View
11
Download
0
Category
Preview:
Citation preview
1
Interaction between Root-knot Nematode Meloidogyne
graminicola and Oomycete Pythium arrhenomanes on Rice Roots Md. Zahangir Alam1, 2
1 Department of Molecular Biotechnology, Faculty of Bioscience Engineering, Ghent University, Gent, Belgium 2 M.Sc. in Nematology, Department of Biology, Faculty of Science, Ghent University, Gent, Belgium
Summary - Both production and yield of rice are reduced to a great extent in response to single infection by
Meloidogyne graminicola and single infection by Pythium arrhenomanes. In contrast, increased grain yield of
rice has been reported in the double (P. arrhenomanes and M. graminicola) infected plants compared to single
(M. graminicola) infected plants. This research was designed to study the influence of P. arrenomanes on M.
graminicola and vice-versa in the SAP system adapted for double (P. arrhenomanes and M. graminicola)
infection experiments in our lab. An experiment was also conducted to evaluate the roles of phytohormones-
auxin, jasmonic acid (JA), salicylic acid (SA) and abscisic acid (ABA) on the M. graminicola infection and on
the interaction between P. arrhenomanes and M. graminicola. To study the interaction between P. arrhenomanes
and M. graminicola, rice cultivars Nipponbare and IR81413-BB-75-4 were used for double infection experiments.
To evaluate the role of auxin, a transgenic rice cultivar GH3.1OX which is auxin-deficient and external
applications with 100 µM NAA (auxin) were used. To evaluate the influence of M. graminicola on P.
arrhenomanes infection, GH3.1OX and Bomba were infected with only P. arrhenomanes as well as with both P.
arrhenomanes and M. graminicola, subsequently the DNA of P. arrhenomanes was quantified by qPCR both in
single (P. arrhenomanes) and double (P. arrhenomanes and M. graminicola) infected plants. To evaluate the roles
of JA, several transgenic/ mutant rice lines deficient in JA biosynthesis and signaling were used as well as JA
biosynthesis inhibitor-DIECA (100 µM) or Methyl Jasmonate (100 µM) were applied to rice cultivar Nipponbare.
To study the roles of SA and ABA, shoots of Nipponbare were treated with 100 µM PAL inhibitor-AOPP (results
in less SA biosynthesis) and 50 µM ABA biosynthesis inhibitor (abamine) respectively. To study the roles of
different treatments on the host finding ability of M. graminicola, a novel method as well as mathematical model
for data processing and subsequent analysis were developed in the lab for an in-vitro attraction assay of M.
graminicola. Our results of the double infection experiments suggest that P. arrhenomanes significantly reduces
the number of nematodes, gall formation and development of M. graminicola (only in Nipponbare) per root system
in both rice cultivars. Our results of qPCR suggest that, M. graminicola and internal auxin levels have no
significant impact on the in-planta growth of P. arrhenomanes. In this study, lower endogenous auxin level
significantly reduces the number of nematodes and gall formation both in single and double infected plants.
However, in presence of P. arrhenomanes, lower endogenous auxin level could not reduce gall formation
significantly indicating that P. arrhenomanes derived auxin might complement the endogenous auxin level in the
GH3.1OX line. In contrast, lower endogenous auxin level significantly promoted nematode development both in
single and double infected plants which was assumed to be regulated by the reduced competition of nutrients in the
double infected plants compared to single infected plants. On the other hand, foliar application of NAA slightly
reduces the number of nematodes and gall formation per root system both in absence and presence of P.
arrhenomanes. In this study, JA slightly promotes number of nematodes and gall formation. On the other hand,
in presence of P. arrhenomanes JA slightly reduces the number of nematodes and gall formation per root system,
indicating that the roles of JA on M. graminicola infection are modulated by P. arrhenomanes. In this study,
AOPP and abamine treatment slightly reduces the number of nematodes and gall formation per root system but in
presence of P. arrhenomanes the number of nematodes and gall formation are slightly increased indicating that
the roles of AOPP and abamine on M. gaminicola infection are modulated by P. arrhenomanes. Our results
suggest that the negative influence of P. arrhenomanes on M. graminicola infection is modulated by endogenous
auxin level (only in gall formation), JA level and signaling, SA-biosynthesis and ABA-biosynthesis. Our results
of attraction tests suggest that 100 µM NAA and metabolites of a 25-days old P. arrhenomanes culture
significantly attracts J2 of M. graminicola, while root tips together with root exudates of Oryza glabberrima and
MeJA treated plants and root exudates alone of ethephon treated plants and P. arrhenomanes infected plants
(although not significant) repel J2s of M. graminicola. In contrast to root tips together with root exudates, when
we used only root tips we could not observed any significant attraction or repulsion of J2s of M. graminicola,
indicating that the exudates are important for the host finding ability of the nematode.
Keywords – Antagonism, Phytohormones, qPCR, Root exudates, Metabolites of P. arrhenomanes, Attraction,
Novel method and Mathematical model.
2
1. Background Information
Rice (Oryza sativa L.) being the staple food for more than half of the world population, is one of the most
important food crops in the world (Matsumoto et al., 2005), mainly grown in Asia and provides mostly
carbohydrates among others nutrient elements in the diet (Kennedy & Burlingame, 2003; Yawadio et al., 2007;
Itani & Ogawa, 2004; Kennedy & Burlingame, 2003; Yawadio et al., 2007; Itani & Ogawa, 2004; Suzuki et al.,
2004; Chen et al., 2006). This important food crop is constantly challenged by a number of biotic (insects, fungi,
bacteria, nematodes, oomycetes, viruses among others) and abiotic (salinity, nutrient toxicity, natural disasters,
drought etc.) threats which can cause significant yield loss.
Rice is grown worldwide and adapted to various environmental and cultural conditions for example wetland,
dryland, upland and submerged conditions. Wetland rice is the main cultivation system accounting for 85% of
total production, however it requires a lot of fresh water (Bouman et al., 2007). Recently, aerobic rice, a water
saving rice production technology, is being popularized to reduce the pressure on fresh water. However, with the
introduction of aerobic rice cultivation, root-knot nematode Meloidogyne graminicola and oomycete Pythium
arrhenomanes have become more damaging than before (Kreye et al., 2009).
Pythium spp. range from hemi-biotrophic to necrotrophic pathogens causing significant growth reduction of root
and shoot, root necrosis, pre- and post-emergence death of seedling, has been ranked as one of the 10 most
important oomycetes in the world (Kamoun et al., 2015). Suitable chemical stimuli for example amino acids,
carbohydrates, volatile compounds (ethanol or aldehydes) derived from root and seed exudates, plant debris and
organic matter favor the germination of oospore to germ tube and facilitate the subsequent infection (Stangehellini
& Hancock, 1971; Lifshitz et al., 1986, Nelson 1991; Paulitz, 1991). Van Buyten (2013) reported that in aerobic
rice fields in Philippines; Pythium arrhenomanes, Pythium graminicola and Pythium inflatum were present,
among which P. arrhenomanes is the most virulent pathogen causing root necrosis, severe stunting and damping
off in rice seedlings. Recently it has been reported that the virulence of Pythium spp. is positively correlated with
their root colonization capacity and carbon utilization profile. The root exudates of rice contain several carbon
sources including carboxylic acid and amino acids on which P. arrhenomanes can grow (Van Buyten, 2013).
Meloidogyne spp. are biotrophic pathogens causing significant yield loss in a number of cereal and vegetable
crops, and have been ranked as the number one plant-parasitic nematodes based on scientific and economic
importance (Jones et al., 2013). After hatching the infective second stage juveniles (J2) of Meloidogyne
graminicola localize the elongation zone of the root surface by sensing stimuli present in the root exudates,
penetrate the root by thrusting their stylet, migrate intercellularly, make a U-turn around the vascular bundle, and
select suitable cells (2-12 in number) in the vascular bundle to induce giant cells (multinucleate, 100x larger than
normal cell) by reprogramming several morphological and physiological processes (Kyndt et al., 2013; Kyndt et
al., 2014; Ji et al., 2013). Then they produce characteristic knot/gall like structures, keep the cells/plants alive
and inhibit absorption as well as upward translocation of water and nutrients by the root system. As a result they
reduce plant height, root and shoot biomass, tiller number, leaf area index, cause seedling wilt in case of severe
infection, and finally reduce the yield of the plant (Bridge et al., 2005; Bimpong et al., 2010; Plowright & Bridge,
1990).
In order to establish successful infection, a pathogen must come in direct contact with the host plants. Upon
physical contact, an interaction between plant and pathogen occurs, which might be compatible or incompatible.
In a compatible interaction virulent pathogens overcome the constitutive and induced physical and biochemical
barriers of the plants and cause successful infection. On the other hand, in an incompatible interaction avirulent
pathogens cannot overcome these barriers and in some cases their spread within the plants will be restricted by
localized cell death or hypersensitive response. In the case of this kind of response, a biotrophic pathogen is
restricted since it can only grow on living tissue. In a natural ecosystem, plants are usually infected by more than
one pathogen simultaneously, causing pathogens to interact with each other in a same ecological niche. This
3
interaction among pathogens might be antagonistic (one pathogen suppresses the another pathogen) or synergistic
(one pathogen favors another pathogen) and this will determine the yield losses in the double infected plants
compared to single infected plants.
For both P. arrhenomanes and M. graminicola, yield reduction has been observed. The yield reduction in the
single infected rice plant by M. graminicola can range between 20 to 70% (Pokharel et al., 2007; Soriano et al.,
2000; Padgham et al., 2004). On the other hand, P. arrhenomanes can cause growth reduction of the rice root by
70% and shoot by 48% (Cother & Gilbert, 1993; Eberle et al., 2007). Severe infection by P. arrhenomanes can
cause pre and post emergence seedling death, hence total yield loss can occur. On the other hand, rice seedlings
can survive and recover from Pythium infection if the pathogen are not virulent and if there was a low density of
Pythium spp. in the soil. Double infections between root-knot nematodes and fungi/oomycetes have been reported
before. Meloidogyne spp. and Fusarium spp. on tobacco (Porter & Powel, 1967), on alfalfa (Griffin and Thyr,
1988), M. incognita and Belonolaimus longicaudatus with P. aphanidermatum on Iceberg chrysanthemum
(Johnson & Litrell, 1970) made the plants more vulnerable than single infection. However, an antagonistic
interaction between P. arrhenomanes and M. graminicola in rice has been reported (Verbeek et al., 2016). The
underlying mechanisms governing the interaction between P. arrhenomanes and M. graminicola are still not
clear.
The growth, yield and resistance of plants to biotic and abiotic stress are regulated by a number of phytohormones.
Phytohormones mediated resistance in plants can be plant, organ, as well as tissue specific. Many studies show
differences in regulation of phytohormones between monocots and dicots, as a result the outcome of hormonal
signaling in model organism Arabidopsis thaliana, cannot be extrapolated to rice. Even the outcome of hormonal
signaling in rice shoots cannot be extrapolated to rice roots. It is generally understood that auxin, cytokinin,
brassinosteroid, and abscisic acid play important roles in growth and development of plants, whereas salicylic
acid, ethylene and jasmonic acid play crucial roles in plant defence. However, more and more evidence is found
that all hormones play a role in defense (De Vleesschauwer et al., 2013). Soil-borne microorganisms modify the
root system by exploiting a number of growth hormones (Brassinosteroids, auxin, cytokinin, gibberellin and
abscisic acid) for their own benefits to facilitate root colonization and to suppress root immunity (Van Buyten,
2013; Yang et al., 2012; Albrecht et al., 2012; De Vleesschauwer et al., 2012). In contrast it has been reported
that jasmonate interferes with gibberellin signaling pathway to prioritize plant defense over growth (Yang et al.,
2012). Recently, tradeoff between growth and immunity of plant has been reported which is mediated by cross-
talk between growth hormone and defense hormone (Pieterse et al., 2009 and Huot et al., 2014).
Rice root immunity to Pythium spp. is mediated by salicylic acid and gibberellic acid signaling, whereas rice root
susceptibility to Pythium spp. is mediated by auxin, brassinosteroids and SLR1 signaling. Pythium inoculation
suppress the rice root immunity by promoting brassinosteroids and auxin signaling in rice and by suppressing
salicylic acid and gibberellic acid signaling (Van Buyten, 2013).
On the other hand, rice root immunity to M. graminicola is regulated by the phythormones salicylic acid (SA),
jasmonic acid (JA) and ethylene (ET) signaling, while rice root susceptibility to M. graminicola is regulated by
ABA and BR signaling. Exogenous application of salicylic acid and jasmonic acid suppresses M. graminicola
infection by suppressing ABA and BR signaling. Similarly, exogenous application of ET suppresses M.
graminicola infection by suppressing ABA and promoting JA signaling in rice (Kyndt et al., 2014). Upon
infection, the nematode stimulates ABA synthesis to suppress SA and JA mediated root defense and thereby
facilitating infection. However, the role of auxin, jasmonic acid, salicylic acid and abscisic acid are not yet clear
when the rice root is infected by both P. arrhenomanes and M. graminicola.
The outcome of hormonal defense depends on the biosynthesis, transportation, signaling pathways of each
hormone and finally cross-talk with other hormones. In healthy plants, the biosynthesis and signaling pathways
of the defense hormone remain inactivated, but in response to exogenous application of that particular hormone
or in response to pathogen attack, the biosynthesis and signaling pathways of the defense hormones become
4
active, facilitate the expression of hormone responsive defense gene and subsequently confer resistance to the
pathogens. On the other hand, in response to the exogenous application of inhibitor of a particular hormone the
biosynthesis and downstream signaling of that particular hormone is blocked.
Recently it has been reported that auxin is produced by Pythium spp. in vitro and contribute to elevated auxin
level in rice, thereby inducing auxin signaling and make the rice seedlings susceptible to Pythium infection (Van
Buyten, 2013). Recently, it has been reported that auxin is required for the gall formation and expansion (Kyndt
et al., 2016). The role of P. arrhenomanes and its secreted auxin in nematode-induced gall formation and
subsequent development of nematode still remain elusive.
In order to infect the host plants, plant-parasitic nematodes have to localize the suitable host surface. Root
exudates present in the rhizosphere help nematodes to localize the root surface. It has been reported that IAA
binds to the amphids, phasmids and surface cuticle of Meloidogyne incognita and thereby helps the nematodes to
orientate and localize the root surface of the host (Curtis, 2009). Recently, it has been reported that auxin facilitate
the host finding of the nematodes Aphelenchoides besseyi (Feng et al., 2014). Kammerhofer et al., (2015) and
Wubben et al., (2001) reported that activation of ethylene biosynthesis and signaling pathways favors the
attraction of cyst nematode- Heterodera schachtii, in contrast Fudali et al., (2013) reported that roots of ethylene
overproducing mutant repel Meloidogyne hapla. However, the role of auxin, jasmonic acid and ethylene are not
yet clear in host finding of J2 of M. graminicola.
