0.8676 P=0.4522
Semi‐field
Control 1.1a ± 1.1 ‐ 92.7a ± 3.3 ‐ 49.2a ± 4.8 ‐Kaolin 1.1a ± 1.1 0.0/1 94.3a ± 2.7 ‐1.22/1 45.2a ± 4.3 ‐18.7/1Bordeaux mixture 3.3a ± 1.9 2.24/1 90.2a ± 6.5 0.5/1 54.0a ± 3.5 ‐41.2/1Copper oxychloride 1.1a ± 1.1 0.0/1 93.3a ± 3.9 0.7/1 45.3a ± 4.1 ‐17.2/1Dimethoate 98.9b ± 1.1 98.9/4 ‐ ‐ ‐ ‐
F4,10=1094.77 F3,12=0.16 F3,12= 0.99 P<0.0001 P= 0.9196 P= 0.4314
Table 7: Percentages of mortality 72 hours after exposure, life span, emergence, attacked hosts and progeny size of P. concolor after kaolin, Bordeaux mixture, copper oxychloride and dimethoate applications on parasitized pupae or ingested via their drinking water (mean data ± standard error)
Data followed by the same letter are not significantly different (ANOVA, LSD; P≥0.05) 1Mortality corrected following the Schneider‐Orelli formula: M (%) = [(Mtreated – Mcontrol)/(100 – Mcontrol)]*100 2 Life span, emergence and attacked hosts and progeny size corrected following the Abbot formula: P (%) = [1‐ (Ptreated/ Pcontrol)] x 100 3IOBC toxicity rating: Laboratory: 1 (harmless) < 30%; 2 (slightly harmful) 30‐79%; 3 (moderately harmful) 80‐99%; 4 (harmful) >99% 4Data analyzed using Kruskal‐Wallis test.
Oral toxicity
% Mortality
72h Reduction1(%)
IOBC3 Life span (days)
Reduction2(%) IOBC 3
% Attacked hosts
Reduction2(%) IOBC 3
% Progeny size
Reduction2(%) IOBC 3
Control 0.0a ± 0.0 ‐ 20.1a ± 2.1 ‐ 94.4a ± 4.0 ‐ 49.8a ± 3.0 Kaolin 36.0ab ± 21.1 36.0/2 3.9c ± 0.6 80.5/3 81.6b ± 6.9 13.5/1 46.4a ± 4.8 6.9/1 Bordeaux mixture 4.0ab ± 2.7 4/1 13.8b ± 0.7 31.1/2 97.2a ± 1.6 ‐2.9/1 61.5a ± 6.4 ‐23.4/1 Copper oxychloride 0.0a ± 0.0 0/1 13.3b ± 1.0 33.6/2 99.8a ± 0.2 ‐5.7/1 51.7a ± 6.9 ‐3.8/1 Dimethoate 100.0b ± 0.0 100/4 1.38d ± 0.13 93.1/3 ‐ ‐ ‐ ‐
K= 17.38684 F4,20= 78.01 F3,12=5.99 F3,12=1.38 P= 0.0016255 P < 0.0001 P=0.0098 P=0.2950
Treatment of pupae
% Emergence
Reduction2(%) IOBC 3
Life span (♀)
Reduction2(%) IOBC3
% Attacked hosts
Reduction2(%) IOBC3
% Progeny size
Reduction2(%)IOBC3
Control 55.7a ± 4.3 ‐ 55.3a ± 2.5 ‐ 99.1a ± 0.5 ‐ 31.6a ± 9.8 ‐ Kaolin 66.5a ± 6.6 ‐19.4/1 49.6a ± 2.8 10.3/1 96.4a ± 1.5 2.8/1 38.6a ± 8.3 ‐22.1/1 Bordeaux mixture 64.8a ± 4.3 ‐16.2/1 48.2a ± 3.8 12.8/1 98.7a ± 0.9 0.4/1 37.9a ± 10.4 ‐19.9/1 Copper oxychloride 63.6a ± 3.6 ‐14.2/1 48.6a ± 2.7 12.0/1 98.8a ± 0.3 0.3/1 30.0a ± 13.9 4.9/1 Dimethoate 37.4b ± 2.7 32.9/2 46.3a ± 3.8 16.2/1 89.5a ± 7.1 9.6/1 29.6a ± 6.7 6.2/1
F4,20=7.16 F4,20=1.14 F4,15=1.51 F4,15= 0.18 P=0.0010 P=0.3678 P= 0.2479 P= 0.9429
Kaolin and copper-based products
107
Table 8: Percentages of mortality 72h after exposure and life span C. nigritus adults after kaolin, Bordeaux mixture, copper oxychloride and dimethoate applications on an inert surface and in an extended laboratory experiment (mean data ± standard error)
Data followed by the same letter are not significantly different (ANOVA, LSD; P≥0.05) 1Mortality corrected following the Schneider‐Orelli formula: M (%) = [(Mtreated – Mcontrol)/(100 – Mcontrol)]*100 2 Life span corrected following the Abbot formula: P (%) = [1‐ (Ptreated/ Pcontrol)] x 100 3IOBC toxicity rating: Laboratory: 1 (harmless) < 30%; 2 (slightly harmful) 30‐79%; 3 (moderately harmful) 80‐99%; 4 (harmful) >99%
% Mortality 72h
Reduction1 (%)IOBC3
Life span (days)
Reduction2(%)IOBC3
Residual contact on glass surfaces
Control 0.0a ± 0.0 ‐ 140.7a ± 8.3 ‐ Kaolin 2.2a ± 2.2 2.2/1 126.9a ± 7.7 9.8/1 Bordeaux mixture 0.0a ± 0.0 0.0/1 140.9a ± 7.5 ‐0.1/1 Copper oxychloride 4.4a ± 2.7 4.4/1 119.6a ± 21.8 ‐15.0/1 Dimethoate 100.0b ± 0.0 100.0/4 1.0b ± 0.0 99.3/4
F4,20= 784.60 F4,20=26.58 P<0.0001 P<0.0001
Extended laboratory
Control 3.1a ± 3.1 ‐ 117.8a ± 7.2 ‐ Kaolin 3.1a ± 3.1 0.0/1 108.7a ± 11.2 7.7/1 Bordeaux mixture 3.1a ± 3.1 0.0/1 134.9a ± 11.3 ‐14.6/1 Copper oxychloride 3.1a ± 3.1 0.0/1 126.9a ± 26.8 ‐7.71 Dimethoate 100.0b ± 0.0 100/4 1.0b ± 0.0 99.1/4
F4,15= 240.25 F4,15=14.80 P<0.0001 P<0.0001
Table 9: Percentages of attacked hosts and progeny size when P. concolor parasitize through a kaolin, Bordeaux mixture or copper oxychloride treated surface with or without olive tree treated leaves. Percentages have been recorded when the surfaces were treated and when females were transferred into non treated cages (mean data ± standard error)
Treated surface After treatment (non‐treated surface)
% Attacked hosts
Reduction1(%) IOBC2
% Progeny size
Reduction1(%) IOBC2
% Attacked hosts
Reduction1(%)IOBC2
% Progeny size
Reduction1(%) IOBC2
Treatment of parasitization surface
Control 99.5a ± 0.3 ‐ 66.0a ± 2.9 ‐ 98.7a ± 0.7 ‐ 52.0a ± 4.7 ‐ Kaolin 83.1b ± 4.7 16.4/1 70.4a ± 2.7 ‐6.6/1 97.3a ± 1.2 1.4/1 69.3a ± 4.5 ‐33.4/1 Bordeaux mixture 99.3a ± 0.3 0.1/1 69.5a ± 3.5 ‐5.2/1 99.2a ± 0.3 ‐0.0/1 53.2a ± 5.4 ‐2.3/1 Copper oxychloride 99.5a ± 0.2 0.0/1 65.8a ± 4.5 0.3/1 99.2a ± 0.5 0.5/1 58.3a ± 4.2 ‐12.2/1
F3,12=22.89 F3,12=0.45 F3,12=1.52 F3,12=2.77
P<0.0001 P=0.7219 P=0.2604 P=0.0872
Treatment of parasitization surface and olive tree leaves
Control 92.1a ± 4.7 ‐ 73.4a ± 3.5 ‐ 94.5a ± 1.3 ‐ 76.0a ± 5.8 ‐ Kaolin 89.4a ± 2.2 2.9/1 70.8a ± 1.4 3.6/1 94.2a ± 2.4 0.3/1 71.2a ± 4.5 6.2/1 Bordeaux mixture 94.5a ± 1.1 ‐2.6/1 72.3a ± 4.9 1.5/1 89.7a ± 4.4 5.1/1 72.8a ± 4.3 4.2/1 Copper oxychloride 98.3a ± 0.8 ‐6.8/1 78.6a ± 3.6 ‐7.1/1 98.2a ± 0.8 ‐3.9/1 75.6a ± 4.1 0.4/1
F3,12=2.82 F3,12=0.89 F3,12=1.77 F3,12=0.23 P=0.0840 P=0.4761 P=0.2070 P=0.8720 Data followed by the same letter are not significantly different (ANOVA, LSD; P≥0.05) 2 Attacked hosts and progeny size corrected following the Abbot formula: P (%) = [1‐ (Ptreated/ Pcontrol)] x 100 3IOBC toxicity rating: Laboratory: 1 (harmless) < 30%; 2 (slightly harmful) 30‐79%; 3 (moderately harmful) 80‐99%; 4 (harmful) >99%; Extended laboratory: 1 <25%; 2 25‐50%; 3 51‐75%; 4 >75%
Kaolin and copper-based products
109
Table 10: Percentages of attacked hosts and progeny size in the dual choice and the no‐choice experiments when P. concolor females parasitize through a kaolin‐treated surface (mean data ± standard error)
Significant differences between treatment means were detected using the two sample t‐tests for the study of the beneficial capacity. If any of the assumptions of the analysis of were violated, the non‐parametric Mann‐Whitney U test was applied. Data followed by the same letter are not significantly different (P≥0.05)
Table 11: C. nigritus: dual choice and no‐choice experiments. Percentage of adults found on the butternuts (mean data ± standard error)
Infested butternut
Uninfested butternut
Marginal mean
No choice
Control 14.4 ± 1.3 0.1 ± 0.1 7.25a ± 0.66 Kaolin 11.1 ± 1.2 1.3 ± 0.5 6.21a ± 0.66
Marginal mean 12.76a ± 0.66 0.70b ± 0.66
Dual choice
Control 8.5 ± 1.2 0.0 ± 0.0 4.25a ± 0.46 Kaolin 3.6 ± 0.5 0.0 ± 0.0 1.79b ± 0.46
Marginal mean 6.05a ± 0.46 0.0b ± 0.46
Data followed by the same letter are not significantly different (Multifactorial ANOVA; P≥0.05)
% Attacked hosts % Progeny size
No‐choice
Control 74.0a ± 3.2 43.8a ± 1.8 Kaolin 59.1a ± 6.2 48.7a ± 8.0
t = 2.13365 W = 9.0 P = 0.076821 P = 0.885229
Dual choice (all together)
Control 81.7a ± 5.7 48.3a ± 4.0 Kaolin 63.8b ± 7.0 38.0a ± 5.0
W = 593.5 t = 1.60231 P = 0.03489 P = 0.113129
Dual choice: upper mesh treated
Control 98.3a ± 0.6 52.9a ± 5.0 Kaolin 30.55b ± 5.8 22.8b ± 5.5
W = 16.0 W = 16.0 P = 0.0294009 P = 0.0303826
Dual choice: bottom mesh treated
Control 65.1a ± 16.9 43.7a ± 7.6 Kaolin 97.0a ± 0.8 53.2a ± 7.3
W = 15.0 t = ‐0.901544 P = 0.0590715 P = 0.402037
Kaolin and copper-based products
110
Table 12: Classification of the products according to the IOBC criteria
Kaolin
Bordeaux mixture
Copper oxychloride
Dimethoate
Mortality 72h after the treatments
Residual contact (glass) P. concolor 1 1 1 4 Residual contact (glass) C. nigritus 1 1 1 4 Extended laboratory P. concolor 1 1 1 4 Extended laboratory C. nigritus 1 1 1 4 Semifield* 1 1 1 4 Ingestion* 2 1 1 4 Treatment of pupae* 1 1 1 4
Life span
Residual contact (glass) C. nigritus 1 1 1 4 Extended laboratory C. nigritus 1 1 1 4 Ingestion* 3 2 2 3 Treatment of pupae (of surviving females)*
1 1 1 1
Emergence
Treatment of pupae* 1 1 1 2
Reproductive parameters
Attacked hosts
Residual contact (glass) P. concolor 1 1 1 ‐ Extended laboratory P. concolor 1 1 1 ‐ Semifield* 1 1 1 ‐ Ingestion* 1 1 1 ‐ Treatment of pupae* 1 1 1 1 Treatment of surface 1 1 1 ‐ Treatment of surface (after treatment) 1 1 1 ‐ Tr. Surface + olive tree leaves 1 1 1 ‐ Tr. Surface + leaves (after treatment) 1 1 1 ‐
Progeny size
Residual contact (glass) P. concolor 1 1 1 ‐ Extended laboratory P. concolor 1 1 1 ‐ Semi‐field* 1 1 1 ‐ Ingestion* 1 1 1 ‐ Treatment of pupae* 1 1 1 1 Treatment of surface 1 1 1 ‐ Treatment of surface (after treatment) 1 1 1 ‐ Tr. Surface + olive tree leaves 1 1 1 ‐ Tr. Surface + leaves (after treatment) 1 1 1 ‐
Ecdysone agonists
111
Chapter 5
ECDYSONE AGONISTS: EFFICACY AND ECOTOXICOLOGY ON BACTROCERA OLEAE AND PSYTTALIA CONCOLOR. INSECT TOXICITY BIOASSAYS AND MOLECULAR DOCKING APPROACHES1
5.1 Introduction
As it was already explained in Chapter 1, control methods against B. oleae include
bait sprays, cover sprays and mass trapping (Haniotakis, 2005). Both traditional
insecticides, such as organophosphates, and other more recently developed
compounds, like spinosad, are commonly applied in bait sprays. However, B. oleae can
develop resistance to some of these insecticides, as it has already been demonstrated
for dimethoate (Skouras et al., 2007; Daane and Johnson, 2010) and spinosad (Kakani
et al., 2010). Therefore, searching alternative treatments against this pest is necessary
if an accurate resistance management program is likely to be applied. Insect growth
regulators (IGRs) such as ecdysone agonists could be an alternative.
The ecdysteroid agonists or moulting accelerating compounds (MACs) act upon
binding specifically with the ecdysone receptor (EcR) of susceptible insects. They are
chemically described as substituted dibenzoylhydrazines (DBHs) and mimic the natural
function of the endogenous insect moulting hormone 20‐hydroxyecdysone (20E). They
induce a premature lethal molting in larval stages of different insect orders, and they
affect reproduction reducing egg production, producing ovicidal activity and disrupting
1 BENGOCHEA P, CHRISTIAENS O, AMOR F, VIÑUELA E, ROUGÉ P, MEDINA P, SMAGGHE G. 2012. Ecdysteroid receptor docking suggests that dibenzoylhydrazine‐based insecticides are devoid to any deleterious effect on the parasitic wasp Psyttalia concolor (Hym. Braconidae). Pest Management Science 68 (DOI 10.1002/ps.3274) BENGOCHEA P, CHRISTIAENS O, AMOR F, VIÑUELA E, ROUGÉ P, MEDINA P, SMAGGHE G. Insect growth regulators as potential insecticides to control olive fruit fly (Bactrocera oleae (Rossi)): insect toxicity bioassays and molecular docking approach. Pest Management Science (In Press)
Ecdysone agonists
112
normal spermatogenesis processes (Dhadialla et al., 1998; 2005; Nakagawa, 2005).
5.1.1 The ecdysone receptor
The morphogenetic events associated with insect development are largely triggered
by the action of a single class of steroid hormones, the ecdysteroids. Among all insect
orders it has been established that the ecdysteroid‐induced orchestration of molting
and metamorphosis is mediated by a heterodimer comprised of the ecdysone receptor
(EcR) and Ultraspiracle (USP, also named RXR) (i. e. this protein is composed of two
similar but not identical subunits; polypeptide chains differ in composition, order,
number, or kind of their amino acid residues). The heterodimer is stabilized by 20E and
recognizes specific promoter elements in the insect genome to regulate transcription
(Henrich, 2005).
Both proteins (EcR and USP) belong to the superfamily of nuclear hormone
receptors, which consists of ligand‐dependent transcription factors that share two
conserved domains: the DNA‐binding domain (DBD) and the ligand‐binding domain
(LBD). They play a central role in controlling gene expression during the development
of arthropods. Their general modular structure commonly has four domains, namely
the A/B, C, D and E domains, although some receptors also contain an F domain at the
carboxy‐terminal end of the protein. Individual domains are at least partially
autonomous in their function (Henrich, 2005) (Figure 60). The DBD and the LBD are the
most conserved across all taxa for both receptors. The LBD is composed of 12 α‐helices
that form a ligand‐binding pocket which holds the cognate ligand. The binding
between the receptor and a ligand starts the hormone signalling cascade regulating
important physiological events in an insect’s life, such as growth, metamorphosis and
reproduction (Bonnetton et al., 2003; Henrich, 2005; Nakagawa, 2005; Tohidi‐Esfahani
et al., 2011; Fahrbach et al., 2012). Crystal structures of the LBD provide important
information on the recognition of the ligands and the mechanisms of activation of
nuclear receptors (Kasuya et al., 2003).
Ecdysone agonists
113
Figure 60: Modular structure (domains) of the insects’ ecdysone receptors
5.2 Objectives and procedures
In the current study, the efficacy of three MACs (tebufenozide (RH‐5992),
methoxyfenozide (RH‐2485), and RH‐5849) on B. oleae has been tested and compared
to dimethoate and spinosad. Furthermore, with the aim of evaluating their possible
compatibility in IPM programs, the toxic effects on P. concolor have also been tested.
In the first part, two biological experiments have been carried out using B. oleae
adults and P. concolor females: exposition to treated glass surfaces and oral toxicity of
the products.
In a second part, the LBD of the EcR of both insects have been cloned and
sequenced. Then, a three dimensional (3D) modelling of the LBD of the EcR of B. oleae
(BoEcR‐LBD) and P. concolor EcR (PcEcR‐LBD) have been constructed to evaluate if they
exhibit the typical canonical structure with 12 α‐helices.
Finally, a ligand docking was performed to support the hypothesis that DBH‐based
insecticides could fit in the ligand binding pocket of susceptible insects. This should
happen in the case of the pest, while it should be devoid of any deleterious effect on
the parasitic wasp.
FA/B C D E
Ecdysone agonists
114
5.3 Materials and methods
5.3.1 Insect bioassays
The residual contact activity on glass surfaces and the oral toxicity test procedures,
as well as, the statistical analysis, were similar to those described in Chapters 3 and 4.
However, in the case of the residual contact activity experiment the PIEC was not
applied. Chemicals used in these experiments are listed in Table 13. Solutions of the
products were prepared freshly in distilled water prior to the assays, based on their
respective MFRC in accordance with the Spanish registration, with a delivery rate of
1000 litre water ha‐1. In the case of RH‐5849 the dose applied was the same as the
dose of tebufenozide. 5 ml of acetone were used for solving for this technical product.
The activity of the three IGRs was compared to spinosad and dimethoate. Both
dimethoate and spinosad were chosen as commercial standards.
P. concolor females and B. oleae adults were obtained as described in chapter 3.
Diets and distilled water were supplied as described in chapter 3.
Experiments consisted of five replicates per treatment. Per replicate, 10 unfed
adults (<48h‐old) of B. oleae and 10 unfed, mated females (<48h‐old) of P. concolor
were used. Mortality 72 hours after the treatments was measured both for B. oleae
and P. concolor. Life span, in the case of the pest, and beneficial capacity, in the case of
the parasitoid, were evaluated following the procedures described in Chapter 3.
Ecdysone agonists
115
Table 13: Chemicals tested in the experiments
1Formulated product 2Dose applied in citrus orchards against Phyllocnistis citrella Stainton (Lepidoptera: 3Dose applied in tangerine tree orchards against P. citrella (for RH‐5849, the same dose as for tebufenozide was tested). 4Dose applied in horticulture crops against different insect pests. The product was used only when the oral toxicity of the insecticides was evaluated in both insects. 5Rate applied in olive orchards against B. oleae. It was only used to evaluate the residual contact activity on a glass surface because it cannot be solved (therefore, the other spinosad formulation was decided to be used in the oral toxicity experiments). Because the product is too dense, instead of applying it with the Tower of Potter, a pipette was used to place small drops on the glass. The dose at field level and the surface of the test cages were taking into account to calculate the amount of product to be applied (1l/ha is the rate for B. oleae; 219.7 cm
2 is the area of the cage; thus, 2.19 µl/per replicate should be applied).
