View
214
Download
0
Category
Preview:
Citation preview
ORIGINAL PAPER
Enhanced accumulation of fatty acids and triacylglycerolsin transgenic tobacco stems for enhanced bioenergy production
Akula Nookaraju • Shashank K. Pandey •
Takeshi Fujino • Ju Young Kim • Mi Chung Suh •
Chandrashekhar P. Joshi
Received: 22 November 2013 / Revised: 23 January 2014 / Accepted: 30 January 2014
� Springer-Verlag Berlin Heidelberg 2014
Abstract
Key message We report a novel approach for
enhanced accumulation of fatty acids and triacylglyce-
rols for utilization as biodiesel in transgenic tobacco
stems through xylem-specific expression of Arabidopsis
DGAT1 and LEC2 genes.
Abstract The use of plant biomass for production of
bioethanol and biodiesel has an enormous potential to
revolutionize the global bioenergy outlook. Several studies
have recently been initiated to genetically engineer oil
production in seeds of crop plants to improve biodiesel
production. However, the ‘‘food versus fuel’’ issues have
also sparked some studies for enhanced accumulation of
oils in vegetative tissues like leaves. But in the case of
bioenergy crops, use of woody stems is more practical than
leaves. Here, we report the enhanced accumulation of
fatty acids (FAs) and triacylglycerols (TAGs) in stems
of transgenic tobacco plants expressing Arabidopsis diac-
ylglycerol acyltransferase 1 (DGAT1) and LEAFY COTY-
LEDON2 (LEC2) genes under a developing xylem-specific
cellulose synthase promoter from aspen trees. The trans-
genic tobacco plants accumulated significantly higher
amounts of FAs in their stems. On an average, DGAT1 and
LEC2 overexpression showed a 63 and 80 % increase in
total FA production in mature stems of transgenic plants
over that of controls, respectively. In addition, selected
DGAT1 and LEC2 overexpression lines showed enhanced
levels of TAGs in stems with higher accumulation of 16:0,
18:2 and 18:3 TAGs. In LEC2 lines, the relative mRNA
levels of the downstream genes encoding plastidic proteins
involved in FA synthesis and accumulation were also ele-
vated. Thus, here, we provide a proof of concept for our
approach of enhancing total energy yield per plant through
accumulation of higher levels of FAs in transgenic stems
for biodiesel production.
Keywords Biodiesel � Renewable energy � Tobacco �Triacylglycerols � Xylem
Introduction
Increasing energy demands and depleting fossil fuels have
invigorated a renewed search for unconventional and non-
traditional energy resources. The two important renewable
bioenergy sources from plants are (1) bioethanol from
sucrose, starch and cellulosic materials and (2) biodiesel
from lipids and seed oils. Plant oils are used for biodiesel
production and are primarily composed of triacylglycerols
Communicated by M. Prasad.
Akula Nookaraju and Shashank K. Pandey have contributed equally
to this work.
Electronic supplementary material The online version of thisarticle (doi:10.1007/s00299-014-1582-y) contains supplementarymaterial, which is available to authorized users.
A. Nookaraju � S. K. Pandey � T. Fujino �J. Y. Kim � M. C. Suh � C. P. Joshi
Department of Bioenergy Science and Technology, Chonnam
National University, Kwangju 500-757, South Korea
A. Nookaraju � C. P. Joshi (&)
Department of Biological Sciences, Biotechnology Research
Center, School of Forest Resources and Environmental Science,
Michigan Technological University, Houghton, MI 49931, USA
e-mail: cpjoshi@mtu.edu
Present Address:
A. Nookaraju
Kaveri Seed Company Ltd., S.D.Road, Secunderabad 500003,
India
123
Plant Cell Rep
DOI 10.1007/s00299-014-1582-y
(TAGs), which consist of three glycerol esters of fatty acid
(FA) chains (usually 18 or 16 carbons long). The fatty acyl
chains are chemically similar to the aliphatic hydrocarbons
found in gasoline and diesel, and these are converted to
fatty acid methyl esters (FAMEs) for complete combustion
in engines. The FAMEs found in biodiesel have a high
energy density with high heat of combustion, similar to that
of conventional diesel (Knothe 2005).
De novo fatty acid synthesis takes place in plant plastids
through series of condensation, reduction and dehydration
reactions. Free FAs thus produced are transported to
endoplasmic reticulum (ER), where they are condensed
with the glycerol backbone via ER-based Kennedy path-
way that terminates with a final rate-limiting step catalyzed
by diacylglycerol acyltransferase (DGAT). There are two
classes of ER-localized DGAT in plants (Shockey et al.
2006). The type 1 class of DGAT (DGAT1) is known to
contribute significantly to seed TAG biosynthesis (Jako
et al. 2001). The type 2 class DGAT enzymes (DGAT2) are
responsible for processing and accumulation of unusual
fatty acids (Shockey et al. 2006). In addition, oil accu-
mulation in seeds is also controlled by transcription factors
(TFs) encoded by genes such as LEAFY COTYLEDON1
(LEC1) (Mu et al. 2008), LEC2 (Santos-Mendoza et al.
2008) and WRINKLED1 (WRI1) (Baud et al. 2007). TAGs
are typically extracted from seeds and fruits of oil crops for
human consumption and industrial uses. Due to importance
of seed TAGs as food sources that competes with fuel
production, attempts have been made to specifically
increase the accumulation of TAGs in vegetative tissues for
enhancing the total bioenergy yield per plant or per unit
area of land (Andrianov et al. 2010; Sanjaya et al. 2011).