In order to explore the aforementioned existing lack of information, it might be interesting to further investigate
the types of interaction and the underlying mechanism governing the interaction between P. arrhenomanes and
M. graminicola on rice roots; to find out the role of auxin, jasmonic acid, salicylic acid, and abscisic acid in the
interaction between oomycete P. arrhenomanes and root-knot nematode M. graminicola; to further investigate
the role of P. arrhenomanes on root penetration, gall formation and subsequent development of M. graminicola
inside rice roots and to find out the host finding agent of J2 of M. graminicola in the rhizosphere of rice. So, the
objectives of this research project are as follows:
To investigate the role of P. arrhenomanes on the root penetration, gall formation, and development of
M. graminicola
To investigate the role of auxin, jasmonic acid, salicylic acid, and abscissic acid in the Pythium
arrhenomanes - Oryza sativa - Meloidogyne graminicola interaction
To investigate the role of M. graminicola on the root colonization and multiplication of P. arrhenomanes
inside the rice roots
To investigate the role of P. arrhenomanes, auxin, jasmonic acid and ethylene on the host finding of M.
graminicola
5
2. Materials and Methods
2. 1 Maintenance of Pythium arrhenomanes and Meloidogyne graminicola culture: P. arrhenomanes was
isolated from the soil of aerobic rice fields in the Philippines (Van Buyten, 2013). P. arrhenomanes was cultured
and maintained following the method of Verbeek et al., (2016). For the preparation of inoculum, one P.
arrhenomanes containing agar plug was transferred to the center of a new PDA plate and kept in the incubator at
30ºC for 3 days. M. graminicola was maintained on susceptible rice cultivar-Nipponbare at 25ºC light dark regime
16/8h.
2. 2 Methodology for extraction of second stage juveniles (J2) of Meloidogyne graminicola: Around 3 month
old M. graminicola infected rice plants cv. Nipponbare were collected. The J2 of M. graminicola were extracted
with modified Baermann funnel method (Hooper et al., 2005; Luc et al., 2005). After 72 hours, the juveniles were
collected. Juvenile suspension was concentrated by centrifugation (1500 rpm) to 166 J2/ml.
2. 3 Methodology for double infection experiment: Seeds of IR81413-BB-75-4 and Nipponbare (to study the
type of interaction), Bomba and GH3.1OX (to study the role of auxin), COI1-18 – transgenic RNAi lines impaired
in JA signaling (Yang et al., 2012) and NC2728- JA biosynthesis mutant (Riemann et al., 2008) (to study the role
of jasmonic acid) were used in our experimentS. Seeds of these cultivars were soaked in 4% sodium hypochloride
solution and kept in a shaker for 15 minutes. Then the seeds were washed off with sterile water for three times.
Seeds were germinated on paper towel for 2 days 16/8h light regime at 31ºC.The germinated seeds were
transplanted into a plastic tube filled with sand + absorbent polymer (SAP). Before transplanting each SAP tube
was provided with 10 mL distilled water. The plants were grown at 28°C. The light (150 μmol m−2 s−1) /dark ratio
was 12-h/12-h and relative humidity was 70% to 75% (Nahar et al., 2011). At five days after germination, two P.
arrhenomanes plugs (4 mm) were used to inoculate each seedling, by placing them in two holes around the
seedling opposite to one another. The P. arrhenomanes plugs were inoculated to the holes in such a way so that
the inoculum containing side of the plug gets in contact with the root system. The control plants were also
inoculated with sterile agar plugs in the same way of P. arrhenomanes inoculation. After inoculation each plant
was provided with 10 mL distilled water. This was done very carefully and slowly so that the inoculum does not
float. After 4 days of P. arrhenomanes inoculation, each rice seedling was inoculated with 250 J2 of M.
graminicola. Each plant was provided with 10 mL Hoagland solution every two days until harvesting.
2. 4 Chemical treatments in the double infection experiment: 100 µM Naphthalene Acetic Acid-NAA
(Auxin); 100 µM Methyl Jasmonate-MeJA (a JA conjugate); 100 µM Diethyldithiocarbamic Acid-DIECA-JA
biosynthesis inhibitor (Doares et al., 1995); 100 µM alpha-aminooxy-beta- phenylpropionic acid-AOPP-PAL
inhibitor result in less SA biosynthesis (Massala et al., 1987); 50 µM abamine - ABA biosynthesis inhibitor
(Kitahata et al., 2006) solution were used for spraying to investigate the role of auxin and JA as well as to study
the role of SA and ABA in the antagonistic interaction. Twenty µL Tween 20 was added to 50 mL working
solution and mixed thoroughly by shaking. The hormones and inhibitors solution were sprayed on the shoot of
rice seedlings (after 6 days of transplanting and 24 hrs before nematode inoculation) under a fume hood. Time
schedule of a double infection experiment is shown in figure 1.
Figure 1. Layout of interaction experiments between P. arrhenomanes and M. graminicola on rice roots over
time.
6
After 12 days of nematode inoculation, the rice seedlings were harvested. Data were recorded on root length,
shoot length, root fresh weight, and root necrosis. The root system of P. arrhenomanes single infected plants and
double (P. arrhenomanes infected and M. graminicola) infected plants of Bomba and GH3.1OX were preserved
in -80̊ C for extraction of DNA and subsequent detection and quantification of P. arrhenomanes in single infected
and double infected plants of both cultivars.
2. 5 Fuchsin staining for gall/nematode visualization: The gall containing root system was stained with 0.013%
acid fuchsin and 0.8% acetic acid for 3 minutes to visualize gall and nematodes (Verbeek et al., 2016), then few
mL acid glycerol was added to each well of 6 well plate for destaining the root system. The stained root placed
on 6-well plate was kept in a shaker for some days. The number of gall per root system of single (M. graminicola)
infected and double (M. graminicola and P. arrhenomanes) infected plants were counted under microscope. The
numbers of galls and different life stages (J2, J3/J4, Female, and Female with eggmass) of M. graminicola were
also counted.
2. 6 Methodology for detection and quantification of Pythium arrhenomanes in rice roots: The DNA was
extracted from the preserved root sample of P. arrhenomanes infected as well as P. arrhenomanes and M.
graminicola infected plants of Bomba and GH3.1OX using the protocol of DNeasy Minikit (Qiagen). After
extraction the concentration and purity of DNA was measured with the help of Nano-drop (Isogen life science-
thermo scientific). Polymerase Chain Reaction (PCR) was done for the amplification of a specific length of DNA.
The mastermix for 10 samples was prepared as follows: milliQ water (119 µL); buffer-10X (20 µL); DNTPs - 25
mM (10 µL); forward primer -10 µM (10 µL); reverse primer -10 µM (10 µL); and Taq polymerase (2 µL). The
mastermix was mixed well. Then 20 µL of mastermix and 5 µL of template DNA were added in to PCR tube and
mixed properly. The PCR tubes were inserted in the Bio-Rad PCR machine and run as follows: 95̊ C for 10
minutes (Denaturation), 95ºC for 30 seconds, 58ºC for 40 seconds (Annealing), 72ºC for 25 seconds (Elongation),
then GO TO STEP 2 for 34X, then 72ºC for 5 minutes and 12º C for infinite. After PCR, the amplified DNA was
run in agarose gel, then stained with EtBr and documented under UV light. Based on the presence of band, the P.
arrhenomanes was detected in the root sample. To quantify the infection pressure of P. arrhenomanes, a
Quantitative Real Time PCR (qPCR) was done as follows:
Table 1. List of primer sets and their sequences used for the amplification of target sequence and subsequent
quantification of P. arrhenomanes DNA for qPCR.
Primer Sequences
Pythium arrhenomanes ATTCTGTACGCGTGGTCTTCCG (PT60 ITS Forward) and
ACCTCACATCTGCCATCTCTCTCC (PT60 ITS Reverse)
Plant TTCTCCTCCCAATCGTCTCG (Plant Exp Forward) and
TTAGGTGGAGGGAGCGAATC (Plant Exp Reverse)
For the preparation of sample mixture; 56 µL milliQ water was added to 56 µL sample DNA. After mixing it
thoroughly, the sample mixture was kept on ice. For No Template Control ( NTC), no sample was added to the
water and for Interrun-Calibrator (IRC), 16 µL plant sample was added to 48 µL water. For the preparation of
mastermix; 40µL of forward primer and 40µL of reverse primer were added in a brown tube. Then 400 µL
supermix was added to the brown tube and mixed thoroughly by pipetting several times. Special care was taken
to avoid any bubble formation in the mastermix. Then with the help of robotics machine; sample mix was mixed
with mastermix in the 96-well plate. After mixing, the 96-well plate was wrapped with plastic paper and rotated
for 30 seconds with the help of a manual rotator. Then the 96 well plate was put on the Bio-Rad Q PCR machine.
After completion of qPCR the data on Cq values were saved in excel file and the P. arrhenomanes DNA in rice
roots was quantified using a standard equation for P. arrhenomanes DNA.
7
2. 7 Methodology for attraction test of Meloidogyne graminicola: The second stage juveniles of M.
graminicola were used for attraction tests. Square plates (12 x 12 cm) were used for design of the attraction test
system. Plates were filled with 2% water agar. The square petridish was subdivided into four small sections. Then
24 longitudinal lines (within 6 cm length) were drawn at the center of each small section for movement scoring
purposes. In the middle a channel was created of 8 cm length with agar filled plastic straw. The one channel was
supplied with test treatment and another channel was supplied with control treatment. The treatments used in this
experiment were 2M NaCl solution; 100 µM NAA solution; 100 µM JA solution; root tip of P. arrhenomanes
infected plants; root tip of 100 µM NAA and 100 µM DIECA treated plants; root tips of GH3.1OX (less
endogenous free auxin compared to it’s wild type Bomba); root tips of Hebiba-JA biosynthesis mutant (Reinmann
et al., 2003); root tips and root exudates of 100 µM MeJA treated plants; root tip and root exudates of Oryza
glabberrima- resistant to plant-parasitic nematodes (Finkers-Tomczak et al.); root exudates of 400 µM ethephon
treated plants-precursor of ethylene, releases ethylene after decomposition in the plant (Weis et al., 1988); root
exudates of P. arrhenomanes infected plants and 25 days old P. arrhenomanes metabolites. Five µL nematode
suspensions containing 30 J2s of M. graminicola (on average) were carefully pipetted at the very center point of
each channel. Then the movement of nematodes was continuously monitored for 75 minutes. Data on number of
nematodes per small division were recorded at 0 minute and 70 minutes after nematodes inoculation.
Figure 2. Layout of a novel method developed and optimized in the lab for in-vitro attraction assay of root-knot
nematode M. graminicola.
2. 8 Statistical Analysis: The data were analyzed by SPSS Statistics 23 program. For the data having normal
distribution and homogeneous variances, were analyzed by Independent Sample T-Test (for less than 5
treatments) and one-way ANOVA with Duncan’s Post Hoc Test (for ≥ 5 treatments). For the data not having
normal distribution and homogeneous variances, were analyzed with Mann-Whitney U non-parametric test. Data
of attraction tests were analyzed by Paired-Sample T-Test. For all experiments, p value less than 0.05 was
considered as significant differences between the treatments.
8
3. Results
3. 1 Interaction between Pythium arrhenomanes and Meloidogyne graminicola
It is known that M. graminicola and P. arrhenomanes antagonize each other under raised bed and greenhouse
conditions with cultivar IR81413-BB-75-4 (Verbeek et al., 2016). To confirm if the interaction is also apparent
under our lab conditions, we do need to further investigate the interactions. The rice cultivars Nipponbare and
IR81413-BB-75-4 were used to study the interaction between P. arrhenomanes and M. graminicola. Number of
nematodes and galls per root system (Figure 3. A, B, C, D) were significantly reduced in the double (P.
arrhenomanes and M. graminicola) infected plants of both cultivars compared to single (M. graminicola) infected
plants. This showed that P. arrhenomanes reduced root penetration and gall formation in both cultivars under our
experimental settings.
The development of M. graminicola was significantly delayed in the double infected plants compared to single
infected plants in Nipponbare (Figure 3. E). In contrast, there was no significant difference in terms of
development of nematodes between single infected plants and double infected plants of IR81413-BB-75-4 (3. F).
3. 1. A Role of auxin in the interaction between Pythium arrhenomanes and Meloidogyne graminicola in
rice roots
It is known that auxin plays an important role in gall formation and expansion (Kyndt et al., 2016). It was therefore
studied if less free auxin in GH3.1OX (Domingo et al., 2009) compared to its wild-type Bomba could have an
effect on the interaction. Our results showed that, lower endogenous auxin level in GH3.1OX significantly
reduced nematode penetration and gall formation both in single (M. graminicola) infected and double infected
plants compared to Bomba (Figure 4. A, B) although the reduction of gall formation in the double infected plants
was not significant (Figure 4. B). On the other hand, lower endogenous auxin promoted nematode development
significantly both in single and double infected plants (Figure 4. C). If we observe the roles of P. arrhenomanes
on M. graminicola in this experiment, we can see that, P. arrhenomanes significantly reduced nematode
penetration and gall formation both in Bomba and GH3.1OX (Figure 4. A, B) although the reduction of gall
formation was not significant in GH3.1OX (Figure 4. B), in contrast P. arrhenomanes significantly promoted gall
formation in Bomba but P. arrhenomanes had no significant impact on development of M. graminicola in
GH3.1OX (Figure 4. C).
9
Figure 3. Meloidogyne graminicola infection data at 16 days post inoculation (dpi) of Pythium arrhenomanes
and 12 dpi of M. graminicola in the interaction experiment between these two root pathogens . Number of
M. graminicola per root system in Nipponbare (A) and IR81413-BB-75-4 (B); number of gall per root system
in Nipponbare (C) and IR81413-BB-75-4 (D); percentage of developmental stages of M. graminicola in
Nipponbare (E) and IR81413-BB-75-4 (F). Bars represent mean ± standard error with 12 replications for
Nipponbare and 15 replications for IR81413-BB-75-4. Different letters indicate statistically significant
different between the treatments (P < 0.05). Data on number of nematodes and number of gall per root system
were analyzed by Independent Sample T-Test. Data on percentage of developmental stages of M. graminicola
were analyzed by Mann-Whitney U non-parametric test.
10
Figure 4. Role of auxin on the nematode infection in the M. graminicola infected plants and P. arrhenomanes
+ M. graminicola infected plants. M. graminicola infection data after 16 days post inoculation (dpi) of P.
arrhenomanes and 12 dpi of M. graminicola in the interaction experiment between these two root pathogens.
Number of M. graminicola per root system (A); number of gall per root system (B); percentage of
developmental stages of M. graminicola (C). Bars represent mean ± standard error with 8 replications.
Different letters indicate statistically significant difference between the treatments (P < 0.05). Data on number
of nematodes were analyzed by Mann-Whitney U non-parametric test. and number of gall per root system
were analyzed by Independent Sample T-Test. Data on percentage of developmental stages of M. graminicola
were analyzed by Mann-Whitney U non-parametric test.
0
20
40
60
80
100
120
140
160
180
200
M. graminicola P. arrhenomanes + M. graminicola
Bomba GH3.1OXNu
mbe
rof n
emat
odes
per
root
syst
emA
a
b
b
c
0
10
20
30
40
50
60
M. graminicola P. arrhenomanes + M. graminicola
Bomba GH3.1OX
Num
bero
f gal
ls pe
r roo
t sys
tem
B
a
b bb
11
3. 1. B Role of M. graminicola and auxin on the in planta growth of Pythium arrhenomanes
For the formulation and prescription of effective control measures, accurate diagnosis of plant pathogens and
quantification of infection pressure are essential. Several authors identified and quantified the infection pressure
of plant pathogens by qPCR (Brouwer et al., 2003; Gachon & Saindrenan, 2004; Zhang et al., 2005; Lievens et
al., 2006; Kernaghan et al., 2008). Here, for accurate detection and quantification of infection pressure of the
oomycete P. arrhenomanes in rice roots, we did qPCR on DNA of single (P. arrhenomanes ) infected and double
(P. arrhenomanes & M. graminicola) infected root samples of Bomba and GH3.1OX (which contains less free
auxin compared to Bomba. We detected and quantified P. arrhenomanes DNA both in single and double infected
plants of Bomba and GH3.1OX. Our results also showed that M. graminicola slightly retards (not significant) in
planta growth of P. arrhenomanes within the root system in Bomba but not in GH3.10X (less amount of free
auxin) (Figure 5 ). Our results also demonstrated that the level of auxin in the plant did not play any significant
roles on the in-planta growth of P. arrhenomanes both in the single (P. arrhenomanes) and double (P.
arrhenomanes and M. graminicola) infected plants (Figure 5).