Active ingredient (a.i.)
Trade name %a.i; form
Conc1 Trade Company
Methoxyfenozide Runner® 24 SC 75 cc/hl2 Dow Agrosciences Iberica
S.A., Madrid (Spain)
Tebufenozide Mimic 2F® 24 SC 75 cc/hl3 Dow Agrosciences Iberica
S.A., Madrid (Spain)
RH‐5849 Technical Product
> 95% 75 cc/hl3 Rohm and Hass, Spring
House (PA)
Spinosad
Spintor 480 SC®
48 SC 25 cc/hl4 Dow Agrosciences Iberica
S.A., Madrid (Spain)
Spintor‐Cebo®
0.024CB 1 l/ha5 Dow Agrosciences Iberica
S.A., Madrid (Spain)
Dimethoate Danadim Progress®
40 EC 150 cc/hl Cheminova Agro S.A. Madrid
(Spain)
Figure 61: Insecticides tested in the experiments
Ecdysone agonists
116
5.3.2 EcR-LBD sequence
Total RNA was extracted from B. oleae and P.
concolor adults using TRI Reagent (Sigma‐Aldrich,
Bornem, Belgium), based on a single‐step liquid
phase separation method (Chomeczynski and
Sacchi, 1987). The product is a mixture of
guanidine, thiocyanate and phenol in a
monophase solution which effectively dissolves
RNA, DNA and protein on homogenization or lysis
of tissue samples. The resulting RNA is intact with
little or no contaminating DNA and protein. The
quality and quantity of the extracted RNA were examined by gel electrophoresis and
spectrophotometry using a NanodropTM ND‐1000 (Thermo Fisher Scientific, Asse,
Belgium). Subsequently, first strand cDNA synthesis was performed using
SuperScriptTM II reverse transcriptase (Invitrogen, Merelbeke, Belgium) with the
oligo(dT)12‐18 primers according to the manufacturer’s protocol.
The complete BoEcR‐LBD and PcEcR‐LBD coding sequences were then determined
through a number of Polymerase Chain Reaction (PCR) reaction steps (SensoQuest
labcycler, SensoQuest GmbH Göttingen, Germany). The specific conditions of PCR
reaction steps are specified in Table 14. Partial sequences of the
LBD were obtained using degenerate and specific primers (Table
15) located in the coding sequence of the LBD and the DBD of
the receptor and designed using Primer3 software (Rozen and
Skaletsky, 2000). Design of degenerate primers was based on
known EcR sequences from different Mecoptera, Trichoptera,
Strepsiptera, Coleoptera, Hymenoptera, Lepidoptera and
Diptera insect species. Gene specific primers were designed in the partial sequence
obtained with the degenerate primers. PCR products were purified using the Cycle
Pure kit (Eppendorf centrifuge 5424; Omega Bio‐Tek, Beaver Ridge Circle, Norcross,
Figure 62: PCR machine used in theexperiments
Figure 63: Agarose gelwith different PCRproducts loaded
Ecdysone agonists
117
GA) to eliminate the DNA of interest from soluble proteins and other nucleic acids.
After purification, samples were sent for sequencing (AGOWA, Berlin, Germany). The
first fragment of both BoEcR‐LBD and PcEcR‐LBD was amplified using two degenerate
primers within the LBD, located at helices 5 and 12, respectively. In a second step, a
degenerate primer in the DBD was used in combination with a gene‐specific primer at
helix 9‐10 in order to amplify and sequence the LBD (fragment 2). Then, the 3’ end of
the transcripts were eventually also amplified by RACE‐PCR (Rapid amplification of
cDNA Ends‐PCR; i.e. a PCR technique which facilitates the cloning of full‐length cDNA
sequences when only a partial cDNA sequence is available) using the 3’RACE System
for RACE (Invitrogen). A specific primer in helix 11 together with the Abridged
Universal Amplification Primer (AUAP) that is delivered with the kit were used in the
reaction. In the case of P. concolor, we also amplified and sequenced a small missing
part between helices 10‐12 and afterwards (Bridge fragment), the whole fragment,
starting in the DBD and ending in the 3’ UTR was cloned and sequenced for
confirmation. In the case of B. oleae, cDNA for RACE‐PRCs was obtained from B. olae
adults stored in RNAlater (Sigma‐Aldrich, Bornem, Belgium) because there were no
adults alive available at the time of isolating RNA.
Figure 64: Gel electrophoresis apparatus (anagarose gel is placed in the buffer‐filled box andelectrical field is applied via the power supply tothe rear. The negative terminal is at the side ofthe apparatus closest to the tip box (colourblue), so DNA migrates toward it
Figure 65: Bio‐Rad. Once the electrophoresis is completed, the molecules in the gel can be stained to make them visible. DNA can be visualized using ethidium bromide which, fluoresces under ultraviolet light, when intercalated into DNA. This apparatus is used to visualize DNA. Photographs of the gels can be taken using Gel Doc
Ecdysone agonists
118
Same B. oleae and P. concolor cDNAs as used in the identification of EcR‐LBD were
used for the initial PCR reactions of the cloning. After purification, the PCR products
were ligated into a pGEM‐T vector (Promega, Madison, WI) according to the
manufacturer’s instructions. Afterwards, plasmids were transformed in competent
Escherichia coli XL‐1 Blue Cells by heat stock and then plated out on an ampicilin‐
containing LB (Lysogeny broth) agar plate. After 16 h incubation, formed colonies were
checked by colony PCR and several of these positive colonies were then purified using
a Plasmid mini prep kit (Omega Bio‐Tek) and sent for sequencing (AGOWA) (Figures
66,67 and 68).
Ecdysone agonists
119
Table 14: Specific conditions of PCR reaction steps for determining BoEcR‐LBD and PcEcR‐LBD coding sequences
Fragment Primers µl primer/ 10 µl PCR reaction
Denaturation (T/t)
Annealing (T/t)
Extension (T/t)
Phases total
Bactrocera oleae
1 Degen F2‐degen R3
0.4‐0.4 94º/30’’ 51º/30’’ 72º/45’’ 32
2 Degen F3‐spec R1
0.4‐0.4 94º/30’’ 53º/30’’ 72º/1’0’’ 32
3 Bridge
fragment 0.4‐0.4 94º/30’’ 55º/30’’ 72º/30’’ 32
Cloning Cloning F‐cloningR
1‐1 94º/30’’ 60º/30’’ 72º/1’0’’ 32
Psyttalia concolor
1 Degen F2‐ degen R3
0.4‐0.4 94º/30’’ 49º/30’’ 72º/45’’ 32
2 Bridge
fragment 0.3‐0.3 94º/30’’ 60º/30’’ 72º/45’’ 32
3 Degen F3‐specific R1
0.4‐0.4 94º/30’’ 53º/30’’ 72º/1’30’’ 32
4 Race F5‐AUAP*
0.6‐0.2 94º/30’’ 60º/30’’ 72º/45’’ 32
Cloning Cloning F‐cloningR
1‐1 94º/30’’ 60º/30’’ 72º/30’’ 32
Ovaries Cloning F‐cloningR
1‐1 94º/30’’ 60º/30’’ 72º/30’’ 32
Table 15: Degenerate and specific primers using for obtaining the partial sequences of the LBD
Bactrocera oleae
Fragment 1 Forward primer GAAGTVATGATGYTNMGNATG
Reversed primer ACGTCCCAKATYTCWKCNARVAA
Fragment 2 Forward primer GVCGVAARTGYCARGAGTG
Reversed primer GCAGTGAGGAGAGCGTATT
Bridge fragment Forward primer CCACAAGAGGATCAAATCAC
Reversed primer CGCAGTTCAGTTAGTATGGA
Cloning Forward primer TGTCCGTTGCTACCTGATGA
Reversed primer CGGCAGTTTACGATTCTTCA
Psyttalia concolor
Fragment 1 Forward primer GAAGTVATGATGYTNMGNATG
Reversed primer ACGTCCCAKATYTCWKCNARVAA
Fragment 2 Forward primer GVCGVAARTGYCARGAGTG
Reversed primer ATTTGTGTTTACGGCGACTG
Bridge fragment Forward primer GAACGGCTCACCTGGAAGTA
Reversed primer AGTGGGCGTCGTTATTGAAA
RACE fragment Forward primer CGAGGCACTCAGAACATACG
Reversed primer GGCCACGCGTCGACTAGTAC
Cloning Forward primer CTGGCAGCACTGACTCGTTA
Reversed primer CCACTGGGGCAATTACACTG
Ecdysone agonists
120
The EcR‐LBD sequences of several arthropods and two human orthologs of EcR
were retrieved by Blast searches against the Genbank database. The chosen sequences
were then aligned by CLUSTALW2/CLUSTALX2 and the phylogenetic trees were made
using MEGA4 software (Larkin et al. 2007; Tamura et al., 2007). Bootstrap analysis with
1000 replicates for each branch position was used to assess support for nodes in the
tree (Felsenstein, 1985).
Figure 66: Ethidium bromide‐stained PCR products of the cloning (beforeand after purification) after gelelectrophoresis (P. concolor)
Figure 68: Ethidium bromide‐stainedplasmids after gel electrophoresis (P.concolor)
Figure 67: Formed bacteria colonies on an ampicilin‐containing LB agar plate (B. oleae)
Ecdysone agonists
121
Figure 69: nucleotide and amino acid sequences of B. oleae and P. concolor
Bactrocera oleae (nucleotides):
CTCTCCCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATTTGTCCGTTGCTACCTGATGATATTGTGGCCAAGTGCAAGGCGAGCAACATTCCGCCGCTCACGCGTAACCAGTTGGCGGTCATATACAAATTGATCTGGTATCAGGATGGCTATGAACAGCCATCGGAGGAAGATCTGAAGCGTATTATGAGCACCCCCGATGAAAACGAAAGCCCGAATGATATCAGCTTTCGGCATATAACCGAAATTACCATTTTGACAGTACAACTTATTGTGGAGTTTGCAAAAGGTTTACCGGCATTTACAAAAATTCCACAAGAGGATCAAATCACGTTGCTGAAGGCCTGCTCATCGGAAGTGATGATGTTGCGTATGGCCCGACGTTACGATCACAATTCGGATTCCATATTCTTCGCCAACAATCGTTCATATACGCGTGATGCGTACAAAATGGCCGGTGTGGCCGATAATATTGAGGATCTATTGCATTTTTGTCGGCAGATGTACTCGATGAAGGTCGACAACGTCGAATACGCTCTCCTCACTGCCATTGTGATCTTCTCCGATCGGCCGGGACTTGAAAAGGCCGAACTAGTCGAAGCGATACAAAGTTACTACATCAATACGCTGCGCGTATATATAATTAATCGACATTGCGGCGATACAAAGAGTCTGGTCTTCTTCGCGAAATTACTCTCCATACTAACTGAACTGCGCACGCTTGGCAATCAGAATGCCGAGATGTGTTAATCCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCC
Bactrocera oleae (amino acids):
QLAVIYKLIWYQDGYEQPSEEDLKRIMSTPDENESPNDISFRHITEITILTVQLIVEFAKGLPAFTKIPQEDQITLLKACSSEVMMLRMARRYDHNSDSIFFANNRSYTRDAYKMAGVADNIEDLLHFCRQMYSMKVDNVEYALLTAIVIFSDRPGLEKAELVEAIQSYYINTLRVYIINRHCGDTKSLVFFAKLLSILTELRTLGNQNAEMCSRGHGGREHATSGPIRPIVSRITIHWPSFYNVVTGKTLALPNLIALQHIPLSPAGVIAKRPAPIA
Psyttalia concolor (nucleotides):
CTCTCCCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATTCTGGCAGCACTGACTCGTTATTAGAATTTAAGAACGGATTGTCAATTGTCAGTCCTGAACAAGCTGAGCTCATTGAGAGACTGGTTTATTTTCAAGGACTCTATGAGAATCCCAGTCCCGAAGATCTTGAAAGAATTACGTATCGACCAGTCGAGGGTGAAGATCCTGTTGACGTTAGATTCAGGCATATGGCGGAAATAACGATACTGACTGTCCAGCTTATTGTTGAATTTGCCAAAAACTTATCGGGTTTCGATAAATTGCTGAGGGAGGATCAAATTGCATTGCTAAAGGCATGCTCCAGTGAAGTCATGATGCTGAGAATGGCAAGAAAGTATGACGCTAGGACAGACAGTATCCTATTTGCTGATAATCAGCCGTACACGAGAGACAGCTACAGTTTGGCTGGAATGGGTGATACAATTGAGGATTTGCTGCGTTTTTGCCGGCACATGTTCAATATGAAAGTCAACAATGCTGAGTATGCGTTATTAACGGCTATCGTCATTTTCTCAGAACGGCCGATGCTCTTGGAGGGCTGGAAAGTCGAAAAAATCCAAGAAATATACCTCGAGGCACTCAGAACATACGTGGACAGTCGCCGTAAACACAAATCAGGAACAATATTCGCTAAACTACTCTCCGTATTGACGGAATTACGAACACTCGGCAATCAAAACAGCGAAATTTGCTTCAGTTTGAAGCTCAAAAACAAGAAGCTACCTCCATTTCTTGCCGAGATCTGGGATGTCATGCCC
Psyttalia concolor (amino acids):
QAELIERLVYFQGLYENPSPEDLERITYRPVEGEDPVDVRFRHMAEITILTVQLIVEFAKNLSGFDKLLREDQIALLKACSSEVMMLRMARKYDARTDSILFADNQPYTRDSYSLAGMGDTIEDLLRFCRHMFNMKVNNAEYALLTAIVIFSERPMLLEGWKVEKIQEIYLEALRTYVDSRRKHKSGTIFAKLLSVLTELRTLGNQNSEICFSLKLKNKKLPPFLAEIWDVMP
Ecdysone agonists
122
5.3.3 Confirmation of EcR expression in Psyttalia. concolor ovaries
The expression of EcR in the ovaries was confirmed on the parasitoid. As it occurred
in the biological experiments, in which effects on reproduction of B. oleae were not
evaluated, there were not olive fly females available at the moment of the
experiments to confirm the expression of this gene in their ovaries.
Ovaries were carefully dissected form P. concolor female adults under stereoscopic
microscope with the help of entomological needles (using a buffer solution to prevent
desiccation of the ovaries). Newly dissected ovaries were stored in TRI Reagent. 43
pairs of ovaries were used to extract the RNA. RNA was extracted and subsequently
cDNA was synthesized following the same procedure described before for total RNA.
The expression of the EcR in the ovaries was investigated by PCR using the specific
primers designed for the cloning process.
Figure 70: P. concolor ovaries
Ecdysone agonists
123
5.3.4 Modeling of PcEcR-LBD and docking studies
Homology modeling of the BoEcR‐LBD and the PcEcR‐LBD were performed with the
YASARA structure program running on a 2.53 GHz Intel core duo Macintosh computer
(Krieger et al., 2002). Different models were built from the X‐ray coordinates of the
EcR of the lepidopteran Heliothis virescens F. (Lepidoptera, Noctuidae) in complex with
synthetic ligand as BYI‐06830 (PDB code 3IXP), the RXR‐USP receptor of the
coleopteran Tribolium castaneum Herbst. (Coleoptera, Tenebrionidae) bound to
ponasterone A (PoA; PDB Code 2NXX) (Iwema et al., 2007), the EcR‐LBD of the
hemipteran Bemisia tabaci Gennadius (Homoptera, Aleyrodidae) complexed to PoA
(PDB code 1Z5X) (Carmichael et al., 2005), the EcR‐USP of H. virescens in complex with
20E (PDB code 2R40) (Browning et al., 2007), and the human RXRα (PDB code 3FC6)
used as templates (Washburn et al., 2009), respectively. Finally, a hybrid model built
up from the five previous models. PROCHECK was used to assess the geometric quality
of the 3D‐model (Laskowski et al, 1993). In this respect, about all of the residues of
BoEcR‐LBD and 87% of PcEcR‐LBD were correctly assigned on the best allowed regions
of the Ramachandran plot. For BoEcR‐LBD the sole exception is the residue Ala75,
which occurs in the non allowed region of the plot (results not shown). For PcEcR‐LBD,
the remaining residues were located in the generously allowed regions of the plot
(result not shown). Using ANOLEA to evaluate the models (Melo and Feytmans, 1998),
a single residue of BoEcR‐LBD over 235 and 5 residues of PcEcR‐LBD over 246 exhibit
and an energy level over the threshold value. All of these residues are located in the
loop regions connecting α‐helices. Molecular cartoons were drawn with YASARA and
PyMol (W.L. DeLano, http://pymol.sourceforge.net). Docking of 20E, PoA,
tebufenozide, methoxyfenozide and RH‐5849 to BoEcR‐LBD and PcEcR‐LBD was
performed with the YASARA structure program. Clipping planes of BoEcR‐LBD and
PcEcR‐LBD complexed to 20E, PoA, tebufenozide, methoxyfenozide and RH‐5849 were
rendered with PyMol. Complexed to halofenozide has also been performer for PcEcR‐
LBD.
Ecdysone agonists
124
5.4 Results
5.4.1 Efficacy and toxicological effects of methoxyfenozide, tebufenozide and RH-5849
Either residual contact or ingestion exposure to methoxyfenozide, tebufenozide
and RH‐5849 did not cause any deleterious effect on B. oleae adults 24 h after
exposition. Then, in the continuation of the experiment, methoxyfenozide and
tebufenozide were not toxic to B. oleae. In great contrast, RH‐5849 provoked a
significant higher mortality. 48 h after being in contact with the products 26% of adults
were killed, 86% on day 7 and 100% on day 15. Results were a little bit different when
oral toxicity of the product was evaluated. After 72 h ingesting RH‐5849, only 10% of
adults have died. 31.8% of adults were killed at 7 days after the treatments and the
percentage increased to 98.2% on day 15. When exposed to dimethoate, however,
100% of B. oleae adults died after 24 h in both experiments. In the case of spinosad,
mortality 24 h after the treatments was 62% when adults were exposed to the fresh
residue of the insecticides and 50% when they ingested the products. 24 h later these
percentages increased up to 88% and 98%, respectively (Figure 71).
Ecdysone agonists
125
0
10
20
30
40
50
60
70
80
90
100
24h 48h 72h 7d 15d 24h 48h 72h 7d 15d
Residual contact (glass) Oral toxicity
*
*
*
*
*
*
*
*
*
** *
*
* * * ** * * * *
*
* * * *
% M
ortality
Different experiments: % mortality of Bactrocera oleae
Control
Methoxyfenozide
Tebufenozide
RH‐5849
Spinosad
Dimethoate
Figure 71: Percentage of mortality of B. oleae adults during the two performed experiments. Spintor‐Cebo® was applied in the residual contact on glass surfaces experiment. Spintor 480 SC® was used for evaluating the oral toxicity. Asterisks indicate statistical differences between the treatments and the controls within the same parameter evaluated (P < 0.05)
In the case of P. concolor, the three tested MACs did not cause any mortality on
females. No effects were detected either when females were exposed to a treated
glass surface or when they ingested the products. When exposed to dimethoate,
however, females died 24 after exposure to this insecticide. Residual contact with
spinosad caused a 68.0% of mortality 72h after exposure, while the percentage
increased to 99.0% when females ingested the insecticide (mean data ± standard
errors are given in supplementary tables in an appendix at the end of this chapter;
Tables 17 and 18). Furthermore, no sublethal effects of the three MACs on
reproductive parameters, namely percentage of attacked hosts and progeny size, were
observed in both assays (P>0.05) and no change in behaviour of treated wasps was
seen (Figures 72 and 73).