Engineering tobacco to accumulate more oils in leaves
instead of seeds is potentially useful for the production of
biodiesel. However, in traditional bioenergy trees such as
poplars, engineering to accumulate oils in the leaves may not
be a viable option as the collection of leaves in these tree
species is not practical. In this situation, engineering plants to
accumulate oils in their stems or trunks will have a double
impact on bioenergy production because the woody stems
can be used for bioethanol production after oil extraction for
biodiesel production. Earlier, we isolated and characterized
PtCesA1 gene [hereafter mentioned as PtdCesA8A accord-
ing to new nomenclature (Kumar et al. 2009)] encoding
Cellulose Synthase 8A protein from aspen trees which is
highly expressed in developing xylem cells undergoing
primary growth and in secondary xylem cells during sec-
ondary growth (Wu et al. 2000). The PtdCesA8A promoter
was also shown to be highly active in developing xylem of
transgenic tobacco plants. Here, we show that the expression
of Arabidopsis DGAT1 and LEC2 genes under the control of
xylem-specific PtdCesA8A promoter in transgenic tobacco
plants resulted in accumulation of higher amount of FAs and
TAGs in stems. Moreover, use of xylem-specific promoter
avoids any plant growth and developmental anomalies
observed with constitutive expression of TF genes such as
LEC2 (Braybrook et al. 2006).
Materials and methods
Construction of DGAT1 and LEC2 expression vectors
and tobacco transformation
Full-length Arabidopsis thaliana cDNA for DGAT1 (Gene
Bank Accession No. AF051849.1) was amplified with
primers that contain XbaI (CGGTCTAGAATGGCGATT
TTGGATTCTGC) and SmaI (TATCCCGGGTCATGA
CATCGATCCTTTTC) restriction sites on either sides and
cloned into the pTOP Blunt V2 vector (Enzynomics,
Korea) and sequenced. The DGAT1 cDNA was digested
using XbaI and SmaI and cloned between the PtdCesA8A
promoter (Wu et al. 2000) and NOS-T in modified pBI121
vector (Supplementary data Fig. S1). Similarly, full-length
Arabidopsis thaliana cDNA for LEC2 (Gene Bank
Accession No. DQ446296) was amplified with primers that
contain XbaI (CGGTCTAGAATGGATAACTTCTTACC
CTTTC) and SacI (TATGAGCTCTCACCACCACTCAA
AGTC) restriction sites on either sides and cloned into
modified pBI121 between the PtdCesA8A promoter and
Nos-T as described above. Such Plasmid constructs of
AtDGAT1 and AtLEC2 were transformed into Agrobacte-
rium tumefaciens strain GV2260 using a heat shock pro-
tocol (Dong et al. 2007).
Plant transformation of tobacco (Nicotiana benthami-
ana) was carried out using leaf discs by Agrobacterium-
mediated technique (Pogrebnyak et al. 2005). Transgenic
shoots were selected on kanamycin (50 lg/ml) and were
rooted on half-strength MS medium (Murashige and Skoog
1962) containing kanamycin (50 lg/ml). The rooted shoots
were transferred to commercial potting mixture (3:2:1
peat–soil–perlite; Heung Nung Seeds, Korea) and hardened
plants were established in growth room maintained at
25 ± 1 �C temperature and 50 % relative humidity.
PCR confirmation of transgenic plants and transgene
expression
The presence of Arabidopsis DGAT1 and LEC2 genes in
kanamycin-resistant tobacco lines was verified by genomic
DNA PCR using gene-specific primers as mentioned ear-
lier. Expression of AtDGAT1 and AtLEC2 mRNA in stem
tissues (from base, 1 to 7th internode) of transgenic plants
was estimated by RT-PCR using the primers: TTGGCCG
GAGATAATAACGGTGGT and AAGATTGCGTCGGA
GCTAAGTGGA for DGAT1, and ACAATCGCTCGCA
Plant Cell Rep
123
CTTCACAACAG and TTTGCGTAACCGGGATCTGA
GGAT for LEC2. The expression of LEC2 downstream
transcription factor gene, WRI1 and other downstream
genes encoding plastidic proteins involved in de novo fatty
acid synthesis was analyzed using the cDNA-specific
primers as listed in Supplementary data Table S1. Real-
time PCR was carried out using CFX96 Real-time system
(Bio-Rad, USA). Real-time PCR was performed using
SYBR green PCR kit (Takara, Japan). Comparative
threshold (Ct) values were normalized to Actin as internal
control and compared to obtain relative expression levels.
In situ RNA hybridization
To locate the transgene mRNA in stem tissues of trans-
genic tobacco plants, in situ RNA hybridization experi-
ments were carried out using Arabidopsis cDNA-specific
probes as described earlier (Wu et al. 2000). Stems sections
were taken at the 3rd internode from base (stem diameter
5.2 mm) and from 3rd internode from apex (stem diameter
2.3 mm) from 6-week-old greenhouse grown plants and
stem tissues were fixed with 4 % paraformaldehyde in
PBS, pH 7.2. These were dehydrated with water/ethanol/t-
butanol series and then embedded with Paraplast-plus
(Sigma). The cDNA fragments of AtDGAT1 and AtLEC2 to
be used as probes were amplified using gene-specific
primers, 50-CCAAGCTTGGATTCTGCTGGCGTTAC-30
and 50-GGCTCGAGCTAAGTGGACTCTCTCTC-3 for
AtDGAT1 and primers, 50-CCAAGCTTCAACAGTCCCT
ACTTATG-30 and 50-GCCTCGAGTTGCCATCTTCGTC
ATAC-30 for AtLEC2 genes, subcloned into the pGEM
T-easy vector (Promega) and were used to produce anti-
sense and sense digoxygenin (DIG)-labeled transcripts with
T7 and Sp6 RNA polymerases (DIG RNA Labeling Kit,
Roche). Tissues sections of 10 lm in thickness were made and
hybridized with DIG-labeled antisense and sense probes
(0.5 ng/ll) at 52 �C overnight. Hybridized probes were
detected by application of Anti-DIG Fab conjugated with
alkaline phosphatase (Roche) at 1:750 dilution and nitroblue
tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate. Images
were captured using a Zeiss Axiolab microscope fitted with a
CoolSNAP-Procf camera (Media Cybernetics).