Figure 5. In planta quantification of P. arrehenomanes DNA with qPCR in rice cultivars Bomba and GH3.1OX.
The DNA of P. arrhenomanes was quantified in single infected (P. arrhenomanes) and double infected (P.
arrhenomanes and M. graminicola) roots of both cultivars. Bars represent mean ± standard error with 3
replications. Similar letter on error bar indicate statistically non-significant differences among the treatments (p
> 0.05). Data were analyzed by Duncan Multiple Range Test.
To further elucidate the role of auxin in the interaction between P. arrhenomanes and M. graminicola , rice shoots
(cv. Nipponbare) were sprayed with 100 µM NAA (an active auxin form). In contrast to Bomba, where high
endogenous auxin compared to GH3.1OX promoted root penetration and gall formation; spraying with NAA,
slightly reduced root penetration and gall formation in the single (M. graminicola) and double (P. arrhenomanes
and M. graminicola) infected roots in comparison to control rice plants (no NAA treatment) although it was not
statistically significant (Figure 6. A, B ). NAA treatments did not show any significant roles on nematode
development (Figure 6. C). In this experiment, P. arrhenomanes slightly reduced (not significant) nematode
penetration and gall formation both in the control and NAA treated plants (Figure 6. A, B ). P. arrhenomanes
did not show significant impact on nematode development (Figure 6. C).
12
Figure 6. Role of 100 µM NAA spraying on the nematode infection in the M. graminicola infected plants and P.
arrhenomanes + M. graminicola infected plants. M. graminicola infection data after 16 days post inoculation (dpi) of
P. arrhenomanes and 12 dpi of M. graminicola in the interaction experiment between these two root pathogens. Number
of M. graminicola per root system (A); number of gall per root system (B); percentage of developmental stages of M.
graminicola (C). Bars represent mean ± standard error with 10 replications. Similar letters indicate statistically non-
significant difference between the treatments (p > 0.05). Data on and number of gall per root system were analyzed by
Duncan Multiple Range Test. Data on number of nematodes and percentage of developmental stages of M. graminicola
were analyzed by Mann-Whitney U non-parametric test.
13
3. 1. C Role of jasmonic acid (JA) in the interaction between Pythium arrhenomanes and Meloidogyne
graminicola in rice roots: It was reported that, exogenous application of MeJA reduced the seedling mortality
to P. arrhenomanes, and increased the root length and shoot length of Pythium infected rice, in contrast MeJA
application reduced root length and shoot length in healthy plants (Van Buyten, 2013). On the other hand, mutual
antagonistic interaction prevails between JA and root-knot nematode (Kyndt et al., 2014). However, to know the
role of JA in the interaction between these two pathogens on rice roots, we used a number of rice cultivars
deficient in JA biosynthesis as well as used JA biosynthesis inhibitor (DIECA) and jasmonate conjugate (MeJA).
Our results showed that number of nematodes (significantly) and gall formation were slightly reduced in response
to JA inhibitor (DIECA) and in COI1-18 – transgenic RNAi line impaired in JA signaling (Yang et al., 2012) and
in NC2728- JA biosynthesis mutant in the single (M. graminicola) infected plants (Figure 7. A, B). In contrast,
nematodes numbers and gall formation were slightly increased (although not significant) in response to MeJA
spraying in the single (M. graminicola) infected plants (Figure 7. A, B). However, the roles of JA inhibitor and
JA biosynthesis and signaling mutant/transgenic lines on nematode establishment were slightly lost in the double
infected plants (Figure 7. A, B). Our experimental results also demonstrated that, JA had no significant influences
on nematode development both in the single and double infected plants (Figure 7. C). If we observe the roles of
P. arrhenomanes in this experiment, we can see that P. arrhenomanes slightly antagonized nematode
establishment (penetration and gall formation) in the control plants but the antagonistic roles of P. arrhenomanes
on M. graminicola was slightly lost in JA biosynthesis and signaling mutant/transgenic lines and also in JA
inhibitor treated plants (Figure 7. A, B). On the other hand, P. arrhenomanes did not have any significant effects
on development of nematodes both in control and in JA biosynthesis and signaling mutant/transgenic lines and
also in JA inhibitor and MeJA treated plants (Figure 7. C).
3. 1. D Role of salicylic acid (SA) inhibitor in the interaction between Pythium arrhenomanes and
Meloidogyne graminicola in rice roots: It is known that salicylic acid activate rice root immunity to Pythium
spp., in contrast Pythium inoculation suppresses SA biosynthesis and signaling (Van Buyten, 2013), on the other
hand, mutual negative interaction prevails between SA and M. graminicola (Kyndt et al., 2014). However, to
study the role of SA in the interaction between these two root pathogens, we used PAL inhibitor (AOPP) as foliar
application. Our results showed that SA inhibitor slightly decreased (not significant statistically) the nematode
penetration and subsequent gall formation in the single infected plants, in contrast, SA inhibitor slightly increased
(not significant statistically) nematode penetration and subsequent gall formation in the double infected plants
(Figure 8. A, B). SA inhibitor did not show any significant roles on nematode development (Figure 8. C).In this
experiment, P. arrhenomanes antagonize nematode penetration and gall formation in the control plants but the
roles of P. arrhenomanes to antagonize nematode establishment in the AOPP treated plant are lost rather it
increases nematode establishment (Figure 8. A, B). P. arrhenomanes did not show any significant roles on
nematode development both in control and AOPP treated plants (Figure 8. C)
3. 1. E Role of abscisic acid (ABA) inhibitor in the interaction between Pythium arrhenomanes and
Meloidogyne graminicola in rice roots: Foliar application of ABA promotes the induction of proteinase inhibitor
II, thus interferes the development of root-knot nematodes (Karimi et al., 1995). It has also been reported that
exogenous application of ABA induces the upregulation of three thionin genes encoding for antimicrobial
peptides and over expression of these genes suppress Pythium graminicola and M. graminicola (Ji et al., 2015).
On the other hand, it has been reported that ABA promotes the infection of Hirschmanniella oryzae (Nahar et al.,
2012). To further elucidate the roles of ABA in the interaction between P. arrhenomanes and M. graminicola on
rice roots, we used ABA inhibitor (abamine). Our results showed that, foliar application of abamine slightly
decreased (not significant) nematode establishment (penetration and gall formation) in the single infected plants
(Figure 9. A, B). In contrast, ABA inhibitor slightly increased (not significant) establishment in the double
infected plants (Figure 9. A, B). However, ABA inhibitor did not show any significant roles on nematode
development (Figure 9. C). In this experiment, P. arrhenomanes slightly antagonized nematode establishment in
the control plants but the roles of P. arrhenomanes to antagonize nematode establishment in the abamine treated
plant were lost rather it slightly increased nematode establishment (Figure 9. A, B).
14
Figure 7. Role of jasmonic acid (JA) on the nematode infection in the M. graminicola infected plants and P.
arrhenomanes + M. graminicola infected plants. M. graminicola infection data at 16 days post inoculation (dpi) of P.
arrhenomanes and 12 dpi of M. graminicola in the interaction experiment between these two root pathogens. Number
of M. graminicola per root system (A); number of gall per root system (B); percentage of developmental stages of M.
graminicola (C). Bars represent mean ± standard error with 10 replications. Asterisks indicate statistically significant
difference between the treatment and control plant (P < 0.05). Data on and number of gall and nematodes per root system
and percentage of developmental stages of M. graminicola were analyzed by Mann-Whitney U non-parametric test.
0
10
20
30
40
50
60
70
80
90
100
M. graminicola P. arrhenomanes + M. graminicola
Nipponbare (Control) Nipponbare + 100 µM DIECA
COI1-18 (JA biosynthesis RNAi) Nipponbare + 100 µM MeJA (JA biosynthesis)
NC2728 (JA biosynthesis transgenic)
AN
umbe
r of n
emat
odes
per
root
sys
tem
* *
Non-significant with control
0
5
10
15
20
25
30
M. graminicola P. arrhenomanes + M. graminicola
Nipponbare (Control) Nipponbare + 100 µM DIECA
COI1-18 (JA biosynthesis RNAi) Nipponbare + 100 µM MeJA (JA biosynthesis)
NC2728 (JA biosynthesis transgenic)
Num
ber o
fgal
ls p
er ro
ot s
yste
m
BNon-significant with control Non-significant with control
0
10
20
30
40
50
60
70
80
90
100
Nipponbare(Control)
Nipponbare+ 100 µM
DIECA
COI1-18 (JAbiosynthesis
RNAi)
Nipponbare+ 100 µMMeJA (JA
biosynthesis)
NC2728 (JAbiosynthesistransgenic)
Nipponbare(Control)
Nipponbare+ 100 µM
DIECA
COI1-18 (JAbiosynthesis
RNAi)
Nipponbare+ 100 µMMeJA (JA
biosynthesis)
NC2728 (JAbiosynthesistransgenic)
J2 J3/J4 Female Female with eggmasses Male
M. graminicola P. arrhenomanes + M. graminicola
Perc
enta
ge o
f nem
atod
espe
r st
age
CNon-significant with control Non-significant with control
15
Figure 8. Role of salicylic acid (SA) inhibitor (100 µM AOPP) on the nematode infection in the M. graminicola
infected plants and P. arrhenomanes + M. graminicola infected plants. M. graminicola infection data at 16 days post
inoculation (dpi) of P. arrhenomanes and 12 dpi of M. graminicola in the interaction experiment between these two root
pathogens. Number of M. graminicola per root system (A); number of gall per root system (B); percentage of
developmental stages of M. graminicola (C). Bars represent mean ± standard error with 10 replications. Similar letters
indicate statistically non-significant difference between the treatments (P > 0.05). Data on number of gall and nematodes
per root system were analyzed by Independent Sample T- Test and percentage of developmental stages of M.
graminicola were analyzed by Mann Whitney U Non-Parametric Test.
0
10
20
30
40
50
60
70
80
M. graminicola P. arrhenomanes + M. graminicola
Nipponbare Nipponbare + 100 µM AOPP
Aa
a
a
a
Num
ber o
f nem
atod
es p
er ro
ot s
yste
m
0
5
10
15
20
25
M. graminicola P. arrhenomanes + M. graminicola
Nipponbare Nipponbare + 100 µM AOPP
Num
ber o
f gal
ls p
er ro
ot s
yste
m
Ba
a
a
a
0
10
20
30
40
50
60
70
80
90
100
Nipponbare Nipponbare + 100 µM AOPP Nipponbare Nipponbare + 100 µM AOPP
M. graminicola P. arrhenomanes + M. graminicola
J2 J3/J4 Female Female with eggmasses Male
Perc
enta
ge o
f nem
atod
es p
er st
age
Ca a a a
16
Figure 9. Role of abscissic acid (ABA) inhibitor (50 µM abamine) on the nematode infection in the M. graminicola
infected plants and P. arrhenomanes + M. graminicola infected plants. M. graminicola infection data after 16 days post
inoculation (dpi) of P. arrhenomanes and 12 dpi of M. graminicola in the interaction experiment between these two root
pathogens. Number of M. graminicola per root system (A); number of gall per root system (B); percentage of
developmental stages of M. graminicola (C). Bars represent mean ± standard error with 10 replications. Similar letters
on the error bars indicate statistically non-significant differences between the treatments (P > 0.05). Data on number of
gall and nematodes per root system were analyzed by Independent Sample T-Test. Data on percentage of developmental
stages of M. graminicola were analyzed by Mann Whitney U Non-Parametric Test.
0
10
20
30
40
50
60
70
80
M. graminicola P. arrhenomanes + M. graminicola
Nipponbare Nipponbare + 50 µM Abamine
Num
ber o
f nem
atod
es p
er ro
ot sy
stem
Aa
aa
a
0
5
10
15
20
25
M. graminicola P. arrhenomanes + M. graminicola
Nipponbare Nipponbare + 50 µM Abamine
Num
ber o
f gal
ls pe
r roo
t sys
tem Ba a
a
a
0
10
20
30
40
50
60
70
80
90
100
Nipponbare Nipponbare + 50 µMAbamine
Nipponbare Nipponbare + 50 µMAbamine
M. graminicola P. arrhenomanes + M. graminicola
J2 J3/J4 Female Female with eggmasses Male
Perc
enta
ge o
f nem
atod
es p
er st
age
Ca a a a
17
3. 2 Development of a novel method for the in-vitro host finding assay of second stage juveniles (J2s)
of Meloidogyne graminicola : A novel method for the in-vitro host finding assay of infective second
stage juveniles of M. graminicola was developed and optimized in the lab as follows:
A. Calibration of the Square Petridish: The square petridish is subdivided into four small sections by
drawing with marker pen (Figure 10. A). Then 24 longitudinal lines (within 6 cm length) are drawn at
the center of each small section which will facilitate the monitoring of nematodes over time. The central
longitudinal line is drawn with blue colored pen to facilitate the inoculation of J2s of M. graminicola at
the center point of square petridish. Then the square petridish is labelled with the name of treatments
randomly.
B. Preparation of plastic straw: A number of 1 cm diameter plastic straws are cut in 8 cm length. Then
the plastic straws are filled with 2% water agar to add some weights which in turn will facilitate to make
smooth channel on 2% water ager. After few minutes the agar is solidified within the plastic straws
(Figure 10. B).
C. Preparation of channel in the square petridish: Under laminar air flow cabinet 50 mL, 2% water agar
is poured on the plastic petridish (Figure 10. C). After few minutes the water agar is solidified. Then 4
agar filled plastic straws are placed in parallel with each other per square petridish (Figure 10. D), then 1
cm length plastic straws are place in vertical line with large straws (Figure 10 E). After that, again 50
mL, 2% water agar is poured. After solidification of the water agar, the agar filled plastic straws are
removed. As a result, smooth channel are made on the agar plate which is used for the inoculation of
treatments and nematodes for the attraction test (Figure 10. F).
D. Attraction test of infective juveniles of Meloidogyne graminicola: The prepared square petridish is
placed on the stage of microscope. The one channel is filled with test treatment (90 µL) and another
channel is filled with control treatment (90 µL). It is done very carefully so that the treatment solution
does not cross the central line. Immediately after that, five µL nematode suspensions (30 nematodes on
average) are pipetted at the very center point of each channel. Then the movement of nematodes is
continuously monitored for 75 minutes. Data on number of nematodes per small division are recorded at
0 minute and 70 minutes after nematodes inoculation.
E. Optimization of the method: For the optimization of the method, attraction test was done with reference
repellent NaCl solution (Dalzell et al., 2011). The results of the attraction test demonstrated that, 2M
NaCl solution significantly repel the J2 of M. graminicola (Figure 12. A) indicating that the method is
optimized.
Figure 10. Development of a novel method for the in-vitro host finding assay of root-knot nematode Meloidogyne
graminicola. Figures showing calibration of square petridish (A), preparation of plastic straws (B), filling of
calibrated square petridish with 50 mL, 2% water agar (C), 2% water agar filled plastic straws are placed on the
square petridish filled with 50 mL water agar (D), 1 cm length agar filled plastic straws are placed in vertical line
with large plastic straws and again 50 mL water agar is poured on the square petridish (E), after solidification of
water agar, all the plastic straws are removed, then the square petridish become ready for the in-vitro host finding
assay of root-knot nematode M. graminicola (F).