Ecdysone agonists
126
0
10
20
30
40
50
60
70
80
90
100
24h 48h 72h 7d 24h 48h 72h
Residual contact (glass) Oral toxicity
*
*
*
*
*
* ** * * *
*
* *% M
ortality
Different experiments: % mortality of Psyttalia concolor
Control
Methoxyfenozide
Tebufenozide
RH‐5849
Spinosad
Dimethoate
Figure 72: Percentage of mortality of P. concolor females during the two performed experiments. Spintor‐Cebo® was applied in the residual contact on glass surfaces experiment. Spintor 480 SC® was used for evaluating the oral toxicity. Asterisks indicate statistical differences between the treatments and the controls within the same parameter evaluated (P < 0.05)
0
10
20
30
40
50
60
70
80
90
100
% Attackedhosts
% Progeny size % Attackedhosts
% Progeny size
Residual contact (glass) Oral toxicity
%
Different experiments: % attacked hosts and progeny size
Control
Methoxyfenozide
Tebufenozide
RH‐5849
Figure 73: Effects of methoxyfenozide, tebufenozide and RH‐5849 on P. concolor beneficial capacity
Ecdysone agonists
127
5.4.2 Bactrocera oleae EcR-LBD sequence
The cDNA encoding the BoEcR‐LBD was cloned in order to obtain its sequence.
However, it was not possible to amplify the 3’ end of the transcript. RACE‐PCR using
the 3’RACE System for Rapid Amplification of cDNA Ends (Invitrogen) did not work,
despite the multiple tentative to sequence it. Thus, a consensus sequence of other
dipteran species, such as the medfly C. capitata, and the Culicidae Anopheles gambiae
Giles, Aedes aegypti (L.) and Aedes albopictus (Skuse), were used to complete the helix
12 of BoEcR‐LBD. A multiple alignment with the amino acid sequences of BoEcR‐LBD
together with the EcR‐LBD from other dipteran species, and insects from other
different orders is shown in Figure 74. The alignment includes ecdysone receptors
from Lepidoptera (Heliothis, Chilo, Bombyx), Coleoptera (Tribolium, Tenebrio,
Leptinotarsa), Hymenoptera (Apis, Bombus, Psyttalia), Hemiptera (Nilaparvata,
Nezara, Bemisia) and Diptera (Drosophila, Calliphora, Aedes, Chironomus, Culex,
Bradisia, Anopheles, Ceratitis, Bactrocera). It has been constructed using CINEMA
(Colour INteractive Editor for Multiple Alignments, Utopia,
http://utopia.cs.man.ac.uk/utopia/). Amino acid colors indicate similar structure.
Sequence analysis showed that the EcR‐LBD of B. oleae exhibits a strong sequence
identity towards the insect order Diptera.
In Figure 74, red dots indicate amino acids that are similar towards dipterans but
different from the other insect orders (residues at positions 5, 6 and 11 in helix 1;
positions 75, 80 and 117; positions 171 and 179 in helix 9; and 236 in helix 12). Other
residues are similar in Lepidoptera and Diptera but differ from the other orders. These
residues are marked in the figure with green dots (position 19 in helix 1; 71 and 77; 81
and 86 in helix 4; 126; 130 in helix 7; 167 and 169; 173, 180, 184 and 190 in helix 9;
201; 239 in helix 12). In addition, amino acids involved in the ligand binding according
to Kasuya et al. (2003), are marked in the figure by blue dots (positions 49, 51, 52, 53,
55, 56, 58, 59 and 62 in helix 3; 93, 96, 97, 99, 100 and 101 in helix 5; positions 103,
111, 113; positions 129, 132, 133 and 136 in helix 7; positions 216, 220, 223, 224, 225,
227, 228, 229, 230, 231, 232 in helix 10‐11 and positions 238 and 242 in helix 12).
128
Figure 74: Sequence alignment of ecdysone receptor ligand‐binding domains (LBD), including BoEcR‐LBD (Helix 1 to 8). In the following order: Heliothis, Chilo, Bombyx, Tribolium, Tenebrio, Leptinotarsa, Apis, Bombus, Psyttalia, Nilaparvata, Nezara, Bemisia, Drosophila, Calliphora, Aedes, Aedes, Chironomus, Culex, Bradisia, Anopheles, Ceratitis, Bactrocera
Figure 74 (continuation): Sequence alignment of ecdysone receptor ligand‐binding domains (LBD), including BoEcR‐LBD (Helix 9 to 12). In the following order: Heliothis, Chilo, Bombyx, Tribolium, Tenebrio, Leptinotarsa, Apis, Bombus, Psyttalia, Nilaparvata, Nezara, Bemisia, Drosophila, Calliphora, Aedes, Aedes, Chironomus, Culex, Bradisia, Anopheles, Ceratitis, Bactrocera
Ecdysone agonists
130
5.4.3. Psyttalia concolor EcR-LBD sequence, phylogenetic tree and expression in the ovaries
The cDNA encoding the PcEcR‐LBD fragment was also cloned in order to obtain the
amino acid sequence. Figure 75 shows a multiple alignment with the amino acid
sequence of PcEcR‐LBD, together with the EcR‐LBD from most other known
hymenopteran species, and several members from other insect orders. It has also been
constructed using CINEMA. The alignment includes ecdysone receptors from
Lepidoptera (Heliothis, Chilo, Bombyx), Coleoptera (Tribolium, Tenebrio, Leptinotarsa),
Hymenoptera (Apis, Bombus, Psyttalia), Hemiptera (Nilaparvata, Nezara, Bemisia) and
Diptera (Drosophila, Calliphora, Aedes, Chironomus, Culex, Bradisia, Anopheles,
Ceratitis, Bactrocera).
PcEcR‐LBD exhibits some amino acid substitutions in positions where conservation
is usually very high throughout the class of Insecta. These residues are marked in
Figure 75 with red dots: residues at positions 2 and 16 in helix 1; 26 in helix 2; 54 and
70 in helix 3, 72, 113 and 195. Blue dots indicate amino acid substitutions in PcEcR‐LBD
that are similar to those in hemipteran species and different form the hymenopteran.
Yellow dots indicate the amino acids involved in the ligand binding in the EcR‐LBD
(Kasuya et al., 2003): positions 47, 49, 50, 51, 53, 54, 56, 57 and 60 in helix 3; 91, 94,
95, 97, 98 and 99 in helix 5; positions 101, 109, 111; positions 127, 130, 131 and 134 in
helix 7; positions 214, 218, 221, 222, 223, 225, 226, 227, 228, 229, 230 in helix 10‐11
and positions 236 and 240 in helix 12).
Figure 75: Sequence alignment of ecdysone receptor ligand‐binding domains (LBD), including PcEcR‐LBD (Helix 1 to 5). In the following order: Drosophila, Aedes, Ceratitis, Bombyx, Junonia, Bicyclus, Tribolium, Tenebrio, Leptinotarsa, Apis, Polistes, Nasonia, Acromyrmex, Camponotus, Bombus, Solenopsis, Pheidole, Psyttalia, Nezara, Bemisia, Nilaparvata.
132
Figure 75 (continuation): Sequence alignment of ecdysone receptor ligand‐binding domains (LBD), including PcEcR‐LBD (Helix 6 to 12). In the following order: Drosophila, Aedes, Ceratitis, Bombyx, Junonia, Bicyclus, Tribolium, Tenebrio, Leptinotarsa, Apis, Polistes, Nasonia, Acromyrmex, Camponotus, Bombus, Solenopsis, Pheidole, Psyttalia, Nezara, Bemisia, Nilaparvata
Ecdysone agonists
133
RT‐PCR from RNA extracted from dissected ovaries of female adults of P. concolor
confirmed the expression of the EcR gene in the female tissues (Figure 76).
Sequence identity analysis was been performed for P. concolor. It shows that the
LBD of P. concolor exhibits a stronger sequence identity towards the insect order of
Hemiptera and also to the Coleoptera than to the Hymenoptera (Table 16).
Table 16: Sequence identity between PcEcR‐LBD and the EcR‐LBD in other insect orders (%)
Diptera Lepidoptera Coleoptera Hymenoptera Hemiptera
65.3 (64‐67) 58.7 (57‐60) 81.0 (79‐82) 77.9 (74‐81) 79.7 (77‐84)
Data are given as average. Data in brackets refer to the range. Species used are Drosophila melanogaster, Aedes aegypti, Ceratitis capitata, Bombyx mori, Junonia coenia, Bicyclus anynana, Tribolium castaneum, Tenebrio molitor, Leptinotarsa decemlineata, Apis mellifera, Polistes dominulus, Nasonia vitripennis, Acromyrmex echinatior, Camponotus japonicus, Bombus terrestris, Solenopsis invicta, Pheidole megacephala, Bemisia tabaci, Nilaparvata lugens, Nezara viridula.
Phylogenetic trees of the EcR‐LBD, including various insect species from several
orders such as Diptera, Lepidoptera, Hymenoptera, Hemiptera, Orthoptera, Coleoptera
together with some Crustacea and Chelicerata, group PcEcR‐LBD together with the
Hemiptera, close to Nezara viridula L. (Pentatomidae), instead of the Hymenoptera
clade (Figure 77). Maximum parsimony trees also confirmed this result (data not
shown).
This tree was constructed with the neighbour‐joining method using the amino acid
sequences of the LBD of the selected sequences. Bootstrap values as percentage of a
1000 replicates, >50 are indicated on the tree.
Figure 76: Confirmation of the expressionof the EcR in the ovaries of P. concolor
Figure 77: Phylogenetic trees of the EcR‐LBD, including various insect species from several orders.
Ecdysone agonists
135
5.4.4 Modeling of BoEcR-LBD and PcEcR-LBD and docking studies
BoEcR‐LBD and PcEcR‐LBD modeled from the X‐ray coordinates of different insect
LBD, exhibited the canonical 3D‐conformation of the LBD of arthropod EcR made of
twelve α‐helices (labeled H1‐H12). These twelve α‐helices are distributed along the
polypeptide chain and are associated to a hairpin of two short β‐strands, β1 and β2
(Figure 78A and B, respectively). They form a protruding hairpin motif A very similar
model was obtained for the fruit fly Drosophila melanogaster Meigen (Diptera,
Drosophilidae) DmEcR‐LBD (Koelle et al. 1991) (Figure 78C). Both dipteran models
readily resemble the tobacco budworm H. virescens HvEcR‐LBD three‐dimensional (3D)
structure (PDB code 3IXP) used as a template, even though α‐helix H2 was not
correctly X‐ray solved and is absent from the 3D structure of the HvEcR‐LBD (Figure
78D). The 3D conformation of the coleopteran T. castaneum TcEcR‐LBD has also been
modeled (Figure78E).
Ecdysone agonists
136
Figure 78: Overall 3D conformation of the modeled LBD domain of the EcR receptors from B. oleae (A), P.
concolor (B), D. melanogaster (C), H. viscerens (D) and T. castaneum (E), all in complex with ponasterona A (PoA)
(colored stick). The twelve α‐helices and the two‐β strands are indicated. N and C consist of the N‐terminal and C‐
terminal ends of the polypeptide chain, respectively
Helices H2, H3, H5, H8 and H11 delineate a ligand‐binding cavity which usually
accommodates the natural insect ecdysteroids 20E (Figure 79) and also the
ponasterone A (PoA) molecule (i.e. an insect steroid hormone involved in regulating
methamorphosis) (Figure80). Docking experiments performed with these two
ecdysteroids yielded a typical H‐bonding scheme the BoEcR‐LBD and the PcEcR‐LBD
share with other arthropod EcR‐LBD. Both ecdysteroids interacted with the BoEcR‐LBD
pocket via a network of 6 hydrogen bonds involving the hydrophilic residues Glu16,
Thr48, Thr51, Ala103 and Tyr113 (Figure 79‐2A and 82‐ 2A) (Glu21, Thr59, Trh62,
Ala114 and Tyr124 in Figure 74). The PcEcR‐LBD pocket interacted via a network of 7
B A
E D C
Ecdysone agonists
137
hydrogen bonds involving the hydrophilic residues Glu73, Thr105, Thr108, Arg145,
Ala160 and Tyr10 (Figure 79‐2B and 80‐ 2B).
Figure 79: Clip view (dashed yellow line) of the ligand‐binding pocket of the BoEcR‐LBD (1A), PcEcR‐LBD (1B),
HvEcR‐LBD (1C) and TcEcR‐LBD (1D) harboring 20‐hydroxyecdysone (20E) (pink stick). (E) Network of hydrogen
bonds (dashed dark lines) anchoring 20E to the BoEcR‐LBD (2A), PcEcR‐LBD (2B), HvEcR‐LBD (2C) and TcEcR‐LBD
(2D). Aromatic residues interacting with the ligand by stacking interactions are colored orange. In the figures A,
residues are labeled according to the three‐dimensional model built for the BoEcR‐LBD. In figures B, C and D,
residues are labeled according to the three‐dimensional model built for the PcEcR‐LBD
1A
2A 2B
1B
3A
3B
4A
4B
Ecdysone agonists
138
Figure 80: Clip view (dashed yellow line) of the ligand‐binding pocket of the BoEcR‐LBD (1A), PcEcR‐LBD (2A),
HvEcR‐LBD (3A) and TcEcR‐LBD (4A), harboring ponasterone A (PoA) (pink stick). Network of hydrogen bonds
(dashed dark lines) anchoring PoA to the BoEcR‐LBD (1B), PcEcR‐LBD (2B), HvEcR‐LBD (3B) and TcEcR‐LBD (4B).
Aromatic residues interacting with the ligand by hydrophobic interactions are colored orange. In the figures A,
residues are labeled according to the three‐dimensional model built for the BoEcR‐LBD. In figures B, C and D,
residues are labeled according to the three‐dimensional model built for the PcEcR‐LBD
1A
1B
2A
2B
3A
3B
4A
4B
Ecdysone agonists
139
In addition, stacking interactions occurring with various aromatic residues located
at the periphery of the ligand‐binding cavity complete the ligand anchorage into the
pocket.
For the DBH‐based compounds, however, due to the restricted extent of the ligand
binding cavity, a steric clash occurred with the methoxy‐phenyl ring of tebufenozide
and methoxyfenozide, upon docking of these two agonists to the BoEcR‐LBD and
PcEcR‐LBD, respectively. The same results are obtained with the chloride‐phenyl ring
of halofenozide and PcEcR‐LBD (data not performed for BoEcR‐LBD). In the case of
PcEcR‐LBD, another steric clash occurred with the unsubstituted phenyl ring RH‐5849.
Although much less severe, a very light steric hindrance still occurred upon docking of
RH‐5849 to the BoEcR‐LBD (Figures 81 and 82).
Figure 81: Clip view of the ligand‐binding pocket of the B. oleae BoEcR‐LBD harboring tebufenozide (A),
methoxyfenozide (B) and RH‐5849 (C) (blue sticks). Note the steric clash () of tebufenozide and
methoxyfenozide with the wall of the ligand‐binding pocket (A and B). Note the very light steric hindrance () of
the B‐phenyl ring of RH‐5849 with the wall of the ligand‐binding pocket (C)
A B C
Ecdysone agonists
140
Figure 82: Clip view (dashed yellow line) of the ligand‐binding pocket of the P. concolor PcEcR‐LBD domain
harboring tebufenozide (A), methoxyfenozide (B), RH‐5849 (C) and halofenocide (D) (blue sticks). Note the steric
conflicts (and ) of the four compounds with the wall of the ligand‐binding pocket of PcEcR‐LBD. Network of
amino acid residues of PcEcR‐LBD (E) interacting with tebufenozide by hydrogen bond (dashed blue line), and
hydrophobic interactions. Hydrophobic and aromatic residues are colored orange
In contrast there was no steric clash for the four DbH‐based agonists in the TcEcR‐
LBD and HvEcR‐ LBD (Figure 83).
C B
E D
A
Ecdysone agonists
141
Figure 83: Clip view (dashed yellow line) of the ligand‐binding pocket of the T. castaneum TcEcR‐LBD domain (A)
and the H. virescens HvEcR‐LBD domain (B) harboring tebufenozide. Network of amino acid residues of TcEcR‐LBD
(C) and HvEcR‐LBD (D) interacting with tebufenozide by hydrogen bond (dashed blue line) and hydrophobic
interactions. Hydrophobic and aromatic residues are colored orange. E, F, G, H, I and J, clip views (dashed yellow
line) of the ligand‐binding pocket of the TcEcR‐LBD domain (E, G and I) and the HvEcR‐LBD domain (F, H and J)
harboring methoxyfenozide (METHO), RH‐5849 (BH) and halofenozide (HALO)
These docking experiments suggest that DBH‐based insecticides like tebufenozide
and methoxyfenozide readily differ from the agonist RH‐5849 by their effects on the
H G E F
I J
D C
D
Ecdysone agonists
142
insect pest B. oleae, which is in agreement with the previous reported experimental
data showing a rather different biological effect of the insecticides in this insect.
5.5 Discussion
5.5.1 Efficacy and toxicology of methoxyfenozide, tebufenozide and RH-5849 on Bactrocera oleae and Psyttalia concolor, respectively
In the present study, tebufenozide and methoxyfenozide did not shown any
deleterious effect on direct mortality or life span of B. oleae adults, while RH‐5849
killed (nearly) all treated olive fruit flies (98‐100%), although 7 days after the
treatments. Deleterious effects of RH‐5849 were higher when adults were exposed to
treated surfaces than when they ingested the insecticide solution. The last result was
not expected because although MACs have some topical activity, they primarily act by
ingestion (Carlson et al., 2001).
Studies on larval stages of dipteran species proved that tebufenozide,
methoxyfenozide and RH‐5849 were effective against larvae of the mosquitoes A.
aegypti, Culex quinquefasciatus (Say) (Culicidae), A. gambiae and midges Chironomus
tentans F. (Diptera, Chironomidae) (Smagghe et al., 2002; Beckage et al., 2004). In
contrast, Paul et al. (2006) found a lack of activity of tebufenozide on A. aegypti larvae,
while pyriproxyfen resulted effective against them. Studies carried on with tephritid
fruit flies larvae shown that the IGR lufenuron had negative effects on different
parameters when larvae of the tephritids C. capitata and Bactrocera. dorsalis (Hendel)
were fed with the product, but no effects were reported for Bactrocera cucurbitae
Ecdysone agonists
143
(Coquillett) (Chang et al., 2012). Similar experiments with azadirachtin and
tebufenozide added to the larval C. capitata medium shown a reduction on adult
emergence for the first compound, while no effects were detected for the MAC
(González‐Núñez and Viñuela, 1997).
Deleterious effects on adults have also been demonstrated on different Tephritidae
species. After the ingestion of neem leaf dust and a commercial formulation of neem,
a reduction of life span of B. cucurbitae and B. dorsalis was reported (Khan et al.,
2007). Lawrence (1993) also observed high mortality percentages (>75%) after 12‐14
days when females of Anastrepha suspensa (Loew) ingested diet that was treated with
RH‐5849, which is in agreement with our results. In contrast, no effects were observed
when B. oleae were fed with artificial diet treated with the IGRs azadirachtin,
cyromazine, flufenoxuron and pyriproxyfen, although a slight negative effect on life
span of adults was reported for lufenuron (Sánchez‐Ramos et al., 2011). The last
compound also caused a significant mortality on adults of Bactrocera latifrons
(Hendel), but had no effects on C. capitata, B. dorsalis and B. cucurbitae (Chang et al.,
2012).
Although as explained before, it was not possible to evaluate the effects of the
three products on the reproductive parameters of B. oleae, different studies shown
deleterious effects on different dipteran species caused by IGRs on these parameters.
Ecdysone has a regulatory role in yolk protein synthesis and ecdysone agonists would
act on this parameter, suppressing egg development (Lawrence 1993). This author
reported a suppression of the level of A. suspense egg development and maturation
and a reduction of ovaries size when RH‐5849 was topically applied on females. When
RH‐5849 was ingested, females were able to oviposit, but on the days 8‐10, 60‐75% of
the eggs were not viable. It has been observed that neem decreased fecundity of B.
cucurbitae and B. dorsalis due to the block of ovarian development. Similarly, diets
Ecdysone agonists
144
treated with neem caused a reduction on fertility of B. cucurbitae and B. dorsalis
(Singh 2003; Khan et al., 2007). Complete egg mortality was also observed when B.
oleae and C. capitata females were fed with diet treated with lufenuron (Casaña et al.,
1999; Sánchez‐Ramos et al., 2011). The product also affected fertility of B. dorsalis, B.
latifrons (Chang et al., 2012), Anastrepha ludens (Loew), Anastrepha obliqua Mcquart,
Anastrepha serpentina Wied. and Anastrepha striata Schiner (Moya et al., 2010).
However, it had no effects on B. cucurbitae fertility or on C. capitata fecundity (Chang
et al., 2012). A lower activity on B. oleae and C. capitata reproductive parameters was
observed for the IGRs cyromazine, azadirachtin, flufenoxuron, triflumuron,
diflubenzuron, methoprene, fenoxycarb, buprofezin, benzylphenol J2644 and
pyriproxyfen (Casaña et al., 1999; Sánchez‐Ramos et al., 2011), although pyriproxyfen
had no effects on B. oleae (Sánchez‐Ramos et al., 2011).