Microscopy analysis
Stem sections of 6-week-old control and transgenic
tobacco plants were stained with Nile red (2.5 lg/ml in
methanol), mounted in 70 % glycerol and examined using
a laser confocal scanning microscope. Oil droplets were
observed at 570- to 630-nm emission following 559-nm
excitation by a solid-state laser. Images were captured with
a TCS SP5 AOBS/Tandem laser confocal scanning
microscope (Leica, Germany) (Sanjaya et al. 2011).
For transmission electron microscopy (TEM), the stem
tissues were fixed in 3 % glutaraldehyde and 10 mM cac-
odylate buffer pH 7.2 for overnight. After rinsing several
times in the same buffer, the stem tissues were prefixed
with a 2 % osmium tetroxide for an additional 1 h. After
dehydration using ethanol series, the tissues were infiltrated
and subsequently embedded in LR white resin. Ultra thin
sections (80 nm) were cut with a diamond knife on Leica
U6 ultra microtome and stained serially with 2 % uranyl
acetate and 1 % lead citrate. Sections were examined in
Joel 1200EX transmission electron microscope operated at
80 kV and photographed using a Deben AMT 1.3 k digital
camera (Slocombe et al. 2009).
Fatty acid analysis and TAG estimation
Total fatty acids from tobacco stems were analyzed using the
method described earlier (Jung et al. 2011). Basal portion of
the stems (from base, 1 to 7th internode) of control and
transgenic tobacco were harvested from 6-week-old plants
maintained in a greenhouse, and were ground to fine powder in
liquid N2. The powder samples were lyophilized and residues
were transmethylated at 90 �C for 90 min in 0.25 ml of tol-
uene and 1 ml of methanol containing 5 % sulfuric acid (v/v).
Heptadecanoic acid (17:0) was added to each sample as an
internal standard. After transmethylation, 1.5 ml of 0.9 %
NaCl solution was added and the fatty acid methyl esters
(FAMEs) were recovered by three sequential extractions with
2 ml of hexane. The FAMEs were analyzed by gas chroma-
tography on a 30 m 9 0.32 mm (inner diameter) DB-23
column (Agilent, USA) while increasing the oven temperature
from 160 to 220 �C at 2.5 �C/min (GC-2010; Shimadzu,
Japan). The fatty acids were identified by comparison of
retention times and mass spectra with those of standards.
Estimation of TAGs was carried out according to the pro-
cedure described by Miquel and Browse (1992) with minor
modifications. About 500 mg fresh stems (from base, 1 to 7
internodes) of 6-week-old control and transgenic tobacco
plants were ground in liquid nitrogen and immediately treated
with 3 ml of preheated (75 �C) isopropanol with 0.01 %
butylated hydroxytoluene (BHT, Sigma) for 15 min. To this,
1.5 ml of chloroform and 0.6 ml of sterile water were added
and agitated on a rotary shaker at 90 rpm for 1 h at RT. The
organic phase containing lipids was carefully transferred to a
new glass tube; 4 ml of chloroform/methanol (2:1, v/v) with
0.01 % BHT was added and agitated as above for 30 min at
RT. The chloroform/methanol extraction was repeated for
three more times. The combined extract was washed with
1 ml of 1 M KCl and 2 ml of water. After centrifugation at
1,200 rpm for 10 min at RT, upper phase was discarded and
the lower phase was used for TAG analysis. Individual lipids
were separated on TLC plates coated with silica gel G using
hexane/diethyl ether/acetic acid (70: 30: 1, v/v/v) mobile
Plant Cell Rep
123
phase. Triheptadecanoic-glycerol was used as standard and
the TAG bands were visualized under iodine vapor. After run,
TAG bands were scraped from TLC plates and their FAs
content was estimated as described above.
Cellulose estimation and glucose release
Precursors of fatty acid biosynthesis in plants are derived
from sugars formed during photosynthesis. Photosynthates
in the form of sugar from the source tissues are transported
into developing seeds and converted via glycolysis into
precursors of fatty acid biosynthesis (Durrett et al. 2008).
Some of those photosynthates are used for cellulose pro-
duction. To check whether there is any reduction in cel-
lulose content in response to diversion of photosynthates to
FA synthesis, we estimated cellulose contents in transgenic
stems. For this, mature stems from 6-week-old tobacco plants
were ground to fine powder and passed through 40 gauge
sieves. The tissue powders were treated with acetonitrile
(ACN) solution (acetic acid:nitric acid:water 8:2:1) at 100 �C
for 30 min (Updegraff 1969). Then the tissue powders were
washed with sterile water and dried. The dried residue con-
taining pure cellulose was weighed and sugar release was
calculated using phenol–sulfuric acid method monitoring the
absorbance at 490 nm as reported by Dubois et al. (1956). A
glucose standard curve was prepared using 2–22 lg lL-1 and
glucose yields of tissue samples were calculated.
Statistical analysis
Data collected from different experiments were analyzed
using Statistical Analysis Software (SAS Inc., USA)
package 9.1. Statistical differences were determined using
a one-way analysis of variance (ANOVA) and means were
considered significantly different at P \ 0.01.
Results
Overexpression of AtDGAT1 and AtLEC2 in transgenic
tobacco resulted in normal plants with minor growth
changes
A total of 25 transgenic lines of tobacco for each of the two
genes, AtDGAT1 and AtLEC2 were generated and selected
on kanamycin containing media and their transgenic nature
was confirmed by genomic DNA PCR using gene-specific
primers for transgenes (data not shown). The transgenic
plants expressing AtDGAT1 and AtLEC2 genes developed
and flowered normally and did not show any develop-
mental anomalies as compared to vector control lines
(Fig. 1). There were some minor differences in the number
of branches and stem diameter measurements (Table 1).