A B C
D E F
18
3. 2 . 1 Development of a mathematical model for data processing and subsequent analysis of data derived
from in-vitro attraction assay (developed and optimized in this thesis) of root-knot nematode Meloidogyne
graminicola:
For getting accurate and reliable results, the no. of nematodes between treatment side and control side of the
channel at 0 minute as well as the total no. of nematodes at 0 minute and after 75 minutes should be equal. But in
practical, there are differences between treatment side and control side at 0 minute (which is not resulted by the
influences of treatment but just initial differences because of difficulties to inoculate equal number of nematodes
to both side of the channel) and also there are differences of total no. of nematodes at 0 minute and after 75
minutes (because of loss of nematodes in 2% water agar and counting error). So to reduce and adjust the
differences of number of nematodes between treatment side and control side at 0 minute and between 0 minute
and 75 minutes, a mathematical model comprising series of mathematical formulae is developed in this thesis as
follows:
Figure 11. Layout of a novel method ( developed and optimized in this thesis) for the in-vitro attraction assay
of M. graminicola.
To prove and validate the mathematical model, primary data of attraction test with root tips and root exudates of
MeJA treated plants and control plants are used hereunder as example.
Table 2. Showing the primary data on the number of nematodes at 0 minutes and after 75 minutes in both
treatment side and control side for the first 4 replications of attraction test (with root tips together with root
exudates of MeJA treated plants versus control plants), for the validation of a mathematical model developed for
data processing and subsequent analysis for the in-vitro host finding assay of M. graminicola.
Replication No. of
nematodes
in
treatment
side at 0
minute (B)
No. of
nematodes
in control
side at 0
minute (C)
Total no. of
nematodes
at 0 minute
(D)
No. of
nematodes
in
treatment
side after
75 minutes
(H)
No. of
nematodes
in control
side after
75 minutes
(I)
Total no. of
nematodes
after 75
minutes (J)
1 17 41 58 14 44 58
2 36 24 60 39 25 64
3 32 41 73 26 51 77
4 75 37 112 59 42 101
Let us consider that,
B = No. of nematodes in treatment side at 0 minute,
C = No. of nematodes in control side at 0 minute and
D = Total no. of nematodes at 0 minute
19
At 0 minute, the no. of nematodes in both treatment side and control side should be equal to get reliable results,
but in practical it is quite impossible to inoculate equal no. of nematodes at both side of the channel. However, to
adjust this initial differences, imbalance factor (E) at 0 minute is calculated and adjusted as follows:
𝐸 = (D/2 )– B
Table 3. showing the imbalance factor for the first four replication at 0 minute.
Replication The imbalance factor at 0 minute
1 12
2 -6
3 4,5
4 -19
F = Adjusted no. of nematodes in treatment side at 0 minute, is calculated as follows:
𝐹 = 𝐵 + 𝐸
G = Adjusted no. of nematodes in control side at 0 minute, is calculated as follows:
𝐺 = 𝐶 − 𝐸
Table 4. showing the adjusted no. of nematodes in both treatment side and control side at 0 minute.
Replication Adjusted no. of nematodes in
treatment side
Adjusted no. of nematodes in control side
1 29 29
2 30 30
3 36.5 36.5
4 56 56
Let us consider that,
H = No. of nematodes in treatment side after 75 minutes
I = No. of nematodes in control side after 75 minutes and
J = Total no. of nematodes after 75 minutes
Total no. of nematodes at 0 minute and 75 minutes should be equal to get reliable results but in practical, there
are differences of total no. of nematodes between 0 minute and after 75 minutes (because of loss of nematodes in
the agar system and counting error).This difference is minimized and adjusted by the imbalance factor (K) as
follows:
𝐾 = 𝐷 − 𝐽
Table 5. showing the imbalance factor of total no. of nematodes between 0 minute and 75 minutes.
Replications Imbalance factor of total no. of nematodes between 0 minute and 75
minutes
1 0
2 -4
3 -4
4 11
20
L = Adjusted no. of nematodes in treatment side after 75 minutes , is calculated as follows:
𝐿 = 𝐻 + (𝐾
2)
M = Adjusted no. of nematodes in control side after 75 minutes, is calculated as follows:
𝑀 = 𝐼 + (𝐾
2)
Table 6. showing the adjusted no. of nematodes in both treatment side and control side after 75 minutes.
Replication Adjusted no. of nematodes in
treatment side
Adjusted no. of nematodes in control
side
1 14 44
2 37 23
3 24 49
4 64,5 47,5
Then total no. of adjusted nematodes after 75 minutes (N) is calculated as follows:
𝑁 = 𝐿 + 𝑀
Table 7. showing the total no. of nematodes at 0 minute and total no. of adjusted nematode after 75 minutes.
Replication Total no. of nematodes at 0 minute Total no. of adjusted nematode after 75 minutes
1 58 58
2 60 60
3 73 73
4 112 112
Now, we can see that, there are no differences of total no. of nematodes between 0 minute and 75 minutes, so
we can calculate the no. of justified nematodes at both treatment side (O) and control side (P) after 75 minutes by
employing initial no. of nematodes and adjusted no. of nematodes in both treatment side and control side at 0
minute.
O = Number of justified nematodes in treatment side after 75 minutes, is calculated as follows:
0 = (𝐿 × 𝐹)/𝐵
P = Number of justified nematodes in control side after 75 minutes, is calculated as follows:
P =M × G
C
Table 8. showing the number of justified nematodes in both treatment side and control side after 75 minutes.
Replication Number of justified nematodes in
treatment side
Number of justified nematodes in control
side
1 23,88 31,12
2 30,83 28,75
3 27,37 43,63
4 48,16 71,89
Then the total no. of justified nematodes are calculated after 75 minutes (Q), as follows:
𝑄 = 𝑂 + 𝑃
21
The total no. of justified nematodes should be equal to total no. of adjusted nematodes total after 75 minutes or
total no. of nematodes at 0 minute, but in practical (after calculation of justified no. of nematodes at 75 minutes)
there are differences between total no. of adjusted nematode and total no. of justified nematodes after 75 minutes.
This difference is calculated by the Imbalance factor (R).
R = Difference between total no. of adjusted nematodes and total no. of justified nematodes after 75 minutes, is
calculated as follows:
𝑅 = 𝑁 − 𝑄
Table 9. showing the total no. of adjusted nematodes and total no. of justified nematodes and imbalance factor
between this two groups after 75 minutes.
Replication Total no. of
adjusted nematodes
Total no. of justified
nematodes
Differences between total no. of
adjusted nematodes and total no.
of justified nematodes
1 58 55,00 2,99
2 60 59,58 0,41
3 73 70,99 2,00
4 112 120,05 -8,05
To get reliable and accurate results the total no. of justified nematodes and total no. of adjusted nematodes should
be equal. To do so, the imbalance factor (R) is minimized and finally adjusted with the total no. of justified
nematodes in treatment side after 75 minutes and with the total no. of justified nematodes in control side after 75
minutes as follows:
S = Final no. of justified nematodes in treatment side after 75 minutes, is calculated as follows:
S = O + (R
2)
T = Final no. of justified nematodes in control side after 75 minutes, is calculated as follows
𝑇 = 𝑃 + (𝑅
2)
Table 10. showing the final no. of justified nematodes in both treatment side and control side after 75 minutes.
Replication Final no. of justified nematodes in
treatment side
Final no. of adjusted nematodes in
control side
1 25,38 32,61
2 31,04 28,95
3 28,37 44,62
4 44,13 67,86
Then total no. of final adjusted nematodes (U) is calculated as follows:
𝑈 = 𝑆 + 𝑇
Now , we can see that the total no. of final adjusted nematodes after 75 minutes are equal to the total no. of
nematodes after at 0 minute (which should be the case).
22
Table 11. showing the total no. nematodes at 0 minute and total no. of final adjusted nematodes after 75 minutes.
Replication Total no. of nematodes at 0
minute
Total no. of final adjusted nematodes after
75 minutes
1 58 58
2 60 60
3 73 73
4 112 112
So the data are now finally adjusted and justified to calculate the percentage of final adjusted no. of nematodes
in treatment side after 75 minutes (V). This is calculated as follows:
𝑉 = (𝑆 × 100)/𝑈
Similarly, we can calculate the percentage of final adjusted no. of nematodes in control side after 75 minutes (W)
as follows:
𝑊 = (𝑇 × 100)/𝑈
To get accurate result, the total no. of nematodes at 0 minute and total no. of final adjusted nematodes should be
equal. If the difference (Error factor- X) between the total no. of nematodes at 0 minute and total no. of final
adjusted nematodes is zero (0), then the model is said to be validated. It is calculated as follows
𝑋 = 𝐷 − 𝑈
After checking the error factor, we can observe that, the mathematical model is indeed validated for all the
replications of different treatments used for the in-vitro attraction assay of root-knot nematodes M. graminicola.
Table 12. showing the percentage of final adjusted no. of nematodes in both treatment side and control side after
75 minutes as well as validation factor.
Replication Percentage of final adjusted no.
of nematodes in treatment side
Percentage of final adjusted no.
of nematodes in control side
Error
factor
1 43,76 56,24 0
2 51,74 48,26 0
3 38,87 61,13 0
4 39,41 60,59 0
To further study if the root penetration of M. graminicola is based on the attractiveness of root tip and root
exudates, we did in-vitro attraction tests to find out which agents attract/repel M. graminicola. Our experimental
results showed that, 100 µM NAA solution (Figure 12) and metabolites of P. arrhenomanes (Figure 12)
significantly attracted J2s of M. graminicola. However, 100 µM JA solution (Figure 12) did not show any
significant impact on nematode attraction. When comparing root tips of GH3.1OX (less endogenous free auxin
compare to it’s wild type Bomba) (Figure 12), Hebiba - JA biosynthesis mutant (less JA compared to it’s wild
type Nihonmansri) (Riemann et al., 2003) (Figure 12), 100 µM NAA (Figure 12) and 100 µM DIECA (Figure
12) treated rice plants with their control, we did not observe any significant differences in their attractiveness to
J2 of M. graminicola. Both healthy root tip and P. arrhenomanes infected root tip equally attracted the J2 of M.
graminicola (Figure 12). Interestingly, root exudates along with root tips of Oryza glabberrima and MeJA treated
plants significantly repelled J2 of M. graminicola (Figure 12). Moreover, root exudates alone of ethephon treated
plants significantly repelled the J2s of M. graminicola (Figure 12) and root exudates of P. arrhenomanes infected
plants slightly repelled the J2S of M. graminicola (Figure 12).
23
Figure 12. Attraction test of J2s of root-knot nematode M. graminicola with a novel in-vitro agar plate method
developed and optimized in the lab. Data on number of J2 on both side of the plate were recorded at 0 minute
and 75 minutes after nematode inoculation. In the graph data are shown on the final adjusted percentage of
nematodes after 75 minutes on both treatment side and control side. Bars represent mean final adjusted
percentage of nematodes after 75 minutes ± standard error with 10 replications on average. On average 30
nematode were inoculated per replication. Primary data were processed by a mathematical model developed and
validated in this thesis to obtain final percentage of nematodes to each side of the channel after 75 minutes. Data
on final percentage of nematodes after 75 minutes were analyzed by Paired-Sample T-Test. Asterisk indicates
significant difference (p < 0.05). Treatments used in this experiment are 2M NaCl solution, 100 µM NAA
solution, 25 days old metabolites of P. arrhenomanes, 100 µM JA solution, root tip of 100 µM NAA treated
plants, root tip of GH3.1OX, root tips of Hebiba, root tip of DIECA treated plants, root tip of P. arrhenomanes
infected plants, root tip and root exudates of Oryza glabberrima, root tip and root exudates of MeJA treated
plants, root exudates of P. arrhenomanes infected plants, and root exudates of ethephon treated plants. PT60 =
P. arrhenomanes, RT = Root tips, RE = Root exudates, RTE = Root tips together with root exudates.
100 80 60 40 20 0 20 40 60 80 100
Final percentage of M. graminicola in treatment side Final percentage of M. graminicola in control side
24
4. Discussion
This experiment was carried out to study the interaction between oomycete - Pythium arrhenomans and root-
knot nematode - Meloidogyne graminicola on rice roots and also to study the roles of auxin, jasmonic acid,
salicylic acid and abscisic acid on the interaction between these two root pathogens. To reach the objective rice
roots were infected with P. arrhenomanes and M. graminicola, transgenic/mutant lines of the particular hormone
biosynthesis and signaling pathways were used for double infection experiment, shoots were sprayed with
particular hormone and inhibitor, attraction tests were done with particular hormone solution, metabolites of P.
arrhenomanes, root tips and root exudates of P. arrhenomanes, infected plants, different hormone treated plants,
resistant plants (Oryza glabberrima) and finally the infection pressure of both pathogens were scored in the
interaction experiments.
Interaction experiments between P. arrhenomanes and M. graminicola on two rice cultivars, Nipponbare and
IR81413-BB-75-4 showed an antagonism of P. arrhenomanes on M. gramninicola. Total number of nematodes
and gall per root system were significantly reduced in the double infected plants compare to single infected plants
in both rice cultivars, indicating that P. arrhenomanes antagonizes M. graminicola in terms of nematode
establishment (attraction and penetration, and subsequent gall formation) on the roots (Figure 3. A, B, C, D). The
results of the experiment reported in this thesis are consistent with the findings of Verbeek et al. (2016), who did
similar experiments in the Philippines. Considering the reason(s) why P. arrhenomanes antagonizes M.
graminicola, several hypotheses can be formulated. For example, the metabolites of P. arrhenomanes might
induce the mortality of infective juveniles of M. graminicola, several studies reported that the secondary
metabolites of fungal and bacterial pathogens promote the mortality of plant-parasitic nematodes (Hallmann &
Sikora, 1996; Hashem & Abo-Elyousr, 2011; Hu et al., 2012), P. arrhenomanes might act as mycoparasite on
infective juveniles of M. graminicola thereby reducing the root penetration capacity of the nematode. This is
supported by reports where the authors showed that several fungi mycoparasitize on plant-parasitic nematodes
along with trapping and feeding on nematodes (Persson & Bååth, 1992; Persmark et al., 1996; Bordallo et al.,
2002; Jansson & Lopez-Llorca, 2004). Alternatively, P. arrhenomanes infected plants might secrete some
allelochemicals which in turn repel (disrupt the host finding ability of the infective juveniles of M. graminicola)
and induce mortality of the J2 of M. graminicola, a hypothesis which is supported by previous reports (Sikora,
1992; Halbrendt, 1996) where the authors showed that plants secreted allelochemicals that had detrimental effects
on plant-parasitic nematodes. In line with this, our results of attraction test also demonstrated that the root
exudates of P. arrhenomanes infected plants repel the J2s of M. graminicola. It was also assumed that P.
arrhenomanes induce the necrotic lesions in the root system and as a result the infective juveniles of M.
graminicola might not find the roots suitable for gall formation (since it is obligate biotrophic pathogen, it will
select living tissue to make its feeding site) which is supported by the previous reports (Jones et al., 2013).