Evidence collected to date indicates that the MAC insecticides such as
methoxyfenozide, tebufenozide and RH‐5849 have an excellent margin of safety to
non‐target organisms, including a wide range of non‐target and beneficial insects as
well as mammals, birds and fishes (Dhadialla et al., 1998; 2005; Aller and Ramsay,
1988; Carlson et al., 2001; Mommaerts et al., 2006). The latter is in agreement with
the results obtained in this study for the parasitic wasp P. concolor. These products
also resulted harmless when their residual contact activity on an inert surface was
tested on the nymphs or adults of the predators of O. laevigatus, Macrolophus
pygmaeus (Rambur) (=M. caliginosus) (Hemiptera, Miridae) and Amblyseius
californicus (McGregor) (= Neoseiulus. Acari, Phytoseiidae) (Van de Veire and Tirry,
2003). No deleterious effects were detected when the hemipterans Orius insidiosus
Say, Podisus maculiventris (Say) and Podisius sagitta (F.) (Pentatomidae) were exposed
to relatively high doses of RH‐5849 and tebufenozide either (Smagghe and Degheele,
1994a,b, 1995; Schneider et al, 2003). Similarly, tebufenozide was harmless for C.
carnea adults and pupae and P. maculiventris (Viñuela et al., 2001). Amongst
parasitoids, they proved also to be safe for the parasitic wasps Encarsia formosa
(Gahan) (Aphelinidae) (Van de Veire and Tirry, 2003), Hyposoter didymator (Thunberg)
(Ichneymonidae) (Schneider et al., 2003; 2008; Viñuela et al., 2001), Telenomus remus
Ecdysone agonists
145
(Nixon) (Scelionidae) (Carmo et al., 2010), Trichogramma cacoeciae (Marchal)
(Grützmacher et al., 2004), Trichogramma pretiosum (Riley) (Trichogrammatidae ) and
Allorhogas pyralophagus (Marsh) (Braconidae) (Bueno et al., 2008; Legaspi et al.,
1999). In agreement with our results, several studies with tebufenozide have shown no
deleterious effect of the product for P. concolor females (Jacas et al., 1995; González‐
Núñez and Viñuela, 1997; Viñuela et al., 2001), except a reduction of life span when
females ingested the product via the drinking water (Jacas et al., 1995; González‐
Núñez and Viñuela, 1997).
In the present, no sublethal effects on the beneficial capacity of the parasitic wasps
of P. concolor, namely their reproductive parameters, have been reported.
Ecdysteroids, together with the juvenile hormones (JH), are the two most important
groups responsible for regulating insect growth, development, metamorphosis, and
reproduction. Insect ecdysteroids are potent regulatory molecules, perhaps best
known for their ability to trigger a molt. Other functions associated with ecdysteroid
action include metamorphosis, egg and sperm production, chitin synthesis, and the
inhibition of eclosion. Inscet host hormones have been demonstrated to influence
endoparasites and endosymbionts in some host‐parasite systems. Bodin et al. (2007)
identified ecdysone as the main ecdysteroid found in females and produced by the
ovaries. This consistent with many studies showing that ecdysone stimulates
vitellogenesis in female insects. Furthermore, the wasp parasitoid itself, typically by
means of its secretory products, alters the biochemistry and physiology of its host by a
variety of different mechanisms. Parasitoids have been reported to release
ecdysteroids and JH into their host’s hemolymph, presumably to fine‐tune the levels of
these hormones to meet their own developmental needs. Parasitized hosts typically
exhibit abnormal patterns of hemolymph ecdysteroid fluctuation, especially in the last
instar. The mechanisms responsible for these anomalies vary with the host‐parasite
Ecdysone agonists
146
system under investigation and for most systems are not well understood. The
parasitoid as well as its venom, calyx fluid, and teratocytes have been shown to play a
role in altering host ecdysteroid levels. Their actions could serve as useful models for
developing insect control strategies, for when the ecdysteroid that triggers the molt
(typically 20E) does not reach threshold levels, host molting is prevented (Becakge and
Gelman, 2004).
Synovigenic insects (i.e., insects emerging with few ripe eggs and maturing more
eggs during the course of their lifetime) may suffer from transient egg limitation due to
the stochastic nature of encounters with patchy hosts and the low availability of ripe
eggs at any given time point. Egg limitation also affects the stability of host–parasitoid
models. Ecdysone levels increased within two minutes of contact with a host, the
fastest hormonal response reported for any insect. Even simple contact with a host,
without further host use, triggered an increase in hormone levels, leading to the
maturation of a single egg, using body reserves only. Feeding on the host caused a
much larger increase in ecdysone levels and was followed by a marked increase in
oogenesis. Oviposition had a weak effect on hormone levels, but increased oogenesis
(Casas et al., 2009). In a study carried out by Bodin et al. (2007) with the parasitoid
Eupelmus vuilleti (Hymenoptera, Eupelmidae), it was observed that a larger secretion
of ecdysone was found in female during their reproductive period compared with
inactive females. Furthermore, the presence of the host, which represents both the
oviposition site and the nutritional source, induced an active biosynthesis of ecdysone.
When hosts were available, this synthesis was cyclic and continuous during the entire
female lifetime. These results showed that host presence triggered ovarian synthesis
of ecdysteroids, which are involved in a stop‐and‐go regulation of egg production
linked to host availability.
Ecdysone agonists
147
Members of the genus Psyttalia are synovigenic parasitoids (Pemberton and
Willard, 1918). Therefore, we can suppose that ecdysone plays an important role on
reproduction, although there are not specific studies on this topic for P. concolor.
In agreement to our results no adverse effects were detected on reproduction
(production of males) nor on the development of the larvae in the treated nests when
MACs were applied to bumblebees, Bombus terrestris L. (Hymenoptera, Apidae)
(Mommaerts et al., 2006). Experiments carried out by Jacas et al. (1995), González‐
Núñez and Viñuela (1997) and Viñuela et al. (2001) also shown no effects on P.
concolor reproduction after the topical application or the ingestion of tebufenozide. In
contrast, MACs strongly affect reproduction in sensitive insect species as Lepidoptera
and Coleoptera which in many cases resulted in sterile female adults and/or abnormal
genitalia, which hinder the mating process or the capacity to produce fertile offspring
(Dhadialla et al., 1998; 2005; Tunaz and Uygun, 2004). The prevention or cessation of
the oviposition of some Coleoptera, Lepidoptera and Diptera was also observed, and
similar effects were reported for Hemiptera (Aller and Ramsay, 1988; Lawrence, 1993).
Dissection of lepidopteran and coleopteran females treated with MACs and which had
stopped oviposition, showed that the formation of new ovarioles seemed inhibited
and they already showed signs of degeneration, resulting in very frail ovarioles.
However, all the eggs that had been deposited by the treated females were equally
viable (Smagghe and Degheele, 1994a,b, 1995; Farinós et al., 1999). In contrast, no
alterations on the oocyte growth or on the ovulation process were detected in
tebufenozide‐treated lacewing predatory adults (Medina et al., 2002).
Ecdysone agonists
148
5.5.2. Molecular docking studies
Although sequence conservation for the LBD of NRs, including the EcR, is high, small
amino acid substitutions in this domain can have a major impact on the 3D‐structure of
the protein, and in particular on the size and shape of the ligand‐binding pocket
(Kasuya et al., 2003 According to Smagghe and Degheele (1994a), the wide range of
susceptibilities to the ecdysteroid‐mimicking compounds in the different insect species
may be explained by differences in the structure of the EcR and their binding affinity
for the ecdysteroid agonist ligand molecules.
BoEcR‐LBD and PcEcR‐LBD exhibit a high conservation among the ligand binding‐
involved residues (indicated with blue dots in Figures 74 and 75). In Lepidoptera, which
show a high sensitivity for tebufenozide and methoxyfenozide, the residues
methionine58 and the valines100 and 111 (Figure 74) (corresponded to methionine56
and the valines 98 and 109 in Figure 75) are the divergent residues lining the binding
pocket. In the case of other insect and non‐insect arthropods that show no or low
susceptibility for tebufenozide and methoxyfenozide, these residues are substituted by
isoleucine, methionine and isoleucine, respectively (Wurtz et al., 2000). These
substitutions are also observed in BoEcR‐LBD and PcEcR‐LBD, which supports the
results obtained in the current biological experiments with these compounds. The
latter authors also reported that especially the isoleucine58 generates steric clashes
between the γ‐methyl group of the isoleucine and the C5‐methyl group at the A‐ring or
the C4‐ethyl group at the B‐ring of the tebufenozide molecule, depending on the
orientation of the insecticide molecule.
As previously mentioned, in the case of BoEcR‐LBD, a steric clash also occurred with
the methoxy‐phenyl ring of methoxyfenozide and tebufenozide. However, in the case
of RH‐5849, which contains no substitutions on the two benzoyl rings, the steric
Ecdysone agonists
149
hindrance occurring upon docking of the products is much less severe (only light) as
compared to the other two DBH‐based products. Thus, in this case, the differences on
insect susceptibility might be due to the size and shape of the insecticide molecule. In
the case of PcEcR‐LBD, two of the amino acid residues are completely different from
the other EcR‐LBD sequences, namely threonine54 and methionine221, which are
substituted by alanine and isoleucine in P. concolor, respectively.
Similar results than those obtained for P. concolor have been reported for bees
(Mommaerts et al., 2006). Indeed the current data are strong indications that target
site differences in the molting hormone reception play an important role. The latter
hypothesis is consistent with the concept that structure and biochemical properties of
EcR may differ among insect species. However, it needs also to be mentioned here
that, next to the structure of the EcR‐LBD pocket, other factors as pharmacokinetics
and metabolic detoxification additionally play an important role in determining the
biological spectrum of the MAC insecticides (Wurtz et al., 2000). For instance, the
penetration of tebufenozide in non‐sensitive C. carnea female adults was relatively
slow and low, while the absorption in sensitive Lepidoptera was much more rapid
(Medina et al., 2002). The latter results demonstrated that the low penetration and
absorption patterns of tebufenozide also help to explain its non‐toxicity towards C.
carnea larvae.
To date different sequences for the EcR‐LBD in Hymenoptera are already available.
For a number of social insects belonging to the Formicidae, Vespidae and Apoidae
families, the sequence is known, but these three families comprise only a small part of
the large order of Hymenoptera. Apart from these social insects, only one EcR
sequence is known for another hymenopteran, namely the Pteromalidae parasitoid
wasp Nasonia vitripennis (Walker), of which the genome has recently been sequenced
(Werren et al., 2010). Sequence alignment analysis with PcEcR‐LBD indicated a number
Ecdysone agonists
150
of substitutions in regions of the LBD that are usually strongly conserved. It also
indicated a higher sequence identity towards the Hemiptera than to the Hymenoptera.
Phylogenetic analysis confirmed this, showing that PcEcR‐LBD grouped together with
the Hemiptera rather than the Hymenoptera. Indeed the EcR‐LBD of P. concolor
exhibits higher sequence identity on amino acid level towards most Hemiptera
orthologs such as N. viridula, B. tabaci and Nilaparvata lugens (Stål.) (Delphacidae) (77‐
84%, average 79.7%), than to the other Hymenoptera orthologs (74‐81%, average
77.9%). However, these differences could also be partly caused by the limited amount
of data that is available for non‐social Hymenoptera. It is clear from the sequence data
that in some conserved regions, social hymenopteran insects, especially ants, have the
same amino acid substitutions, while these are not shared by the EcR of the two
parasitic wasps (N. vitripennis and P. concolor) or other insect species. Other examples
of nuclear receptors not following the normal phylogeny have also been described
before. For instance, the Mecopterida EcR proteins failed to cluster together with the
rest of the Holometabola group, despite this being considered a monophyletic group
(Bonnetton et al., 2003). A similar phenomenon was found in Hemiptera where
members of the Sternorrhyncha suborder did not group together with the Heteroptera
or Auchenorrhyncha suborders to form a hemipteran clade. The phylogenetic distance
of PcEcR‐LBD from that of Lepidoptera can explain the negative correlation with the
high affinity of MAC for Lepidoptera. This negative correlation was also found for RH‐
5849 in N. viridula (Tohidi‐Esfahani et al., 2011), whose EcR‐LBD exhibits a high
sequence identity with PcEcR‐LBD.
Ecdysone agonists
151
5.6 Appendix (tables of results)
Table 17: Efficacy of methoxyfenozide, tebufenozide, RH‐5849, dimethoate and spinosad on B. oleae (mean data ± standard error)
Data followed by the same letter are not significantly different (ANOVA, LSD; P≥0.05)
Mortality 24h Mortality 48h % Mortality 72h % Mortality 7d % Mortality 15d
Residual contact on glass surfaces
Control 2.0a ± 2.0 4.0a ± 4.0 4.0a ± 4.0 4.0a ± 4.0 45.8a ± 16.2 Methoxyfenozide 0.0a ± 0.0 0.0a ± 0.0 4.0a ± 4.0 4.0a ± 4.0 49.1a ± 14.4 Tebufenozide 0.0a ± 0.0 2.0a ± 2.0 2.0a ± 2.0 18.0b ± 5.8 58.0a ± 11.6 RH‐5849 0.0a ± 0.0 26.0b ± 8.7 54.0b ± 13.3 86.0c ± 7.5 100.0b ± 0.0 Spinosad 62.0b ± 6.6 88.0c ± 3.7 96.0c ± 4.0 100.0d ± 0.0 100.0b ± 0.0 Dimethoate 100.0c ± 0.0 100.0c ± 0.0 100.0c ± 0.0 100.0d ± 0.0 100.0b ± 0.0
F5,24= 295.87 F5,24= 113.16 F5,24= 73.35 F5,24= 135.0 F5,24= 7.33 P<0.0001 P<0.0001 P<0.0001 P<0.0001 P = 0.0003
Oral toxicity
Control 0.0a ± 0.0 0.0a ± 0.0 2.5a ± 2.5 2.5a ± 2.5 2.5a ± 2.5 Methoxyfenozide 2.5a ± 2.5 2.5a ± 2.5 2.5a ± 2.5 2.5a ± 2.5 2.5a ± 2.5 Tebufenozide 0.0a ± 0.0 0.0a ± 0.0 0.0a ± 0.0 0.0a ± 0.0 0.0a ± 0.0 RH‐5849 0.0a ± 0.0 2.0a ± 2.0 10.0a ± 7.7 31.8b ± 8.1 98.2b ± 1.8 Spinosad 50.0b ± 6.3 98.0b ± 2.0 100.0b ± 0.0 100.0c ± 0.0 100.0b ± 0.0 Dimethoate 85.2c ± 14.8 100.0b ± 0.0 100.0b ± 0.0 100.0c ± 0.0 100.0b ± 0.0
F5,22= 48.51 F5,22= 841.31 F5,22= 96.52 F5,22= 139.64 F5,22= 924.4 P<0.0001 P<0.0001 P<0.0001 P<0.0001 P<0.0001
Table 18: Toxicological effects of methoxyfenozide, tebufenozide, RH‐5849, dimethoate and spinosad on P. concolor females (mean data ± standard
error)
Data followed by the same letter are not significantly different (ANOVA, LSD; P≥0.05) Effects of oral toxicity of the products 7 days after the treatment were not measured 1Data analysed using Kruskal‐Wallis test
Mortality 24h
Mortality 48h
% Mortality 72h
% Mortality 7 days
% Attacked hosts
% Progeny size
Residual contact on glass surfaces
Control 0.0a ± 0.0 0.0a ± 0.0 0.0a ± 0.0 0.0a ± 0.0 93.4a ± 2.3 57.6a ± 13.2 Methoxyfenozide 2.0a ± 2.0 2.0a ± 2.0 2.0a ± 2.0 4.0a ± 4.0 96.7a ± 1.4 55.3a ± 9.3 Tebufenozide 0.0a ± 0.0 0.0a ± 0.0 0.0a ± 0.0 0.0a ± 0.0 86.2a ± 8.1 59.4a ± 11.0 RH‐5849 0.0a ± 0.0 0.0a ± 0.0 0.0a ± 0.0 4.0a ± 4.0 89.8a ± 7.5 53.6a ± 7.9 Spinosad 8.0b ± 3.7 25.3b ± 4.4 35.3b ± 7.9 68.0b ± 13.6 ‐ ‐ Dimethoate 100.0c ± 0.0 100.0c ± 0.0 100.0c ± 0.0 100.0c ± 0.0 ‐ ‐
F5,24= 536.76 F5,24= 399.61 F5,24= 207.71 F5,24= 54.52 F3,12= 0.42 F3,12= 0.06 P<0.0001 P<0.0001 P<0.0001 P<0.0001 P = 0.7450 P = 0.9804
Oral toxicity
Control 0.0a ± 0.0 0.0a ± 0.0 0.0a ± 0.0 ‐ 89.9a ± 0.7 53.9a ± 7.4 Methoxyfenozide 0.0a ± 0.0 0.0a ± 0.0 0.0a ± 0.0 ‐ 98.3a ± 0.6 58.9a ± 7.2 Tebufenozide 0.0a ± 0.0 0.0a ± 0.0 0.0a ± 0.0 ‐ 99.1a ± 0.2 52.8a ± 4.9 RH‐5849 0.0a ± 0.0 2.0a ± 2.0 4.0a ± 4.0 ‐ 99.0a ± 0.2 40.6a ± 7.7 Spinosad 92.0c ± 3.7 98.0b ± 2.0 100.0b ± 0.0 ‐ ‐ ‐ Dimethoate 73.8b ± 12.0 100.0b ± 0.0 100.0b ± 0.0 ‐ ‐ ‐
F5,24= 69.61 F5,24= 1941.20 K1= 27.5455 ‐ F3,12= 0.68 F3,12= 1.27 P<0.0001 P<0.0001 P<0.0001 ‐ P = 0.5834 P = 0.3289
Conclusions
155
Chapter 6
CONCLUSIONS
After evaluating the ecotoxicological effects of kaolin, Bordeaux mixture and cooper
oxychloride on the parasitic wasp P. concolor and the scale predator C. nigritus it can be
concluded:
Neither direct mortality nor high negative sublethal effects of the products have been
recorded on adults of P. concolor and C. nigritus through the different experiments
performed. However, when P. concolor females ingested the pesticides via the
drinking water some deleterious effects on mortality, life span and attacked hosts
could be observed, especially in the case of kaolin. Progeny size was not affected by
the products.
Kaolin seems to be a promising compound to be used in olive crops, taking into
account that it affects beneficial arthropods to a lesser extent than compounds
commonly used, such as dimethoate. However, because of its uncommon mode of
action, special attention should be paid to its sublethal effects, such as reproduction
and behaviour.
The two copper‐based products evaluated in these experiments can also be
considered as alternatives against B. oleae. Furthermore, as they washed away easier
than kaolin, they can be a good alternative for table olives (especially in organic
farming). Nevertheless, the possible negative effects that copper residues could
provoke on the ecosystems if they accumulated in the soil should also be taken into
account.
From a practical point of view, they might be considered together with other
insecticides, such as dimethoate or spinosad, if an accurate resistance management
program is likely to be applied, both for integrated pest management programs and
Conclusions
156
organic oliviculture. However, because their effectiveness is conditioned by the pest
level, they should be used in those years in which populations are low.
The study of the efficacy of methoxyfenozide, tebufenozide and RH‐5849 on B. oleae and their
ecotoxicological effects on P. concolor through biological assays and molecular and docking
experiments has reported the following conclusions:
For B. oleae adults, data showed no biological activity of methoxyfenozide and
tebufenozide, while insecticidal effects were found for RH‐5849. Modeling and docking
experiments also suggest that tebufenozide and methoxyfenozide are not effective
against the pest. In contrast, RH‐5849 demonstrated a promising activity against it.
More experiments for testing the product on other pest developmental stages pest are
needed to confirm this issue. Evaluation of effects on olive fruit fly reproduction
should also be performed.
No biological activity of methoxyfenozide, tebufenozide and RH‐5849 on P. concolor
was found. Modeling of the PcEcR‐LBD and docking experiments also indicate that
DBH‐based insecticides are devoid of any deleterious effect on the wasp.
Searching and developing of new insecticides to control B. oleae could be based on the
basic lead structure of RH‐5849 molecule (1, 2‐dibenzoyl‐1‐tert‐butylhydrazine).