Total RNA was isolated from stem of transgene tobacco
plants and checked for transgene expression by quantitative
real-time PCR with reference to Actin. The expression
levels of AtDGAT1 and AtLEC2 in the stem of transgenic
plants ranged from 0.25 to 0.65 (DGAT1) and 0.5 to 1.05
(LEC2) when compared to actin gene expression (Fig. 2a,
b).
LEC2 TF overexpression in transgenic lines also
induced the expression of downstream TF gene, WRI1
(Fig. 2c). Furthermore, the expression of further down-
stream genes encoding plastidic proteins involved in de
novo fatty acid synthesis as well as biotin carboxyl carrier
protein isoform 2 and acyl carrier protein 1 was also
enhanced in stems of AtLEC2 transgenic plants as com-
pared to that of control plants (Fig. 2c). In addition,
enhanced expression of DGAT1 was observed in AtLEC2
transgenic stems when compared to that in stems of vector
control lines. There was a moderate increase in SUS gene
expression in 5 lines out of 8 lines of AtLEC2 transgenics.
Fig. 1 PCR confirmed 6-week-old DGAT1 and LEC2 transgenic
plants of tobacco maintained in greenhouse. DGAT1-2, transformed
tobacco lines 2; LEC2-4, LEC2 transformed line 4; VC-1, vector
control 1. The transgenic plants did not show any morphological
variations with control vector lines
Plant Cell Rep
123
Transgene mRNAs were localized in developing xylem
tissues of tobacco
To examine the pattern of AtDGAT1 and AtLEC2 expres-
sion in stem tissues of transgenic tobacco plants, in situ
RNA hybridization was performed using gene-specific
antisense RNA probes. AtDGAT1 expression was observed
in developing secondary xylem (SX) and its expression
gradually decreased in mature xylem (Fig. 3a), whereas no
signal was observed in sections hybridized with sense
probes (Fig. 3b) and control plant sections hybridized with
antisense probes (Fig. 3g). In AtDGAT1 overexpression
line 3, a strong expression of AtDGAT1 mRNA was seen in
developing xylem cells during both primary and secondary
Table 1 Growth parameters of transgenic and control plants of tobacco
Line Plant height
(cm)
No. of
internodes
No. of
branches
No. of
leaves
Ave. leaf size
(cm) (L/B)
Stem diameter (mm) No. of flower buds
per plantTop Middle Base
Control 28.5 ± 2.3 17.5 ± 3.6 7.3 ± 1.8 71.0 ± 15.8 6.5/6.2 1.1 ± 0.2 4.2 ± 1.0 6.0 ± 0.7 21.3 ± 5.5
DGAT1 29.4 ± 3.2 19.3 ± 2.3 6.4 ± 1.5 59.4 ± 20.5 6.3/6.2 1.2 ± 0.5 4.6 ± 1.1 5.0 ± 1.0 23.1 ± 6.0
LEC2 32.0 ± 2.3 16.3 ± 2.9 5.0 ± 0.2 61.5 ± 19.0 6.5/6.5 1.2 ± 0.5 4.0 ± 2.0 4.7 ± 1.1 19.1 ± 8.0
Observations were recorded at 6 weeks after transfer of plants to soil. The number of samples for each treatment is 12 and the experiment was
repeated twice. Values are averages for 12 plants each of control, AtDGAT1 and AtLEC2 transgenic lines and are represented as mean ± SD. L/B
refers to length/breadth of leaves
VC-1 VC-10 DG-1 DG-2 DG-3 DG-4 DG-5 DG-8 DG-9 DG-10 VC-1 VC-10 LE-4 LE-5 LE-6 LE-9 LE-11 LE-13 LE-14
a b
c VC-1 VC-10 LE-4 LE-5 LE -6 LE -9 LE-11 LE-13 LE-14
WRI1
ACTIN
ACP
ACPR
GPA
BCCP
PD
PK
SUS
DGAT1
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
Rel
ativ
e m
RN
A e
xpre
ssio
n
Transgenic lines
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
Rel
ativ
e m
RN
A e
xpre
ssio
n
Transgenic lines
Fig. 2 Relative expressions of transgenes in tobacco plants and
expression patterns of LEC2 downstream genes in transgenic tobacco
plants expressing AtLEC2. Relative expression pattern of AtDGAT1
(a) and AtLEC2 (b) mRNA in stem tissues of transgenic plants
expressing AtDGAT1 and AtLEC2, respectively. Upregulation of
LEC2 downstream genes in transgenic tobacco plants expressing
AtLEC2 (c). The relative expressions were compared to that of actin.