Another hypothesis is that P. arrhenomanes might prevent root-knot nematode infection by inducing JA signaling
in the root. Van Buyten, (2013) reported that Pythium spp. activate JA biosynthesis and signaling pathways, and
in addition, Nahar et al., (2011) and Kyndt et al., (2014) reported that activation of JA signaling suppresses M.
graminicola infection. This root immunity might resulted in reduced root branching, root length and root biomass
which might prevent and lower the nematode penetration and gall formation. Pieterse et al., (2009) and Huot et
al., (2014) reported that tradeoff between immunity and plant growth exist which is mediated by crosstalk
between defense hormone and growth hormone. The antagonistic interactions observed in our experiment are
contradictory with the findings of Sikder, (2015) who found synergism in terms of gall formation per root system
in Nipponbare and no interaction in terms of gall formation and number of nematodes per root system in IR81413-
BB-75-4. However, Sikder (2015) was not able to detect P. arrhenomanes in rice roots, showing that P.
arrhenomanes probably did not effectively colonize the rice roots, and subsequently could not antagonize M.
graminicola. In contrast to the experiments of Sikder (2015), we advanced the inoculation time of P.
arrhenomanes from 9 to 5 days after germination, after which we were able to observe root necrosis, and could
detect P. arrhenomanes DNA in the roots. Hence we showed that if P. arrhenomanes can colonize rice roots, it
25
antagonizes M. graminicola. In this experiment, Nipponbare was heavily infected with P. arrhenomanes (distinct
root necrosis) and M. graminicola, hence this cultivar seems to be highly susceptible for both pathogens. In
contrast to Nipponbare, the infection pressure of M. graminicola (observed by number of gall) and P.
arrhenomanes (observed by root necrosis) was lower in IR81413-BB-75-4. Nipponbare had already been
reported to be a susceptible rice cultivar to M. graminicola (Nahar et al., 2011; Kyndt et al., 2012b; Nahar et al.,
2012; Kyndt et al., 2014; Sikder, 2015) and P. arrhenomanes (Van Buyten & Höfte, 2013). The result of the
present study showed that P. arrhenomanes significantly delayed the development of M. graminicola in rice
cultivar Nipponbare (Figure 3. E). This result is consistent with the recent findings of Verbeek et al., (2016). It
was hypothesized that P. arrhenomanes antagonized nematode development because of the insufficient nutrients
(disruption of vascular bundles caused by root necrosis) along with competition for existing nutrients between
these two pathogens. Nutrient deficiency in the root system, as observed by the significant reduction of root fresh
weight and seedling length, was indeed confirmed in our results (Appendix Figure 1). In contrast to Nipponbare,
P. arrhenomanes did not antagonize nematode development in IR81413-BB-75-4 (Figure 3. F). We observed
that nematode infection in the rice cultivar IR81413-BB-75-4 was lower compared to Nipponbare, and as a result
of a lower infection pressure sufficient nutrients probably exist in the root system, so P. arrhenomanes did not
compete for nutrients with M. graminicola, consequently the development of nematodes was not affected in the
root of IR81413-BB-75-4. It also might be that IR81413-BB-75-4 is less susceptible to P. arrhenomanes
compared to Nipponbare, which in turn might result in a lower effect on the development of M. graminicola. It
has been reported that nutrient contents of the plants as well as types of plants (resistant or susceptible) govern
the development of root-knot nematode inside the plants (Oteifa, 1953; Bird, 1974; Roberts, 1992).
Auxin regulates growth, development and defense responses of plants (roots), thereby influencing the plant-
pathogen interaction (Park et al., 2007; Kazan & Manners, 2009). To know the role of auxin in the interaction, a
transgenic rice line overexpressing GH3.1, which was described to contain less free auxin compared to wild type
Bomba (Domingo et al., 2009), were used in the experiment. It was showed that, lower auxin levels in GH3.1OX
significantly decreased the total no. of nematodes (hence assumed nematode attraction and penetration) and
subsequent gall formation per root system compared to Bomba both in the single and double infected plants,
suggesting that lower auxin level antagonize M. graminicola in terms of nematode establishment (attraction,
penetration and gall formation)(Figure 4. A, B). We also found that 100 µM NAA solution attracts the J2 of M.
graminicola significantly. Feng et al., (2014) reported that 100 µM IAA solution facilitated the attraction,
migration and aggregation of Aphelenchoides besseyi in the pluronic F-127 gel medium. We observed that a cell
free culture filtrate of P. arrhenomanes did attract the J2 of M. graminicola..Van Buyten, (2013) reported that
Pythium spp. produced auxin in vitro, so it is tempting to assume that P. arrhenomanes produced auxin might
cause attraction of the nematode. In contrast, root tips of P. arrhenomanes infected plants and root tips of
GH3.1OX and 100 µM NAA treated plants did not show any significant impact on nematode attraction. Together
these results of attraction test suggest that, the types of treatments (hormone solution, root tip of hormone treated
plants, metabolites of P. arrhenomanes and root tip of P. arrhenomanes infected plants) regulate the outcome of
attraction test in our system. Hutangura et al., (1999) described that auxin is required as a trigger for giant cell
initiation. In line with this, recently it was reported that auxin is required for the initiation and expansion of giant
cell induced by root-knot nematodes (Kyndt et al., 2016). It was also observed that lower endogenous auxin level
could not reduce gall formation significantly in presence of P. arrhenomanes (Figure 4. B) suggesting that the
antagonistic role of lower endogenous auxin level on gall formation is slightly modulated by P. arrhenomanes.
However, in GH3.1OX, the development of nematodes inside root was significantly promoted compared to
Bomba both in single and double infected plants (Figure 4. C). We hypothesize that this is due to the availability
of sufficient nutrients inside roots, because of the three times lower number of nematodes in GH3.1OX (53.87)
compared to Bomba (170.67). P. arrhenomanes infection in the line with lower auxin is still able to antagonize
M. graminicola infection. This was mainly seen in the number of nematodes (Figure 4. A), the effect was not
significant for gall number although the trend was still observed (Figure 4. B). It was assumed that the ability of
P. arrhenomanes to retards gall formation is high in presence of high amount of auxin (Bomba) and the ability
26
of P. arrhenomanes to retards gall formation is low in presence of low amount of auxin (GH3.10X). It was also
assumed that high amount of P. arrhenomanes DNA (although not significant) in the double infected plants of
GH3.1OX compared to double infected plants of Bomba (Figure 5) might add some additional auxin which in
turn might promote the gall formation in GH3.OX and consequently antagonism was less clear. We also observed
that P. arrhenomanes significantly promoted nematode development in Bomba but it had no significant impact
on nematode development in GH3.1OX (Figure 4. C). It is hypothesize that this is due to the availability of
sufficient nutrients inside roots, because of the lower number of nematodes in double infected plant (86,75)
compared to compare to single infected plants of Bomba (170.67). On the other hand the average no. of nematodes
in the double infected plants of GH3.1OX is 30,63 and average no. of nematodes in single infected plants of
GH3.1OX is 53.87, so the competition for nutrients does not seem to be high , consequently the development of
nematodes might not be affected by P. arrhenomanes in GH3.1OX.
However, foliar application of 100 µM NAA did not increase number of nematodes, gall formation rather it
slightly decreased (not significant) number of nematodes and gall formation both in the single and double infected
plants compared to control plants (no NAA treatment) (Figure 6. A, B). Foliar application of NAA did not show
any significant impact on nematode development (Figure 6. C). These results suggest that NAA treatment slightly
antagonized M. graminicola both in the single and double infected plants. It was reported before that exogenous
application of lower concentrations of auxin facilitates root elongation, in contrast, higher concentrations are
detrimental to growth suggesting that small changes in the concentration of hormone can completely change
growth and subsequently defense responses of plants (Hardtke et al., 2007). On the other hand, P. arrhenomanes
slightly reduced (not significant) nematode penetration, gall formation both in control plants and NAA treated
plants suggesting that the antagonistic roles of P. arrhenomanes on M. graminicola are not modulated by NAA
treatment (Figure 6. A, B). The results of this experiment also suggesting that P. arrhenomanes antagonized M.
graminicola in terms of nematode establishment. However, P. arrhenomanes did not show any significant impact
on nematode development both in the control and NAA treated experiments (Figure 6. C). It might be because of
the lack of differences in nutrient contents between single infected plants and double infected plants.
The finding of the present experiments also indicated that M. graminicola slightly (not significant) retarded in-
planta growth of P. arrhenomanes within the root system of Bomba (Figure 5). It was hypothesized that, M.
graminicola might do so by competing with P. arrhenomanes for nutrients. To our knowledge this is the first
report to show the role of M. graminicola and auxin on the in planta growth of P. arrhenomanes, the underlying
mechanism is still not clear, so several individual replications might be useful to draw concluding remarks.
In this experiment, exogenous application of MeJA slightly increased the number of nematodes and gall
formation compared to control plants. In addition, JA biosynthesis inhibitor and JA biosynthesis/signaling
mutant/transgenic lines significantly decreased number of nematodes and slightly decreased subsequent gall
formation per root system compared to control plants (Nipponbare) (Figure 7. A. B). Exogenous application of
MeJA, JA biosynthesis inhibitor and JA signaling RNAi line did not have significant impact on nematode
development compared to control plants (Figure 7. C). These results indicated that JA favors nematode
penetration and gall formation, which contradicts previous studies (Nahar et al., 2011; Kyndt et al., 2012a; Kyndt
et al., 2012b; Kyndt et al., 2014; Sikder, 2015) where the authors described that JA antagonizes root-knot
nematode infection. The result of this experiment is also contradictory with our attraction test where root exudates
+ root tips of MeJA treated plants repelled nematodes significantly suggesting that JA will reduce infection of
M. graminicola. In contrast, 100 µM JA solution and root tip alone of Hebiba and 100 µM DIECA (JA
biosynthesis inhibitor) treated plant did not show any significant role in attraction of nematodes. It is not clear
why JA increased nematode infection in our double infection experiment. It should be mentioned that, 16 days
old seedlings were inoculated with M. graminicola in case of Nahar et al., (2011) experiments, but we used 9
days old seedlings in our experiments. This change in timing of nematode inoculation and hormone application
might result in complete reverse effects. It was reported that concentration, timing and amount of solution might
have an impact on the JA homeostasis (Hause et al., 2007), and as a result might have an impact on nematode
27
infection. Our result also showed that the roles of JA biosynthesis and signaling on number of nematodes and
gall formation are slightly lost in presence of P. arrhenomanes (Figure 7. A, B) It was hypothesized that, P.
arrhenomanes might convert the active form of JA and subsequently induce root susceptibility to M. graminicola.
Patkar et al., (2015) reported that antibiotic biosynthesis monooxygenase (abm) enzyme of the fungus Pyricularia
oryzae mediated the conversion of JA to 12OH-JA which in turn reduced the innate immunity of rice. Together
these results suggest that the role of JA on M. graminicola is modulated by P. arrhenomanes. Our results show
that P. arrhenomanes slightly antagonized M. graminicola in control plants (Nipponbare) but the ability of P.
arrhenomanes to antagonize M. graminicola is lost in different JA-deficient lines and also in MeJA and DIECA
treated plants (Figure 7. A, B) suggesting that the antagonism of P. arrhenomanes versus M. graminicola is
modulated by JA.
The Phenylalanine Ammonia Lyase (PAL) mediated phenylpropanoid pathway (Bate et al., 1994) provides
benzoic acid, the immediate precursor of SA (Mur et al., 2000). In our experiment, foliar application of a specific
inhibitor of PAL activity, alpha-aminooxy-beta-phenylpropionic acid (AOPP) slightly reduced nematode
penetration, gall formation and slightly delayed development of nematodes in rice roots compared to control
plants (no AOPP) (Figure 8. A, B, C) suggesting that SA inhibitor slightly antagonized nematode infection which
is contradictory with previous reports from our research group (Nahar et al., 2011; Kyndt et al., 2014; Huang et
al., 2015; Ji et al., 2015b) where the authors reported that activation of salicylic acid (SA) biosynthesis and
signaling pathways reduced the infection of root-knot nematode and AOPP slightly enhanced nematode infection.
The reason why this contradiction was observed might be because of the low concentration (100 µM) of AOPP
we used and incapability of AOPP alone to block PAL activity. Massala et al., (1987) reported that 250 μM
AOPP served as the potential inhibitor of PAL, in addition Dorey et al., (1997) reported that AOPP alone could
not block PAL activity but AOPP along with glycoprotein clearly reduced SA accumulation in plants. On the
other hand, the reason why activation of SA biosynthesis and signaling pathway reduced pathogen infection
might be because of the induction of systemic acquired resistance, production of H2O2 and subsequent defense
response (Shirasu et al., 1997). On the other hand, in presence of P. arrhenomanes, AOPP slightly increased the
number of nematodes and gall formation per root system compared to control plants (no AOPP) ( Figure 8. A,
B) suggesting that the role of PAL inhibitor on root-knot nematode infection is modulated by P. arrhenomanes.
P. arrhenomanes slightly antagonized M. graminicola in the control plants (Nipponbare) but in response to
application of SA inhibitor, the ability of P. arrhenomanes to antagonize M. graminicola in terms of number of
nematodes and gall formation per root system was lost compared to double infected control plants (no AOPP)
(Figure 8. A, B) indicating that PAL inhibitor has an influence on the interaction between P. arrhenomanes and
M. graminicola. It was reported that Pythium inoculation suppresses the SA biosynthesis and signaling pathway
(Van Buyten, 2013) resulting in low SA concentrations in plants. In addition, the PAL inhibitor also blocks SA
mediated defense, even in the presence of low concentrations of SA (Dempsey et al., 1999), consequently
nematode infection is increased in the AOPP treated double infected plants and as a result the antagonism was
lost.
In this experiment, foliar application of 50 µM abamine, an abscisic acid (ABA) biosynthesis inhibitor, slightly
reduced nematode penetration and delayed nematode development compared to control plants (no abamine)
(Figure 9. A, C) suggesting that the ABA inhibitor slightly reduces the infection of M. graminicola. Nahar et al.,
(2012) reported that exogenous application of ABA favors the infection of Hirschmanniella oryzae. In contrast,
Karimi et al., (1995) reported that exogenous application of ABA promoted the induction of proteinase inhibitor
II and subsequently delayed the development of root-knot nematode. Ji et al., (2015a) reported that exogenous
application of ABA significantly upregulated three thionin genes encoding antimicrobial peptides and over
expression of these genes reduced M. graminicola infection. In contrast to single infection by M. graminicola, in
presence of P. arrhenomanes, abamine slightly increased nematode number, gall formation and nematode
development plants compared to control plants (Figure 9. A, B, C) suggesting that the role of ABA inhibitor on
M. graminicola infection is modulated by P. arrhenomanes. P. arrhenomanes slightly antagonized nematode
number and gall formation per root system in Nipponbare but the ability of P. arrhenomanes to antagonize M.
28
graminicola was lost rather it slightly promoted nematode infection in response to foliar application of ABA
inhibitor, so the antagonism between both pathogens was lost. (Figure 9. A, B, C) indicating that the role of P.
arrhenomanes on M. graminicola infection is modulated by ABA inhibitor. It was hypothesized that P.
arrhenomanes might produce abscisic acid themselves and induce ABA signaling and might utilize ABA-
SA/JA/ET antagonistic cross-talk and subsequently induce root susceptibility to M. graminicola in the double
infected plants. This hypothesis is supported by the previous reports where the authors showed that plant
pathogens produce abscisic acid, induce ABA signaling, subsequently utilize ABA- SA/JA/ET antagonistic
cross-talk and finally render root susceptibility (Dörffling et al., 1984).