These products could be safely applied in IPM programs in which the parasitic wasp is
present. However, it is recommended to test MACs also on other species to prevent
undesirable effects on the auxiliary fauna.
References
157
Chapter 7
REFERENCES
AAO (Agencia para el Aceite de Oliva), 2011. Información del sector.
http://intereweb.mapa.es/pwAgenciaAO/InfGeneral.aao?opcion_seleccionada=1000&
control_acceso=S&idioma=ESP (14/12/2010)
Adán A, T González, R Bastante, F Budia, P Medina, P Del Estal and E Viñuela, 2007.
Efectos de diversos insecticidas aplicados en condiciones de laboratorio extendido
sobre Psyttalia concolor (Szèpligeti) (Hymenoptera: Braconidae). Bol San Veg Plagas
33: 391-397
Aller HE and JR Ramsay, 1988. RH-5849- A novel insect growth regulator with a new
mode of action. Brighton Crop Protection Conference-Pests and Diseases
Alvarado M, M Civantos and JM Durán, 2008. Plagas. In: El cultivo del olivo, pp. 509-593.
Barranco D, R Fernández-Escobar and L Rallo (eds.) 6ª ed. revisada y ampliada. Junta
de Andalucía y Ediciones Mundiprensa. Madrid
Angeli G, M Baldessari, R Maines and C Duso, 2005. Side-effects of pesticides on the
predatory bug Orius laevigatus (Heteroptera: Anthocoridae) in the laboratory.
Biocontrol Sci Technol 15 (7): 745-754
Anonymous, 2008. Alimentos ecológicos. Las certificaciones ecológicas.
http://alimentosecologicos.wordpress.com/2008/09/01/las-certificaciones-
ecologicas/ (04/12/2010)
Anonymous, 2009a. Oleoturismo. Turismo rural en torno al aceite de oliva.
http://www.oleoturismo.es (14/12/2010)
Anonymous, 2009b. Rutas del aceite. http://www.rutasdelaceite.com (14/12/2009)
Anonymous, 2009c. Dipartamento Specialistico Regionale Idrometeoclimatico.
Scheda informativa: mosca delle olive.
http://www.sar.sardegna.it/documentazione/agro/moscaolive.asp (27/01/10)
Anonymous, 2009d. Avversità dell’olivo nella zona di Semproniano.
http://www.agroambientalemaremma.it/olivone/avversit%C3%A0.htm (27/01/10)
References
158
Anonymous, 2011. Parasitoids of fruit-infesting Tephritidae.
http://hymenoptera.tamu.edu/paroffit/(19/01/2011)
Arambourg Y, 1986. Entomologie oleicole. Conseil Oleicole International, Madrid. 360 pp
Barranco, D., 2008. Variedades y patrones. In: El cultivo del olivo, pp. 63-92. D Barranco,
R Fernández-Escobar and L Rallo (ed.) 6ª ed. revisada y ampliada. Junta de Andalucía y
Ediciones Mundiprensa. Madrid
Barrett KL, N Grandy, EG Harrison, S Hassan and P Oomen, 1994. Guidance document on
regulatory testing procedures for pesticides with non-target arthropods. SETAC,
Brussels
Beckage NE and DB Gelman, 2004. Wasp parasitoid disruption of host development:
implications for new biologically based strategies for insect control. Annu Rev Entomol
49: 299-330
Beckage NE, KM Marion, WE Walton, MC Wirth and FF Tan, 2004. Comparative larvicidal
toxicities of three ecdysone agonists on the mosquitoes Aedes aegypti, Culex
quinquefasciatus, and Anopheles gambiae. Arch Insect Biochem Physiol 57: 111-122
Belcari A and E Bobbio, 1999. The use of copper in the control of the olive fly, Bactrocera
oleae. Informatore Fitopatologico 49: 52-55
Belcari A, P Sacchetti, MC Rosi and RD Pianta, 2005. The use of copper products to
control the olive fly (Bactrocera oleae) in central Italy. “Integrated Protection of Olive
Crops” IOBC/wprs Bull 28 (9): 45-48
Bengochea P, S Hernando,R Saelices, A Adán, F Budia, M González-Núñez, E Viñuela and
P Medina, 2010. Side effects of kaolin on natural enemies found on olive crops.
IOBC/wprs Bull 55: 61-67
Bento A, JE Cabannas, JA Pereira, A Torres, A Herz and SA Hassan, 2004. Effects of
different attractive sources on the abundance of olive predatory arthropods and
possible enhacenment of their activity as predators on eggs of Prays oleae Bern. 5th
International Symposium on Olive Growing. 27 September – 2 October 2004.
Izmir/Turkiye. www.olive2004turkiye.com (11/11/2010)
Bento A, S Pereira, JE Cabannas and JA Pereira, 2010. Effects of different sugars and
pollens on the olive moth, Prays oleae Bern. and their parasitoids Elasmus flabellatus
Wetsw. IOBC/wprs Bull 53: 108
References
159
Billah MK, SW Kimani-Njogu, RA Wharton, WA Overholt, DD Wilson and MA Cobblah,
2008. Cross mating studies among five fruit fly parasitoid populations: potential
biological control implications for tephritid pests. BioControl 53: 709-724
Boccaccio L and R Petacchi, 2009. Landscape effects on the complex of Bactrocera oleae
parasitoids and implications for conservation biological control. BioControl 54:607-616
Bodin A, Jaloux B, Mandon N, Vannier F, Delbecque JP, Monge JP and N Mondy, 2007.
Host-induced ecdysteroids in the stop-and-go oogenesis in a synovigenic parasitoid
wasp. Arch Insect Biochem Physiol 65: 103-111
BOE (Official State Gazette; Boletín Oficial del Estado), 2004. Orden APA/1/2004, de 9 de
enero, por la que se establece el logotipo de la identificación de garantía nacional de
producción integrada. BOE 10/01/2004
BOJA (Official Gazette of the Council of Andalusia; Boletín Oficial de la Junta de
Andalucía), 2002. Orden de 18 de julio de 2002, por la que se aprueba el Reglamento
Específico de Producción Integrada de Olivar. BOJA 27-07-2002
Bonnetton F, D Zelus, T Iwema, M Robinson-Rechavi and V Laudet, 2003. Rapid
divergence of the ecdysone receptor in Diptera and Lepidoptera suggests coevolution
between EcR and USP-RXR. Mol Biol Evol 20 (4): 541-553
Boyce AM, 1932. Mortality of Rhagoletis corpunta Cress, though the ingestion of certain
solid materials. J Econ Entomol 25: 1053-1059
Braham M, E Pasqualini and N Ncira. 2007. Efficacy of kaolin, spinosad and malathion
against Ceratitis capitata in citrus orchards. Bull Insectol 60 (1): 39-47
Browning C, E Martin, C Loch, JM Wurtz, D Moras, RH Stote, AP Dejaegere and IM Billas,
2007. Critical role of desolvation in the binding of the 20-hydroxyecdysone to the
ecdysone receptor. J Biol Chem 282: 32924-32934
Bueno AF, RCOF Bueno, JRP Parra and SS Vieira, 2008. Effects of pesticides used in
soybean crops to the egg parasitoid Trichogramma pretiosum. Ciência Rural, Santa
Maria 38 (6): 1495-1503
Bürgel K, C Daniel and E Wyss, 2005. Effects of autumn kaolin treatments on the rosy
appel aphid, Dysaphis plantaginea (Pass.) and possible modes of action. J Appl Entomol
129(6): 311-314
References
160
Cadogan BL and RD Scharbach, 2005a. Effects of a kaolin-based particle film on
oviposition and feeding of gypsy moth (Lep. Lymantriidae) and forest tent caterpillar
(Lep., Lasiocampidae) in the laboratory. J Appl Entomol 129 (9-10): 498-504
Cadogan BL and RD Scharbach, 2005b. Effects of kaolin-based particle film on spruce
budworm (Choristoneura fumiferana (Lepidoptera: Tortricidae)) oviposition in the
laboratory. Pest Manag Sci 61 (12): 1215-1219
Caleca V and R Rizzo, 2006. Effectiveness of clays and copper products in the control of
Bactrocera oleae (Gmelin). In: En: Procedings of Olivebioteq 2006, Second
International Seminar “Biotechnology and quality of olive tree products around the
Mediterranean Basin” [Mazara del Vallo, Marsala (Italia), 5-10 de noviembre]. Vol. II.
Caruso, T. y A. Motisi Eds. Organic eprints Web.
http://orgprints.org/10965/01/Caleca%26RizzoOlivebioteq166.pdft. (12/04/ 2009)
Caleca V and Rizzo, 2007. Tests on the effectiveness of kaolin and copper hydroxide in
the control of Bactrocera oleae (Gmelin). IOBC/wprs Bull 30(9): 111-117
Caleca V, G Lo Verde, M Palumbo Piccionello and R Rizzo, 2008. Effectiveness of clays
and copper products in the control of Bactrocera oleae (Gmelin) and Ceratitis capitata
(Wiedemann) in organic farming. 16 IFOAM Organic World Congress, Modena, Italy,
June 16-20, 2008.
http://orgprints.org/view/projects/conference.html (06/07/2010).
Cals-Usciati, 1972. Les relations hôte-parasite dans le couple Ceratitis capitata
Wiedemann (Diptera, Trypetidae) et Opius concolor Szèpligetti (Hymenoptera,
Braconidae). Ann Zool –Écol Anim 4 : 427-481
Canale A and A Loni, 2006. Host location and acceptance in Psyttalia concolor : role of
host instar. Bull Insectol 59 (1) : 7-10
Candolfi MP, S Blümel, R Forster, FM Bakker, C Grimm, SA Hassan, U Heimbach, MA
Mead-Briggs, B Reber, R Schmuck and H Vogt (eds.), 2000. Guidelines to evaluate side-
effects of plant protection products to non-target arthropods. IOBC, BART and EPPO
Joint Initiative. Dreier Druck Reinheim158 pp IOBC/wprs, Gent 158 pp
Capuzzo C, F Giuseppe, L Mazzon, A Squartini and V Girolami, 2005. “Candidatus Erwinia
dacicola”, a coevolved symbiotic bacterium of the olive fly Bactrocera oleae (Gmelin).
Int J Syst Evol Microbiol 55: 1641-1647
References
161
Carlson GR, TS Dhadialla, R Hunter, RK Jansson, CS Jany, Z Lidert and RA Slawecki, 2001.
The chemical and biological properties of methoxyfenozide, a new insecticidal
ecdysteroid agonist. Pest Manag Sci 57:115-119
Carmichael JA, MC Lawrence, LD Graham, PA Pilling, VC Epa, L Noyce, G Lovrecz, DA
Winkler, A Pawlak-Skrzecz, RE Eaton, GN Hannan and RJ Hill, 2005. The X-ray structure
of a hemipteran ecdysone receptor ligand-binding domain: comparison with a
lepidopteran ecdysone receptor ligand-binding domain and implications for insecticide
design. J Biol Chem 280: 22258-22269
Carmo EL, AF Bueno and RCOF Bueno, 2010. Pesticide selectivity for the egg parasitoid
Telenomus remus. Biocontrol 55 (4): 455-464
Casaña V, A Gandía, C Mengod, J Primo and E Primo. 1999. Insect growth regulators as
chemosterilants for Ceratitis capitata (Diptera: Tephritidae). J Econ Entomol 92 (2):
303-308
Casas J, F Vannier, N Mandon, JP Delbecque, D Giron and JP Monge, 2009. Mitigation of
egg limitation in parasitoids: immediate hormonal response and enhanced oogenesis
after host use. Ecology 90 (2): 537-545
Casida JE and GB Quistad, 1998. Golden age of insecticides research: past, present, or
future? Annu Rev Entomol 43: 1-16
Chamorro ML and M Sánchez, 2003. La ATRIA como herramienta indispensable en la
consecución de la calidad. OLI-20. Foro del olivar y del medioambiente.
http://www.expoliva.com/expoliva2003/simposium/comunicaciones/OLI-20-
TEXTO.PDF (13/12/2008)
Chang CL, IK Cho and QX Li, 2012. Laboratory evaluation of the chemosterilant lufenuron
against the fruit flies Ceratitis capitata, Bactrocera dorsalis, B. cucurbitae, and B.
latifrons. J Asia-Pacific Entomol 15 (1): 13-16 doi:10.1016/j.aspen.2011.07.012
Chomeczynski P and N Sacchi, 1987. Single-step method of RNA isolation by acid
guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159
CIAS (International Conference on Olive Oil and Health; Congreso Internacional sobre
Aceite de Oliva y Salud), 2008. http://www.cias2008.com/p/aceite-y-salud
(10/07/2009)
Cirio U, 1997. Productos agroquímicos e impacto ambiental en olivicultura. Olivae 65:32-
39
References
162
Civantos M, 1998a. El prays y el barrenillo del olivo. IX Symposium Internacional. La
Sanidad del Olivar en Países del Mediterráneo. Phytoma España 102: 124-129
Civantos M, 1998b. Desarrollo de sistemas MPI (Manejo Integrado de Plagas) en el olivar.
La red de ATRIAS en Andalucía. Problemática sanitaria en la producción de aceite
ecológico en la provincia de Jaén. IX Symposium Internacional. La Sanidad del Olivar en
Países del Mediterráneo. Phytoma España 102: 194-197
Civantos M, 1999. Control de plagas y enfermedades del olivar. Consejo Oleícola
Internacional (COI) (ed.). Madrid. 207 pp
Civantos L, 2008. La olivicultura en el mundo y en España. In: El cultivo del olivo, pp. 17-
36. Barranco, D.; R. Fernández-Escobar y L. Rallo (ed.) 6ª ed. revisada y ampliada. Junta
de Andalucía y Ediciones Mundiprensa. Madrid
Croft BA, 1990. Arthropod biological control agents and pesticides. John Wiley & Sons.
USA, 723 pp
Daane KM and MW Johnson, 2010. Olive fruit fly: Managing an ancient pest in modern
times. Annu Rev Entomol 55: 151-169
Daniel C, W Pfammatter, P Kehrli and E Wyss, 2005. Processed kaolin as an alternative
insecticide against the European pear sucker, Cacopsylla pyri (L.). J Appl Entomol 129
(7): 363-367
De Andrés F, 1991. Enfermedades y plagas del olivo. 2ª ed. corregida y ampliada.
Riquelme y Vargas Ediciones, S.L., Jaén. 646 pp.
De la Roca M, 2003: Surround® Crop Protectant: La capa protectora natural para cultivos
como el olivar. Phytoma España, 148: 82-85.
De Liñán C, 2007. Vademécum de productos fitosanitarios y nutricionales. Ediciones
Agrotécnicas, Madrid, 768 pp
De Ricke AA, 1998. Nuevas tecnologías en aceites agrícolas en Control Integrado de
Plagas. IX Symposium Internacional. La Sanidad del Olivar en Países del Mediterráneo.
Phytoma España 102: 198-199
Delrio G, 1995. Controllo integrato dei fitofagi dell´olivo. Informatore Fitopatologico 12:
9-15
Delrio G, A Lentini and A Satta, 2005. Biological control of olive fruit fly through
inoculative releases of Opius concolor Szépl; Integrated Protection of Olive Crops.
IOBC/wprs Bull. 28(9): 53-58
References
163
Delrio G, 2010. Biological control of olive pests in the Mediterranean region. Integrated
protection of olive crops. IOBC/wprs Bull. 53: 85-92
Dent D, 1991. Insect Pest Management. C. A. B. International, Oxon, Reino Unido. 604 pp
Desneux N, A Decourtye and JM Delpuech, 2007. The sublethal effects of pesticides on
beneficial organisms. Annu Rev Entomol 52: 81-106
Devesa JA, 2005. Plantas con semillas. In: Botánica, pp. 417-636. Izco, J & colaboradores.
2ª ed. McGraw-Hill Interamericana. Madrid
Dhadialla TS, G Carlson and D Le, 1998. New insecticides with ecdysteroidal and juvenile
hormone activity. Annu Rev Entomol 43: 545-569
Dhadialla TS, A Retnakaran and G Smagghe, 2005. Insect growth- and development-
disrupting insecticides, in Comprehensive Insect Molecular Science, ed. by Gilbert LI,
Kostas I and Gill S. Pergamon Press, New York, Vol. 6, pp. 55-116
Díaz B, E Garzo, M Duque, P González and A Fereres, 2002. Partículas de caolín: efecto
sobre la mortalidad y desarrollo de Trichoplusia ni Hübner. Bol San Veg Plagas 28: 177-
183
Duarte F, N Jones and L Fleskens, 2008. Traditional olive orchards on sloping land:
Sustainability or abandonment? J Environ Manag 89: 86-98
EPPO, (European and Mediterranean Organization of Plant Protection Organization),
2011a. Successfully introduced classical biological control agents. Insecta,
Hymenoptera (part II).
http://archives.eppo.org/EPPOStandards/biocontrol_web/classical/hymen2_class.htm
(17/03/2011)
EPPO, 2011b. Commercially used biological control agents – Insecta, Coleoptera.
http://archives.eppo.org/EPPOStandards/biocontrol_web/coleoptera.htm
(17/03/2011)
Estes AM, D Nestel, A Belcari, A Jessup, P Rempoulakis and AP Economopoulos, 2012. A
basis for the renewal of sterile insect technique for the olive fly, Bactrocera oleae
(Rossi). J Appl Entomol 136: 1-16
Fahrbach SE, G Smagghe and RA Velarde, 2012. Insect Nuclear Receptors. Annu Rev
Entomol 2012, In Press doi: 10.1146/annurev-ento-120710-100607
References
164
FAO (Food and Agriculture Organization of the United Nations), 2011a. AGP Integrated
Pest Management
http://www.fao.org/agriculture/crops/core-themes/theme/pests/ipm/en/
(17/03/2011)
FAO, 2011b. Good Agricultural Practices.
http://www.fao.org/prods/gap/home/principles_4_en.htm. (17/03/2011)
Farinós G, G Smagghe, L Tirry and P Castañera, 1999. Action and pharmacokinetics of a
novel insect growth regulator, Halofenozide, in adult beetles of Aubeonymus
mariaefranciscae and Leptinotarsa decemlineata. Arch Insect Biochem Physiol 41: 201-
213
Felsenstein J, 1985. Confidence limits on phylogenies: An approach using the bootstrap.
Evolution 39:783-791
Glenn DM, GJ Puterka, T Vanderzwet, RE Stern and C Feldmhake, 1999: Hydrophobic
particle films: a new paradigm for suppression of arthropod pests and plant diseases. J
Econ Entomol 92 (4): 759-771.
Glenn M and GJ Puterka, 2005. Particle Films: A New Technology for Agriculture. Jules
Janick (Ed.). Horticultural Reviews 31: 1-44
Gobin B, D Bylemans and G Peusens, 2005. Biological efficacy of kaolin against the pear
sucker Psylla pyri in winter and summer applications. IOBC/WPRS Bull 8(7):193–197
González-Núñez M, 1998. Uso conjunto de plaguicidas y enemigos naturales en el olivar:
optimización del manejo de Opius concolor Szèpligeti, parasitoide de la mosca del
olivo, Bactrocera oleae (Gmelin). Tesis doctoral. E.T.S.I.Agrónomos, Universidad
Politécnica de Madrid. 175 pp.
González-Núñez M, 2008. Olivo. In: Control Biológico de Plagas Agrícolas, pp. 336-374.