The error bars represent the SEM of three independent experiments
carried out from three independent RNA extractions. DG, DGAT1;
LE, LEC2. All long forms of the genes used here are listed in Table
S1
Plant Cell Rep
123
Fig. 3 In situ mRNA hybridization studies in DGAT1 and LEC2
transgenic stems. Positive DNA/RNA hybridization signals stained in
purple blue color. Arrows indicate the cellular localization of DGAT1
and LEC2 transcripts. Localization of AtDGAT1 mRNA in stems of
DGAT1 overexpression line 3 (a, e) and AtLEC2 overexpression line
5 (c). AtDGAT1 expression was observed in developing xylem cells of
primary (e) and secondary xylem (a) of transgenic plants and its
expression gradually decreased toward maturity, whereas no signal
was observed in sense-probed sections (b, f) and control plant
sections hybridized with antisense probes (g). Similarly, AtLEC2
mRNA expression was observed in a few developing cells of
secondary xylem (c) whereas no signal was observed in sense-probed
sections (d) and control plant sections hybridized with antisense
probes (h). PX primary xylem, SX secondary xylem. Figures are
presented in 9100 magnification. Bar 100 lm (color figure online)
Plant Cell Rep
123
growth. However, in LEC2 overexpression line 5, AtLEC2
mRNA expression was observed only in a few developing
cells of secondary xylem in mature stems (Fig. 3c) whereas
no signal was observed with sense probes (Fig. 3d, f) and
control plant sections were hybridized with antisense
probes (Fig. 3h). However, all the cells of primary xylem
in young stems stained positive (Fig. 3e) indicating the
expression of AtDGAT1 driven by PtdCesA8A promoter. It
was very difficult to distinguish between cytoplasm and
plasma membrane in xylem fibers as majority of the cell is
occupied by a large vacuole and cytoplasm forms a thin
layer around the vacuole. This is the reason for the
observed staining of plasma membrane in transgenic lines.
The expression of DGAT1 and LEC2 was limited to
developing secondary xylem as the promoter (PtdCesA8A)
activity is seen in actively growing xylem cells. Also, due
to low expression levels of LEC2 TF, the expression could
not be detected in mature xylem cells.
Increased number of oil bodies in tissues of transgenic
stems
Hand sections of control and transgenic stems from 6-week-
old plants were stained with Nile red and observed under a
confocal laser scanning microscope after excitation at
559 nm of light. Oil droplets were observed at much higher
frequency in xylem, phloem, pith and cortex tissues of
transgenic stems as compared to control vector stems
(Fig. 4). The localization of oil droplets was sometimes seen
in pith regions at a higher frequency as compared to phloem
and xylem tissues. Oil droplets were also observed in vas-
cular cambium and ray cells of secondary xylem. Among the
transgenics, LEC2 overexpression line 5 showed a higher
frequency of oil droplet accumulation in pith, xylem and
cortex tissues (Fig. 4e, f) as did DGAT1 overexpression line
3 (Fig. 4c, d); vector control lines showed a comparatively
lower frequency of oil droplets accumulation (Fig. 4a, b). On
an average, two-to fourfold increase in droplet frequency
was observed in xylem tissues of DGAT1 overexpression line
3 and LEC2 overexpression line 5, respectively, as compared
to that of control plants (Fig. 4g). The size of oil droplets was
more or less uniform in all the tobacco stem tissues and
among control and transgenic lines.
The TEM visualization of stem sections revealed the
presence of many small black-colored oil bodies in cyto-
plasm surrounding vacuoles in developing xylem and mature
xylem cells of control and transgenic plants (Fig. 5). Similar
to confocal microscopy observations, oil bodies were
observed at a higher frequency in developing and mature
xylem cells of DGAT1 overexpression line 3 (Fig. 5b, e) as
compared to vector control (Fig. 5a, d), while LEC2 over-
expression line 5 (Fig. 5c, f) showed moderate increase in oil
droplet accumulation in their stems as compared to control.
Transgenic tobacco plants showed increased titers
of FAMEs and enhanced levels of TAGs in stems
Mature stems (from base, 1 to 7th internode) from
transgenic tobacco plants at 6 weeks of age were used for
FA analysis. The tobacco plants typically possessed
16–19 internodes at that time of age. Overall, LEC2
overexpression lines accumulated higher levels of FAs in
their stems as compared to DGAT1 overexpression lines
(Fig. 6a). On an average, AtDGAT1 and AtLEC2 expres-
sion resulted in a 63 and 80 % increase in total FA
production in their stems over control plants (Fig. 6a).
Among AtDGAT1 transgenics, stems of AtDGAT1 over-
expression line 2 showed a higher FA accumulation
(95 % increase over control). However, among all the
lines, stems of AtLEC2 overexpression line 5 showed a
maximum of 133 % increase in FA accumulation over
control stems.
Composition of FAs in the stems showed significant
variation among control and transgenic plants. The results
showed that the common fatty acids, palmitic (16:0), le-
noleic (18:2) and linolenic acid (18:3) contributed mainly
to the total stem FA pool. A steady increase in the C18-
type unsaturated FA pool was observed in DGAT1 and
LEC2 overexpression lines as compared to other fatty acids
(Fig. 6b). The levels of oleic acid (18:1), lenoleic and
linolenic acid showed more than a twofold increase in
stems of transgenic plants as compared to those in control
stems (Fig. 6b). A moderate increase in C16:0 (palmitic
acid) level was observed in transgenic stems while no
significant differences were observed for C16:3 (palmito-
leic acid) and C18:0 (stearic acid) levels between control
and transgenic stems (Fig. 6b).
The fatty acid composition of TAGs from stems of
control and selected transgenic plants was estimated by gas
chromatography. The results showed that levels of TAGs in
stems of transgenic lines were found to be higher as
compared to vector control lines (Fig. 7a). Among differ-
ent FAs, palmitic (16:0), lenoleic (18:2) and linolenic acid
(18:3) were main constituents (Fig. 7b). Among the
transgenic lines, higher levels of TAGs were recorded in
case of AtLEC2 overexpression line 5, AtDGAT1 overex-
pression lines 1 and 5. On an average, AtLEC2 overex-
pression line 5 showed an eightfold increase in TAG
accumulation as compared to those of controls. This
transgenic line (AtLEC2 overexpression line 5) with high-
est TAG levels also had the highest total FA content
(Fig. 7a). The FA composition of TAGs showed enhanced
levels of 16:0, 18:0, 18:2 and 18:3 TAGs in transgenic lines
(Fig. 7b). The overall contribution of TAGs to the total FA
pool in vector control lines is around 4–9 %, while TAGs
contribute for about 13–28 % to total FA pool in transgenic
stems.