The roles of NAA treatment, JA, SA inhibitor and ABA inhibitor in the interaction between P. arrhenomanes
and M. graminicola do not always confirm previous results. Several hypotheses were assumed: in this study we
only made use of hormone inhibitors of SA and ABA, however the role of hormonal pathway in the interaction
between P. arrhenomanes and M. graminicola cannot be confirmed without the use of mutant lines in knock-out
or overexpressing of particular genes involved in hormone biosynthesis and signaling pathways and exogenous
application of optimized concentration of that particular hormone as well as its inhibitor. It should also be
mentioned that, the role of phytohormones on plant-microbes interaction depends on the methods of application,
timing of application and concentration of the solution used (Hause et al., 2007). Cross-talks among major plant
hormones involved in plant growth and defense regulate the outcome of plant-pathogen interaction (Lee et al.,
2001; Swarup et al., 2002; Gazzarrini & MCCOURT, 2003; Li et al., 2004; Mei et al., 2006; Qiu et al., 2007;
Qiu et al., 2009; Depuydt & Hardtke, 2011; Tamaoki et al., 2013; Van Buyten, 2013; Kyndt et al., 2014; Thole
et al., 2014), these need to be kept in mind in elucidating the role of phytohormones in plant-pathogen interaction.
Careful examination of phytohormones derived from pathogen (Arshad & Frankenberger, 1997; Baca &
Elmerich, 2007; Spaepen et al., 2007), here from P. arrhenomanes and M. graminicola and the role of these
pathogen derived phytohormones in the plant-pathogen interaction (Patkar et al., 2015) here from P.
arrhenomanes and M. graminicola also need to be examined.
A novel method for attraction tests, along with the mathematical model for data processing and subsequent
analysis was developed in the lab. It was demonstrated that 2M NaCl solution repels the J2 of M. graminicola
significantly, which is consistent with the results of Dalzell et al., (2011) suggesting that our method is working.
Several attraction tests were done using excised root tip but the nematodes did not respond to root tips alone. In
contrast to only root tip, root exudates together with the root tip of Oryza glabberrima and MeJA treated plants
did repel J2 of M. graminicola significantly, suggesting that resistant plant and JA signaling has an impact in the
repulsion of nematodes. This result also indicates that root exudates should be used along with root tip in our
method of attraction test. Our results also showed that root exudates of ethephon treated plants significantly
repelled the J2 of M. graminicola which is consistent with the reports of Fudali et al., (2013) where the author
showed that ethylene played a role in the repulsion of Meloidogyne hapla. However, our results of attraction test
with root exudates of ethephon treated plants contradicts the reports of Kammerhofer et al., (2015) and Wubben
et al., (2001) where the authors showed that ethylene favour the attraction of cyst nematode - Heterodera
schachtii. The reason(s) why root exudates of ethephon treated plants repel nematodes might be because of the
presence of several secondary metabolites and toxins in the root exudates which in turn repel nematodes. It was
reported that ethephon and ethylene induce the production of secondary metabolites, specially alkaloid production
(Cho et al., 1988). Root exudates play an important role in the attraction of plant-parasitic nematodes thus in
rhizosphere interaction (Bird, 1959; Rovira, 1969; Grundler et al., 1991; Bais et al., 2006). The infective stage
of plant-parasitic nematodes can sense and distinguish surrounding physical, chemical and biological stimuli with
the help of sensory perception organs like amphids, phasmids, and cuticle (Jones, 2002; Robinson, 2002).
Similarly infective juveniles can distinguish attractants and repellents in the soil and in the rhizosphere and help
themselves to orientate towards hosts in case of attractants or away from the host in case of repellents (Zuckerman
& Jansson, 1984).
29
5. Future Works
To explore the underlying mechanisms of antagonism, in depth morphological, histological, biochemical
and molecular analyses are to be carried out in P. arrhenomanes-Oryza sativa-M. graminicola interaction
experiment.
To elucidate the role of P. arrhenomanes on M. graminicola infection, composition and concentration of
culture filtrates of P. arrhenomanes and root exudates of P. arrhenomanes infected plants should be
examined by means of HPLC and mass spectrometry.
To find out the agents responsible for nematode attraction and repulsion present in the root exudates,
composition and concentrations of root exudates of different rice cultivars used for double infection
experiments and attraction tests are to be examined.
To confirm the role of phytohormones in the interaction between P. arrhenomanes and M. graminicola
on rice roots, exogenous application of hormones and its biosynthesis and signaling inhibitors, use of
mutant and transgenic lines (RNAi, T-DNA insertion mutant, knock-out and over-expression) of a
particular gene involved in hormone biosynthesis and signaling are to be used.
To explore the roles of pathogen derived phytohormones, and their interaction with plant-derived
phytohormones in the interaction experiments between P. arrhenomanes and M. graminicola,
composition and concentration of major growth and defense hormones are to be examined in the culture
filtrates of P. arrhenomanes and M. graminicola and also in rice cultivars used for double infection
experiments (before and after application of hormones as well as inhibitors, before and after inoculation
of pathogens).
6. Conclusions Based on the findings of this thesis, we can conclude that, P. arrhenomanes antagonizes M. graminicola in the
rice cultivars Nipponbare and IR81413-BB-75-4, in the SAP system adapted for double infection experiments in
our laboratory. Our results of the double infection experiment also demonstrated that lower endogenous auxin
level significantly reduces the nematode number and gall formation per root system. In line of this, our result of
attraction tests with 100 µM NAA solution supported that auxin favors the attraction of nematodes significantly.
Our results also indicate that P. arrhenomanes might complement the endogenous auxin level in the roots and
thus might promote gall formation therein. The results of this study indicate that JA promotes nematode
penetration and gall formation in absence P. arrhenomanes, but JA slightly reduces nematode penetration and
gall formation in presence of P. arrhenomanes. Our double infection experiment with a PAL inhibitor (resulting
in lower SA biosynthesis and lignin production) indicated that application of this inhibitor slightly blocks M.
graminicola infection in absence of P. arrhenomanes, but slightly increases M. graminicola infection in presence
of P. arrhenomanes. Based on our double infection experiment the ABA inhibitor slightly reduces M.
graminicola infection in absence of P. arrhenomanes, but the ABA inhibitor slightly increases nematode
infection in presence of P. arrhenomanes. Our results of several double infection experiments demonstrated that
the role of lower endogenous auxin level (only in gall formation), jasmonic acid biosynthesis and signaling, SA
inhibitor and ABA inhibitor on M. graminicola infection are modulated slightly by P. arrhenomanes. In addition,
the negative influence of P. arrhenomanes on M. graminicola infection is also regulated slightly by lower
endogenous auxin level (only gall formation), jasmonic level and signaling, salicylic acid biosynthesis and
abscisic acid biosynthesis. Based on qPCR-based P. arrhenomanes quantification, it can be said that M.
graminicola, and auxin levels have no significant impact on in-planta growth of P. arrhenomanes. A novel
method for in-vitro host finding assay of M. graminicola, along with mathematical model for data processing and
subsequent analysis were developed in this thesis. Our result of the attraction test also demonstrated that root
exudates of ethephon treated plants, root exudates of P. arrhenomanes infected plants (not significant), root tips
and root exudates of Oryza glabberrima and MeJA treated plants significantly repel the J2s of M. graminicola
whereas NAA solution and metabolites of P. arrhenomanes attract J2s of M. graminicola.
30
7. Acknowledgements
Ruben Verbeek (PhD student at the Department of Molecular Biotechnology, Ghent University, Belgium), my
thesis supervisor and Dr. Tina Kyndt (Professor of Epigenetics and Defence, Department of Molecular
Biotechnology, Ghent University, Belgium), my thesis promoter; you two peoples continuously taught and
assisted me a lot on how to plan and execute thesis works as well as write a thesis paper over the last 12 months.
I learned many aspects of higher research from both of you, I thank you so much and express my heartfelt
gratitude to both of you. Constructive criticisms, comments and direction for further improvement for thesis
writings from my jury members Professor Dr. Godelieve Gheysen, Department of Molecular Biotechnology and
Professor Dr. Monica Höfte, Department of Crop Protection, Faculty of Bioscience Engineering, Ghent
University, Belgium helped me a lot to improve the quality of thesis writings, I express my sincere gratitude to
both of you. I express my gratitude to the laboratory technicians Lien De Smet and Isabel Verbeke for their nice
cooperation during my thesis works. The supports and suggestions of Zobaida Lahari, Henok Zemene, Diana
Naalden, Mohammad Reza Atighi, and Richard Singh (PhD students of the Department of Molecular
Biotechnology, Ghent University, Belgium) were really great, I thank you all. I also express my gratitude to the
lab members of Molecular Phytopathology, Department of Crop Protection, Ghent University, Belgium. I learned
a lot from all the teachers of the Postgraduate International Nematology Course (PINC), Ghent University
Belgium, you peoples worked a lot to make my dream true for higher education and research, I am grateful to
you all. I specially acknowledge the scholastic supports of Professor Dr. Wilfrida Decraemer, Department of
Biology, Ghent University, Belgium. The cooperation of Inge Dehennin (Co-ordinator of PINC) from the very
first day of application for scholarship to the last day here in Ghent University, Belgium was really great, I thank
you very much and express my gratitude. Co-operation of Emmanuelle De Bock (Acting Co-ordinator of Agro
and Environmental Nematology Course) is also appreciated. The last but not the least, VLIR-UOS, the funding
agency, my dream for higher education would not come to true without the financial supports, I thank the
authority very much and also express my heartfelt gratitude.
8. References
Albrecht, C., Boutrot, F., Segonzac, C., Schwessinger, B., Gimenez-Ibanez, S., Chinchilla, D., Rathjen, J. P., De
Vries, S. C. & Zipfel, C. (2012). Brassinosteroids inhibit pathogen-associated molecular pattern–
triggered immune signaling independent of the receptor kinase BAK1. Proceedings of the National
Academy of Sciences 109, 303-308.
Arshad, M. & Frankenberger, W. T. (1997). Plant growth-regulating substances in the rhizosphere: microbial
production and functions. Advances in agronomy 62, 45-151.
Baca, B. & Elmerich, C. (2007). Microbial production of plant hormones. Associative and endophytic nitrogen-
fixing bacteria and cyanobacterial associations. Springer, pp. 113-143.
Bais, H. P., Weir, T. L., Perry, L. G., Gilroy, S. & Vivanco, J. M. (2006). The role of root exudates in rhizosphere
interactions with plants and other organisms. Annu. Rev. Plant Biol. 57, 233-266.
Bate, N. J., Orr, J., Ni, W., Meromi, A., Nadler-Hassar, T., Doerner, P. W., Dixon, R. A., Lamb, C. J. & Elkind,
Y. (1994). Quantitative relationship between phenylalanine ammonia-lyase levels and phenylpropanoid
accumulation in transgenic tobacco identifies a rate-determining step in natural product synthesis.
Proceedings of the National Academy of Sciences 91, 7608-7612.
Bimpong, I. K., Carpena, A. L., Mendioro, M. S., Fernandez, L., Ramos, J., Reversat, G. & Brar, D. S. (2010).
Evaluation of Oryza sativa x O. glaberrima derived progenies for resistance to rootknot nematode and
identification of introgressed alien chromosome segments using SSR markers. African Journal of
Biotechnology 9, 3988-3997.
Bird, A. F. (1959). The attractiveness of roots to the plant parasitic nematodes Meloidogyne javanica and M.
hapla. Nematologica 4, 322-335.
Bird, A. F. (1974). Plant response to root-knot nematode. Annual review of phytopathology 12, 69-85.
31
Bordallo, J., Lopez‐Llorca, L., Jansson, H. B., Salinas, J., Persmark, L. & Asensio, L. (2002). Colonization of
plant roots by egg‐parasitic and nematode‐trapping fungi. New Phytologist 154, 491-499.
Bouman, B., Humphreys, E., Tuong, T. & Barker, R. (2007). Rice and water. Advances in agronomy 92, 187-
237.
Bridge, J., Plowright, R. A. & Peng, D. (2005). 4 Nematode Parasites of Rice. Plant parasitic nematodes in
subtropical and tropical agriculture, 87.
Brouwer, M., Lievens, B., Van Hemelrijck, W., Van Den Ackerveken, G., Cammue, B. P. & Thomma, B. P.
(2003). Quantification of disease progression of several microbial pathogens on Arabidopsis thaliana
using real-time fluorescence PCR. FEMS Microbiology Letters 228, 241-248.
Chen, P.-N., Kuo, W.-H., Chiang, C.-L., Chiou, H.-L., Hsieh, Y.-S. & Chu, S.-C. (2006). Black rice anthocyanins
inhibit cancer cells invasion via repressions of MMPs and u-PA expression. Chemico-biological
interactions 163, 218-229.
Cho, G., Kim, D., Pedersen, H. & Chin, C. K. (1988). Ethephon enhancement of secondary metabolite synthesis
in plant cell cultures. Biotechnology progress 4, 184-188.
Cother, E. & Gilbert, R. (1993). Comparative pathogenicity of Pythium species associated with poor seedling
establishment of rice in Southern Australia. Plant Pathology 42, 151-157.
Curtis, R. H., Robinson, A. F. & Perry, R. N. (2009). 6 Hatch and Host Location. Root-knot nematodes, 139.
Dalzell, J. J., Kerr, R., Corbett, M. D., Fleming, C. C. & Maule, A. G. (2011). Novel bioassays to examine the
host-finding ability of plant-parasitic nematodes. Nematology 13, 211-220.
De Vleesschauwer, D., Gheysen, G. & Höfte, M. (2013). Hormone defense networking in rice: tales from a
different world. Trends in plant science 18, 555-565.
De Vleesschauwer, D., Van Buyten, E., Satoh, K., Balidion, J., Mauleon, R., Choi, I.-R., Vera-Cruz, C., Kikuchi,
S. & Höfte, M. (2012). Brassinosteroids antagonize gibberellin-and salicylate-mediated root immunity
in rice. Plant physiology 158, 1833-1846.
Dempsey, D. M. A., Shah, J. & Klessig, D. F. (1999). Salicylic acid and disease resistance in plants. Critical
Reviews in Plant Sciences 18, 547-575.
Depuydt, S. & Hardtke, C. S. (2011). Hormone signalling crosstalk in plant growth regulation. Current Biology
21, R365-R373.
Doares, S. H., Syrovets, T., Weiler, E. W. & Ryan, C. A. (1995). Oligogalacturonides and chitosan activate plant
defensive genes through the octadecanoid pathway. Proceedings of the National Academy of Sciences
92, 4095-4098.
Domingo, C., Andrés, F., Tharreau, D., Iglesias, D. J. & Talón, M. (2009). Constitutive expression of OsGH3. 1
reduces auxin content and enhances defense response and resistance to a fungal pathogen in rice.
Molecular plant-microbe interactions 22, 201-210.
Dorey, S., Baillieul, F., Pierrel, M.-A., Saindrenan, P., Fritig, B. & Kauffmann, S. (1997). Spatial and temporal
induction of cell death, defense genes, and accumulation of salicylic acid in tobacco leaves reacting
hypersensitively to a fungal glycoprotein elicitor. Molecular plant-microbe interactions 10, 646-655.
Dörffling, K., Petersen, W., Sprecher, E., Urbasch, I. & Hanssen, H.-P. (1984). Abscisic acid in phytopathogenic
fungi of the genera Botrytis, Ceratocystis, Fusarium, and Rhizoctonia. Zeitschrift für Naturforschung C
39, 683-684.
Eberle, M., Rothrock, C. & Cartwright, R. (2007). Pythium species associated with rice stand establishment
problems in Arkansas. BR Wells Rice Research Studies, 57-63.
Feng, H., Shao, Y., Wei, L.-H., Gao, C.-Y. & Zhou, Y.-J. (2014). The white-tip nematode, Aphelenchoides
besseyi, exhibits an auxin-orientated behaviour affecting its migration and propagation. Nematology 16,
837-845.