Jacas JA and A Urbaneja (eds.) Phytoma España. Valencia
González-Núñez M and E Viñuela, 1997. Effects of two modern pesticides: azadirachtin
and tebufenozide on the parasitoid Opius concolor (Szèpligeti). IOBC/WPRS Bull 20(8):
233-240
González-Núñez M, F Bahena and E Viñuela, 1998. Desarrollo de un método de
semicampo para estudio de los efectos secundarios de los productos fitosanitarios
sobre el parasitodie Opius concolor Szèpligeti. Bol San Veg Plagas 24: 661-668
References
165
González-Núñez M, S Pascual, E Seris, JR Esteban-Durán, P Medina, F Budia, A Adán and
E Viñuela, 2008. Effects of different control measures against the olive fruit fly
(Bactrocera oleae (Gmelin)) on beneficial arthropofauna. Methodology and first results
of field assays. IOBC/wprs Bull. 35: 26-31
Grafton-Cardwell B and C Reagan, 2003. Surround use in citrus increases California red
scale. KAC Plant Protection Quaterfly 13 (3): 5-6
Greathead DJ and RD Pope, 1977. Studies on the biology and taxonomy of some
Chilocorus spp. (Coleoptera: Coccinellidae) preying on Aulacaspis spp. (Hemiptera:
Diaspididae) in East Africa, with the description of a new species. B Entomol Res 67:
259-270
Grützmacher AD, O Zimmermann, A Yousef and A Hassan, 2004. The side-effects of
pesticides used in integrated production of peaches in Brazil on the egg parasitoid
Trichogramma cacoecidae Marchal (Hym. Trichogrammatidae). J Appl Entomol 128 (6):
377-383
Guerrero A, 2003. Nueva olivicultura. 5ª ed. Revisada y ampliada. Mundiprensa (ed.),
Madrid. 304 pp
Haniotakis GE, 2005. Olive pest control: Present status and prospects. Integrated
Protection of Olive Crops; IOBC/WPRS Bull. 28:1-9
Hassan SA, 1998. Introduction. In: Ecotoxicology: Pesticides and biological organisms. pp:
55-68. Haskell PT and P McEwen (ed.). Chapman & Hall (ed.), London
Hattingh V MJ Samways, 1991. Determination of the most effective method for field
establishment of biocontrol agents of the genus Chilocorus (Coleoptera: Coccinellidae).
B Entomol Research 81: 169-174
Hattingh V and MJ Samways, 1993. Evaluation of artificial two species of natural prey as
laboratory food for Chilocorus spp. Entomol Exp Appl 69: 13-20
Hattingh V and MJ Samways, 1994. Physiological and behavioural characteristics of
Chilocorus spp. (Coleoptera: Coccinellidae) in the laboratory relative to effectiveness in
the field as biocontrol agents. J Econ Entomol 87 (1): 31-38
Henrich VC, 2005. The ecdysteroid receptor. In: Comprehensive molecular insect
science. pp. 243-273. Gilbert LJ, K Iatrou and SS Gill (eds). Oxford, Elsevier/Pergamon.
Vol. 3.
References
166
IAEA (International Atomic Energu Agency), 2009. IAEA uses sterile insect technique to
tackle olive fruit fly. Staff report.
http://www.iaea.org/newscenter/news/2009/olivefruitfly.html (12/12/2010)
Iannotta N, 2003. La difesa fitosanitaria. In: Olea, tratatto di olivicoltura. pp. 393-410.
Fiorino, P. (ed.). Ed. Edagricole, Bologna (Italy)
Iannotta N, T Belfiore, ME Noce, L Perri and S Scalercio, 2006. Efficacy of products
allowed in organic olive farming against Bactrocera oleae (Gmel.). In: Procedings of
Olivebioteq 2006, Second International Seminar “Biotechnology and quality of olive
tree products around the Mediterranean Basin” [Mazara del Vallo, Marsala (Italia), 5-
10 de noviembre]. Vol. II. Caruso, T. y A. Motisi Eds.
http://orgprints.org/12896/1/Iannotta_Scalercio_et_al_2006h.pdf (23/12/2010)
Iannotta N, T Belfiore, ME Noce, S Scalercio and V Vizzarri, 2007a. Bactrocera oleae
(Gmelin) control in organic olive farming. B-economic aspects. Ecoliva 2007, VI
Jornadas Internacionales de Olivar Ecologico, Puente de Génave (Jaén)
http://www.ecoliva.info/index.php?option=com_content&task=blogcategory&id=17&I
temid=38. (24/11/2010)
Iannotta N, T Belfiore, ME Noce, S Scalercio and V Vizzarri, 2007b. The impact of some
compounds utilized in organic olive groves on the non-target arthropod fauna: Canopy
and soil levels. C-Ecological Aspects. Ecoliva 2007, VI Jornadas Internacionales de Olivar
Ecologico, Puente de Génave (Jaén) Organic eprints Web.
http://orgprints.org/12893/1/Ecolivaimpatto_def.pdf (24/11/2010).
Iannotta N, T Belfiore, ME Noce, S Scalercio and V Vizzarri, 2008. Environmental impact
of kaolin treatments on the arthropod fauna of the olive ecosystem. 16th IFOAM
Organic Worl Congress, Modena, Italy. June 16-20 2008.
http://orgprints.org/view/projects/conference.html (15/07/2010)
IEEP (Institute for European Environmental Policy), 2009. Environment and Health:
Compromise Reached on Pesticides Proposal.
http://www.ieep.eu/assets/692/9_January_2009_-_Environment_and_Health_-
_Pesticide_Agreement.pdf (20/03/2011)
IFOAM (International Federation of Organic Agriculture Movement), 2011. About the
International Federation of Organic Agriculture Movements (IFOAM).
http://www.ifoam.org/about_ifoam/index.html (16/03/2011)
References
167
IOBC (International Organisation for Biological and Integrated Control of Noxious
Animals and Plants), 2011. IOBC/WPRS IP & IPM.
http://www.iobc-wprs.org/ip_ipm/index.html (17/03/2011)
IOOC (International Olive Oil Council), 2011.
http://www.internationaloliveoil.org/estaticos/view/131-world-olive-oil-figures
(18/03/2011)
Iwema T, IML Billas, Y Beck, F Bonneton, H Nierengarten, A Chaumot, G Richards, V
Laudet and D Moras, 2007. Structural and functional characterization of a novel type of
ligand-independent RXR-USP receptor. The EMBO J 26: 3770-3782
Jacas JA, 1992. Desarrollo de un método normalizado para estudiar en laboratorio la
peligrosidad de las aplicaciones fitosanitarias sobre Opius concolor Szèpl.
(Hymenoptera: Braconidae), parasitoide de la mosca de la aceituna, Bactrocera oleae
(Gmel.) (Diptera, Tephritidae). Tesis doctoral. E.T.S.I.Agrónomos, Universidad
Politécnica de Madrid. 195 pp.
Jacas JA and E Viñuela, 1994: Analysis of a lab method to test the effects of pesticides on
adult females of Opius concolor, a parasitoid of the olive fruit fly Bactrocera oleae.
Biocontrol Sci. Technol. 4: 147-154.
Jacas JA, González-Núñez M and E Viñuela, 1995. Influence of the application method on
the toxicity of the moulting accelerating compound tebufenozide on adults of the
parasitic wasp Opius concolor Szèpl. Med Fac Landbouww Univ Gent 60/3b: 935-939
Jandel Scientific, 1994. TableCurve user’s manual. San Rafael, CA
Jiménez A, E Castillo and P Lorite, 1990. Supervivencia del himenóptero bracónido Opius
concolor Szèp. parásito de Dacus oleae Gmelin en olivares de Jaén. Bol San Veg Plagas
16:97-103
Jiménez A, JR Esteban, E Castillo, FJ Melero and M Avilés, 2002. Lucha integrada en el
olivar: ensayos en condiciones reales y nuevas metodologías. Jornadas Técnicas del
Aceite de Oliva, Madrid (España), 23-24 Abril 2002 5pp.
http://www.inia.es/gcontrec/pub/97023c201_1058521793859.pdf (15/03/2011)
References
168
Jorge S, JE Cabanas, JA Pereira, A Bento and L Torres, 2005. Efeito da criaçao de manchas
de vegetaçäo produtora de flores, na fauna auxiliar do olival. IV Congreso Nacional de
Entomología Aplicada. X Jornadas Científicas de la SEEA. Bragança (Portugal), 17-21
octubre 2005. (20/03/2011)
http://www.seea.es/laseea/reunion/IVcongreso/resumenesIVCongreso.pdf
Kahn A, T Schoenwald and B Beers, 2001. Effect of kaolin (Sourrond) on western
tentiform leafminer and its principal parasitoid, Pnigalio flavipes. Proceedings of the
75th Annual Western Orchard Pest & Disease Management Conference 10-12 January
2001, pp. 38-39 Biological Control. (02/02/2011)
http://forestcat.tfrec.wsu.edu/bugguys/wopdmc/portlandPDFs/BiologicalKahn41.pdf
Kakani EG, NE Zygouridis, KT, Tsoumani, N Seraphides, FG Zalom and KD Mathiopoulos,
2010. Spinosad resistance development in wild olive fruit fly Bactrocera oleae (Diptera:
Tephritidae) populations in Califormina. Pest Manag Sci 66: 447-453
Kapatos E, BS Fletcher, S Pappas and Y Laudeho, 1977. The release of Opius concolor and
O. concolor var. siculus (Hym.: Braconidae) against the spring generation of Dacus
oleae (Dipt.: Trypetidae) on Corfu. Biocontrol 22 (3): 256-270
Kasuya A, Y Sawada, Y Tsukamoto, K Tanaka, T Toya and M Yanagi, 2003. Binding mode
of ecdysone agonists to the receptor: comparative modeling and docking studies. J Mol
Model 9: 58-65
Khan M, MA Hossain and MS Islam, 2007. Effects if neem leaf dust and a commercial
formulation of a neem compound on the longevity, fecundity and ovarian
development of the melon fly, Bactrocera cucurbitae (Coquillett) and the oriental fruit
fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). J Biol Sci 10(20): 3656-3661
Khan MR and MR Khan, 2002. Mass rearing of Menochilus sexmaculatus Fabricius
(Coleoptera: Coccinellidae) on natural and artificial diets. Int J Agri Biol 4: 107-109
Kimani-Njogu SW, MK Trostle, RA Wharton, JB Woolley and A Raspi, 2001. Biosistematics
of the Psyttalia concolor species complex (Hymenoptera: Braconidae: Opiinae): the
identity of populations attacking Ceratitis capitata (Diptera: Tephritidae) in coffee in
Kenya. Biol Control 20: 167-174
Knight AL, TR Unruh, BA Christianson, GJ Puterka and DM Glenn, 2000. Effects of a
kaolin-based particle film on obliquebanded leafroller (Lepidoptera: Tortricidae).
Horticultural Entomol 93 (3): 744-749
References
169
Koelle MR, WS Talbot, WA Segraves, MT Bender, P Cherbas and DS Hogness, 1991. The
Drosophila EcR gene encodes an ecdysone receptor, a new member of the steroid
receptor superfamily. Cell 67: 59-77
Kourdoumbalos AK, JT Margaritopoloulos, GD Nanos and JA Tsitsipis, 2006. Alternative
aphid control methods for peach production. J Fruit and Ornamental Plant Research.
14 (Suppl. 3): 181-190
Krieger E, G Koraimann and G Vriend, 2002. Increasing the precision of comparative
models with YASARA NOVA - a self-parameterizing force field. Proteins 47: 393-402
Laffranque JP, SW Shires and N Phillips, 2009. Kaolin: Barriere minerale protective contre
le psylle du porier et d’autres ravageurs. AFPP-7ème Conference Internationale sur les
ravageurs en agriculture (Montpellier-26-27 octobre 2005).
http://www.cabi.org/cabdirect/FullTextPDF/2009/20093018722.pdf (19/04/2010)
Larentzaki E, AM Shelton and J Plate, 2008. Effect of kaolin particle film on Thrips tabaci
(Thysanoptera: Thripidae), oviposition, feeding and development on onions: a lab and
a field case study. Crop Prot 27: 727-734
Larkin MA, G Blackshields, NP Brown, R Chenna, PA McGettigan, H McWilliam, F
Valentin, IM Wallace, A Wilm, R Lopez, JD Thompson, TJ Gibson and DG Higgins, 2007.
CLUSTALW and CLUSTALX Version 2. Bioinformatics 23: 2947-2948
Laskowski RA, MW MacArthur, DS Moss and JM Thornton, 1993. PROCHECK: a program
to check the stereochemistry of protein structures. J Appl Cryst 26: 283-291
Lawrence PO, 1993. Egg development in Anastrepha suspensa: influence of the
ecdysone agonist, RH-5849. pp 51-56. Fruit Flies: Biology and Management In: Fruit
flies: recent advances in research and control programs. Aluja M and P Liedo (Eds).
New York: Springer Verlag.
Legaspi JC, BC Legaspi and RR Saldaña, 1999. Laboratory and field evaluations of
biorational insecticides against the Mexican rice borer (Lepidoptera: Pyralidae) and a
parasitoid (Hymenoptera: Braconidae). J Econ Entomol 92 (4): 804-810
Liang G and TX Liu, 2002. Repellency of kaolin particle film, surround, and a mineral oil,
sunspray oil, to silverleaf whitefly (Homoptera: Alerodidae) on melon in the laboratory.
J Econ Entomol 95 (2): 317-324
References
170
Liaropoulos C, VG Mavraganis, T Broumas and N Ragoussis, 2005. Field tests on the
combination of mass trapping with the release parasite Opius concolor (Hymenoptera:
Braconidae), for the control of the olive fruit fly Bactrocera oleae; (Diptera:
Tephritidae). pp. 77-81. In: “Proceedings of the European Meeting of the IOBC/WPRS
Working Group "Integrated Protection of Olive Crops" (Chania, Grecia, 29-31 de mayo
de 2003) Kalaitzaki A, V Alexandrakis and K Varikou (eds.) OILB, Gante (Bélgica)
Lo Verde G, R Rizzo, G Barranco and A Lombardo, 2011. Effects of kaolin on Ophelimus
maskelli (Hymenoptera: Eulophidae) in laboratory and nursery experiments. J Econ
Entomol 104 (1): 180-187
Lombardo N, 2003. Aspetti generali dell´olivicoltura. pp. 3-12. In: Olea, tratatto di
olivicoltura. Fiorino P (ed.). Ed. Edagricole, Bologna (Italy)
Loni A, 1997. Developmental rate of Opius concolor (Hym. Braconidae) at various
constant temperatures. Entomophaga 42 (3): 359-366
Loni A and A Canale, 2005/2006. Reproductive success of Psyttalia concolor (Szépligeti)
(Hymenoptera: Braconidae) on different hosts. Frustula Entomologica 28/29:166-171
Malavolta C, G Delrio and EF Boller, 2002. Guidelines for Integrated Production of Olives.
Technical Guideline III. IOBC/wprs Bull. 25(4): 27-35
Markó V, LHM Blommer, S Bolya and H Helsen, 2006. The effect of kaolin treatments on
phytophagous and predatory arthropods in the canopies of apple trees. J Fruit
Ornamental Plant Research 14 (3): 79-87
Markó V, LHM Blommer, S Bolya and H Helsen, 2008. Kaolin particle films suppress many
apple pests, disrupt natural enemies and promote woolly apple aphid. J Appl Entomol
132: 26–35
MARM (Ministry of the Environmental and Rural and Marine Environs; Ministerio de
Medio Ambiente y Medio Rural y Marino), 2004a. Producción Integrada. Logotipo.
Identificación de garantía nacional. Orden APA/1/2004. RD 1201/2002 España
http://www.mapa.es/es/agricultura/pags/ProduccionIntegrada/logotipo.htm
(18/03/2011)
MARM, 2004b. Producción Integrada. Logotipo. Identificaciones de garantía
autonómicas.
http://www.mapa.es/agricultura/pags/ProduccionIntegrada/varios/LOGOS-PI-
autonomicos.pdf (18/03/2011)
References
171
MARM, 2006. Plan Integral de Actuaciones para el Fomento de la Agricultura Ecológica
2007-2010. http://www.mapa.es/alimentacion/pags/ecologica/pdf/plan_integral.pdf
(04/02/2011)
MARM, 2007. Plan Integral de Actuaciones para el fomento de la agricultura ecológica.
2007-2010. http://www.mapa.es/es/alimentacion/pags/ecologica/plan_integral.htm
(04/02/2011)
MARM, 2011a. Encuesta sobre superficies y rendimientos de cultivos. Resultados
nacionales y autonómicos (ESYRCE) 2011.
http://www.marm.es/estadistica/temas/encuesta-sobre-superficies-y-rendimientos-
de-cultivos-esyrce/ESPANAYCCAA_tcm7-182430.p (07/02/2012)
MARM, 2011b. Avances. Superficies y producciones agrícolas. Noviembre 2011
http://www.marm.es/estadistica/temas/avances-de-superficies-y-producciones-de-
cultivos/cuaderno-Noviembre2011-tcm7-189152.pdf (11/02/2012)
MARM, 2011c. Registro de Productos Fitosanitarios. Actualización de datos: 14 de
diciembre de 2011.
http://www.magrama.es/es/agricultura/temas/medios-de-produccion/productos-
fitosanitarios/fitos.asp (11/02/2012)
MARM, 2011d. La agricultura ecológica en España.
http://www.mapa.es/es/alimentacion/pags/ecologica/introduccion.htm (18/03/2011)
MARM, 2011e. Resumen de los datos de producción integrada durante el año 2010.
http://www.mapa.es/agricultura/temas/produccion-integrada/resultados-2010-v3-
tcm7-1282.pdf (03/10/2011)
MARM, 2011f. Encuesta producción integrada a las Comunidades Autónomas Marzo
2011. Cultivos contemplados en el marco legislativo de las Comunidades Autónomas.
http://www.marm.es/es/agricultura/temas/produccion-
integrada/Resultados_Estadistica_2010_tcm7-1279.pdf (21/12/2011)
Mazor M and A Erez, 2004. Processed kaolin fruits from Mediterranean fruit fly
infestations. Crop Prot 23: 47-51
Medina P, G Smagghe, F Budia, P Del Estal, L Tirry and E Viñuela, 2002. Significance of
penetration, excretion, and transovarial uptake to toxicity of three insect growth
regulators in predatory lacewings adults. Arch Insect Biochem Physiol 51: 91-101
References
172
Melo F and E Feytmans, 1998. Assessing protein structures with a non-local atomic
interaction energy. J Mol Biol 277: 1141-1152
Michaud JP and AK Grant, 2003. Sub-lethal effects of a copper sulphate fungicide on the
development and reproduction in three coccinellid species. J Insect Sci 3:16
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC524656/pdf/i1536-2442-003-16-
0001.pdf. (25/03/2011)
Miranda MA, M Miquel, J Terrasa, N Melis and M Monerris, 2008. Parasitism of
Bactrocera oleae (Diptera; Tephritidae) by Psyttalia concolor (Hymenoptera;
Braconidae) in the Balearic Isands (Spain). J Appl Entomol 132: 798-805
Mommaerts V, G Sterk and G Smagghe, 2006. Bumblebees can be used in combination
with juvenile hormone analogues and ecdysone agonists. Ecotoxicology 15: 513–521
Montiel-Bueno A and O Jones, 2002. Alternative methods for controlling the olive fly,
Bactrocera oleae, involving semiochemicals. IOBC/wprs Bull. 25: 1-11
Moretti R, E Lampazzi, P Reina and M Calvitti, 2007. On the use of the exotic oo-pupal
parasitoid Fopius arisanus for the biological control of Bactrocera oleae in Italy.
IOBC/wprs Bull. 30 (9): 49-60
Moya P, S Flores, I Ayala, J Sanchis, P Montoya and J Primo. 2010. Evaluation of
lufenuron as a chemosterilant against fruit flies of the genus Anastrepha (Diptera:
Tephritidae). Pest Manag Sci 66 (6): 657-663
Murali-Baskaran RK and K Suresh, 2007. Influence of semi-synthetic diets and non-living
substrata on fecundity of Black beetle, Chilocorus nigrita (Fabricius) (Coleoptera:
Coccinellidae). J Entomol Res 31 (3): 243-246
Nadel DJ and S Biron, 1964. Laboratory studies and controlled mass rearing of Chilocorus
bipustulatus Linn., a citrus scale predator in Israel. Rivista di Parassitologia 25 (3): 195-
206
Nakagawa Y, 2005. Nonsteroidal ecdysone agonists. Vitam. Horm. 73: 131-173.
Obrycki JJ and TJ Kring, 1998. Predaceous coccinellidae in biological control. Annu Rev
Entomol 43: 295-321
Navrozidis EI and ME Tzanakakis, 2005. Tomato fruits as an alternative host for a
laboratory strain of the olive fruit fly Bactrocera oleae. Phytopasasitica 33 (3): 225-236
References
173
OJEU (Official Journal of the European Union), 2007. Council Regulation (EC) 834/2007 of
28 June, 2007 on organic production and labelling of organic products and repealing
Regulation (EEC) No 2092/91.
http://eur-
Lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2007:189:0001:0023:EN:PDF.
