View
220
Download
2
Category
Tags:
Preview:
Citation preview
• Composed of 4 nucleotide bases, 5 carbon sugar and phosphate.
• Base pair = rungs of a ladder.
• Edges = sugar-phosphate backbone.
• Double Helix
• Anti-Parallel
The structure of DNA
Figure 2.22aDNA ReplicationRemember – the two strands run in opposite directions
Synthesis of a new (daughter) strand occurs in the opposite direction of the old (parental) strand.
Complementary base-pairing occurs A with T and G with C
G and C have three hydrogen bonds
A and T have two hydrogen bonds
DNA Replication• Each new double helix is composed of an old
(parental) strand and a new (daughter) strand.
• As each strand acts as a template, process is called Semi-conservative Replication.
• Replication errors can occur. Cell has repair enzymes that usually fix problem. An error that persists is a mutation.
• This is permanent, and alters the phenotype.
The structure of RNA• Formed from 4
nucleotides, 5 carbon sugar, phosphate.
• Uracil is used in RNA.– It replaces Thymine
• The 5 carbon sugar has an extra oxygen.
• RNA is single stranded.
Central Dogma of Molecular Biology
• DNA holds the code
• DNA makes RNA
• RNA makes Protein• DNA to DNA is called
REPLICATION• DNA to RNA is called
TRANSCRIPTION• RNA to Protein is called
TRANSLATION
Central Dogma of Molecular Biology
• There are exceptions:
• Retroviruses – Use RNA as the genetic code– Must make DNA before making
protein product– This new DNA makes RNA and
then a protein
• Also, one protein is not always the product of a single gene – we will talk about this later in the course!
A close-up view of transcription
RNApolymerase
RNA nucleotides
Newly madeRNA Direction of
transcriptionTemplatestrand of DNA
• How does the order or sequence of nucleotides in a DNA and then a RNA molecule determine the order of amino acids in a protein? (Translation)
TACCTGAACGTACGTTGCATGACT
AUGGACUUGCAUCGAACGUACUGA
Met-Asp-Leu-His-Arg-Thr-Tyr-STOP
DNA
RNA
protein
Translation• Translation requires:
– Amino acids (AAs)– Transfer RNA: (tRNA) Appropriate to its time, transfers
AAs to ribosomes. The AA’s join in cytoplasm to form proteins. 20 types. Loop structure
– Ribosomal RNA: (rRNA) Joins with proteins made in cytoplasm to form the subunits of ribosomes. Linear molecule.
– Messenger RNA: (mRNA) Carries genetic material from DNA to ribosomes in cytoplasm. Linear molecule.
Translation• The mRNA has a specific
“open reading frame” made up of three base pairs –codon.
• The tRNA has the complementary base-pairing fit to the codon –known as an Anticodon
• Each of these codes for an amino acid
Translation• Initiation—
–mRNA binds to smaller of ribosome subunits, then, small subunit binds to big subunit.
–AUG start codon--complex assembles
• Elongation—–add AAs one at a time to form chain.– Incoming tRNA receives AA’s from outgoing tRNA.
Ribosome moves to allow this to continue
• Termintion—Stop codon--complex falls apart
What happens when it all goes wrong?
– MUTATIONS!!!!!!!!!!– two general categories
1.result in changes in the amino acids in proteins
A change in the genetic code
2.Change the reading frame of the genetic message
Insertions or deletions
Remember Thalidomide?• The structure of thalidomide is
similar to that of the DNA purine bases adenine (A) and guanine (G).
• In solution, thalidomide binds more readily to guanine than to adenine, and has almost no affinity for the other nucleotides, cytosine (C) and thymine (T).
• Furthermore, thalidomide can intercalate into DNA, presumably at G-rich sites.
Remember Thalidomide?• Thalidomide or one of its
metabolites intercalates into these G-rich promoter regions, inhibiting the production of proteins and blocking development of the limb buds.
• This intercalation would not significantly affect the over 90 per cent of genes that rely primarily on guanine sequences.