Finkers-Tomczak, A., Koropacka, K., Goverse, A., Smant, G. & Bakker, E. Resistant plant responses to parasitic
nematodes. Co-evolution between Globodera rostochiensis and potato driving sequence diversity of NB-
LRR resistance loci and nematode suppressors of plant immunity, 17.
32
Fudali, S. L., Wang, C. & Williamson, V. M. (2013). Ethylene signaling pathway modulates attractiveness of
host roots to the root-knot nematode Meloidogyne hapla. Molecular plant-microbe interactions 26, 75-
86.
Gachon, C. & Saindrenan, P. (2004). Real-time PCR monitoring of fungal development in Arabidopsis thaliana
infected by Alternaria brassicicola and Botrytis cinerea. Plant Physiology and Biochemistry 42, 367-371.
Gazzarrini, S. & Mccourt, P. (2003). Cross‐talk in plant hormone signalling: what arabidopsis mutants are telling
us. Annals of botany 91, 605-612.
Griffin, G. & Thyr, B. (1988). Interaction of Meloidogyne hapla and Fusarium oxysporum f. sp. medicaginis on
alfalfa. Phytopathology 78, 421-425.
Grundler, F., Schnibbe, L. & Wyss, U. (1991). In vitro studies on the behaviour of second-stage juveniles of
Heterodera schachtii (Nematoda: Heteroderidae) in response to host plant root exudates. Parasitology
103, 149-155.
Halbrendt, J. (1996). Allelopathy in the management of plant-parasitic nematodes. Journal of Nematology 28, 8.
Hallmann, J. & Sikora, R. (1996). Toxicity of fungal endophyte secondary metabolites to plant parasitic
nematodes and soil-borne plant pathogenic fungi. European Journal of Plant Pathology 102, 155-162.
Hardtke, C. S., Dorcey, E., Osmont, K. S. & Sibout, R. (2007). Phytohormone collaboration: zooming in on
auxin–brassinosteroid interactions. Trends in cell biology 17, 485-492.
Hashem, M. & Abo-Elyousr, K. A. (2011). Management of the root-knot nematode Meloidogyne incognita on
tomato with combinations of different biocontrol organisms. Crop Protection 30, 285-292.
Hause, B., Mrosk, C., Isayenkov, S. & Strack, D. (2007). Jasmonates in arbuscular mycorrhizal interactions.
Phytochemistry 68, 101-110.
Hooper, D. J., Hallmann, J. & Subbotin, S. A. (2005). Methods for extraction, processing and detection of plant
and soil nematodes. Plant parasitic nematodes in subtropical and tropical agriculture 2, 53-86.
Hu, Y., Zhang, W., Zhang, P., Ruan, W. & Zhu, X. (2012). Nematicidal activity of chaetoglobosin A poduced by
Chaetomium globosum NK102 against Meloidogyne incognita. Journal of agricultural and food
chemistry 61, 41-46.
Huang, W. K., Ji, H. L., Gheysen, G. & Kyndt, T. (2015). Thiamine‐induced priming against root‐knot nematode
infection in rice involves lignification and hydrogen peroxide generation. Molecular plant pathology.
Huot, B., Yao, J., Montgomery, B. L. & He, S. Y. (2014). Growth–defense tradeoffs in plants: a balancing act to
optimize fitness. Molecular Plant 7, 1267-1287.
Hutangura, P., Mathesius, U., Jones, M. G. & Rolfe, B. G. (1999). Auxin induction is a trigger for root gall
formation caused by root-knot nematodes in white clover and is associated with the activation of the
flavonoid pathway. Functional Plant Biology 26, 221-231.
Itani, T. & Ogawa, M. (2004). History and recent trends of red rice in Japan. Japanese Journal of Crop Science
73, 137-147.
Jansson, H.-B. & Lopez-Llorca, L. V. (2004). Control of nematodes by fungi. Fungal biotechnology in
agricultural, food, and environmental applications, 205-215.
Jansson, H.-B. & Nordbring-Hertz, B. (1980). Interactions between nematophagous fungi and plant-parasitic
nematodes: attraction, induction of trap formation and capture. Nematologica 26, 383-389.
Ji, H., Gheysen, G., Denil, S., Lindsey, K., Topping, J. F., Nahar, K., Haegeman, A., De Vos, W. H., Trooskens,
G. & Van Criekinge, W. (2013). Transcriptional analysis through RNA sequencing of giant cells induced
by Meloidogyne graminicola in rice roots. Journal of Experimental Botany 64, 3885-3898.
Ji, H., Gheysen, G., Ullah, C., Verbeek, R., Shang, C., De Vleesschauwer, D., Höfte, M. & Kyndt, T. (2015a).
The role of thionins in rice defence against root pathogens. Molecular plant pathology 16, 870-881.
Ji, H., Kyndt, T., He, W., Vanholme, B. & Gheysen, G. (2015b). β-Aminobutyric Acid–Induced Resistance
Against Root-Knot Nematodes in Rice Is Based on Increased Basal Defense. Molecular plant-microbe
interactions 28, 519-533.
33
Johnson, A. W. & Littrell, R. H. (1970). Pathogenicity of Pythium aphanidermatum to chrysanthemum in
combined inoculations with Belonolaimus longicaudatus or Meloidogyne incognita. Journal of
Nematology 2, 255.
Jones, J. (2002). 14. Nematode Sense Organs. The Biology of Nematodes, 353.
Jones, J. T., Haegeman, A., Danchin, E. G., Gaur, H. S., Helder, J., Jones, M. G., Kikuchi, T., Manzanilla‐López,
R., Palomares‐Rius, J. E. & Wesemael, W. M. (2013). Top 10 plant‐parasitic nematodes in molecular
plant pathology. Molecular plant pathology 14, 946-961.
Kammerhofer, N., Radakovic, Z., Regis, J., Dobrev, P., Vankova, R., Grundler, F. M., Siddique, S., Hofmann, J.
& Wieczorek, K. (2015). Role of stress‐related hormones in plant defence during early infection of the
cyst nematode Heterodera schachtii in Arabidopsis. New Phytologist 207, 778-789.
Kamoun, S., Furzer, O., Jones, J. D., Judelson, H. S., Ali, G. S., Dalio, R. J., Roy, S. G., Schena, L., Zambounis,
A. & Panabières, F. (2015). The Top 10 oomycete pathogens in molecular plant pathology. Molecular
plant pathology 16, 413-434.
Karimi, M., Montagu, M. V. & Gheysen, G. (1995). Exogenous application of abscissic acid to potato plants
suppresses reproduction of Meloidogyne incognita. Mededelingen Faculteit Landbouwkundige en
Toegepaste Biologische Wetenschappen Universiteit Gent (Belgium).
Kazan, K. & Manners, J. M. (2009). Linking development to defense: auxin in plant–pathogen interactions.
Trends in plant science 14, 373-382.
Kennedy, G. & Burlingame, B. (2003). Analysis of food composition data on rice from a plant genetic resources
perspective. Food Chemistry 80, 589-596.
Kernaghan, G., Reeleder, R. & Hoke, S. (2008). Quantification of Pythium populations in ginseng soils by culture
dependent and real-time PCR methods. applied soil ecology 40, 447-455.
Kitahata, N., Han, S.-Y., Noji, N., Saito, T., Kobayashi, M., Nakano, T., Kuchitsu, K., Shinozaki, K., Yoshida,
S. & Matsumoto, S. (2006). A 9-cis-epoxycarotenoid dioxygenase inhibitor for use in the elucidation of
abscisic acid action mechanisms. Bioorganic & medicinal chemistry 14, 5555-5561.
Kreye, C., Bouman, B., Reversat, G., Fernandez, L., Cruz, C. V., Elazegui, F., Faronilo, J. & Llorca, L. (2009).
Biotic and abiotic causes of yield failure in tropical aerobic rice. Field crops research 112, 97-106.
Kyndt, T., Denil, S., Bauters, L., Van Criekinge, W. & De Meyer, T. (2014). Systemic Suppression of the Shoot
Metabolism upon Rice Root Nematode Infection. PloS one 9, e106858.
Kyndt, T., Denil, S., Haegeman, A., Trooskens, G., Bauters, L., Criekinge, W., Meyer, T. & Gheysen, G. (2012a).
Transcriptional reprogramming by root knot and migratory nematode infection in rice. New Phytologist
196, 887-900.
Kyndt, T., Goverse, A., Haegeman, A., Warmerdam, S., Wanjau, C., Jahani, M., Engler, G., De Almeida Engler,
J. & Gheysen, G. (2016). Redirection of auxin flow in Arabidopsis thaliana roots after infection by root-
knot nematodes. Journal of Experimental Botany 67, 4559-4570.
Kyndt, T., Nahar, K., Haegeman, A., De Vleesschauwer, D., Höfte, M. & Gheysen, G. (2012b). Comparing
systemic defence‐related gene expression changes upon migratory and sedentary nematode attack in rice.
Plant biology 14, 73-82.
Kyndt, T., Vieira, P., Gheysen, G. & De Almeida-Engler, J. (2013). Nematode feeding sites: unique organs in
plant roots. Planta 238, 807-818.
Lee, M.-W., Qi, M. & Yang, Y. (2001). A novel jasmonic acid-inducible rice myb gene associates with fungal
infection and host cell death. Molecular plant-microbe interactions 14, 527-535.
Li, J., Brader, G. & Palva, E. T. (2004). The WRKY70 transcription factor: a node of convergence for jasmonate-
mediated and salicylate-mediated signals in plant defense. The Plant Cell 16, 319-331.
Lievens, B., Brouwer, M., Vanachter, A. C., Cammue, B. P. & Thomma, B. P. (2006). Real-time PCR for
detection and quantification of fungal and oomycete tomato pathogens in plant and soil samples. Plant
Science 171, 155-165.
34
Lifshitz, R., Windham, M. & Baker, R. (1986). Mechanism of biological control of preemergence damping-off
of pea by seed treatment with Trichoderma spp. Phytopathology 76, 720-725.
Lozano-Durán, R. & Zipfel, C. (2015). Trade-off between growth and immunity: role of brassinosteroids. Trends
in plant science 20, 12-19.
Luc, M., Sikora, R. A. & Bridge, J. (2005). Plant parasitic nematodes in subtropical and tropical agriculture.
Cabi, pp.
Massala, R., Legrand, M. & Fritig, B. (1987). Comparative effects of two competitive inhibitors of phenylalanine
ammonialyase on the hypersensitive resistance of tobacco to tobacco mosaic virus. Plant Physiology and
Biochemistry 25, 217-225.
Mei, C., Qi, M., Sheng, G. & Yang, Y. (2006). Inducible overexpression of a rice allene oxide synthase gene
increases the endogenous jasmonic acid level, PR gene expression, and host resistance to fungal
infection. Molecular plant-microbe interactions 19, 1127-1137.
Mur, L. A., Brown, I. R., Darby, R. M., Bestwick, C. S., Bi, Y. M., Mansfield, J. W. & Draper, J. (2000). A loss
of resistance to avirulent bacterial pathogens in tobacco is associated with the attenuation of a salicylic
acid‐potentiated oxidative burst. The Plant Journal 23, 609-621.
Nahar, K., Kyndt, T., De Vleesschauwer, D., Höfte, M. & Gheysen, G. (2011). The jasmonate pathway is a key
player in systemically induced defense against root knot nematodes in rice. Plant physiology 157, 305-
316.
Nahar, K., Kyndt, T., Nzogela, Y. B. & Gheysen, G. (2012). Abscisic acid interacts antagonistically with classical
defense pathways in rice–migratory nematode interaction. New Phytologist 196, 901-913.
Nelson, E. B. (1991). Exudate molecules initiating fungal responses to seeds and roots. The rhizosphere and plant
growth. Springer, pp. 197-209.
Oteifa, B. A. (1953). Development of the root-knot nematode, Meloidogyne incognita, as affected by potassium
nutrition of the host. Phytopathology 43, 1-74.
Padgham, J., Duxbury, J., Mazid, A., Abawi, G. & Hossain, M. (2004). Yield loss caused by Meloidogyne
graminicola on lowland rainfed rice in Bangladesh. Journal of Nematology 36, 42.
Park, J.-E., Park, J.-Y., Kim, Y.-S., Staswick, P. E., Jeon, J., Yun, J., Kim, S.-Y., Kim, J., Lee, Y.-H. & Park, C.-
M. (2007). GH3-mediated auxin homeostasis links growth regulation with stress adaptation response in
Arabidopsis. Journal of Biological Chemistry 282, 10036-10046.
Patkar, R. N., Benke, P. I., Qu, Z., Chen, Y. Y. C., Yang, F., Swarup, S. & Naqvi, N. I. (2015). A fungal
monooxygenase-derived jasmonate attenuates host innate immunity. Nature chemical biology 11, 733-
740.
Paulitz, T. (1991). Effect ofPseudomonas putida on the stimulation of Pythium ultimum by seed volatiles of pea
and soybean. Phytopathology 81, 1282-1287.
Persmark, L., Banck, A. & Jansson, H.-B. (1996). Population dynamics of nematophagous fungi and nematodes
in an arable soil: vertical and seasonal fluctuations. Soil Biology and Biochemistry 28, 1005-1014.
Persson, Y. & Bååth, E. (1992). Quantification of mycoparasitism by the nematode-trapping fungus Arthrobotrys
oligospora on Rhizoctonia solani and the influence of nutrient levels. FEMS Microbiology Letters 101,
11-16.
Pieterse, C. M., Leon-Reyes, A., Van Der Ent, S. & Van Wees, S. C. (2009). Networking by small-molecule
hormones in plant immunity. Nature chemical biology 5, 308-316.
Plowright, R. & Bridge, J. (1990). Effect of Meloidogyne graminicola (Nematoda) on the establishment, growth
and yield of rice CV IR36. Nematologica 36, 81-89.
Pokharel, R. R., Abawi, G. S., Zhang, K., Duxbury, J. M. & Smart, C. D. (2007). Characterization of isolates of
meloidogyne from rice-wheat production fields in Nepal. Journal of Nematology 39, 221-230.
Porter, D. & Powell, N. (1967). Influence of certain Meloidogyne species on Fusarium wilt development in flue-
cured tobacco. Phytopathology 57, 282-285.
Project, I. R. G. S. (2005). The map-based sequence of the rice genome. Nature 436, 793-800.
35
Qiu, D., Xiao, J., Ding, X., Xiong, M., Cai, M., Cao, Y., Li, X., Xu, C. & Wang, S. (2007). OsWRKY13 mediates
rice disease resistance by regulating defense-related genes in salicylate-and jasmonate-dependent
signaling. Molecular plant-microbe interactions 20, 492-499.
Qiu, D., Xiao, J., Xie, W., Cheng, H., Li, X. & Wang, S. (2009). Exploring transcriptional signalling mediated
by OsWRKY13, a potential regulator of multiple physiological processes in rice. BMC plant biology 9,
1.
Riemann, M., Müller, A., Korte, A., Furuya, M., Weiler, E. W. & Nick, P. (2003). Impaired induction of the
jasmonate pathway in the rice mutant hebiba. Plant physiology 133, 1820-1830.
Riemann, M., Riemann, M. & Takano, M. (2008). Rice JASMONATE RESISTANT 1 is involved in
phytochrome and jasmonate signalling. Plant, cell & environment 31, 783-792.
Roberts, P. A. (1992). Current status of the availability, development, and use of host plant resistance to
nematodes. Journal of Nematology 24, 213.
Robinson, A. F. (2002). Impact on Plant-parasitic Nematode Host Finding and Recognition. The Behavioural
Ecology of Parasites, 89.
Rovira, A. D. (1969). Plant root exudates. The Botanical Review 35, 35-57.