OJEU 20-07-2007 (15/12/2011)
OJEU (Official Journal of the European Union), 2009a. Regulation of the European
Parliament and the Council of 21 October 2009 concerning the placing of plant
protection products on the market, repealing the Council Directives 97/117/EEC and
91/414/EEC.
http://eur-
Lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2009:309:0001:0050:EN:PDF
(25/11/2011)
OJEU (Official Journal of the European Union), 2009b. Directive 2009/128/EC of the
European Parliament and the Council of 21 October 2009, establishing a framework for
Community action to achieve the sustainable use of pesticides. http://eur-
lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2009:309:0071:0086:EN:PDF
(25/11/2011)
Omkar and A Pervez, 2003. Ecology and Biocontrol Potential of a Scale-Predator,
Chilocorus nigritus. Review. Biocontrol Sci Technol 13(4): 379-390
Orenga S and J Giner, 1998. Importancia de los elementos secundarios en la vecería del
olivar. IX Symposium Internacional. La Sanidad del Olivar en Países del Mediterráneo.
Phytoma España 102: 61-64
Pajarón M, 2007. El olivar ecológico: aprender a observar el olivar y comprender sus
procesos vivos para cuidarlo. La Fertilidad de la Tierra y Ministerio de Agricultura,
Pesca y Alimentación (eds). Navarra (Spain). 153 pp
Palomar C, 2009. La Directiva de uso sostenible de productos fitosanitarios. Phytoma
España 206 (2): 16-17
Pascual S, G Cobos, E Seris and M González-Núñez, 2010a. Effects of processed kaolin on
pests and non-target arthropods in a Spanish olive grove. J Pest Sci 83: 121-133
References
174
Pascual S, I Sánchez-Ramos and M González-Núñez, 2010b. Repellent/deterrent effect of
kaolin and copper on Bactrocera oleae oviposition in the laboratory. IOBC/wprs Bull
59: 83-88
Pasqualini E, S Civolani and LC Grappadelli, 2003. Particle film technology: approach for
biorational control of Cacopsylla pyri (Rhynchota Psyllidae) in north Italy. Bull. Insectol.
55: 39–42
Paul A, LC Harrington and JG Scott, 2006. Evaluation of novel insecticides for control
dengue vector Aedes aegypti (Diptera: Culicidae). J Med Entomol 43(1): 55-60
Pemberton CE and HF Willard, 1918. A contribution to the biology of fruit fly parasites in
Hawaii. J Agr Res 15:419-466
Peng L, JT Trumble, J Munyaneza and TX Liu, 2011. Repellency of kaolin particle film to
potato psyllid, Bactericera cockerelli (Hemiptera: Psyllidae), on tomato under
laboratory and field conditions. Pest Manag Sci 67: 815-824
Pennino G, G Pane, G Raiti, E Perri, MA Carovita, B Macchione, P Tucci, P Socievole, M
Pellegrino, D Cartabellotta and V Di Martino. 2006. Three years field trials to assess the
effect of kaolin made particles and copper on olive-fruit fly (B.oleae Gmelin)
infestations in Sicily. Second International Seminar "Biotechnology and Quality of Olive
tree Products around the Mediterranean Basin", Marsala - Italy, November 5-10, 2006.
In: Proceedings, DCA - Università di Palermo; Regione Siciliana - Assessorato
Agricoltura e Foreste, II, pp. 303-306. http://orgprints.org/14278/ (08/06/2010)
Perri E, N Iannotta, I Muzzalupo, A Russo, MA Caravita, M Pellegrino, A Parise and P
Tucci, 2007. Kaolin protects olive fruits from Bactrocera oleae (Gmelin) infestations
unaffecting olive oil quality. IOBC/WPRS Bull 30 (9): 153
Peters A, 1996. Prospects for the use of biological control agents to control fruit flies, pp.
199-204. In: Fruit flies in the Pacific. A regional Symposyum. Nadi, Fiji, 28-31 October,
1996. Allwood AJ and RAI Drew, (eds). ACIAR Proceedings 76, 267 pp
http://aciar.gov.au/files/node/550/PR%2076%20Fruit%20Flies.pdf#page=199
(15/03/2011)
Phillps N and M De la Roca, 2003. Empleo de una capa protectora de partículas como
método de control físico de la mosca del olivo (Bactrocera oleae) y generación
carpófaga de prays (P. oleae) en el olivar tradicional.
http://www.expoliva.com/expoliva2003/simposium (08/02/2009)
References
175
Pinder JE III, JG Wiener and MH Smith, 1978. The Weibull distribution: a new method of
summarizing survivorship data.Ecology 59: 175-179
Ponsonby DJ and MJW Copland, 1995. Olfatory responses by the scale insect predator
Chilocorus nigritus (F.) (Coleoptera: Coccinellidae). Biocontrol Sci Technol 5: 83-93
Ponsonby DJ and MJW Copland, 1996. Effect of temperature on development and
immature survival in the scale insect predator, Chilocorus nigritus (F.) (Coleoptera:
Coccinellidae). Biocontrol Sci Technol 6: 101-109
Ponsonby DJ and MJW Copland, 1998. Environmental influences on fecundity, egg
viability and egg cannibalism in the scale insect predator Chilocorus nigritus. BioControl
43: 39-52
Ponsonby DJ and MJW Copland, 2000. Maximum feeding potential of larvae and adults
of the scale insect predator Chilocorus nigritus with a new method of estimating food
intake. BioControl 45: 295-310
Ponsonby DJ, 2009. Factors affecting utility of Chilocorus nigritus (F.) (Coleoptera.
Coccinellidae) as a biocontrol agent. CAB Reviews: Perspectives in Agriculture,
Veterinary Science, Nutrition and Natural Resources 4 (46): 1-20
Porcel M, B Costes and M Campos, 2011. Biological and behavioural effects of kaolin
particle film on larvae and adults of Chrysoperla carnea (Neuroptera: Chrysopidae).
Biol Control http://dx.doi.org/10.1016/j.biocontrol.2011.07.011
Puterka GJ, DM Glenn, DG Sekutowski, TR Unruh and SK Jones, 2000. Progress toward
liquid formulations of particle films for insect and disease control in pear. Environm
Entomol 29 (2): 329-339
Quarles W, 1992. Diatomaceous earth for pest control. The IPM Practitioner. Monitoring
the field for pest management XIV (5/6). 16 pp.
http://www.freshwaterorganics.com/DE%20Pest%20Control.pdf (26/10/2011)
Ragusa S, 1974. Influence of temperature on the oviposition rate and longevity of Opius
concolor siculus (Hymenoptera: Braconidae). Entomophaga 19: 61-66
Rallo L, 1998. El olivar y la innovación tecnológica. IX Symposium Internacional. La
Sanidad del Olivar en Países del Mediterráneo. Phytoma España 102: 6-8
Ramesh-Babu T and KM Azam, 1987. Toxicity of different fungicides to adult
Cryptolaemus montrouzieri Mulsant (Coleoptera: Coccinellidae). Crop Protection 6(3):
161-162
References
176
Rapoport HF, 2008. Botánica y morfología. In: El cultivo del olivo, pp. 37-62. Barranco D,
R Fernández-Escobar and L Rallo (eds.) 6ª ed. revisada y ampliada. Junta de Andalucía y
Ediciones Mundiprensa. Madrid (Spain)
Richardson GH and LH Glover, 1932. Some effects of certain “inert” and toxic substances
upon the 12-spotted cucumber beetle, Diabrotica duodecempunctata (Fab.) J Econ
Entomol 25: 1176-1181
Romero A, L Rosell, E Martí and J Tous, 2006. Aplicación del caolín como tratamiento
fitosanitario en el cultivo ecológico del olivo en la comarca del Priorato (Tarragona).
DARP FITXA 02. Producción Agraria Ecológica 1-10. Generalitat de Catalunya.
Departament d´Agricultura, Ramaderia i Pesca
http://www20.gencat.cat/docs/DAR/AL_Alimentacio/AL01_PAE/06_Publicacions_mat
erial_referencia/Fitxers_estatics/fitxa_caoli.pdf (20/01/2011)
Rosi MC, P Sacchetti, M Librandi and A Belcari, 2007. Effectiveness of different copper
products against the olive fly in organic olive groves. Integrated protection of olive
crops. IOBC/wprs Bull. 30 (9): 277-281
Rotundo G and A De Cristofaro, 2003. Fitofagi dell´olivo. pp. 411-436. In: Olea, trattato
di olivicoltura. Fiorino, P. (ed.). Ed. Edagricole, Bologna (Italy)
Rozen S and HJ Skaletsky, 2000. Primer3 on the WWW for general users and for biologist
programmers. Methods Mol Biol 132: 365-386
Rugman-Jones PF, R Wharton, T van Noort and R Stouthamer, 2009. Molecular
differenciation of the Psyttalia concolor (Szépligeti) species complex (Hymenoptera:
Braconidae) associated with olive fly, Bactrocera oleae (Rossi) (Diptera: Tephritidae), in
Africa. Biol Control 49: 17-26
Ruiz-Torres MJ and A Montiel-Bueno, 2007. Eficacia de los tratamientos mediante
árboles-cebo contra la mosca del olivo (Bactrocera oleae, Gmel; Tephritidae, Diptera)
en la provincia de Jaén. Bol San Veg Plagas 33(2): 249-265
Ruiz-Torres MJ, 2009. El nuevo escenario europeo de pesticidas en el olivar. Vida Rural.
283: 24-26
Saavedra M, 1998. Demografía de los herbazales del olivar y manejo de la flora
espontánea. IX Symposium Internacional. La Sanidad del Olivar en Países del
Mediterráneo. Phytoma España 102: 74-76
References
177
Sackett TE, CM Buddle and C Vicent, 2005. Effect of kaolin on fitness and behavior of
Choristoneura rosaceana (Lepidoptera: Tortricidae) larvae. J Econ Entomol 98 (5):
1649-1653
Sackett TE, CM Buddle and C Vincent, 2007. Effects of kaolin on the composition of
generalist predator assemblages and parasitism of Choristoneura rosaceana (Lep.,
Tortricidae) in apple orchards. J Appl Entomol 131(7): 478-485
Samways MJ, 1984. Biology and economic value of the scale predator Chilocorus nigritus
(F.) (coccinellidae). Review article. Biocontrol News Inf. 5(2): 91-105
Samways MJ and BA Tate, 1984. Sexing of Chilocorus nigritus (F.) (Coccinellidae). The
Citrus and Subtropical Fruit J. 607: 4-5
Samways MJ and BA Tate, 1986. Mass-rearing of the scale predator Chilocorus nigritus
(F.) (Coccinellidae). Citrus and Subtropical Fruit J. 630: 9-14
Sánchez-Ramos I, M González-Núñez and S Pascual (2011). Efecto de reguladores del
crecimiento de insectos (RCI) sobre la reproducción y la longevidad de la mosca del
olivo, Bactrocera olae (Rossi) (Diptera: Teprhitidae). VII Congreso Nacional de
Entomología Aplicada. 24-28 October. Baeza, Spain: 182
http://www.ujaen.es/congreso/entomologia/Documentos/LibroResumenes.pdf
(13/12/2011)
Santos SAP, JA Pereira and AJA Nogueira, 2010. Response of coccinellid community to
the dimethoate application in olive groves in northeastern Portugal. Span J Agric Res 1:
126-134
Saour G and H Makee, 2004. A kaolin based particle film for supression of the olive fruit
fly Bactrocera oleae Gmelin (Dip., Tephritidae) in olive groves. J Appl Entomol 128:28-
31.
Saour, G., 2005. Efficacy of kaolin particle film and selected synthetic insecticides against
pistachio psyllid Agonoscena targionii (Homoptera: Psyllidae) infestation. Crop Prot 24:
711-717
Scalercio S, T Belfiore, ME Noce, V Vizzarri and N Iannotta, 2009. The impact of
compounds allowed in organic farming on the above-ground arthropods of the olive
ecosystem. Bull Insectol 62 (2): 137-141
References
178
Schneider MI, G Smagghe amd E Viñuela, 2003. Susceptibility of Hyposoter didymator
(Hymenoptera: Ichneumonidae) adults to several insect growth regulators and
spinosad by different exposure methods. IOBC/wprs Bull 26 (5): 111-122
Schneider MI, G Smagghe, S Pineda and E Viñuela, 2008. The ecological impact of four
IGR insecticides in adults of Hyposoter didymator (Hym., Ichneumonidae):
pharmacokinetics approach. Ecotoxicology 17: 181-188
Showler A, 2003. Effects of kaolin particle film on beet armyworm, Spodoptera exigua
(Hübner) (Lepidoptera: Noctuidae), oviposition, larval feeding and development on
cotton, Gossypium hirsutum L. Agr Ecosyst Environ 95: 265-271
Showler AT and M Sétamou, 2004. Effects of kaolin particle film on selected arthropod
populations in cotton in the lower Rio Grande Valley of Texas. Sothwest Entomol 29
(2): 137-146
Showler AT and JS Armstrong, 2007. Kaolin particle films associated with increased
cotton aphid infestations in cotton. Entomol Exp. Appl. 124: 55-60
Silva RA, GA Carvalho, CF Carvalho, PR Reis, AMAR Pereira and L Cosme, 2005.
Toxicidade de produtos fitossanitarios utilizados na cultura do cafeeiro a larvas de
Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e efeitos sobre as fases
subseqüentes do desenvolvímento do predador. Neotrop Entomol 34 (6): 951-959
Sime KR, KM Daane, RH Messing and MW Johnson, 2006. Comparison of two laboratory
cultures of Psyttalia concolor (Hymenoptera: Braconidae), as a parasitoid of the olive
fruit fly. Biol Control 39: 248-255
Singh S, 2003. Effects of aqueous extract of neem seed kernel and azadirachtin on the
fecundity, fertility and post-embryonic development of the melon fly, Bactrocera
cucurbitae and the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae). J Appl
Entomol 127: 540-547
Sisterson MS, YB Liu, DL Kerns and BE Tabashnik, 2003. Effercts of kaolin particle film on
oviposition, larval mining, and infestation of cotton by pink bollworm (Lepidoptera:
Gelechiidae). J Econ Entomol 96 (3): 805-810
Skouras PJ, JT Margaritopoulos, NA Seraphides, IM Ioannides, EG Kakani, KD
Mathiopoulos and JA Tsitsipis. 2007. Organophosphate resistance in olive fruit fly,
Bactrocera oleae, populations in Greece and Cyprus. Pest Manag Sci 63 (1): 42-48
References
179
Slobodkin LB, 1962. Growth and regulation of animal populations. Dover Publications,
Inc. New York. 184 pp.
Smagghe G and D Degheele, 1994a. Action of non-ecdysteroid mimic RH 5849 on larval
development and adult reproduction of insects of different orders. Invertebr Reprod
Dev 25 (3): 227-236
Smagghe G and D Degheele, 1994b. Action of a novel nonsteroidal ecdysteroid mimic,
tebufenozide (RH-5992), on insects of different orders. Pestic Sci 42: 85-92
Smagghe G and D Degheele, 1995. Selectivity of nonsteroidal ecdysteroid agonists RH
5849 and RH 5992 to nymphs and adults of the predatory soldier bugs, Podisus
nigrispinus and P. maculiventris (Hemiptera: Pentatomidae). J Econ Entomol 88: 40-45
Smagghe G, TS Dhadialla and M Lezzi, 2002. Comparative toxicity and ecdysone receptor
affinity of non-steroidal ecdysone agonists and 20-hydroxyecdysone in Chironomus
tentans. Insect Biochem Molec 32: 187-192
Smith HS, 1915. Recent ladybird introductions. Monthly Bulletin, California Commission
of Horticulture 4: 523-524
Southwood TRE, 1976. Ecological methods. Chapman and Hall. London. 524 pp.
STSC, 1987. Statgraphics user’s guide, Version 5.1. Graphic software system, STSC,
Rockville, MD, USA
Szèpligeti GV, 1911. Einer neuer Sigalphus (Braconidae) aus Dacus oleae Gmel. Bol Lab
Zool Gen. Agr Portici 5: 223
Tamura K, J Dudley, M Nei and S Kumar, 2007. MEGA4: Molecular Evolutionary Genetics
Analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596-1599
Tohidi-Esfahani D, LD Graham, GN Hannan, AM Simpson and RJ Hill, 2011. An ecdysone
receptor from the pentatomorphan, Nezara viridula, shows similar affinities for
moulting hormones makisterone A and 20-hydroxyecdysone. Insect Biochem Molec
Biol 41(2): 77-89
Torrell A and B Celada, 1998. Nueva problemática fitosanitaria en las plantaciones
intensivas actuales: seguimiento de algunos fitófagos. IX Symposium Internacional. La
Sanidad del Olivar en Países del Mediterráneo. Phytoma España 102: 90-97
Trapero A and MA Blanco, 2008. Enfermedades. In: El cultivo del olivo, pp. 595-656.
Barranco D, R Fernández-Escobar and L Rallo (eds.) 6ª ed. revisada y ampliada. Junta
de Andalucía y Ediciones Mundiprensa. Madrid (Spain)
References
180
Trapero A, LF Roca, J Moral, FJ López-Escudero and MA Blanco, 2009. Enfermedades del
olivo. Phytoma España 209: 18-28
Tunaz H and K Uygun, 2004. Insect growth regulators for insect pest control. Turk J Agric
For 28: 377-387
Ulmer BJ, SL Lapointe, JE Peña and RE Duncan, 2006. Toxicity of pesticides used in citrus
to aprostocetus vaquitarum (Hymenoptera: Eulophidae), an egg parasitoid of
Diaprepes abbreviates (Coleoptera: Curculionidae). Florida Entomologist 89 (1): 10-19
Urbaneja A and JA Jacas, 2008. Tipos de control biológico y métodos para su
implementación. In: Control biológico de plagas agrícolas., pp. 15-24. Jacas JA and A
Urbaneja (eds.) Phytoma-España. Valencia (Spain)
Uygun N and Elekçioglu, 1998. Effect of three diaspididae prey species on the
development and fecundity of the ladybeetle Chilocorus bipustulatus in the laboratory.
BioControl 43: 153-162
Van de Veire M and L Tirry, 2003. Side effects of pesticides on four species of beneficials
used in IPM in glasshouse vegetable crops: “worst case” laboratory tests. IOBC/wprs
Bull 26(5): 41-50
Ventura P, N Pereira and L Oliveira, 2009. Side-effects of organic and synthetic pesticides
on cold stored diapausing prepupae of Trichogramma cordubensis. BioControl 54: 451-
458
Villanueva-Jiménez JA and MA Hoy, 1998. Toxicity of pesticides to the citrus leafminer
and its parasitoid Ageniapsis citricola evaluated to assess their suitability for an IPM
program in citrus nurseries. BioControl 43: 357-388
Vincent C, G Hallman, B Panneton and F Fleurat-Lessard, 2003. Management of
agricultural insects with physical control methods. Annu Rev Entomol 48: 261–281
Viñuela E and M Arroyo, 1983. Effect of nutrition on the susceptibility of Ceratitis
capitata Wied. (Dip: Tephritidae) adults to malathion. Influence of adult food,
physiological stage and age. Acta Oecológ Oecol Applic 4: 123-130
Viñuela E, P Medina, M Schneider, M González-Núñez, F Budia, A Adán and P del Estal,
2001. Comparison of side-effects of spinosad, tebufenozide and azadirachtin on the
predators Chrysoperla carnea and Podisus maculoventris and the parasitoids Opius
concolor and Hyposoter didymator under laboratpry conditions. IOBC/wprs Bull 24(4):
25-34
References
181
Wang XG, MW Johnson, KM Daane and H Nadel, 2009. High summer temperatures
affect the survival and reproduction of olive fruit fly (Diptera: Tephritidae).
Environmental Entomol 38 (5): 1496-1504
Washburn DG, TH Hoang, N Campobasso, A Smallwood, DJ Parks, CL Webb, KA Frank, M
Nord, C Duraiswami, C Evans, M Jaye and SK Thompson, 2009. Synthesis and SAR of
potent LXR agonists containing an indole pharmacophore. Bioorg Med Chem Lett 19:
1097-1100
Werren JH, S Richards, CA Desjardins, O Niehuis, J Gadau and JK Colbourne, 2010. The
Nasonia Genome Working Group. Functional and evolutionary insights from the
genomes of three parasitoid Nasonia species. Science 327: 343-348
Wurtz JM, B Guillot, J Fagart, D Moras, K Tietjen and M Schindler, 2000. A new model for
20-hydroxyecdysone and dibenzoylhydrazine binding: A homology modeling and
docking approach. Protein Sci 9: 1073-1084
Ye GY, SZ Dong, H Dong, C Hu, ZC Shenn and JA Cheng, 2009. Effects of host
(Boettcherisca peregrina) copper exposure on development, reproduction and
vitellogenesis of the ectoparasitic wasp, Nasonia vitripennis. Insect Sci 16: 43-50
Yee Wl, 2007. Effects of several newer insecticides and kaolin on oviposition and adult
mortality in western cherry fruit fly (Diptera: Tephritidae). J Entomol Sci 43 (2): 177-
190
Yee WL, 2010. Behavioral responses by Rhagoletis indifferens (Dip. Tephritidae) to sweet
cherry treated with kaolin- and limestone-based products. J Appl Entomol doi:
10.1111/j.1439-0418.2010.01603.x
Yokoyama VY, PA Rendón and J Sivinski, 2008. Psyttalia cf. concolor (Hymenoptera:
Braconidae) for biological control of olive fruit fly (Diptera: Tephritidae) in California.