Plant Cell Rep
123
Transgenic tobacco stems remain unchanged in terms
of cellulose content
As the precursors of fatty acid biosynthesis in plants are
derived from sugars formed during photosynthesis, we
estimated the cellulose contents in transgenic stems
showing higher accumulation of FAs. It was observed that
the levels of cellulose in transgenic stems were on par with
those of control stems (Supplementary data Fig. S2). Fur-
thermore, the glucose released from transgenic stems did
not show any significant reduction as compared to that of
control stems (Supplementary data Fig. S3). These results
suggest that there was no reduction in cellulose levels and
glucose release due to higher accumulation of FAs in
transgenic stems.
Discussion
Plants normally accumulate oil in seeds, which have less
storage capacity than leaves and stems due to their smaller
sizes. To overcome this limitation and to address ‘‘Food
versus fuel’’ competition issue, it is advantageous to spe-
cifically accumulate oil in the vegetative tissues for
increasing the total energy yield per plant. In this study, we
report for the first time, the enhanced accumulation of fatty
acids in stem tissues of transgenic plants expressing
Arabidopsis DGAT1 and LEC2 genes driven by the aspen
secondary cell wall cellulose synthase promoter, Ptd-
CesA8A-P (Wu et al. 2000). The transgenic plants grew
normally and were similar to vector control plants except
for minor differences in stem diameter and number of
Fig. 4 Localization of Nile red-stained oil bodies in control and
transgenic tobacco stems. Oil bodies were localized at higher
frequency in LEC2 overexpression line 5 (e, f) and DGAT1
overexpression line 3 (c, d), whereas lower number of oil bodies
were observed in control vector stems (a, b). The distribution of oil
droplets (oleosomes) was higher in xylem, phloem, pith and cortex
tissues of transgenic plants as compared to that of vector control
stems (g). The sections were taken at 3rd internode from apex. Nile
red-stained oil bodies were localized (arrows) in cortex, phloem,
xylem parenchyma and pith tissues of tobacco stems. PX primary
xylem, SX secondary xylem, Ph phloem, VC vascular cambium, Pt
pith, Co cortex. Bar 200 lm
Plant Cell Rep
123
branches. Contrary to our observations, some growth
reductions were reported by Andrianov et al. (2010) for
transgenic tobacco plants expressing AtDGAT1 and At-
LEC2 under a strong leaf-specific promoter. The differ-
ences in the transgenics between our study and this earlier
study could be attributed to the differences in the strength
and spatial expression of transgene driven by two different
promoters. The use of xylem-specific promoter as descri-
bed here appears to be more specific and beneficial for such
genetic manipulations.
Enhanced expression of DGAT1, the major rate-limiting
enzyme in oil biosynthesis pathway in AtDGAT1 overex-
pression lines appears to have generated higher TAG levels
(Fig. 7a), which have contributed to higher FA levels in
transgenic stems (Fig. 6a). Apart from DGAT1, the over-
expression of AtLEC2 encoding a seed-specific transcrip-
tion factor also resulted in enhanced accumulation of TAGs
contribution and increased FA accumulation in AtLEC2
transgenic tobacco stems. However, the levels of FAMEs
were higher in AtLEC2 overexpression lines as compared
to AtDGAT1 lines (Fig. 6a). As mentioned earlier, LEC1
and LEC2 are developmental TFs involved in storage
product accumulation and their overexpression in green
tissues has been reported to stimulate the formation of
structures similar to seed embryos (Lotan et al. 1998), and
caused increased accumulation of oil in Arabidopsis seeds
(Mu et al. 2008; Santos-Mendoza et al. 2008; Slocombe
et al. 2009) and transgenic tobacco leaves (Andrianov et al.
2010). The LEC1 and LEC2 were reported to directly
regulate another TF, WRI1, which is involved in fatty acid
biosynthesis in seeds (Baud et al. 2007; Shen et al. 2010).
The increased expression of WRI1 mRNA in AtLEC2
transgenic plants in the present study further supports these
earlier findings on transcriptional regulation of WRI1 by
LEC2.
Studies with Arabidopsis showed that LEC2 controls the
transcription of many seed-specific mRNAs controlling
seed oil accumulation (Santos-Mendoza et al. 2008). In our
study, the expression of WRI1 was enhanced significantly
in the stems of AtLEC2 overexpression lines (Fig. 2c).
Furthermore, enhanced expression of many downstream
genes from AtLEC2 encoding plastidic proteins involved in
de novo FA synthesis, biotin carboxyl carrier protein iso-
form 2 and acyl carrier protein 1 and SUS was observed. It
is possible that such upregulation of genes might have
contributed to increased FA levels in stems of transgenic
tobacco plants. Interestingly, the expression of AtDGAT1,
and its involvement in TAG formation, was also enhanced
Fig. 5 Electron micrographs (20,000x) of control and transgenic
tobacco stems stained with osmium tetroxide. Localization of oil
droplets was observed as small black-colored spots (arrows) in the
cytoplasm surrounding the vacuoles. Oils droplets were observed at
higher frequencies in AtDGAT1 overexpression line 3 (b, e) and
AtLEC2 overexpression line 5 (c, f) transgenic stems as compared to
controls (a, b). Comparatively more number of oil droplets was
observed in developing xylem cells (d–f) as compared to mature
xylem cells (a–c). N nucleus, P plastid, M mitochondria, V vacuole.
Bar 2 lm
Plant Cell Rep
123
in the stems of AtLEC2 overexpression lines, indicating an
increase in TAG levels in AtLEC2 overexpression lines
(Fig. 7a). Also, the enhanced expression of DGAT1 in
AtDGAT1 overexpression lines might have contributed to
the increased synthesis of FAs.