Shirasu, K., Nakajima, H., Rajasekhar, V. K., Dixon, R. A. & Lamb, C. (1997). Salicylic acid potentiates an
agonist-dependent gain control that amplifies pathogen signals in the activation of defense mechanisms.
The Plant Cell 9, 261-270.
Sikder, M. M. (2015). The analysis of Pythium arrhenomanes-Meloidogyne graminicola infection on rice. Gent
University.
Sikora, R. A. (1992). Management of the antagonistic potential in agricultural ecosystems for the biological
control of plant parasitic nematodes. Annual review of phytopathology 30, 245-270.
Soriano, I. R., Prot, J.-C. & Matias, D. M. (2000). Expression of tolerance for Meloidogyne graminicola in rice
cultivars as affected by soil type and flooding. Journal of Nematology 32, 309.
Spaepen, S., Vanderleyden, J. & Remans, R. (2007). Indole-3-acetic acid in microbial and microorganism-plant
signaling. FEMS microbiology reviews 31, 425-448.
Stanghellini, M. & Hancock, J. (1971). The sporangium of Pythium ultimum as a survival structure in soil.
Phytopathology 61, 7-164.
Suzuki, M., Kimura, T., Yamagishi, K., Shinmoto, H. & Yamaki, K. (2004). Comparison of mineral contents in
8 cultivars of pigmented brown rice. Journal of the Japanese Society for Food Science and Technology
(Japan).
Swarup, R., Parry, G., Graham, N., Allen, T. & Bennett, M. (2002). Auxin cross-talk: integration of signalling
pathways to control plant development. Auxin Molecular Biology. Springer, pp. 411-426.
Tamaoki, D., Seo, S., Yamada, S., Kano, A., Miyamoto, A., Shishido, H., Miyoshi, S., Taniguchi, S., Akimitsu,
K. & Gomi, K. (2013). Jasmonic acid and salicylic acid activate a common defense system in rice. Plant
signaling & behavior 8, e24260.
Thole, J. M., Beisner, E. R., Liu, J., Venkova, S. V. & Strader, L. C. (2014). Abscisic acid regulates root
elongation through the activities of auxin and ethylene in Arabidopsis thaliana. G3: Genes| Genomes|
Genetics 4, 1259-1274.
Van Buyten, E. (2013). Pythium spp. affecting aerobic rice cultivation in the Philippines: characterization,
virulence strategies and plant defense. Ghent University.
Van Buyten, E. & Höfte, M. (2013). Pythium species from rice roots differ in virulence, host colonization and
nutritional profile. BMC plant biology 13, 1.
Verbeek, R., Banaay, C., Sikder, M., De Waele, D., Cruz, C. V., Gheysen, G., Höfte, M. & Kyndt, T. (2016).
Interactions between the oomycete Pythium arrhenomanes and the rice root-knot nematode Meloidogyne
graminicola in aerobic Asian rice varieties. Rice 9, 36.
Weis, K. G., Goren, R., Martin, G. C. & Webster, B. D. (1988). Leaf and inflorescence abscission in olive. I.
Regulation by ethylene and ethephon. Botanical Gazette, 391-397.
36
Wubben, M. J., Su, H., Rodermel, S. R. & Baum, T. J. (2001). Susceptibility to the sugar beet cyst nematode is
modulated by ethylene signal transduction in Arabidopsis thaliana. Molecular plant-microbe interactions
14, 1206-1212.
Yang, D.-L., Yao, J., Mei, C.-S., Tong, X.-H., Zeng, L.-J., Li, Q., Xiao, L.-T., Sun, T.-P., Li, J. & Deng, X.-W.
(2012). Plant hormone jasmonate prioritizes defense over growth by interfering with gibberellin signaling
cascade. Proceedings of the National Academy of Sciences 109, E1192-E1200.
Yawadio, R., Tanimori, S. & Morita, N. (2007). Identification of phenolic compounds isolated from pigmented
rices and their aldose reductase inhibitory activities. Food Chemistry 101, 1616-1625.
Zhang, Z., Zhang, J., Wang, Y. & Zheng, X. (2005). Molecular detection of Fusarium oxysporum f. sp. niveum
and Mycosphaerella melonis in infected plant tissues and soil. FEMS Microbiology Letters 249, 39-47.
Zuckerman, B. M. & Jansson, H. (1984). Nematode chemotaxis and possible mechanisms of host/prey
recognition. Annual review of phytopathology 22, 95-113.
37
9. Appendix
Figure 1. Role of P. arrhenomanes on root length (A) and shoot length (B) of
Nipponbare in the interaction experiment between P. arrhenomanes and M.
graminicola . Data were recorded 19 days after seedling transplanting in the SAP
system. Bars represent mean ± standard deviation with 12 replications. Different
letters indicate statistically significant difference between the treatments (P < 0.05).
Data on root length were analyzed by Independent Sample T – Test and data on shoot
length were analyzed by Mann Whitney U Non-Parametric Test.
0
5
10
15
20
25
30
M. graminicola P. arrhenomanes + M. graminicola
Ro
ot
len
gth
in
cm b
a
A
0
5
10
15
20
25
30
M. graminicola P. arrhenomanes + M. graminicola
Sh
oo
t le
ng
th i
n c
m
b a
B
38
Figure 2. Role of P. arrhenomanes on seedling length (C) and root fresh weight (D)
of Nipponbare in the interaction experiment between P. arrhenomanes and M.
graminicola. Data were recorded 19 days after seedling transplanting in the SAP
system. Bars represent mean ± standard deviation with 12 replications. Different
letters indicate statistically significant difference between the treatments (P < 0.05).
Data on sedling length were analyzed by Mann Whitney U Non-Parametric Test and
data on root fresh weight were analyzed by Independent Sample T – Test.
39
Figure 3. Role of P. arrhenomanes on root length (A) and shoot length (B) of
IR81413-BB-75-4 in the interaction experiment between P. arrhenomanes and M.
graminicola . Data were recorded 19 days after seedling transplanting in the SAP
system. Bars represent mean ± standard deviation with 17 replications. Different
letters indicate statistically significant difference between the treatments (P < 0.05).
Data on root length and shoot length were analyzed by Independent Sample T – Test.
0
5
10
15
20
25
M. graminicola P. arrhenomanes + M. graminicola
Ro
ot
len
gth
in
cm
a a
A
0
5
10
15
20
25
30
35
M. graminicola P. arrhenomanes + M. graminicola
Sh
oo
t le
ng
th i
n c
m
b
a
B
40
Figure 4. Role of P. arrhenomanes on seedling length (C) and root fresh weight (D)
of IR81413-BB-75-4 in the interaction experiment between P. arrhenomanes and
M. graminicola . Data were recorded 19 days after seedling transplanting in the SAP
system. Bars represent mean ± standard deviation with 17 replications. Different
letters indicate statistically significant difference between the treatments (P < 0.05).
Data on seeding length were analyzed by Independent Sample T – Test and data on
root fresh weight were analyzed by Mann Whitney U Non-Parametric Test.
0
10
20
30
40
50
M. graminicola P. arrhenomanes + M. graminicola
Seed
lin
g l
en
gth
in
cm
ba
C
0
50
100
150
200
250
M. graminicola P. arrhenomanes + M. graminicola
Roo
t fr
esh
weig
ht
in m
g
a
a
D
41
Figure 5. Role of auxin on the root length (A), shoot length (B), seedling length (C)
and root fresh weight (D) in the M. graminicola infected plants and P. arrhenomanes
+ M. graminicola infected plants. Data were recorded 19 days after seedling
transplanting in the SAP system. Bars represent mean ± standard deviation with 8
replications. Different letters indicate statistically significant difference between the
treatments (P < 0.05). Data on root length, shoot length and seedling length were
analyzed by Mann-Whitney U non-parametric test and data on root fresh weight were
Independent Sample T-Test.
42
Figure 6. Role of NAA treatment on the root length (A) and shoot length (B) in the
M. graminicola infected plants and P. arrhenomanes + M. graminicola infected
plants. Data were recorded 19 days after seedling transplanting in the SAP system.
Bars represent mean ± standard deviation with 10 replications. Different letters
indicate statistically significant difference between the treatments (P < 0.05). Data on
root length and shoot length were analyzed by Mann-Whitney U non-parametric test.
0
5
10
15
20
25
M. graminicola P. arrhenomanes + M. graminicola
Ro
ot
len
gth
in
cm
Nipponbare Nipponbare + 100 µM NAA
ab b ab a
A
0
10
20
30
40
50
M. graminicola P. arrhenomanes + M. graminicola
Sh
oo
t le
ngth
in
cm
Nipponbare Nipponbare + 100 µM NAA
ab abba
B
43
Figure 7. Role of NAA treatment on the seedling length (C) and root fresh weight
(D) in the M. graminicola infected plants and P. arrhenomanes + M. graminicola
infected plants. Data were recorded 19 days after seedling transplanting in the SAP
system. Bars represent mean ± standard deviation with 10 replications. Different
letters indicate statistically significant difference between the treatments (P < 0.05).
Data on seedling length and root fresh weight were analyzed by Mann-Whitney U
non-parametric test.
0
10
20
30
40
50
60
70
M. graminicola P. arrhenomanes + M. graminicola
See
dli
ng
len
gth
in
cm
Nipponbare Nipponbare + 100 µM NAA
ab aba
C
0
50
100
150
200
250
300
M. graminicola P. arrhenomanes + M. graminicola
Ro
ot
fres
h w
eigh
t in
mg
Nipponbare Nipponbare + 100 µM NAA
bb
a a
D
44
Figure 8. Role of jasmonic acid on the root length (A) and shoot length (B) in the M.
graminicola infected plants and P. arrhenomanes + M. graminicola infected plants.
Data were recorded 19 days after seedling transplanting in the SAP system. Bars
represent mean ± standard deviation with 10 replications. Different letters indicate
statistically significant difference between the treatments (P < 0.05). Data on root
length were analyzed by Mann-Whitney U non-parametric test and shoot length were
analyzed by one-way ANOVA (Duncan Multiple Range Test).
0
10
20
30
M. graminicola P. arrhenomanes + M. graminicola
Ro
ot
len
gth
in
cm
Nipponbare (control)
Nipponbare + DIECA (JA biosynthesis inhibitor)
Nipponbare + MeJA
COI1-18 (JA signaling transgenic RNAi)
NC2728 (JA biosynthesis mutant)
aba a
b b aab ab ab
A
0
20
40
60
M. graminicola P. arrhenomanes + M. graminicola
Sh
oo
t le
ng
th i
n c
m
Nipponbare (control)
Nipponbare + DIECA (JA biosynthesis inhibitor)
Nipponbare + MeJA
COI1-18 (JA signaling transgenic RNAi)
NC2728 (JA biosynthesis mutant)
a a abab abab ab
bb b
B
45
Figure 9. Role of jasmonic acid on the seedling length (C) and root fresh weight (D)
in the M. graminicola infected plants and P. arrhenomanes + M. graminicola infected
plants. Data were recorded 19 days after seedling transplanting in the SAP system.
Bars represent mean ± standard deviation with 10 replications. Different letters
indicate statistically significant difference between the treatments (P < 0.05). Data on
seedling length and root fresh weight were analyzed by Mann-Whitney U non-
parametric test.
0
20
40
60
80
M. graminicola P. arrhenomanes + M. graminicolaSee
dli
ng
len
gth
in
cm
Nipponbare (control)
Nipponbare + DIECA (JA biosynthesis inhibitor)
Nipponbare + MeJA
COI1-18 (JA signaling transgenic RNAi)
NC2728 (JA biosynthesis mutant)
abb
ab
aab
abC
0
50
100
150
200
250
300
M. graminicola P. arrhenomanes + M. graminicolaRo
ot
fres
h w
eigh
t in
mg
Nipponbare (control)
Nipponbare + DIECA (JA biosynthesis inhibitor)
Nipponbare + MeJA
COI1-18 (JA signaling transgenic RNAi)
NC2728 (JA biosynthesis mutant)
c
bcb b b
a ab b ab ab
D
46
Figure 10. Role of PAL inhibitor (AOPP) on the root length (A) and shoot length (B)
in the M. graminicola infected plants and P. arrhenomanes + M. graminicola infected
plants. Data were recorded 19 days after seedling transplanting in the SAP system.
Bars represent mean ± standard deviation with 10 replications. Different letters
indicate statistically significant difference between the treatments (P < 0.05). Data on
root length and shoot length were analyzed by Mann-Whitney U non-parametric test.
0
5
10
15
20
25
M. graminicola P. arrhenomanes + M. graminicola
Ro
ot
len
gth
in
cm
Nipponbare Nipponbare + 100 µM AOPP
a a a aA
0
10
20
30
40
50
M. graminicola P. arrhenomanes + M. graminicola
Sh
oo
t le
ng
th i
n c
m
Nipponbare Nipponbare + 100 µM AOPP
a a a a
B
47
Figure 11. Role of PAL inhibitor (AOPP) on the seedling length (C) and root fresh
weight (D) in the M. graminicola infected plants and P. arrhenomanes + M.
graminicola infected plants. Data were recorded 19 days after seedling transplanting
in the SAP system. Bars represent mean ± standard deviation with 10 replications.
Different letters indicate statistically significant difference between the treatments (P
< 0.05). Data on seedling length and root fresh weight were analyzed by Mann-
Whitney U non-parametric test.
0
10
20
30
40
50
60
70
M. graminicola P. arrhenomanes + M. graminicola
Seed
lin
g l
en
gth
in
cm
Nipponbare Nipponbare + 100 µM AOPP
a a a aC
0
50
100
150
200
250
300
M. graminicola P. arrhenomanes + M. graminicola
Ro
ot
fresh
weig
ht
in m
g
Nipponbare Nipponbare + 100 µM AOPP
b b
aa
D
48
Figure 12. Role of ABA inhibitor on the root length (A) and shoot length (B) in the
M. graminicola infected plants and P. arrhenomanes + M. graminicola infected
plants. Data were recorded 19 days after seedling transplanting in the SAP system.
Bars represent mean ± standard deviation with 10 replications. Different letters
indicate statistically significant difference between the treatments (P < 0.05). Data on
root length were analyzed by Mann-Whitney U non-parametric test and shoot length
were analyzed by Independent Sample T-Test.
0
5
10
15
20
25
M. graminicola P. arrhenomanes + M. graminicola
Ro
ot
len
gth
in
cm
Nipponbare Nipponbare + 50 µM Abamine
a a a aA
0
10
20
30
40
50
M. graminicola P. arrhenomanes + M. graminicola
Sh
oo
t le
ng
th i
n c
m
Nipponbare Nipponbare + 50 µM Abamine
aa
abb
B
49
Figure 13. Role of ABA inhibitor on the seedling length (C) and root fresh weight
(D) in the M. graminicola infected plants and P. arrhenomanes + M. graminicola
infected plants. Data were recorded 19 days after seedling transplanting in the SAP
system. Bars represent mean ± standard deviation with 10 replications. Different
letters indicate statistically significant difference between the treatments (P < 0.05).
Data on seedling length and root fresh weight were analyzed by Mann-Whitney U
non-parametric test.
0
10
20
30
40
50
60
70
M. graminicola P. arrhenomanes + M. graminicola
See
dli
ng
len
gth
in
cm
Nipponbare Nipponbare + 50 µM Abamine
abb
aa
C
0
50
100
150
200
250
300
M. graminicola P. arrhenomanes + M. graminicola
Ro
ot
fres
h w
eigh
t in
mg
Nipponbare Nipponbare + 50 µM Abamine
b
b
a a
D
Recommended