Environ. Entomol. 37:764-773
Youssef AI, FN Nasr, SS Stefanos, SSA Elkhair, WA Shehata, E Agamy, A Herz and SA
Hassan, 2004. The side-effects of plant protection products used in olive cultivation on
the hymenopterous egg parasitoid Trichogramma cacoecidae Marchal. J Appl Entomol
128 (9-10): 593-599
References
182
Appendix
183
Appendix
INDEX OF FIGURES Chapter 1:
Figure 1: An olive grove in Castile-La Mancha 1
Figure 2: Female of B. oleae 10
Figure 3: Detail of a B. oleae larva in an olive fruit. Microorganism growth can be observed in the feeding gallery 12
Figure 4: Adult of P. oleae 14
Figure 5: S. oleae adult females 15
Figure 6: Olive leaf spot 16
Figure 7: National and Autonomous Integrated Protection logos 21
Figure 8: Spanish, Autonomous Communities and European Union logos. Certification for European organic products (ECO CERT, SHC) 23
Figure 9: P. concolor female 30
Figure 10: C. nigritus adults 35
Figure 11: C. nigritus larva 36
Chapter 3:
Figure 12: Cage of C. capitata adults’ rearing 45
Figure 13: P. concolor adults’ cage 47
Figure 14: Temptative C. nigritus rearing established in the laboratory 48
Figure 15: A. nerii rearing. Infested and uninfested butternuts and potatoes are placed on wire baskets 49
Figure 16: Fungal contamination of B. oleae artificial diet 51
Figure 17: Methacrylate cages where third-instar larvae of B. oleae were collected when they jumped from the olive fruits 51
Figure 18: Round plastic cages used in the experiments 53
Figure 19: Cages used to evaluate beneficial capacity of P. concolor 54
Figure 20: C. capitata larvae transferred into Petri dishes after 1hour of exposure to P. concolor females 55
Appendix
184
Chapter 4:
Figure 21: Chemicals used in the experiments 61
Figure 22: Kaolin-coated olive tree 62
Figure 23: Olive tree leaves and fruits covered by copper 64
Figure 24: Residual contact on glass surfaces test. C. nigritus cages have been mounted in the climatic chamber. The forced ventilation system is also observed 66
Figure 25: Pesticide solutions in the glass vials and plastic stoppers with the diet 67
Figure 26: Testing of the effects when products are ingested 68
Figure 27: Treatment of pupae using hand sprayers 69
Figure 28: Treatment of the meshes through which P. concolor females parasitize 70
Figure 29: Treatment of olive tree leaves 71
Figure 30: Detail of kaolin-treated leaves in the plastic cages 72
Figure 31: Olive tree leaves and parasitization surface treated 72
Figure 32: Olive tree in the wooden cage. Glass vials and stoppers can also be observed 73
Figure 33: Semi field experiment in the greenhouse. In the top of the wooden frames, the sand bags used to prevent C. capitata larvae from jumping when P. concolor females are parasitizing can be observed 74
Figure 34: Dual choice and no-choice experiments. C. capitata larvae were offered either on the top and the floor of the parasitization cages. The small plastic stopper placed on the top of the cages to prevent larvae from jumping and escaping is apparent 75
Figure 35: Detail of P. concolor females parasitizing through the bottom mesh of the cages 76
Figure 36: Experimental units: plastic cages covered with a piece of mesh held with a rubber band and binder clips 77
Figure 37: No-choice experiment: controls. The non-infested butternut is on the left of the picture and the infested one is on the right. Butternuts are placed on egg boxes. In the middle of the cage there is a glass vial with distilled water, a plastic stopper with E. kuehniella eggs and a piece of the semi-solid diet 78
Figure 38: No-choice experiments: kaolin replicates (non-infested butternut on the left and the infested one on the right) 78
Figure 39: Dual choice experiment (on the left, the infested butternut; on the right the non-infested one). Half of the butternut was treated with kaolin and the other half with distilled water 78
Figure 40: Detail of a kaolin-treated butternut. C. nigritus adults can be observed on the treated surface 78
Figure 41: Percentage of P. concolor and C. nigritus mortality 72 hours after different treatments. Asterisks indicate statistical differences between the treatments and the control (P < 0.05) 80
Appendix
185
Figure 42: Life span (number of days) of P. concolor when oral toxicity and treatment of pupae were evaluated. Asterisks indicate statistical differences between the treatments and the control (P < 0.05) 81
Figure 43: C. nigritus life span (number of days) during the residual contact on a glass surface and the extended laboratory experiments. Asterisks indicate statistical differences between the treatments and the control (P < 0.05) 81
Figure 44: Survival probability of C. nigritus adults (Series 1) and line of best fit by Weibull function (Series 2) at the different treatments on the residual contact on glass surfaces experiment 83
Figure 45: Survival probability of C. nigritus adults (Series 1) and line of best fit by Weibull function (Series 2) at the different treatments on the extended laboratory experiment 83
Figure 46: Percentages of P. concolor emergence from treated pupae. Asterisks indicate statistical differences between the treatments and the control (P < 0.05) 84
Figure 47: Percentage of P. concolor attacked host in different experiments. Asterisks indicate statistical differences between the treatments and the control (P < 0.05) 85
Figure 48: Percentage of P. concolor progeny size in different experiments 86
Figure 49: Percentage of P. concolor attacked hosts in the experiment in which females had to parasitize throughout a treated surface and in the experiment in which also treated olive tree leaves are placed into the parasitization cages. The differences between the beginning of the two experiments (treated materials) and the end (untreated meshes and no olive trees, in the second case) have also been compared. Asterisks indicate statistical differences between the treatments and the control (P < 0.05) 87
Figure 50: Percentage of P. concolor progeny size in the experiment in which females had to parasitize throughout a treated surface and in the experiment in which also treated olive tree leaves are placed into the parasitization cages. The differences between the beginning of the two experiments (treated materials) and the end (untreated meshes and no olive trees, in the second case) have also been compared 87
Figure 51: Percentage of P. concolor attacked hosts in the dual choice experiment. Asterisks indicate statistical differences between the treatments and the control (P < 0.05) 89
Figure 52: Percentage of P. concolor attacked hosts in the dual choice and no-choice experiments. With the aim of comparing experiments, in the dual choice assay all the kaolin treated and water treated surfaces have been grouped together. Asterisks indicate statistical differences between the treatments and the control (P < 0.05) 89
Figure 53: Percentage of P. concolor progeny size in the dual choice experiment. Asterisks indicate statistical differences between the treatments and the control (P < 0.05) 90
Appendix
186
Figure 54: Percentage of P. concolor progeny size in the dual choice and no-choice experiments. A With the aim of comparing experiments, in the dual choice assay all the kaolin treated and water treated surfaces have been grouped together 90
Figure 55: Daily fluctuation in the percentage of P. concolor attacked hosts in the no-choice experiment 91
Figure 56: Daily fluctuation in the percentage of P. concolor attacked hosts in the dual choice experiment 91
Figure 57: Dual choice experiment: percentages of C. nigritus adults placed in the infested butternuts, the non-infested ones or other parts of the experimental cages. Percentages were recorded during 4 days. “Water” means the half of the butternut treated with distilled water and “Kaolin” the other half, treated with kaolin 93
Figure 58: Percentages of C. nigritus adults placed in the infested butternuts, the non-infested ones or other parts of the experimental cages in the no-choice experiments. Percentages were recorded during 4 days. “Control” means the replicates in which both butternuts were treated with distilled water and “Kaolin” indicates the replicates in which both were treated with kaolin 93
Figure 59: Number of C. nigritus larvae found in the different replicates of each treatment. In the dual choice experiment, larvae on the butternuts were always observed on the non-treated parts of the butternuts. It can be observed the high percentage of dead larvae, especially on the kaolin treated butternuts 94
Chapter 5:
Figure 60: Modular structure (domains) of the insects’ ecdysone receptors 113
Figure 61: Insecticides tested in the experiments 115
Figure 62: PCR machine used in the experiments 116
Figure 63: Agarose gel with different PCR products loaded 116
Figure 64: Gel electrophoresis apparatus (an agarose gel is placed in the buffer-filled box and electrical field is applied via the power supply to the rear. The negative terminal is at the side of the apparatus closest to the tip box (colour blue), so DNA migrates toward it 117
Figure 65: Bio-Rad. Once the electrophoresis is completed, the molecules in the gel can be stained to make them visible. DNA can be visualized using ethidium bromide which, fluoresces under ultraviolet light, when intercalated into DNA. This apparatus is used to visualize DNA. Photographs of the gels can be taken using Gel Doc 117
Figure 66: Ethidium bromide-stained PCR products of the cloning (before and after purification) after gel electrophoresis (P. concolor) 120
Figure 67: Formed bacteria colonies on an ampicilin-containing LB agar plate (B. oleae) 120
Appendix
187
Figure 68: Ethidium bromide-stained plasmids after gel electrophoresis (P. concolor) 120
Figure 69: nucleotide and amino acid sequences of B. oleae and P. concolor 121
Figure 70: P. concolor ovaries 122
Figure 71: Percentage of mortality of B. oleae adults during the two performed experiments. Spintor-Cebo® was applied in the residual contact on glass surfaces experiment. Spintor 480 SC® was used for evaluating the oral toxicity. Asterisks indicate statistical differences between the treatments and the control within the same parameter evaluated (P<0.05) 125
Figure 72: Percentage of mortality of P. concolor females during the two performed experiments. Spintor-Cebo® was applied in the residual contact on glass surfaces experiment. Spintor 480 SC® was used for evaluating the oral toxicity. Asterisks indicate statistical differences between the treatments and the control within the same parameter evaluated (P<0.05) 126
Figure 73: Effects of methoxyfenozide, tebufenozide and RH-5849 on P. concolor beneficial capacity 126
Figure 74: Sequence alignment of ecdysone receptor ligand-binding domains (LBD), including BoEcR-LBD (Helix 1 to 8). In the following order: Heliothis, Chilo, Bombyx, Tribolium, Tenebrio, Leptinotarsa, Apis, Bombus, Psyttalia, Nilaparvata, Nezara, Bemisia, Drosophila, Calliphora, Aedes, Aedes, Chironomus, Culex, Bradisia, Anopheles, Ceratitis, Bactrocera 128
Figure 74 (continuation): Sequence alignment of ecdysone receptor ligand-binding domains (LBD), including BoEcR-LBD (Helix 9 to 12). In the following order: Heliothis, Chilo, Bombyx, Tribolium, Tenebrio, Leptinotarsa, Apis, Bombus, Psyttalia, Nilaparvata, Nezara, Bemisia, Drosophila, Calliphora, Aedes, Aedes, Chironomus, Culex, Bradisia, Anopheles, Ceratitis, Bactrocera 129
Figure 75: Sequence alignment of ecdysone receptor ligand-binding domains (LBD), including PcEcR-LBD (Helix 1 to 5). In the following order: Drosophila, Aedes, Ceratitis, Bombyx, Junonia, Bicyclus, Tribolium, Tenebrio, Leptinotarsa, Apis, Polistes, Nasonia, Acromyrmex, Camponotus, Bombus, Solenopsis, Pheidole, Psyttalia, Nezara, Bemisia, Nilaparvata 131
Figure 75 (continuation): Sequence alignment of ecdysone receptor ligand-binding domains (LBD), including PcEcR-LBD (Helix 6 to 12). In the following order: Drosophila, Aedes, Ceratitis, Bombyx, Junonia, Bicyclus, Tribolium, Tenebrio, Leptinotarsa, Apis, Polistes, Nasonia, Acromyrmex, Camponotus, Bombus, Solenopsis, Pheidole, Psyttalia, Nezara, Bemisia, Nilaparvata 132
Figure 76: Confirmation of the expression of the EcR in the ovaries of P.concolor 133
Figure 77: Phylogenetic trees of the EcR-LBD, including various insect species from several orders 134
Appendix
188
Figure 78: Overall 3D conformation of the modeled LBD domain of the EcR receptors from B. oleae (A), P. concolor (B), Drosophila melanogaster (C), H. viscerens (D) and T. castaneum (E), all in complex with ponasterona A (P1A) (colored stick). The twelve α-helices and the two-β strands are indicated. N and C consist of the N-terminal and C-terminal ends of the polypeptide chain, respectively 136
Figure 79: Clip view (dashed yellow line) of the ligand-binding pocket of the BoEcR-LBD (1A), PcEcR-LBD (1B), HvEcR-LBD (1C) and TcEcR-LBD (1D) harboring 20-hydroxyecdysone (20E) (pink stick). (E) Network of hydrogen bonds (dashed dark lines) anchoring 20E to the BoEcR-LBD (2A), PcEcR-LBD (2B), HvEcR-LBD (2C) and TcEcR-LBD (2D). Aromatic residues interacting with the ligand by stacking interactions are colored orange. In the figures A, residues are labeled according to the three-dimensional model built for the BoEcR-LBD. In figures B, C and D, residues are labeled according to the three-dimensional model built for the PcEcR-LBD 137
Figure 80: Clip view (dashed yellow line) of the ligand-binding pocket of the BoEcR-LBD (1A), PcEcR-LBD (1B), HvEcR-LBD (1C) and TcEcR-LBD (1D), harboring ponasterone A (PA1) (pink stick). Network of hydrogen bonds (dashed dark lines) anchoring P1A to the BoEcR-LBD (2A), PcEcR-LBD (2B), HvEcR-LBD (2C) and TcEcR-LBD (2D). Aromatic residues interacting with the ligand by hydrophobic interactions are colored orange. In the figures A, residues are labeled according to the three-dimensional model built for the BoEcR-LBD. In figures B, C and D, residues are labeled according to the three-dimensional model built for the PcEcR-LBD 138
Figure 81: Clip view of the ligand-binding pocket of the B. oleae BoEcR-LBD harboring tebufenozide (A), methoxyfenozide (B) and RH-5849 (C) (blue sticks). Note the steric clash () of tebufenozide and methoxyfenozide with the wall of the ligand-binding pocket (A and B). Note the very light steric hindrance () of the B-phenyl ring of RH-5849 with the wall of the ligand-binding pocket (C) 139
Figure 82: Clip view (dashed yellow line) of the ligand-binding pocket of the P. concolor PcEcR-LBD domain harboring tebufenozide (A), methoxyfenozide (B), RH-5849 (C) and halofenocide (D) (blue sticks). Note the steric conflicts (and ) of the four compounds with the wall of the ligand-binding pocket of PcEcR-LBD. Network of amino acid residues of PcEcR-LBD (E) interacting with tebufenozide by hydrogen bond (dashed blue line), and hydrophobic interactions. Hydrophobic and aromatic residues are colored orange 140
Appendix
189
Figure 83: Clip view (dashed yellow line) of the ligand-binding pocket of the T. castaneum TcEcR-LBD domain (A) and the H. virescens HvEcR-LBD domain (B) harboring tebufenozide. Network of amino acid residues of TcEcR-LBD (C) and HvEcR-LBD (D) interacting with tebufenozide by hydrogen bond (dashed blue line) and hydrophobic interactions. Hydrophobic and aromatic residues are colored orange. E, F, G, H, I and J, clip views (dashed yellow line) of the ligand-binding pocket of the TcEcR-LBD domain (E, G and I) and the HvEcR-LBD domain (f, H and J) harboring methoxyfenozide (METHO), RH-5849 (BH) and halofenozide (HALO) 141
INDEX OF TABLES
Chapter 1:
Table 1: Main olive grove phytophagous and their eating habits 8
Table 2: Olive grovepathogenic agents and abiotic diseases. Significance of the damage caused by them 9
Table 3: Integrated pest management in olive crops 24, 25, 26
Chapter 4:
Table 4: Chemicals evaluated in the experiments 61
Table 5: Parameters estimated for the Weibull function describing the survivorship of C. nigritus adults at different treatments in two experiments: residual contact on glass surfaces and an extended laboratory experiments in which olive tree leaves were treated (mean data ± standard error) 82
Table 6: Percentages of mortality 72 hours after exposure, attacked hosts and progeny size of P. concolor after kaolin, Bordeaux mixture, copper oxychloride and dimethoate applications on an inert surface, an extended laboratory and a semi-field experiments (mean data ± standard error) 105
Table 7: Percentages of mortality 72 hours after exposure, life span, emergence, attacked hosts and progeny size of P. concolor after kaolin, Bordeaux mixture, copper oxychloride and dimethoate applications on parasitized pupae or ingested via their drinking water (mean data ± standard error) 105
Table 8: Percentages of mortality 72h after exposure and life span C. nigritus adults after kaolin, Bordeaux mixture, copper oxychloride and dimethoate applications on an inert surface and in an extended laboratory experiment (mean data ± standard error) 107
Appendix
190
Table 9: Percentages of attacked hosts and progeny size when P. concolor parasitize through a kaolin, Bordeaux mixture or copper oxychloride treated surface with or without olive tree treated leaves. Percentages have been recorded when the surfaces were treated and when females were transferred into non treated cages (mean data ± standard error) 108
Table 10: Percentages of attacked hosts and progeny size in the dual choice and the no-choice experiments when P. concolor females parasitize through a kaolin-treated surface (mean data ± standard error) 109
Table 11: C. nigritus: dual choice and no choice experiments. Percentage of adults found on the butternuts and other parts of the experimental cages (mean data ± standard error) 109
Table 12: Classification of the products according to the IOBC criteria 110
Chapter 5:
Table 13: Chemicals tested in the experiments 115
Table 14: Specific conditions of PCR reaction steps for determining BoEcR-LBD and PcEcR-LBD coding sequences 119
Table 15: Degenerate and specific primers using for obtaining the partial sequences of the LBD 119
Table 16: Sequence identity between PcEcR-LBD and the EcR-LBD in other insect orders (%) 133
Table 17: Efficacy of methoxyfenozide, tebufenozide, RH-5849, dimethoate and spinosad on B. oleae (mean data ± standard error) 152
Table 18: Toxicological effects of methoxyfenozide, tebufenozide, RH-5849, dimethoate and spinosad on P. concolor females (mean data ± standard error) 153
Appendix
191
ACRONYMS
20E: the endogenous insect moulting hormone 20-hydroxyecdysone
3D: three dimensional modelling
ATRIAS: Agrupaciones de Tratamientos Integrados en Agricultura
(Agricultural Integrated Treatment Groups)
AUAP: Abridged Universal Amplification Primer
BART: Beneficial Arthropod Testing Group
Bo-EcR-LBD: LBD of the EcR of B. oleae
DBD: DNA-binding domain
DBHs: Dibenzoylhydrazines
EcR: Ecdysone receptor
EIL: Economic Injury Level
EPPO: European and Mediterranean Plant Protection Organisation in collaboration with the Council of Europe
ET: Economic Threshold
FAO: Food and Agriculture Organization of the United Nations
IAEA: International Atomic Energy agency
IFOAM: International Federation of Organic Agriculture Movement
IGR: Insect Growth Regulators
IP: Integrated Protection
IPM: Integrated Pest Management
JH: Juvenile Hormones
JI: Joint Initiative
LB: Lysogeny broth LBD: Ligand-binding domain
MACs: Moulting Accelerating Compounds
MARM: Ministerio de Medio Ambiente y Medio Rural y Marino (Ministry of the Environmental, Rural and Marine Environs). Now, MAGRAMA (Ministerio de Agricultura, Alimentación y Medio Ambiente)
MFRC: Maximum Field Recommended Concentrations
OIBC: Organisation for Biological and Integrated Control of Noxious Animals and Plants
PcEcR-LBD: LBD of the P. concolor EcR
PCR: Polymerase Chain Reaction
PIEC: Predicted Initial Environmental Concentration
PoA: Ponasterone A
RACE-PCR: Rapid amplification of cDNA Ends-PCR
SIT: Sterile Insect Technique
USP: Ultraspiracle gen
Appendix
192
Recommended