• Most other developing tissues in the embryo rely on pathways without guanine, and are therefore not affected by thalidomide
Genes can lead to inherited diseases
• A gene which doesn’t function on an autosomal chromosome can lead to devastating diseases
• Autosomal chromosomes are 22 pairs of chromosomes which do not determine gender
• Such diseases can be caused by both a dominant or a recessive trait
Autosomal Recessive Disorders
• Tay-Sachs Disease:– Jewish people in USA (E. Euro descent)– Not apparent at birth– 4 to 8 months
• Neurological impairment evident
• Gradually becomes blind and helpless
• Develops uncontrollable seizures/paralyzed
• Allele is on Chromosome 15– Lack of enzyme hexosaminidase A (Hex A)
• Lysosomes don’t work, build up in brain
Autosomal Recessive Disorders
• Cystic Fibrosis– Most common in USA (Caucasian) – 1 in 20 caucasians is a carrier – Mucus in bronchial and pancreas thick/viscous– Breathing and food digestion problems
• Allele is on chromosome 7– Cl ions can not pass through plasma membrane
channels
• Cl ions pass –water goes with it. No water, thick mucus
Autosomal Recessive Disorders
• Phenylketonuria (PKU)– Affects in in 5,000 newborns– Most common nervous system disorder
• Allele is on chromosome 12– Lack the enzyme needed for the metabolism of the
amino acid phenylalanine– A build up of abnormal breakdown pathway
• Phenylketone
• Accumulates in urine. If diet is not checked, can lead to severe mental retardation
Autosomal Dominant Disorders
• Neurofibromatosis
• Very common genetic disorder
• Tan spots on skin
• Later tumors develop
• some sufferers have large head and ear and eye tumors.
• Allele is on chromosome 17– Gene controls the production of a protein called
neurofibromin– This naturally stops cell growth
Autosomal Dominant Disorders
• Huntington Disease
• Leads to degeneration of brain cells
• Severe muscle spasms and personality disorders
• Attacks in middle age
• Allele is on chromosome 4– Gene controls the production of a protein called
huntington– Too much AA glutamine. Changes size and shape of
neurons
Incomplete Dominant traits
• Sickle Cell Anemia
• Controlled by intermediate phenotypes at a ratio of 1:2:1
• Red blood cells are not concave
• Normal Hemoglobin (HbA). Sickle cell (HbS)
• HbA-HbA-normal Hbs-Hbs – sickle cell
• HbA-Hbs- have the trait
Mutations
- any change in the nucleotide sequence of DNA
Figure 10.21
Normal hemoglobin Sickle-cell hemoglobin
Glu Val
Normal hemoglobin DNA Mutant hemoglobin DNA
mRNA mRNA
Figure 9.21
Individual homozygousfor sickle-cell allele
Sickle-cell (abnormal) hemoglobin
Abnormal hemoglobin crystallizes,causing red blood cells to become sickle-shaped
Sickled cells
Breakdown ofred blood cells
Accumulation ofsickled cells in spleen
Physicalweakness Anemia Heart
failurePain and
feverBrain
damage
Damage toother
organs
Clumping of cellsand clogging of
small blood vessels
Spleendamage
Impairedmental
functionParalysis
Pneumoniaand otherinfections
Rheumatism Kidneyfailure
Genetic engineering• The direct alteration of a genotype
– Human genes can be inserted into human cells for therapeutic purposes
– Genes can be moved from one species to another
• Moving genes from human to human or between species requires the use of special enzymes known as restriction enzymes.– These cut DNA at very specific sites– They restrict DNA from another species – isolated from
bacteria.
Figure 4.1•Each restriction enzyme cuts the DNA at a specific site, defined by the DNA sequence
•Enzymes which produce “sticky ends” are more useful•Allows gene of interest to be inserted into a vector
•Also need a DNA probe•Radioactive ssDNA that will bind to gene of interest so you can locate it
Genetic engineering
Genetic engineering• Transferred DNA is denatured to give ssDNA
• The probe will bind to gene of interest by Complementary base-pairing - A with T and G with C
Genetically engineered insulin
• Why do some people not like the idea?
The plasmid also needs a “marker gene”
This is usually an antibiotic resistance gene
Some people fear that the insulin which is extracted from the bacteria would also contain a gene product to make anyone who uses the insulin resistant to antibiotics!
Gene therapy• Can treat human diseases
– eg – severe combined immune deficiency syndrome (SCIDS)• Bubble- Boy/Girl syndrome
• The enzyme which causes this is on chromosome 20– Called adenosine deaminase (ADA)
• Many problems– Difficult to transfer large genes
– Insert in a way that the gene expresses to protein correctly
– TRANSLATION!!!!!!!!!!!!
Figure 4.4 (5)Gene therapy
Virus has genetic defect to prevent viral reproduction and spreading to other cells
Figure 4.4 (6)Gene therapyVirus vector must get the gene into the nucleus of the patient’s lymphocyte
Figure 4.4 (7)Gene therapyGene has to be incorporated into cell’s DNA where it will be transcribed
Also inserted gene must not break up some other necessary gene sequence
Gene therapy• The genetically engineered lymphocytes injected
into the patient should out grow the “natural” (defective) lymphocytes
• As ADA-deficient cells to not divide as fact as those with the active enzyme
• Not permanent - need repeat injections as injected lymphocytes are mature and have limited life span
• Stem cells would get around this problem (later!)
Genetic Profiling• We could screen everyone’s DNA for mutations.
• How would this affect insurance?
• How would this affect health care?
• What about “reproductive control”?
• What do you think?
Recommended