In majority of oil plants, TAGs are stored as oil droplets
in the seeds and utilized during seedling growth after
germination (Jolivet et al. 2004). In addition to seeds and
the mesocarp of fruits, some plants accumulate lipids in
stems, roots and leaves. The plants known for accumulat-
ing lipids in stems include sandalwood, teak, scots pine,
tung and the desert plant Tetraena mongolica. For exam-
ple, relatively high levels of TAG were reported in stem
tissues of scots pine [5 % of dry weight (DW)] and ‘oil
firewood’ Tetraena mongolica (9 % DW in Phloem)
(Durrett et al. 2008) though the mechanism of oil accu-
mulation in these plants is not well studied. However, in
our study, expression of AtDGAT1 native gene was
observed in vegetative parts such as stem and leaf tissues of
tobacco (data not shown) indicating the occurrence of FA
biosynthesis in these tissues. This result supports our claim
to produce lipids in stem tissues, thereby increasing the
potential for bioenergy production from stems. We
expressed Arabidopsis DGAT1 and LEC2 genes under a
strong xylem-specific PtdCesA8A promoter that showed
strong expression in xylem cells during primary and sec-
ondary growth (Wu et al. 2000). Expression of these genes
in xylem cells resulted in enhanced oil droplets accumu-
lated in stem tissues of transgenic tobacco plants as
revealed by Nile red staining (Fig. 4). The promoter
activity was reported mainly in developing xylem cells.
However, under mechanical stress, its expression was also
seen in phloem fiber tissues (Wu et al. 2000). In our study,
oil accumulation was observed in phloem, pith and cortex
tissues apart from xylem though no hybridization signal
was observed in pith and cortex tissues in stems of trans-
genic plants. This could be due to very low expression
levels of AtDGAT1 and AtLEC2 that did not show up in
RNA hybridizations. The oil droplets were seen more fre-
quently in stem tissues of transgenic plants as compared to
those of control plants. We observed that transgenic
tobacco plants expressing Arabidopsis DGAT1 and LEC2
showed 63–80 % increase in total extractable FAs in stems.
Similar to our study, overexpression of AtDGAT1 under a
strong leaf-specific rbcS promoter resulted in accumulation
of FAs in leaves (Andrianov et al. 2010). In the same study,
ectopic expression of AtLEC2 under the alc promoter
resulted in more than 100 % increase in extracted FAs
from transgenic tobacco leaves. Similar results were
recently reported with transgenic Arabidopsis plants
b
aFig. 6 Contents of fatty acids
in stems of DGAT1 and LEC2
transgenic lines of tobacco. The
total amount of extractable FAs
(a) and fatty acid composition
(b) in control and transgenic
stems
Plant Cell Rep
123
overexpressing WRI1 under the constitutive promoter,
CaMV35S (Sanjaya et al. 2011). However, in these studies,
leaf-specific overexpression of AtDGAT1 and AtWRI1 in
tobacco and Arabidopsis resulted in minor growth
alterations.
In general, very long-chain fatty acid-containing TAGs
are found only in seeds. However, an increase in very long-
chain fatty acid-containing TAGs was reported in the
vegetative tissue of the AGPRNAi-WRI1 lines of Arabi-
dopsis (Sanjaya et al. 2011) and in senescing leaves of
LEC2 overexpression lines of Arabidopsis (Slocombe et al.
2009). These reports suggest that seed-like biosynthetic
mechanisms could be ectopically induced in the non-seed
tissues. Enhanced accumulation of 16:0, 18:0, 18:2 and
18:3 TAGs in DGAT1 and LEC2 transgenic lines was
observed as compared to control stems in our study
(Fig. 7b). The compositions of FAs in the stems of DGAT1
and LEC2 transgenic tobacco plants showed more than
100 % increase in the C18 type unsaturated FA pool
compared to control stems. These results reflect previous
reports that 16:0, 18:1 and 18:2 FAs and very long-chain
FAs having more than 20 carbon atoms comprised more
than 90 % and\1 % of total FAs, respectively, in tobacco
seed oils.
In conclusion, here, we have successfully demonstrated
the accumulation of lipids in transgenic stems that have a
potential to be useful biofuel source. Further studies in our
laboratory are aimed at transforming poplar trees for
enhanced accumulation of oils in the stems using a similar
approach. Also, no compensation in cellulose contents was
observed due to higher accumulation of FAs in transgenic
tobacco stems. Our approach has a potential for increasing
the total energy production per plant because the ligno-
cellulosic plant material can be used for traditional bio-
ethanol production and excess oil produced in transgenic
plant stems could be used for biodiesel production from the
same stems. This study provides a proof of concept for
enhancing the production of FAs and TAGs in stems of
transgenic bioenergy plants, where lignocellulosic material
from transgenic stems after oil extraction can be utilized
for bioethanol production.
Acknowledgments This work was supported by the World Class
University project of the Ministry of Science and Technology of
Korea (R31-2009-000-20025-0). The authors declare that they have
no conflict of interest.
References
Andrianov V, Borisjuk N, Pogrebnyak N, Brinker A, Dixon J, Spitsin
S, Flynn J, Matyszczuk P, Andryszak K, Laurelli M, Golovkin
M, Koprowski H (2010) Tobacco as a production platform for
biofuel: overexpression of Arabidopsis DGAT and LEC2 genes
increases accumulation and shifts the composition of lipids in
green biomass. Plant Biotechnol J 8:277–287
Baud S, Mendoza MS, To A, Harscoet E, Lepiniec L, Dubreucq B
(2007) WRINKLED1 specifies the regulatory action of LEAFY
COTYLEDON2 towards fatty acid metabolism during seed
maturation in Arabidopsis. Plant J 50:825–838
Braybrook SA, Stone SL, Park S, Bui AQ, Le BH, Fischer RL,
Goldberg RB, Harada JJ (2006) Genes directly regulated by
LEAFY COTYLEDON2 provide insight into the control of
embryo maturation and somatic embryogenesis. Proc Natl Acad
Sci USA 103:3468–3473
Dong Y, Burch-Smith TM, Liu Y, Mamillapalli P, Dinesh-Kumar SP
(2007) A ligation-independent cloning tobacco rattle virus vector
for high-throughput virus-induced gene silencing identifies roles
for NbMADS4-1 and -2 in floral development. Plant Physiol
145:1161–1170
Dubois M, Gilles KA, Hamilton JK, Rebers PA, Smith F (1956)
Calorimetric method for determination of sugars and related
substances. Anal Chem 28:350–356
Durrett TP, Benning C, Ohlrogge J (2008) Plant triacylglycerols as
feedstocks for the production of biofuels. Plant J 54:593–607
Jako C, Kumar A, Wei Y, Zou J, Barton DL, Giblin EM, Covello PS,
Taylor DC (2001) Seed-specific overexpression of an Arabi-
dopsis cDNA encoding a diacylglycerol acyltransferase
enhances seed oil content and seed weight. Plant Physiol 126:
861–874
Jolivet P, Roux E, d’Andrea S, Davanture M, Negroni L, Zivy M,
Chardot T (2004) Protein composition of oil bodies in Arabi-
dopsis thaliana ecotype WS. Plant Physiol Biochem 42:501–509
Fig. 7 Contents of triacylglycerols (TAGs) in stems of DGAT1 and
LEC2 transgenic lines of tobacco. Total amount of TAGs (a) and the
proportion of different TAGs (b) in stems of control and transgenic
stems. TAG levels are expressed in terms of lg FAME/mg DW. The
error bars represent the SEM of three independent observations
(n = 3). *t test significant at P \ 0.001
Plant Cell Rep
123
Jung JH, Kim H, Go YS, Lee SB, Hur CG, Kim HU, Suh MC (2011)
Identification of functional BrFAD2-1 gene encoding micro-
somal delta-12 fatty acid desaturase from Brassica rapa and
development of Brassica napus containing high oleic acid
contents. Plant Cell Rep 30:1881–1892
Knothe G (2005) Dependence of biodiesel fuel properties on the
structure of fatty acid alkyl esters. Fuel Process Technol
86:1059–1070
Kumar M, Thammannagowda S, Bulone V, Chiang V, Han KH, Joshi
CP, Mansfield SD, Mellerowicz E, Sundberg B, Teeri T, Ellis
BE (2009) An update on the nomenclature for the cellulose
synthase genes in Populus. Trends Plant Sci 14:248–254
Lotan T, Ohto M, Yee KM, West MA, Lo R, Kwong RW, Yamagishi
K, Fischer RL, Goldberg RB, Harada JJ (1998) Arabidopsis
LEAFY COTYLEDON1 is sufficient to induce embryo devel-
opment in vegetative cells. Cell 93:1195–1205
Miquel M, Browse J (1992) Arabidopsis mutants deficient in
polyunsaturated fatty acid synthesis. Biochemical and genetic
characterization of a plant oleoyl-phosphatidylcholine desatur-
ase. J Biol Chem 267:1502–1509
Mu J, Tan H, Zheng Q, Fu F, Liang Y, Zhang J, Yang X, Wang T,
Chong K, Wang XJ, Zuo J (2008) LEAFY COTYLEDON1 is a
key regulator of fatty acid biosynthesis in Arabidopsis. Plant
Physiol 148:1042–1054
Murashige T, Skoog F (1962) A revised medium for rapid growth and
bioassay with tobacco tissue cultures. Physiol Plant 15:473–497
Pogrebnyak N, Golovkin M, Andrianov V, Spitsin S, Smirnov Y,
Egolf R, Koprowski H (2005) Severe acute respiratory syndrome
(SARS) S protein production in plants: development of
recombinant vaccine. Proc Natl Acad Sci USA 102:9062–9067
Sanjaya Durrett TP, Weise SE, Benning C (2011) Increasing the
energy density of vegetative tissues by diverting carbon from
starch to oil biosynthesis in transgenic Arabidopsis. Plant
Biotechnol J 9:874–883
Santos-Mendoza M, Dubreucq B, Baud S, Parcy F, Caboche M,
Lepiniec L (2008) Deciphering gene regulatory networks that
control seed development and maturation in Arabidopsis. Plant J
54:608–620
Shen B, Allen WB, Zheng P, Li C, Glassman K, Ranch J, Nubel D,
Tarczynski MC (2010) Expression of ZmLEC1 and ZmWRI1
increases seed oil production in maize. Plant Physiol 153:
980–987
Shockey JM, Gidda SK, Chapital DC, Kuan JC, Dhano PK, Bland
JM, Rothstein SJ, Mullen RT, Dyer JM (2006) Tung tree
DGAT1 and DGAT2 have nonredundant functions in triacyl-
glycerol biosynthesis and are localized to different subdomains
of the endoplasmic reticulum. Plant Cell 18:2294–2313
Slocombe S, Cornah J, Pinfield-Wells H, Soady K, Zhang Q, Gilday
A, Dyer J, Graham A (2009) Oil accumulation in leaves directed
by modification of fatty acid breakdown and lipid synthesis
pathways. Plant Biotechnol J 7:694–703
Updegraff DM (1969) Semi-micro determination of cellulose in
biological materials. Anal Biochem 32:420–424
Wu L, Joshi CP, Chiang VL (2000) A xylem-specific cellulose
synthase gene from aspen (Populus tremuloides) is responsive to
mechanical stress. Plant J 6:495–502
Plant Cell Rep
123
Recommended